JP2008289376A - Nucleic acid recovery reagent, nucleic acid amplification reagent kit prepared by using the same, nucleic acid recovery method and nucleic acid amplifying method using the recovery method - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a reagent and a method of extracting a nucleic acid from a biospecimen, etc., by a simple operation without using a complicate operation, and amplifying the nucleic acid. <P>SOLUTION: The nucleic acid recovery reagent contains an inorganic salt composed of an inorganic cation and an inorganic anion, and the inorganic salt forms a precipitate together with the nucleic acid. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a nucleic acid recovery reagent for recovering nucleic acid from a biological sample or the like, a nucleic acid amplification reagent kit using the same, a nucleic acid recovery method and a nucleic acid amplification method using the same.

  The establishment of nucleic acid amplification methods using the polymerase chain reaction has led to an expanded use of nucleic acids. In addition, with the development of technologies (RT-PCR, LAMP, etc.) for analyzing nucleic acids with higher sensitivity or higher speed, nucleic acid amplification methods are widely used as research tools, diagnostic tools, therapeutic agents, etc. Have found utility in various applications. Further, there is a need for further improvement in a technique for recovering nucleic acid that is a starting material or amplification product of an amplification method from a sample (body fluid, tissue, cell, etc.).

  Many techniques have been developed so far for recovering nucleic acids from biological samples containing nucleic acids. Typical methods include an organic extraction method in which impurities such as proteins are denatured and precipitated with an organic solvent such as phenol and chloroform, and then the nucleic acid in the aqueous phase is recovered. A precipitant (ethanol) is added to the solution containing the nucleic acid. , Isopropanol, etc.) or a coprecipitation agent (polymer polysaccharide) is added, and a precipitation method is known in which the precipitated nucleic acid is recovered by centrifugation. As a simple method, it is diluted with ion-exchanged water. Known are an alkali dissolution method in which a sample is repeatedly freeze-thawed and an alkali solution is added, followed by oil-liquid separation, heat treatment, and the like, and a method in which cells or tissues are simply boiled.

  Since the organic extraction method has a high protein removing ability, it is often used when nucleic acid is recovered from a sample (for example, tissue, blood, etc.) containing a large amount of contaminants. As an organic extraction method, for example, in order to increase the recovery rate, an organic solvent containing a water-insoluble polymer compound is used to facilitate entry of the nucleic acid into the aqueous phase. There has been proposed a method (Patent Document 1) in which alcohol is added to cause precipitation by centrifugal separation and recovery by centrifugation. However, since organic extraction uses a highly toxic organic solvent such as phenol, it is necessary to handle the reagent with care. In addition, the liquid layer needs to be collected immediately after centrifugation, and the procedure becomes complicated especially when the number of samples is large.

  As a precipitation method, a method of performing precipitation by adding a coprecipitation agent such as a high molecular weight polysaccharide (dextran or glycogen) (Patent Document 2), a nucleic acid is dissolved in an organic phase (alcohol or the like) using a cationic detergent, A method in which an inorganic salt solution is added for precipitation (Patent Document 3). A method in which impurities in a sample are precipitated by bringing a transition metal ion having a valence of 2 or more into contact therewith, and RNA remaining in the supernatant is recovered (Patent Document 4). ) Etc. have been proposed. For example, in the case of alcohol precipitation, the precipitation method requires long-time cooling or addition of a coprecipitation agent in order to obtain a high recovery rate, and high-speed centrifugation and drying are required to recover the precipitate. Moreover, since the nucleic acid to be recovered is insolubilized, it must be resolubilized for use.

  Various solid-phase extraction methods have been developed as methods for recovering nucleic acids more easily. The solid phase extraction method is a method for separating nucleic acid from contaminants in a sample by adsorbing the nucleic acid to a solid phase carrier having a property of reversibly binding to the nucleic acid, and then recovering the carrier. For example, a step of separating the nucleic acid from the carrier is further added. As a carrier for solid phase extraction, glass powder, glass fiber, silica particles, celite, non-woven fabric and the like are known. Examples of the solid-phase extraction method include the boom method, and a nucleic acid recovery method (Patent Document 5) that combines nucleic acid lysis and nuclease inactivation with a chaotropic agent and nucleic acid adsorption action of silica particles or diatom is proposed. ing. In addition, a method has been developed in which nucleic acids are separated by gel electrophoresis, adsorbed with a non-woven fabric, and purified by dialysis (Non-patent Document 1). When the target nucleic acid is mRNA, only the mRNA can be recovered using a carrier containing as a component a poly T sequence that complementarily binds to the 5 ′ terminal poly A sequence of the RNA polypeptide sequence (for example, , Known as oligo dT columns). Furthermore, Patent Document 6 discloses a method for separating a nucleic acid and a chaotic carrier by adsorbing the nucleic acid to a solid phase carrier to which a chaotic group is bound, and then treating with a anionic substance. Means for imparting nucleic acid adsorption properties to a carrier having a carrier have been developed. Patent Document 7 discloses a method of adsorbing nucleic acids to paramagnetic particles such as iron oxide and recovering the paramagnetic particles using the action of a magnetic field.

