JP2008245585A - Primer for detecting fatty acid-degrading bacteria, and method for monitoring the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a primer set for conducting specifically quantitative detection of fatty acid-degrading bacteria in a genus or family level. <P>SOLUTION: This primer set contains any one of the set of oligonucleotides: (a) an oligonucleotide, having a specific base sequence by targeting the bacteria belonging to the genus Syntrophobactor and another oligonucleotide having a specific base sequence; (b) an oligonucleotide having a specific base sequence by targeting the bacteria belonging to the genus Pelotomaculum and another oligonucleotide having a specific base sequence; (c) an oligonucleotide having a specific base sequence by targeting the bacteria belonging to the genus Desulfotomaculum and another oligonucleotide, having a specific base sequence; and (d) an oligonucleotide having a specific base sequence, by targeting the bacteria belonging to Syntrophomonadaceae family and another oligonucleotide having a specific base sequence. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a method for detecting lipids present in methane fermentation-treated sludge such as organic waste and wastewater and bacteria related to fatty acid degradation and a primer used therefor, more specifically, lipids in an anaerobic treatment system, The present invention relates to a microorganism detection method useful for grasping and controlling the behavior of an acid-producing bacterial community related to propionic acid degradation.

  Conventionally, anaerobic treatment (methane fermentation) has been frequently used for treatment of wastewater and organic sludge containing high-concentration organic waste and wastewater. This method has advantages such as saving energy consumption because aeration power is unnecessary, reducing the amount of surplus sludge, reducing the processing cost, and recovering methane gas useful as energy.

  Methane fermentation involves (1) the process of solubilizing high-molecular organic substances, (2) the process of acid-fermenting solubilized organic substances, and (3) the methane production process. It is a complex biological reaction system. In this specification, this biological reaction system is referred to as “methane fermentation microorganism system”, but is also referred to as “methane fermentation system”, “anaerobic treatment system”, or simply “treatment system” or “reaction system”.

  Oils and fats typical as organic pollutants are hardly decomposable substances in both aerobic treatment and anaerobic treatment. The reason is that the dispersibility of fats and oils is poor, and the scum is formed by floating in the treatment tank. Wastewater and waste containing fats and oils include, for example, kitchen drainage, vegetable production wastewater, tofu production wastewater, meat processing wastewater, fishery processing wastewater, pastry manufacturing wastewater, milk wastewater, rice bran waste, bean processing waste, etc. Examples are given.

  Since most of fats and oils are composed of carbon and hydrogen, a large amount of methane gas is generated during anaerobic decomposition, so the anaerobic treatment method of fats and oils is a technology expected from the viewpoint of energy recovery. However, in the anaerobic treatment of wastewater containing high-concentration fat or sludge or sludge, it is a technical problem that higher fatty acids generated by higher fatty acid inhibition of reaction, that is, hydrolysis of neutral fat, cause degradation rate control and inhibition. Higher fatty acids inhibit methanogens, especially those that use acetic acid, and bacteria that degrade higher fatty acids themselves are also inhibited. Once higher fatty acids begin to accumulate, the accumulation proceeds further due to the inhibitory action, leading to a vicious cycle in which methane production stops. If higher fatty acids produced by the decomposition of neutral fat are present in the treated wastewater, the functions of methanogens that act on methane fermentation in anaerobic treatment, especially acetic acid-utilizing methanogens and hydrogen-utilizing methanogens In addition, the growth of the microorganism itself is also inhibited (Non-patent Document 1). Therefore, although it can be said that the organic matter decomposition rate can be taken high in high-temperature methane fermentation of fat and oil waste, methane gas recovery corresponding to the amount of organic matter decomposition cannot be obtained, and intermediate metabolites such as higher fatty acids accumulate in the methane fermentation tank, It is inferred that the oil component floats and separates in the fermenter. In order to avoid this problem, stable and efficient by monitoring the concentration of higher fatty acids in the anaerobic reaction system and controlling the concentration as described in the invention of JP-A-2001-321792 (Patent Document 1). There is an anaerobic treatment method for oil-containing wastewater or oil-containing waste. However, the method of monitoring the concentration of higher fatty acids and lipids is a method of measuring the neutral fat and fatty acid concentrations in the methane fermenter by a chemical acid value and saponification value measuring method using ethanolic caustic potash, A high-speed liquid with a higher fatty acid labeling reagent such as Adam reagent (9-anthryldiazomethane, ADAM) added to the sample, labeled with higher fatty acid, and equipped with an ultraviolet absorption (UV) detector or a fluorescence (FL) detector Method for separating and quantifying higher fatty acids using chromatograph (HPLC), extraction with organic solvent normal hexane / isopropanol, chloroform / methanol, acetone, ethers etc. that can extract lipids, TLC / FID analyzer or gas chromatograph There is a method of analyzing fatty acids with an analyzer. In any case, the operation is complicated and time-consuming. For analysis waste liquid discharge or gas supply by sophisticated analytical equipment needed, can not be used as process monitoring means in the processing site.