  In the case of the solid phase extraction method, the nucleic acid recovery rate depends on the nature of the carrier and the surface area of the carrier. That is, when a solid phase carrier such as a fiber or particle is used, the amount of the carrier that can be used is limited to the volume of the solution, thereby limiting the amount of nucleic acid that can be adsorbed. Therefore, when the sample is in a small amount, or when the target nucleic acid is present in a very small amount in the sample, it is necessary to obtain a high recovery rate at the stage of nucleic acid purification.

As described above, various nucleic acid extraction methods have been proposed depending on the type of nucleic acid-containing sample or the purpose of use of the extracted nucleic acid. In any case, complicated methods such as precipitation, separation, washing, and purification are required. It is necessary to combine the operations, and temperature control such as freezing and boiling is required even in the alkali dissolution method and boiling method which are said to be simple. Even if DNA can be recovered, the RNA recovery rate is low, or conversely, the DNA recovery rate may be low, or the recovery rate of short-chain nucleic acids may be low. Development is desired.
Japanese Patent Laid-Open No. 11-253158 JP-A-7-236499 Japanese Patent No. 2791367 JP-T-2001-516863 US Pat. No. 5,234,809 JP 2001-352979 A JP 2000-159791 A Watanabe and Otake, "New DNA recovery method from agarose gel-Development of DNA recovery chip using dialysis membrane and non-woven fabric", Protein Nucleic Acid Enzyme, 1999, Vol. 44, No. 10

  Accordingly, an object of the present invention is to provide a reagent and a method capable of extracting and amplifying a nucleic acid contained in a biological sample or the like by a simple operation without requiring a conventional complicated operation. It is.

  As a result of earnest research in view of the above object, the present inventor, when contacting an inorganic salt composed of an inorganic cation and an inorganic anion with a nucleic acid, produces a precipitate containing the nucleic acid, from a sample containing impurities. It has been found that nucleic acids can be efficiently recovered, and the present invention has been completed.

  That is, the present invention relates to a nucleic acid recovery reagent containing an inorganic salt composed of an inorganic cation and an inorganic anion, and the inorganic salt forms a precipitate with the nucleic acid.

  The present invention also relates to the nucleic acid recovery reagent, wherein the inorganic cation is an iron ion and / or a copper ion.

  Furthermore, this invention relates to the said nucleic acid collection | recovery reagent whose inorganic anion is a phosphate ion and / or a hydroxide ion.

  The present invention also relates to the nucleic acid recovery reagent, wherein the inorganic salt is at least one selected from the group consisting of iron hydroxide, iron phosphate, copper hydroxide, and copper phosphate.

  Furthermore, the present invention relates to the nucleic acid recovery reagent, wherein the inorganic salt is iron hydroxide and further contains magnetite.

  The present invention also relates to the nucleic acid recovery reagent, wherein an inorganic salt is contained in an alkaline aqueous solution.

  Furthermore, the present invention further relates to the nucleic acid recovery reagent containing albumins.

  The present invention also relates to a nucleic acid amplification reagent kit containing the nucleic acid recovery reagent.

  Furthermore, the present invention relates to a nucleic acid recovery method for recovering a nucleic acid by utilizing a precipitation phenomenon between the nucleic acid and an inorganic salt composed of an inorganic cation and an inorganic anion.

  The present invention also relates to the nucleic acid recovery method, wherein a nucleic acid and an inorganic salt in a sample are coprecipitated.

  Furthermore, the present invention relates to the method for recovering nucleic acid, wherein a nucleic acid precipitate is added after the inorganic salt precipitate is formed, and the nucleic acid is adsorbed to the inorganic salt precipitate.

  The present invention also relates to the nucleic acid recovery method, wherein the inorganic cation is an iron ion and / or a copper ion.

  Furthermore, the present invention relates to the nucleic acid recovery method, wherein the inorganic anion is a phosphate ion and / or a hydroxide ion.

  The present invention also relates to the nucleic acid recovery method, wherein the inorganic salt is at least one selected from the group consisting of iron hydroxide, iron phosphate, copper hydroxide, and copper phosphate.

  Furthermore, the present invention relates to the nucleic acid recovery method, wherein iron hydroxide is used as an inorganic salt, iron hydroxide and magnetite are brought into contact with nucleic acid, and a precipitate comprising a complex containing nucleic acid, iron hydroxide and magnetite is generated. .

  Furthermore, the present invention further relates to the nucleic acid recovery method containing albumins.

  Furthermore, the present invention relates to the nucleic acid recovery method performed under alkaline conditions.

  The present invention also relates to a nucleic acid amplification method comprising a step of bringing a precipitate containing a nucleic acid by the above method into contact with a nucleic acid amplification reagent.

  Furthermore, this invention relates to the said nucleic acid amplification method including the process of wash-removing substances other than a nucleic acid.

The present invention also relates to a nucleic acid amplification method comprising subjecting the precipitate collected by the above method to the following steps.
a) a step of adsorbing a precipitate containing a nucleic acid by a magnetic substance to remove a substance other than the nucleic acid; and b) a step of bringing the precipitate containing a nucleic acid into contact with a nucleic acid amplification reagent.

  Furthermore, the present invention relates to the nucleic acid amplification method using the LAMP method.