  In addition, intermediate metabolic fatty acids (butyric acid and propionic acid) generated during the acid fermentation of organic matter are decomposed by hydrogen-producing acetic acid-producing bacteria (Acetogenic bacteria) into acetic acid and hydrogen, which are substrates for methanogenic bacteria. Propionic acid decomposing activity of fermented methane sludge is a fraction to a fraction of a fraction of that of methane production from acetic acid, so propionic acid is likely to accumulate (Non-Patent Document 4, Non-Patent Document 5, Non-patent document 6). Furthermore, methane fermentation is roughly classified into medium temperature methane fermentation (35 ° C.) and high temperature methane fermentation (55 to 65 ° C.) according to the optimum temperature of the methane-producing bacteria group responsible for the final reaction of organic matter decomposition. Compared to medium temperature methane fermentation, high temperature methane fermentation has a shorter residence time and can efficiently digest solid organic matter, reduce pathogenic bacteria, and improve the dewaterability of digested sludge. However, in high temperature methane fermentation, accumulation of VFA (Volatile Fatty Acid: volatile fatty acid), particularly propionic acid as an intermediate metabolizing organic acid is likely to occur, and the reaction system tends to become unstable. The reason is that in high-temperature methane fermentation sludge, intermediate metabolic fatty acids are likely to accumulate due to poor microbial diversity compared to medium-temperature methane fermentation sludge (Non-patent Document 2), and acid fermentation is likely to proceed. Therefore, it has been reported that the hydrogen partial pressure in the reaction system tends to be relatively high, and there is a possibility that the decomposition of intermediate metabolic fatty acids may be hindered (Non-patent Document 3). It is expected to improve the efficiency and stability of the overall methane fermentation process by suppressing production of highly degradable intermediate metabolic fatty acids such as propionic acid or by high-efficiency decomposition technology. There is little knowledge about microorganisms, and no effective means has been found.

  By avoiding the accumulation of higher fatty acids and propionic acid, it is expected to improve the efficiency and stability of the overall process of methane fermentation, but the operation management of methane fermentation, which is a complex microbial system, is skilled. Relying on the experience of the operator, once methane production deteriorates, it is difficult to identify the cause and it takes a long time to recover.

  Therefore, in the methane fermentation treatment of organic pollutants, the information on the microorganism concentration and metabolic activity related to lipids and fatty acids is grasped, the accurate sludge lipid or propionic acid resolution is evaluated based on the information, and feedback control is performed. However, development of a method for anaerobic treatment is desired.

  From the conventional MPN method, which requires long-term culture as a method for quantitative detection of microorganisms, to a method that enables quantitative detection from environmental samples without culturing target bacteria using molecular biological techniques. The method has developed. For example, the FISH (fluorescent in situ hybridization) method, in which an oligonucleotide having a sequence complementary to a specific portion of a target bacterial gene sequence is prepared and a DNA probe to which a fluorescent dye is attached, is hybridized in the cell. SSU (small subunit) rRNA enzyme cleavage method using RNaseH and DNA probe, and real-time PCR (polymerase chain reaction) method using primers specific to bacterial genes.

PCR methods are known as replication replant reaction, a reaction that replicates repeatedly only a specific site of a DNA strand, a small amount of DNA can be amplified up to about 10 ⁶ times. The real-time PCR method is one of quantitative PCR methods, and is a technique for monitoring and analyzing the increase of PCR amplification products in real time. Compared with the conventional PCR method in which the amplification product is confirmed by performing electrophoresis after the reaction is completed, the nucleic acid can be accurately quantified, can be analyzed quickly and easily, and the risk of contamination is small. Because it has many advantages, it is used for quantitative analysis of gene expression (evaluation of array data and gene knockdown, etc.), qualitative analysis of nucleic acids (detection of microorganisms, viral nucleic acids, etc.), genotyping (mutation analysis, SNPs analysis), etc. Has been. By applying the real-time PCR method, it is possible to quantitatively detect a small amount of bacteria in environmental samples such as sludge. Furthermore, by using reverse transcriptase in the first reaction of PCR, cDNA amplification from RNA (16SrRNA, mRNA etc.) can also be performed (real-time RT-PCR). Therefore, with the same primer set, the number of specific microorganisms (DNA amount) and activity (RNA amount) can be quantified, and the procedure from sample preparation to measurement and data analysis is simple, and a large number of samples can be prepared in a short time. Since the measurement is possible, the application range seems to be wide.

The fatty acid degrading bacteria group currently reported is shown in FIG. Examples of propionic acid degrading bacteria group include Syntrophobacter group (a), Pelotomaculum group (b) and Desulfotomaculum group (c) which are separated from each other on the systematic diagram. In addition, there are Syntrophomonadaceae family (d) as fatty acid-degrading bacteria with resolution of fatty acids (C4 to C18) that contain more carbon atoms than propionic acid, and these fungi are in an environment that coexists with methanogens. It is an acid-producing bacterium that decomposes by β-oxidation metabolic pathway to produce hydrogen and acetic acid. Since this bacterial group is difficult to isolate and culture, there is little knowledge about physiological characteristics in the high-temperature methane fermentation system. The only lipid and higher fatty acid-degrading strain Thermosyntrophalipolytica isolated under high temperature conditions was found to be closely related to this Syntrophomonadaceae family (Non-patent Document 7). Moreover, from the result of analyzing the microbial 16S rRNA gene information in the high-temperature higher fatty acid-degrading bacteria enriched culture, it was found to be closely related to the Syntrophomonadaceae group (Non-patent Document 8).
A method for detecting higher fatty acid degrading bacteria using a DNA probe that specifically detects the 16S rRNA gene has been reported (Non-patent Documents 8 and 9). However, the procedure from sample preparation to measurement completion is complicated, and for quantification, it is necessary to calculate the average value by counting multiple fields using a fluorescence microscope. The problem is that it takes a lot of time. In addition, since intracellular RNA is targeted, detection sensitivity is easily affected by the efficiency of probe entry into cells.

In addition, PCR primers for analyzing the cloning of propionic acid-degrading bacteria of the genus Pelotomaculum and Desulfotomaculum using a primer that specifically detects the 16S rRNA gene have been reported (Non-patent Document 10). However, these PCR amplification products have a size of 700 bp or more, and cannot be applied to real-time PCR equipment (application range: 100 to 700 bp). Moreover, as a result of examining the specificity of the primer (FIG. 6), the higher fatty acid-degrading bacterium Syntrophomonadaceae family group well present in methane fermentation sludge, the cellulose-degrading bacterium JC3 (Non-patent Document 11) and the carbohydrate-degrading bacterium S2 Since a strain (Patent Document 2) is also detected, the accuracy is insufficient as a specific detection method for propionic acid degrading bacteria, and it cannot be used.
JP 2001-321792 Naoaki Kataoka, Hao Lin Yun, Akiko Miya, Anaerobic treatment method and treatment system for oil-containing contaminants Japanese Patent Application 2006-099990 Akiko Miya, Tatsuo Shimomura, Tomoko Tachizawa, Hao Lin Yun, Method and apparatus for treating organic waste by anaerobic microorganisms Chu Shun-ho, Lee Yu-yu, Takashi Miyahara, Tatsuya Noike, et al., Japan Society of Civil Engineers, No. 559 / VII-2, 31-38, 1997. Sekiguchi et al., Microbiology, 144, pp.2655-2665, 1998. Harada et al., Environmental Engineering Research Journal, Vol. 34, p327-336, 1997. Syutsubo et al., Wat. Sci. Tech., 36, 391-398, 1997. Uemura et al, Appl. Microbiol. Biotechnol., 39, 654-660, 1993. Wiegant et al, Biotech. Bioeng., 27, 1603-1607, 1985. Vitalii Svetlitshnyi et al., Thermosyntropha lipolytica gen. Nov., sp. Nov., A Lipolytic, Anaerobic, Alkalitolerant, Thermophilic Bacterium Utilizing Short- and Long-Chain Fatty Acid in Syntrophic Coculture with a Methanogenic Archaeum, International Journal of systematic Bacteriology, 1996, Vol.46, No.10, p.1131-1137. Masafumi Enomoto, Hiroyuki Imachi, Akiyoshi Ohashi, Hideki Harada, Attempt to Isolate Anaerobic Higher Fatty Acid Degrading Symbiotic Bacteria Combined with Molecular Genetic Methods, 2004, Proceedings of the 38th Annual Meeting of Japan Society on Water Environment, p.241 . Kaare H. HANSEN et al., Quantification of Syntrophic Fatty Acid-beta-Oxidizing Bacteria in a Mesophilic Biogas by Oligonucleotide Probe Hybridization, Applied and Environmental Microbiology, 1999, Vol.65, p.4767-4774. Hiroyuki Imachi et al, No-sulfate-reducing, Syntrophic Bacteria Affiliated with DesulfotomaculumCluster I Are Widely Distributed in Methanogenic Environments, Applied and Environmental Microbiology, 2006, Vol.72, No.3, p.1-12. Yoshiya Nagaya, Kazuaki Suzutsubo, Akiko Miya, Identification and detection of dominant cellulose-degrading bacteria in high-temperature methane fermentation system, 37th Annual Conference of Japan Society on Water Environment p.282.

  The cause of the deterioration of methane production in the anaerobic decomposition of lipids (methane fermentation) includes the above-described inhibition of acid fermentation and methane production by higher fatty acids and the accumulation of hardly decomposable propionic acid. In the present invention, paying attention to the behavior of microbial communities involved in fatty acid accumulation, by monitoring the concentration and metabolic activity of such microorganisms, easily and quickly grasp the fatty acid resolution or fatty acid accumulation status in the reaction system, We aim to develop a highly efficient anaerobic treatment method using feedback control.