  According to the present invention, a nucleic acid can be easily recovered by utilizing a precipitation phenomenon between a nucleic acid and an inorganic salt. In particular, inorganic salts using iron ions as inorganic cations have a high rate of precipitation with nucleic acids, and can efficiently recover nucleic acids from a mixture containing nucleic acids. The nucleic acid may be adsorbed on the precipitated inorganic salt, but it is more efficient to add the inorganic salt in the presence of the nucleic acid and entrain and precipitate the nucleic acid. When iron hydroxide is used as the inorganic salt, magnetite is further added as a reagent component, nucleic acid is added in the presence of iron hydroxide and magnetite, and a complex containing nucleic acid, iron hydroxide and magnetite is formed. It is effective to form a precipitate. Since the complex produced in this way has magnetism as a whole, magnetic separation is possible. In addition, a precipitate containing nucleic acid is adsorbed with a magnetic substance in a subsequent process such as nucleic acid amplification, and a substance other than nucleic acid is adsorbed. It can be washed away.

  Furthermore, an important feature of the present invention is that nucleic acid contained in the precipitate can be amplified by directly acting the nucleic acid amplification reagent on the precipitate without requiring an operation for eluting the nucleic acid from the generated precipitate. This is because, in the precipitate containing the nucleic acid produced according to the present invention, either when producing a precipitate due to a nucleic acid and an inorganic salt, or when producing a precipitate comprising a complex containing nucleic acid, iron hydroxide and magnetite. In this case, it is considered that the nucleic acid and the inorganic salt or the nucleic acid and the inorganic salt and magnetite form a loose bond. Therefore, according to the present invention, nucleic acids can be recovered and amplified more easily.

[I] Nucleic acid recovery reagent The nucleic acid recovery reagent of the present invention contains an inorganic salt composed of an inorganic cation and an inorganic anion.

(1) Inorganic salt Any inorganic salt may be used as long as it generates a nucleic acid and a precipitate. The inorganic cation constituting the inorganic salt is preferably a salt containing ions of transition metal elements of Group 3 to Group 12 of the periodic table, more preferably a salt containing iron ions and / or copper ions. More preferably a salt containing iron ions. The iron ion may be divalent or trivalent. The copper ion may be monovalent or divalent, but is usually divalent.

  The inorganic anion constituting the inorganic salt is preferably a combination of an inorganic cation and a fast precipitation rate generated by a reaction with a nucleic acid. Examples of inorganic anions that can be used include hydroxide ions, phosphate ions, pyrophosphate ions, carbonate ions, and the like. The inorganic anion is preferably a hydroxide ion and / or a phosphate ion from the viewpoint of the nucleic acid recovery rate, and is preferably a hydroxide ion from the viewpoint of magnetic separation or the like. One inorganic cation and one inorganic anion may be used, or two or more inorganic cations may be used in combination.

  Specific examples of the inorganic salt used in the present invention include iron hydroxide, iron phosphate, copper hydroxide, copper phosphate and the like. These inorganic salts may be used alone or in combination of two or more. In this specification, iron hydroxide is ferrous hydroxide (iron hydroxide (II)), ferric hydroxide (iron hydroxide (III)), ferric hydroxide ferrous hydroxide (iron hydroxide ( III) iron (II)) and the like, and iron phosphate is ferrous phosphate (iron (II) phosphate), ferric phosphate (iron (III) phosphate), iron (III) phosphate (II), including iron pyrophosphate and the like. Moreover, copper hydroxide contains cuprous hydroxide (copper hydroxide (I)), cupric hydroxide (copper hydroxide (II)), etc., and copper phosphate is cupric phosphate (copper phosphate). (II)), sodium copper phosphate and the like. The amount of the inorganic salt used for the nucleic acid recovery reagent is not particularly limited, and may be appropriately adjusted according to the amount of nucleic acid in the sample.

  The form of the reagent of the nucleic acid recovery reagent of the present invention is not particularly limited as long as the inorganic salt can be brought into contact with the nucleic acid in the sample. For example, the inorganic salt may be added directly to a biological sample (blood, urine, etc.) or the solution may be in the form of a solution (aqueous solution, buffer (buffer), etc.) containing the inorganic salt. When an inorganic salt is contained in the solution, a part of the inorganic salt may be dissociated into an inorganic cation and an inorganic anion.

  The solution containing the inorganic salt is preferably an alkaline aqueous solution, and the alkaline aqueous solution is preferably more than pH 7 and 14 or less, more preferably pH 10-13. The alkaline aqueous solution may be an aqueous solution containing sodium hydroxide, potassium hydroxide or the like, or an alkaline buffer such as a phosphate buffer or a tris buffer. Moreover, you may add organic solvents, such as alcohol, to alkaline aqueous solution.