  Therefore, the object of the present invention is to provide a novel means for monitoring bacterial concentration and metabolic activity related to fatty acid degradation in anaerobic degradation of lipids, It is to find a measure to make it an operation management index.

  In order to solve the above problems, in the present invention, acid-producing bacteria related to fatty acid decomposition other than acetic acid present in methane fermentation-treated sludge such as organic waste and wastewater are quantitatively analyzed using molecular biological techniques. Provide a means to detect.

Specifically, a novel primer for application to quantitative PCR targeting a specific part of the 16S rRNA gene of acid-producing bacteria, and a specific genus present in methane fermentation-treated sludge using the primer. Alternatively, a method for quantitatively detecting acid-producing bacteria of a family is provided. Furthermore, by using this primer, the bacterial concentration and metabolic activity are monitored by quantitatively detecting bacterial DNA and RNA related to fatty acid degradation over time in the methane fermentation sludge of organic waste and wastewater. The results provide a method for estimating the resolution of lipids and fatty acids in the entire methane-fermenting microbial system. Furthermore, the method of feeding back the obtained result and using it for operation control of an anaerobic processing apparatus is also provided.

That is, the present invention relates to the following contents.
(1) Primer set containing any one set of oligonucleotides described in the following (a) to (d) for differentially and quantitatively detecting fatty acid degrading bacteria at the genus or family level:
(A) an oligonucleotide having the nucleotide sequence of SEQ ID NO: 1 targeting the Syntrophobacter genus group or a nucleotide sequence substantially homologous thereto, and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence substantially homologous thereto nucleotide;
(B) an oligonucleotide having the nucleotide sequence of SEQ ID NO: 3 targeting the Pelotomaculum genus or a nucleotide sequence substantially homologous thereto, and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence substantially homologous thereto nucleotide;
(C) an oligonucleotide having the base sequence of SEQ ID NO: 5 or a base sequence substantially homologous thereto, and an oligonucleotide having the base sequence of SEQ ID NO: 6 or a base sequence substantially homologous thereto, targeting the genus Desulfotomaculum nucleotide;
(D) an oligonucleotide having the nucleotide sequence of SEQ ID NO: 7 targeting the Syntrophomonadaceae family, or a nucleotide sequence substantially homologous thereto, and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence substantially homologous thereto nucleotide.

(2) A method for detecting a fatty acid-degrading bacterium of a predetermined genus or family in a sample by PCR using the primer set described in (1) above.
(3) The method according to (2), wherein the sample is a sample collected from a methane fermentation microbial system.
(4) A method for diagnosing a methane-fermenting microbial system, wherein a sample collected from the methane-fermenting microbial system is used as a target, and quantification using any one or more of the primer sets (a) to (d) above. The diagnostic method comprising performing PCR and detecting a predetermined group of fatty acid-degrading bacteria in the methane-fermenting microbial system.
(5) Real-time PCR is performed as quantitative PCR, and the number and / or activity of a predetermined fatty acid-degrading bacterium group in the methane-fermenting microbial system is monitored over time. The method according to (4), including predicting.
(6) Quantitative PCR using any one or more of the primer sets (a) to (c) above, and the number of predetermined acid-producing bacteria involved in propionic acid degradation in the methane fermentation microorganism system and / or The method according to (4), comprising quantifying activity and estimating the propionic acid resolution of the methane-fermenting microbial system from the quantification result.
(7) Performing real-time PCR using any one or more of the primer sets of (a) and (d) above, and the number and / or activity of predetermined acid-producing bacteria involved in lipid degradation in the methane fermentation microorganism system The method according to (4), comprising monitoring the aging over time and predicting the lipid resolution of the methane-fermenting microbial system from the monitoring results.
(8) Quantitative PCR using any one or more of the primer sets (a) to (d) above is performed on a sample collected from the methane fermentation microorganism system, and a predetermined in the methane fermentation microorganism system is obtained. An anaerobic treatment characterized in that the predominance of fatty acid-degrading bacteria group is investigated, bacteria that are considered useful for the methane fermentation microorganism system are estimated, and the number and activity of the bacteria that are considered useful are controlled. Method.
(9) Real-time PCR using any one or more of the primer sets (a) to (d) above is performed on a sample collected from the methane fermentation microorganism system, and the predetermined in the methane fermentation microorganism system is performed. Monitoring the activity per cell of the fatty acid-degrading bacteria group over time, predicting appropriate operation control conditions for the methane fermentation microbial system from the monitoring results, and implementing the appropriate control conditions Anaerobic treatment method.

  According to the present invention, anaerobic bacteria related to fatty acid degradation present in methane fermentation-treated sludge such as organic waste and wastewater can be specifically detected and quantified at the genus or family level without culturing for a long time. It has become possible. This is especially true for microorganisms of high-temperature methane fermentation systems that have been lacking in knowledge, especially bacteria responsible for the degradation of higher fatty acids and propionic acid, which are thought to affect methane production efficiency from oil-containing waste and wastewater. For the first time, the invention allows detection with sufficient accuracy. Furthermore, by performing detection and quantification using real-time PCR, the behavior of bacteria related to fatty acid degradation can be monitored over time at the processing site.

  By monitoring bacteria related to fatty acid degradation present in such methane fermentation-treated sludge, accumulation of intermediate metabolites that are factors that inhibit methane production can be predicted. And based on a prediction result, the efficiency and stabilization of the whole methane fermentation process can be aimed at by suppressing the accumulation | storage of the intermediate metabolite used as an obstruction factor.

  Hereinafter, embodiments of the present invention will be described in detail.

1. Fatty acid-degrading bacterium In the present specification, a fatty acid-degrading bacterium (fatty acid-degrading bacterium) refers to a bacterium that is involved in fatty acid decomposition other than acetic acid. The currently reported group of fatty acid-degrading bacteria is shown in FIG. 1 (see also the above description of the background art).

  The fatty acid-degrading bacteria targeted by the present invention are mainly some acid-producing bacteria known to exist in methane fermentation treatment systems such as organic waste and wastewater. In the present invention, since fatty acids present in the methane fermentation treatment system focus on what is considered to be an intermediate metabolite that becomes a methane production inhibiting factor, specifically, higher fatty acids, and in particular, high-temperature methane fermentation tends to accumulate. Propionic acid is important. Therefore, in some aspects of the present invention, the fatty acid-degrading bacteria are targeted to propionic acid-degrading bacteria and higher fatty acid-degrading bacteria.

In a more specific aspect of the present invention, the following fungal groups are targeted as representatives of propionic acid degrading bacteria and higher fatty acid degrading bacteria in high-temperature methane fermentation. That is, as propionic acid degrading bacteria, (a) Syntrophobacter genus group; (b) Pelotomaculum genus group; (c) Desulfotomaculum genus group, and higher fatty acid degrading bacteria as (d) Syntrophomonadaceae family is there.

  The names “propionic acid-degrading bacterium” and “higher fatty acid-degrading bacterium” described above are convenient, and do not mean that these bacteria exclusively decompose only propionic acid or higher fatty acid.

Ordinary fatty acids include “lower (short chain) fatty acids” (eg, butyric acid, valeric acid, caproic acid, pelargonic acid, capric acid, undecylic acid, etc.) that have fewer carbon atoms, typically less than 11 carbon atoms. There are “higher fatty acids” with high carbon numbers, typically 11 or more carbon atoms. Examples of the higher fatty acid include lauric acid, tridecylic acid, myristic acid, pentadecylic acid, palmitic acid, heptadecylic acid, stearic acid, nonadecanoic acid, arachidic acid, behenic acid, lignoceric acid, serotic acid, heptacosanoic acid, montanic acid, melicin Examples thereof include saturated fatty acids such as acids and laccelic acids, unsaturated fatty acids such as oleic acid, elaidic acid, celetic acid, erucic acid, brassic acid, linoleic acid, linolenic acid, arachidonic acid, stearic acid, and mixtures thereof. The Syntrophomonadaceae family of bacteria has substrate assimilability that degrades higher fatty acids having 18 carbon atoms to lower fatty acids having 4 carbon atoms. On the other hand, since the Syntrophobacter genus group also has substrate-assimilating ability to degrade lower fatty acids having 11 or less carbon atoms, it is not limited to propionic acid-degrading bacteria.

2. Primer of the present invention The present invention is characterized in that the presence of a nucleic acid derived from 16S rRNA of a fatty acid-degrading bacterium is specifically quantitatively detected through a PCR method (polymerase chain reaction). Here, the nucleic acid “derived from 16S rRNA” is derived from 16S rRNA, which is a 16S rRNA gene, and 16S rRNA, which is RNA constituting a ribosome small subunit that is a protein synthesis factory. means. Specifically, quantitative detection via PCR is performed by performing quantitative PCR using specific primers, amplifying a specific base sequence in the 16S rRNA gene of fatty acid degrading bacteria, and By quantitatively detecting, 16S rDNA or 16S rRNA in the original sample is quantitatively detected.

Primers used in the present invention are, under predetermined PCR conditions, among fatty acid degrading bacteria, propionic acid degrading bacteria (a) Syntrophobacter group; (b) Pelotomaculum group; (c) Desulfotomaculum group Higher fatty acid-degrading bacteria (d) It can anneal to 16S rDNA from Syntrophomonadaceae family, but under the same conditions, it has a base sequence that does not anneal to 16S rDNA from eubacteria and other methanogens Designed. In addition, these primers were designed as quantitative detection primers applicable to the real-time PCR method so that they can be used as a means for rapid monitoring of fatty acid-degrading bacteria in anaerobic treatment sites.