  The nucleic acid recovery reagent may directly contain the above inorganic salt, or may be prepared at the time of use in consideration of stability and the like. For example, when iron hydroxide is used as an inorganic salt, an alkaline aqueous solution such as ferric chloride (iron (III) chloride) (for example, an aqueous solution containing iron chloride) and an aqueous sodium hydroxide solution is prepared, and iron chloride (III ) Iron hydroxide may be prepared by adding an alkaline aqueous solution. In addition, when iron phosphate is used as the inorganic salt, iron phosphate may be prepared by adding a phosphate buffer as an alkaline aqueous solution to iron (III) chloride. The alkaline aqueous solution used here may be the same as the case of the alkaline aqueous solution described above. For example, the pH is preferably more than pH 7 and 14 or less, more preferably pH 10 to 13.

(2) Magnetite When the inorganic salt is iron hydroxide, magnetite is added as a constituent of the nucleic acid recovery reagent, and iron hydroxide and magnetite are brought into contact with the nucleic acid sample to form a nucleic acid, iron hydroxide and magnetite complex. The precipitate containing the produced nucleic acid can be separated from the solution by magnetic separation. Magnetite (Fe ₃ O ₄ ) is preferably a fine particle from the viewpoint of forming a complex of a nucleic acid and an inorganic salt, and the particle size of the magnetite is preferably 0.01 to 10 μm, more preferably 0.2 to 1 μm. It is. By adjusting the particle size of the magnetite to such a range, an appropriate complex with the nucleic acid and the inorganic salt is formed, and the recovery efficiency of the nucleic acid can be increased.

  The amount of magnetite in the nucleic acid recovery reagent is not particularly limited, but from the viewpoint of forming an appropriate complex with nucleic acid and inorganic salt, the molar ratio to inorganic salt (inorganic salt: magnetite) is preferably 1: 0.1. -10, more preferably 1: 0.5-2.

(3) Other components The nucleic acid recovery reagent of the present invention may appropriately contain components other than those described above as long as the object of the present invention is not impaired. Examples of other components include pH buffers, proteins such as albumins [bovine serum albumin (BSA), etc.], surfactants, saccharides, and the like. In particular, it is preferable to add albumins to the reagent because the reaction rate of precipitation is increased and the recovery rate is increased. The amount of albumin added is preferably 0.1 to 20% by mass, more preferably 0.5 to 4% by mass, based on the total mass of the reaction solution.

  The nucleic acid recovery reagent of the present invention can also be used as a reagent constituting a nucleic acid amplification reagent kit, for example. The nucleic acid recovered with the nucleic acid recovery reagent of the present invention does not need to be separated by an operation such as elution of the nucleic acid from the precipitate, and has versatility. Therefore, for nucleic acid amplification such as PCR, RT-PCR, LAMP, etc. It can be used as a reagent.

[II] Nucleic Acid Recovery Method The nucleic acid recovery method of the present invention recovers a nucleic acid by bringing a nucleic acid and an inorganic salt into a precipitate by contacting the nucleic acid with an inorganic salt combining an inorganic cation and an inorganic anion. To do. The precipitate may be generated by bringing the nucleic acid and the inorganic salt into contact with each other in the solution. Since the inorganic precipitate itself has the adsorptivity of nucleic acid, the nucleic acid sample is added after the inorganic precipitate is generated in advance. It may be adsorbed. As a result of the test, a higher recovery rate is obtained when the precipitate is formed by bringing the nucleic acid and the inorganic salt into contact with each other in the solution. This is probably because the nucleic acid is taken in and precipitated together when an inorganic precipitate is formed. Of course, even if a nucleic acid sample is added after the formation of the inorganic precipitate, a recovery rate equivalent to practical use such as nucleic acid detection can be achieved.

  The nucleic acid recovery method of the present invention is the above-mentioned method in any case where a nucleic acid and an inorganic salt are brought into contact with each other in a solution to generate a precipitate, and when a nucleic acid is added and adsorbed after an inorganic precipitate has been generated in advance. This can be performed using the nucleic acid recovery reagent of the present invention.

  In the present invention, the nucleic acid recovery reaction is preferably performed under alkaline conditions. In genetic testing, a method of dissolving a virus, bacteria, etc. to be measured with an alkali (for example, an aqueous sodium hydroxide solution) to release nucleic acid can be used. According to the present invention, an alkaline solution is used. By using it, the nucleic acid recovery reagent can also serve as a lysis reagent, so that the operation is further simplified.

  The method for recovering the precipitated nucleic acid can be selected depending on the final utilization form. For example, a widely used method such as centrifugal separation or filtration with filter paper can be used.

  When a precipitate containing nucleic acid is generated in the presence of magnetite, not only magnetite but also the entire precipitate is magnetized, so that magnetic force can be used for the transfer of the precipitate and the nucleic acid recovery operation. This is presumed to be because magnetite fine particles are efficiently taken into the precipitate. As shown in FIG. 10, the method of recovering an inorganic precipitate containing nucleic acid by magnetic force has a higher degree of purification than a method such as centrifugation because there is little contamination with insoluble components such as a nucleic acid amplification reaction inhibiting component.

  The recovered inorganic precipitate can be further washed with substances other than nucleic acids using a buffer or the like. When using for nucleic acid amplification reaction etc., it is desirable to remove the substance which inhibits reaction beforehand.

  The nucleic acid recovery method of the present invention can recover not only long-chain DNA as nucleic acid but also short-chain nucleic acid such as RNA. For example, it is possible to collect a SARS control sample which is a short-chain nucleic acid of 542b.