Primers were designed according to the following method. First, from sequence information published in databases such as GenBank and literature, (a) Syntrophobacter genus group; (b) Pelotomaculum genus group; (c) Desulfotomaculum genus group; (d) Syntrophomonadaceae family group The base sequences of 16S rDNA of each fungal group were obtained, and these base sequences were compared with 16S rDNA derived from other eubacteria and methanogens to identify regions specific to each target fungus group. . The region was specified to be 100 bp to 700 bp so that it could be applied to a real-time PCR instrument. A primer pair (a primer set consisting of a forward primer: F and a reverse primer: R) is designed based on the base sequence of the specified region, and a DNA extract of a representative pure strain or its 16S rDNA full-length amplification product, Next, real-time PCR was performed using a DNA extract of an actual sludge sample as a template, and the detection specificity and reaction efficiency were examined. What the specificity with respect to the fatty-acid-decomposing bacteria group made into the object was confirmed was obtained as a detection primer set of the following (a)-(d).
(A) A primer set consisting of a set of oligonucleotides each consisting of the nucleotide sequences of SEQ ID NO: 1 (SYN330F 5 ′ TTCGGGTTGTAAAGCTCGTC 3 ′) and SEQ ID NO: 2 (SYN575R 5 ′ CTCCAGCACTCAAGACGAACA 3 ′). According to this primer set, among the propionic acid degrading bacteria Syntrophobacter genus bacteria 16S rDNA, in the representative Syntrophobacter wolinii (Accession No. X70905, 16SrDNA full-length base number about 1427), at the base position counted from the 5 ′ end side A fragment of 246 bases corresponding to the 330th to 575th region is amplified.
(B) A primer set consisting of a pair of oligonucleotides consisting of the nucleotide sequences of SEQ ID NO: 3 (Pelot255F 5 ′ GGGAACCCGCTGACA 3 ′) and SEQ ID NO: 4 (Pelot525R 5 ′ CGGGGCTTCCTCCTCA 3 ′). According to this primer set, among the propionic acid-degrading bacteria Pelotomacum genus bacteria 16S rDNA, the bases counted from the 5 ′ end in the representative Pelotomaculum thermopropionicum strain SI (Accession No. AB035723, 16SrDNA full-length base number about 1532) A fragment of 271 bases corresponding to the 255th to 525th region at the position is amplified.
(C) A primer set consisting of a pair of oligonucleotides consisting of the nucleotide sequences of SEQ ID NO: 5 (DFM 628F 5 ′ CAAGAAGTCAGGGGTGAAATACC 3 ′) and SEQ ID NO: 6 (DFM 1176R 5 ′ CGCTGGCAACTAACCGTAG 3 ′). According to the primer set, among the propionic acid degrading bacteria Desulfotomaculum bacteria 16S rDNA, in a typical Desulfotomaculumthermobenzoicum (Accession No.AY007190, about 1551 pieces 16SrDNA full length bases), a base position counted from the 5 'end 628 A fragment of 549 bases corresponding to the 1st to 1176th region is amplified.
(D) A primer set consisting of a set of oligonucleotides consisting of the nucleotide sequences of SEQ ID NO: 7 (SYM373F 5 ′ GAAGGCGGCTTTCTGGACTGACC 3 ′) and SEQ ID NO: 8 (SYM788R 5 ′ CCCGTTAGCAACTAACAGC 3 ′). According to this primer set, among the fatty acid-degrading bacteria Syntrophomonadaceae family 16S rDNA, in the typical high-temperature palmitic acid-degrading bacterium Uncultured clone TPA (Accession No. AB232551, 16SrDNA full-length base number about 1246) from the 5 ′ end side A fragment of 416 bases corresponding to the 373rd to 788th regions is amplified at the counted base positions.

  However, when actually used, it is not necessary to have 100% homology with the base sequence described above. Oligonucleotides having a base sequence that differs from these sequences by 1 to 6 bases and has substantially no change in reaction efficiency and specificity with the target bacterial species gene can also be used as detection primers. In the present specification, such a base sequence is referred to as a “substantially homologous base sequence”. Accordingly, 1 to 6 bases (in some cases, more preferably 1 to 3 bases, and further preferably 1 to 2 bases) in the base sequence represented by the above SEQ ID NO are deleted or other Even if it is substituted or added with a base, it can anneal to 16S rDNA of each fungus group under the predetermined PCR conditions, but it does not anneal to 16S rDNA derived from other eubacteria and methanogenic archaea under the same conditions. As a result, such an oligonucleotide that can specifically amplify the specific region of the 16S rDNA is also included in the primer of the present invention as an “oligonucleotide having a substantially homologous base sequence”.

Types of fatty acid degrading bacteria detected with the primer of the present invention are shown in FIGS. (For the names of the system diagram and primers bacteria, FIG see also.) Syntrophobacter genus Pelotomaculum genus Desulfotomaculum genus fractionally in each fatty acid degradation bacterial DNA or RNA to genus or family level Syntrophomonadaceae family It can be seen that quantitative detection is possible. In the present specification, “quantitative and quantitative detection at the genus or family level” means that bacteria classified into a predetermined genus or family can be specifically detected. Here, the term “specific” means that the range of the detection target is comprehensive to the target DNA or RNA of a fungus group classified into a predetermined genus or family, and the corresponding DNA or RNA of another genus or family It means having sufficient exclusivity to RNA. However, such comprehensiveness and exclusivity do not mean complete inclusiveness or exclusivity, but substantial inclusiveness and exclusivity that does not impair the usefulness of the Act. Thus, for “specific” detection, phenotypes or families of a given genus or family with a fatty acid resolution are very similar in phenotypic trait to a representative group of bacteria of a given genus or family and have a close phylogenetic location. In some cases, bacteria can be detected. For example, in the primer set (a) targeting the Syntrophobacter genus group, two types of Syntrophobacter genus groups (Fig. 2, lanes 9 and 11) having different genus names but having a fatty acid resolving power and Smithella propionica (Fig. 2, Lane 8) can be detected. Therefore, even if the dominant bacterial species within the detection range of this primer set is changed without changing the fatty acid resolution of sludge, it can be detected as a degrading bacterium that correlates with the fatty acid resolution of sludge. With the primer set (b) targeting the Pelotomaculum genus group, the propionate-degrading bacterium group having no sulfate reducing ability belonging to the Desulfotomaculum cluster can be specifically detected, and can be separated from the sulfate-reducing bacteria. When detection using this primer set reveals that propionic acid-degrading bacteria that do not have sulfate-reducing ability are dominant, sulfate is added to increase the propionic acid resolution in the reaction system. It is considered that addition of fumaric acid or the like is effective, not a means. With the primer set (c) targeting the Desulfotomaculum genus group, it is possible to detect the propionic acid-degrading bacterium group having the ability to reduce sulfate as distinguished from the Pelotomaculum genus group. In a reaction system in which this fungal group is dominant, it can be predicted that a control method for increasing the propionic acid resolution by adding an appropriate sulfate is effective. The primer set (d) targeting the Syntrophomonadaceae family can detect the medium-temperature fatty acid-degrading bacteria Syntrophomonas wolfeii , Syntrophomonassapovorans , Syntrothermorus lipocalidus , and the high-temperature fatty acid-degrading bacterium Thermosyntropha lypolytica , It also covers the medium and high temperature higher fatty acid-degrading bacteria Clone MPA, MOL, MLI and TPA, TST, TOL that cannot be isolated. By this detection method, it is possible to monitor almost all of the known higher fatty acid degrading bacteria.


3. Quantitative PCR
Although the primer of this invention is applicable also to normal PCR, it is suitable to apply to quantitative PCR (Quantitative polymerase chain reaction: Q-PCR). Using the primer of the present invention, fatty acid-degrading bacteria can be specifically detected from a sample containing various microorganisms without performing a culture operation. The sample for detecting fatty acid degrading bacteria by applying the primer of the present invention is not particularly limited as long as there is a possibility that fatty acid degrading bacteria exist. As an example of a sample in which fatty acid degrading bacteria may be present, those closely related to the preferred embodiment of the present invention are samples derived from a system in which anaerobic degradation of organic substances is suspected, for example, Examples include anaerobic treated sludge or wastewater (methane fermentation microorganism system) collected from various wastes, and accumulation culture from such sludge or wastewater.

  As a template for PCR amplification, a nucleic acid extracted from a microorganism (DNA or RNA in the case of RT-PCR) contained in a sample is used. Nucleic acid extraction can be easily performed by those skilled in the art according to various known methods or using commercially available kits (for example, Miller, tL, Evaluation and Optimization of DNA Extraction and Purification Procedures for Soil and Sediment Samples, Appl. Environ. Microbiol., 65: 4715-4724, 1999; or QIAGEN RNA protect Bacteria Reagent and RNeasy® Mini Kit operating manual). Because microbial DNA is highly stable and easy to handle, it can be easily extracted from samples collected and stored frozen. As a DNA extraction method, a general phenol / chloroform-ethanol precipitation method can be used, and a commercially available DNA extraction kit or DNA extraction apparatus can be used quickly and easily. On the other hand, since microbial RNA is easily degraded, extraction from a fresh sample (24 hours) is desirable, but extraction from a sample stored frozen by adding a commercially available RNA stabilizer is also possible. In addition, RNA can be amplified by the RT-PCR method, and the detection sensitivity of RNA becomes high, so that target bacteria can be detected from a slightly degraded RNA solution. Therefore, after collection, for the convenience of storage and use, the sample was subjected to any treatment (pulverization, separation, filtration, etc.) under the conditions that the nucleic acid contained in the sample is not severely damaged, denatured, degraded, or lost. It may be a thing.

  Quantitative PCR is an improved version of PCR that can rapidly quantify its products. This is an indirect measure of the total amount of DNA, cDNA or RNA before amplification. Usually, it is used for the purpose of checking whether the target gene sequence exists and how many copies exist. As a method for quantitative PCR, agarose gel electrophoresis, SYBR green (double-stranded DNA staining), or a fluorescent probe is often used. The latter two can be analyzed in real time using real-time PCR. The primer of the present invention can be used in any of these three methods.