  The nucleic acid thus extracted can be used for known nucleic acid analysis such as a nucleic acid amplification method such as a PCR method and a LAMP method and a hybridization method.

[III] Nucleic Acid Amplification Method A typical nucleic acid amplification method is a PCR method. The PCR method is a nucleic acid amplification method using an oligonucleotide that recognizes one sense strand at both ends of a target sequence and an oligonucleotide that recognizes the other antisense strand at both ends as two types of primers. A complementary double-stranded nucleic acid is denatured into a single-stranded nucleic acid by heat treatment, and a primer is complementarily bound (annealed) to each single-stranded nucleic acid from the 3 ′ side, followed by binding with a template-dependent nucleic acid synthase. DNA is extended from the prepared primer. By repeating the cycle so far, the target sequence can be amplified exponentially, and the amplification product can be detected using electrophoresis, fluorescent intercalator method or the like. However, since the reaction temperature differs in each stage in the PCR method, it is necessary to control the reaction temperature according to the stage of the reaction.

  The nucleic acid amplification method that can be used in the present invention is not limited to the PCR method. As a suitable method, for example, a loop-mediated isothermal amplification method (International Publication No. 00/28082 or the like) called a LAMP (Loop-mediated thermal amplification of DNA) method is used. ). The LAMP method anneals its 3 'end to the template nucleotide and uses it as a starting point for complementary strand synthesis. By combining primers that anneal to the loop formed at this time, isothermal complementary strand synthesis reaction is performed. This is a possible nucleic acid amplification method. In the LAMP method, the 3 ′ end of the primer always anneals to the region derived from the sample, so that the check mechanism by complementary binding of the base sequence functions repeatedly. As a result, a highly specific gene sequence amplification reaction is possible.

  In the LAMP method, primers (inner primer F and R and outer primer F and R) consisting of at least four types of oligonucleotides that recognize a total of six regions of base sequences, a template-dependent nucleic acid synthase having strand displacement synthesis activity, and A substrate can be used and a gene amplification reaction with high specificity can proceed promptly at an isothermal temperature without requiring heat denaturation.

  The nucleic acid amplification method of the present invention includes a step of bringing a precipitate containing a nucleic acid into contact with a nucleic acid amplification reagent. The precipitate obtained by the nucleic acid recovery reagent of the present invention does not require an operation for eluting the nucleic acid from the precipitate, and can be amplified as it is using the above-described nucleic acid amplification method. Further, the nucleic acid amplification may include a step of washing away substances other than the nucleic acid.

In a preferred embodiment of the nucleic acid amplification method of the present invention, a nucleic acid sample is added in the presence of iron hydroxide and magnetite, a complex containing nucleic acid, iron hydroxide and magnetite is recovered as a precipitate, and a precipitate containing the produced nucleic acid is obtained. It includes processing the object according to the following steps.
a) a step of adsorbing a precipitate containing a nucleic acid by a magnetic substance to remove a substance other than the nucleic acid; and b) a step of bringing the precipitate containing a nucleic acid into contact with a nucleic acid amplification reagent.

  This method utilizes the fact that a precipitate made of a complex containing nucleic acid, iron hydroxide and magnetite has magnetism in the entire precipitate, whereby substances other than nucleic acid can be washed away. In addition, since the nucleic acid is gently bound to iron hydroxide and magnetite in the precipitate produced by the recovery method of the present invention, the nucleic acid contained in the precipitate is brought into direct contact with the nucleic acid amplification reagent. Can be amplified.

  EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to these examples.

Example 1
Nucleic acid recovery by coprecipitation method using iron (III) phosphate and nucleic acid amplification by LAMP method 1. Add 2.5 μL of 100 mM iron (III) chloride aqueous solution (containing 50 mM HCl) to PCR tube (MJ Research, Inc. 8-strip 0.2 mL thin-wall tubes).
2. Sample solution was added (100 mM phosphate buffer solution pH8.0 containing template nucleic acid (10 ⁴ copies of λDNA)) 5μL, a pretreatment solution obtained was mixed by pipetting. Immediately, metal ions reacted to cause precipitation of phosphorous oxide.
3. Centrifugation was carried out for 10 seconds with a desktop small centrifuge (6000 rpm) to pelletize the precipitate.
4). 92.5 μL of washing buffer (10 mM phosphate buffer, pH 8.0, 0.1% Tween 20) was added and lightly pipetted.
5. After lightly spinning down with a desktop small centrifuge, 95 μL of the added washing buffer was extracted (first washing).
6). After adding 95 μL of washing buffer and lightly pipetting, 95 μL of washing buffer added was extracted (second wash). This operation was repeated twice (washing twice) or four times (washing four times). The washed pellet was used as a sample for nucleic acid amplification.
7). As a positive control (PC), an aqueous solution of iron (III) chloride was not added, and only the sample solution was used as a nucleic acid amplification sample. As a negative control (NC), a 100 mM phosphate buffer pH 8.0 or a sodium hydroxide aqueous solution 0.25M aqueous solution was used as a nucleic acid amplification sample.
8). Nucleic acid amplification by the LAMP method 20 μL of the LAMP reaction solution shown below was added to the above sample, and the nucleic acid contained in the precipitate was amplified using ABI-7700 (manufactured by Applied Biosystems).
Basic composition of LAMP reaction solution (Loopamp DNA amplification kit, manufactured by Eiken Chemical Co., Ltd.) Tris-HCl (pH 8.8) 20 mM
KCl 10 mM
(NH ₄ ) ₂ SO ₄ 10 mM
MgSO ₄ 8 mM
Tween 20 0.1%
Betaine 0.8M
dNTPs 5.6 mM
Inner primer (FIP, BIP) 3.2μM
Outer primer (F3, B3) 0.8μM
(Loop primer 1.6μM)
YO (Oxazole Yellow) 0.25 μg / mL
Bst polymerase 8U / tube

Primer:
・ DNA amplification system λDNA LH4.3
FIP: AGGCCAAGCT GCTTGCGGTA GCCGGACGCT ACCAGCTTCT
BIP: CAGGACGCTG TGGCATTGCA GATCATAGGT AAAGCGCCAC GC
F3: AAAACTCAAAT CAACAGGCG
B3: GACGGATATCA CCACGATCA

Template Commercially available (Takara Bio Inc.) λDNA (48.5 kbp) was diluted and used.
Nucleic acid amplification A LAMP reaction solution (1.25 ×) prepared to 20 μL was added to a precipitate containing nucleic acid recovered from a sample solution, and amplified using ABI-7700 as it was at a reaction temperature of 64 ° C. Nucleic acid amplification was confirmed as shown in FIG.

Example 2
Recovery of nucleic acid by coprecipitation method using iron (III) hydroxide and amplification of nucleic acid by LAMP method Example 1 except that a solution containing 0.25 M sodium hydroxide instead of phosphate buffer was used as a sample solution. The experiment was conducted in the same manner. As shown in FIG. 2, nucleic acid amplification was confirmed.

Example 3
Nucleic acid recovery by coprecipitation method using copper (II) phosphate and nucleic acid amplification by LAMP method An experiment was conducted in the same manner as in Example 1 except that copper sulfate was used instead of iron chloride. The aqueous copper sulfate solution contains 50 mM sulfuric acid. Nucleic acid amplification was confirmed as shown in FIG.

Example 4
Recovery of RNA from sample solution and amplification of RNA by LAMP method The experiment was conducted in the same manner as in Example 1 except that the sample was changed to a SARS control sample and nucleic acid amplification was performed in the RNA amplification system.
Basic composition of LAMP reaction solution (Loopamp RNA amplification kit, manufactured by Eiken Chemical Co., Ltd.) Tris-HCl (pH 8.8) 20 mM
KCl 10 mM
(NH ₄ ) ₂ SO ₄ 10 mM
MgSO ₄ 8 mM
Tween 20 0.1%
Betaine 0.8M
dNTPs 5.6 mM
Inner primer (FIP, BIP) 3.2μM
Outer primer (F3, B3) 0.8μM
(Loop primer 1.6μM)
YO (Oxazole Yellow) 0.25 μg / mL
Enzyme mix 1 μL / tube

Primer / RNA amplification system SARS kit
FIP: TGCATGACAG CCCTCGAAGA AGCTATTCGT CAC
BIP: GCTGTGGGTA CTAACCTACC TGTCAACATA ACCAGTCGG
F3: CTAATATGTT TATCACCCGC
B3: CTCTGGTGAA TTCTGTGTT
FLP: AAAGCCAATC CACGC
BLP: CCAGCTAGGA TTTTCTACAG G

Using template SARS control sample (400 copies / 5 μL; 542b) Nucleic acid amplification Add 20 μL of LAMP reaction solution (1.25 ×) to the precipitate containing nucleic acid recovered from the sample solution, and use ABI-7700 as it is The reaction was amplified at a reaction temperature of 62.5 ° C. Nucleic acid amplification was confirmed as shown in FIG.

Example 5
Recovery of nucleic acid using filter paper An experiment was conducted in which the precipitate produced in Example 1 was recovered on filter paper. After making the reaction liquid which produced | generated the precipitate into 1 mL with a washing | cleaning liquid, after filtering with a filtration device and washing | cleaning twice with 1 mL washing | cleaning buffer, the filter paper was thrown into the LAMP reaction liquid. The same operation was performed for the positive control (PC) and the negative control (NC). Amplification was examined using a fluorescence real-time measuring machine rotor gene. As shown in FIG. 5, nucleic acid amplification was confirmed.

Example 6
Nucleic acid recovery by adsorption method and nucleic acid amplification by LAMP method 2.5 μL of 100 mM iron (III) chloride aqueous solution containing 1.50 mM HCl was dispensed into a PCR tube.
2. 5 μL of a pseudo sample solution not containing a template (100 mM phosphate buffer pH 8.0 or sodium hydroxide aqueous solution 0.25 M aqueous solution) was added, and the resulting pretreatment solution was mixed by pipetting. Immediately, metal ions reacted to form precipitates (phosphorus oxide or hydroxide).
3. The precipitate was pelleted by centrifuging for 10 seconds with a desktop small centrifuge (6000 rpm).
4). Withdrawn supernatant 5 [mu] L, template nucleic acid (10 ⁴ copies of [lambda] DNA) solution 5 [mu] L was added gently pipetted and the template nucleic acid is adsorbed on the inorganic precipitate by leaving 10 minutes.
5. Thereafter, washing was performed in the same manner as in the protocol of Example 1 to obtain a nucleic acid amplification sample.
6). As a positive control (PC), only the sample solution was used as a sample for nucleic acid amplification. As a negative control (NC), a 100 mM phosphate buffer pH 8.0 or a sodium hydroxide aqueous solution 0.25M aqueous solution was used as a nucleic acid amplification sample.
7). The above sample was subjected to a LAMP reaction. The result compared with the case by the coprecipitation method of Example 1 and 2 is shown in FIG. As shown in FIGS. 6A and 6B, nucleic acid amplification was confirmed in both cases where iron phosphate was used as the inorganic salt and iron hydroxide was used.

Example 7
Recovery of nucleic acid using magnetite 2.5 μL of 100 mM iron (III) chloride aqueous solution containing 1.50 mM HCl and 1 μL of 0.2% magnetite suspension were dispensed into a PCR tube.
2. Add 5 μL of template nucleic acid solution (specimen solution) to a pretreatment solution containing 0.3M sodium hydroxide aqueous solution and 0.15% Tween 20, heat at 95 ° C. for 5 minutes, and cool at room temperature to 1 tube The obtained liquid was mixed by pipetting.
3. A tube was placed on the neodymium magnet to aggregate the precipitate. The supernatant was removed leaving 7.5 μL.
4). 92.5 μL of a washing buffer (10 mM phosphate buffer pH 8.0, 0.1% Tween 20) was added on a neodymium magnet, and after light pipetting, 95 μL of the added washing buffer was extracted. (First wash)
5. After adding 92.5 μL of washing buffer on a neodymium magnet and lightly pipetting, 95 μL of the added washing buffer was extracted. (2nd wash)
6). As a control, a pretreatment liquid in which only magnetite was added without using iron hydroxide was prepared, and a sample liquid was added thereto for the same treatment. As a positive control (PC), only the sample solution was used as a nucleic acid amplification sample. As a negative control (NC), a 100 mM phosphate buffer pH 8.0 or a sodium hydroxide aqueous solution 0.25M aqueous solution was used as a nucleic acid amplification sample.
7). Thereafter, the LAMP reaction was performed in the same manner as the protocol of Example 1. As shown in FIG. 7, nucleic acid amplification was confirmed.

Example 8
Effect of Bovine Serum Albumin (BSA) on Nucleic Acid Recovery BSA was added to the pretreatment liquids (reaction solutions) of Examples 1 and 6 so as to be 1% by mass, and experiments were conducted. As shown in FIGS. 8 (A) and (B), even if BSA is present in the pretreatment liquid, it does not inhibit the adsorption of the template DNA to iron (III) phosphate. In the coprecipitation method containing 1% by mass in LAMP, it was found that the rise time of the LAMP reaction was almost equal to that of the PC control, and an apparently high recovery rate was exhibited.

Example 9
Recovery of nucleic acid from sample liquid and amplification of nucleic acid by PCR method (1) In the same manner as in Example 1, a pellet pellet containing nucleic acid (template DNA) was recovered from the sample liquid. To the resulting pellet pellet, 100 μL of a washing buffer (100 mM phosphate buffer, 0.1% Tween 20) was added and washed in the same manner as in Example 1 (this washing operation was repeated four times). 25 μL of the following PCR reaction solution was added to the washed precipitate pellet, and nucleic acid was amplified under the following conditions.
Basic composition of PCR reaction solution:
dNTP 1.8 mM
Z-Taq (Takara Bio Inc.) 1Unit
Primer 0.5 μM
1% by mass of BSA
YO (Oxazole Yellow) 0.25 μg / mL
(In Z-Taq buffer)

PCR device: iCycler (manufactured by Bio-Rad)
Primer sequence:
F AAAACTCAAATCAACAGGCG
B GACGATATCACCACGATCA

PCR conditions:
40 cycles of 95 ° C.-60 ° C.-72 ° C. were performed.

(2) Control experiment (a) Positive control: A nucleic acid was amplified in the same manner as in (1) except that the following pseudo sample was used instead of the sample.
Pseudo specimen: 100 mM phosphate buffer containing 0.1 wt% Tween20,1 wt% BSA, template DNA (10 ⁶ copies) (pH 8.0)
(B) Negative control: The nucleic acid was amplified in the same manner as (1) except that 100 mM phosphate buffer pH 8.0 or sodium hydroxide aqueous solution 0.25 M aqueous solution was used instead of the specimen.
(C) No iron phosphate: The nucleic acid was amplified in the same manner as in (1) except that 2.5 μL of 100 mM iron (III) chloride aqueous solution (containing 50 mM HCl) was not added.

(3) Results The results obtained from the above (1) and (2) are shown in FIG. As is apparent from FIG. 9, the iron phosphate coprecipitation method using iron phosphate of the present invention had a faster amplification cycle than the control without iron phosphate. This indicates that the PCR product can be directly amplified from the precipitate containing the template DNA recovered by the iron phosphate coprecipitation method. The recovery rate of the iron phosphate coprecipitation method estimated from the positive control amplification cycle was 1 to 10%. The reaction occurring in the negative control is considered nonspecific amplification.

4 is a graph showing the relationship of the fluorescence intensity to the reaction time in the nucleic acid amplification reaction according to the method of Example 1. In the nucleic acid amplification reaction by the method of Example 2, it is a graph which shows the relationship of the fluorescence intensity with respect to reaction time. In the nucleic acid amplification reaction by the method of Example 3, it is a graph which shows the relationship of the fluorescence intensity with respect to reaction time. In the nucleic acid amplification reaction by the method of Example 4, it is a graph which shows the relationship of the fluorescence intensity with respect to reaction time. In the nucleic acid amplification reaction by the method of Example 5, it is a graph which shows the relationship of the fluorescence intensity with respect to reaction time. In the nucleic acid amplification reaction by the method of Example 6, it is a graph which shows the relationship of the fluorescence intensity with respect to reaction time, (A) shows the case where iron phosphate is used, (B) shows the case where iron hydroxide is used. Show. In the nucleic acid amplification reaction by the method of Example 7, it is a graph which shows the relationship of the fluorescence intensity with respect to reaction time. In the nucleic acid amplification reaction by the method of Example 8, it is a graph which shows the relationship of the fluorescence intensity with respect to reaction time, (A) shows the effect of BSA in a coprecipitation method, (B) shows the effect of BSA in an adsorption method. . In the nucleic acid amplification reaction by the method of Example 9, it is a graph which shows the relationship of the fluorescence intensity with respect to the cycle number. (A) It is the schematic which shows the method of collect | recovering nucleic acids by centrifugation using iron hydroxide as an inorganic salt. (B) It is the schematic which shows the method of collect | recovering nucleic acids by magnetic separation, using iron hydroxide as an inorganic salt.

Claims (21)

  A nucleic acid recovery reagent comprising an inorganic salt composed of an inorganic cation and an inorganic anion, wherein the inorganic salt forms a precipitate with the nucleic acid.   The nucleic acid recovery reagent according to claim 1, wherein the inorganic cation is an iron ion and / or a copper ion.   The nucleic acid recovery reagent according to claim 1 or 2, wherein the inorganic anion is a phosphate ion and / or a hydroxide ion.   The nucleic acid recovery reagent according to any one of claims 1 to 3, wherein the inorganic salt is at least one selected from the group consisting of iron hydroxide, iron phosphate, copper hydroxide, and copper phosphate.   The nucleic acid recovery reagent according to any one of claims 1 to 4, wherein the inorganic salt is iron hydroxide and further contains magnetite.   The nucleic acid recovery reagent according to any one of claims 1 to 5, wherein the inorganic salt is contained in an alkaline aqueous solution.   Furthermore, the nucleic acid collection | recovery reagent in any one of Claims 1-6 containing albumins.   A reagent kit for nucleic acid amplification, comprising the nucleic acid recovery reagent according to claim 1.   A nucleic acid recovery method for recovering a nucleic acid by utilizing a precipitation phenomenon between the nucleic acid and an inorganic salt composed of an inorganic cation and an inorganic anion.   The nucleic acid recovery method according to claim 9, wherein the nucleic acid and the inorganic salt are coprecipitated.   The nucleic acid recovery method according to claim 9, wherein a nucleic acid is added after the inorganic salt precipitate is formed, and the nucleic acid is adsorbed to the inorganic salt precipitate.   The method for recovering nucleic acid according to any one of claims 9 to 11, wherein the inorganic cation is an iron ion and / or a copper ion.   The method for recovering nucleic acid according to any one of claims 9 to 12, wherein the inorganic anion is a phosphate ion and / or a hydroxide ion.   The nucleic acid recovery method according to any one of claims 9 to 13, wherein the inorganic salt is at least one selected from the group consisting of iron hydroxide, iron phosphate, copper hydroxide, and copper phosphate.   The method for recovering nucleic acid according to claim 9, wherein iron hydroxide is used as the inorganic salt, and iron hydroxide and magnetite are brought into contact with nucleic acid to generate a precipitate comprising a complex containing nucleic acid, iron hydroxide and magnetite.   Furthermore, the nucleic acid collection | recovery method in any one of Claims 9-15 containing albumins.   The nucleic acid recovery method according to any one of claims 9 to 16, which is carried out under alkaline conditions.   A nucleic acid amplification method comprising a step of bringing a precipitate containing a nucleic acid according to any one of claims 9 to 17 into contact with a nucleic acid amplification reagent.   The nucleic acid amplification method according to claim 18, comprising a step of washing and removing a substance other than the nucleic acid. A nucleic acid amplification method comprising performing the following steps on the precipitate collected by the method according to claim 15.
a) a step of adsorbing a precipitate containing a nucleic acid by a magnetic substance to remove a substance other than the nucleic acid; and b) a step of bringing the precipitate containing a nucleic acid into contact with a nucleic acid amplification reagent.   The nucleic acid amplification method according to any one of claims 18 to 20, wherein a LAMP method is used.

Images