Quantitative PCR can be performed according to the following general procedure. A primer is brought into contact with a nucleic acid sample derived from an environmental sample as a template, and an intermittent amplification reaction is repeated under a series of polymerase chain reaction conditions. The amplification reaction conditions at this time may be appropriately set according to common general knowledge or empirical rules in the technical field. As a result, the nucleic acid region having a specific fragment length between the 3 ′ primer and the 5 ′ primer used is specifically amplified. The amplified nucleic acid can be confirmed to be the target nucleic acid, for example, by confirming the fragment length thereof by electrophoresis or using a probe specific to the fragment. Real-time PCR is performed with a dedicated device that integrates a thermal cycler and a spectrofluorometer, and detects PCR amplification products by fluorescence.
Since the amount of nucleic acid to be amplified is substantially correlated with the number of bacteria in the test sample when a bacterial gene DNA is amplified, the number of bacteria can be determined based on the quantitative value of the amplified nucleic acid.

  Among quantitative PCR methods, agarose gel electrophoresis is a semi-quantitative method that is generally used to simply determine whether a probe or primer target sequence is present. Prepare an unknown sample and a known sample with a near-sized DNA fragment of known concentration. Each sample is reacted under the same conditions for the same time (preferably using the same primers or at least at the same annealing temperature). Separate PCR products by agarose gel electrophoresis. Quantify unknown samples by measuring the relative amount of known and unknown samples.

  The SYBR Green method is more accurate than gel electrophoresis by using SYBR Green, and results are obtained in real time. DNA-binding dyes bind to newly synthesized double-stranded DNA and increase green fluorescence. The first concentration is measured by measuring this. However, SYBR Green binds other than the target sequence, so the results may be confused. As a procedure of this method, PCR is performed by adding a double-stranded DNA-binding fluorescent dye, and the fluorescence intensity is measured simultaneously with the PCR. At this time, the dye fluoresces only when bound to double-stranded DNA. The concentration of double-stranded DNA is quantified by comparison with a standard sample (no fluorescent dye added).

  In the fluorescent probe method, in addition to two types of primers at both ends of the amplification region, a fluorescent probe that binds complementarily within the amplification region is used. Since a probe specific to the DNA to be amplified is used, only the target sequence can be quantified. That is, it does not react to all double-stranded DNAs as in the method described above. Usually, the probe is based on RNA, with a fluorescent reporter and a quencher (excitation energy absorber) next to it. The reporter near the quencher is suppressed in fluorescence. Thus, fluorescence is only seen when the probe is degraded. This process depends on the 5 '→ 3' exonuclease activity of the DNA polymerase used. The basic procedure for this method is to add a probe and perform PCR. When the reaction is initiated and the DNA becomes single-stranded, the probe binds to its complementary sequence (ie, its template DNA). When the polymerase reaches the working temperature, it makes a complementary strand to the primer-bound single-stranded DNA. When DNA synthesis reaches the probe location, the probe is “overwritten” by exonuclease activity. As a result, the original probe breaks down into individual nucleotides. Then, the fluorescent reporter separates from the quencher and emits fluorescence. As the PCR progresses, the fluorescent reporter separates from the quencher, so the fluorescence clearly increases geometrically. This makes it possible to accurately measure the initial amount of DNA.

  Tables 1 and 2 show the base sequences of detection primer sets used in the present invention and typical quantitative PCR conditions.

4). Detection and behavior analysis of fatty acid degrading bacteria and application to anaerobic treatment Using the primer of the present invention, 16S rDNA of various fatty acid degrading bacteria (propionic acid degrading bacteria group and higher fatty acid degrading bacteria group) is quantitatively detected, Changes in the number of bacteria in the group can be monitored. “Bacterial count” is also referred to as “bacterial concentration” when considering the detection result of the PCR method. These are generally positively correlated with the “bacterial count” and are used interchangeably, especially taking into account the copy number / bacteria of the target 16S rRNA. Furthermore, 16S rRNA can be quantitatively detected by reverse transcription PCR (RT-PCR), and the activity of each bacterial group can also be measured.

  Using these quantitative detection methods for fatty acid-degrading bacteria, we first diagnose fatty acid-degrading bacteria in an anaerobic treatment system for organic matter, and examine the physiological characteristics of the bacterial species that seem to correlate with the performance of the treatment system. A corresponding control method is performed, and a stable anaerobic treatment becomes possible. In this specification, “diagnosis” of fatty acid-degrading bacteria refers to data collection, analysis and judgment based on the obtained data (estimate, Quantitative PCR detects quantitatively the nucleic acid derived from 16SrRNA of a predetermined fatty acid-degrading bacterium, quantitatively determines its bacterial count (DNA) and activity (RNA), methane fermentation It means a part or all of each step for judging the resolution and / or methanogenic ability of microbial lipids and / or fatty acids.

  In addition, by monitoring the variation in the number or activity of various fatty acid-degrading bacteria, it is possible to predict the limit load of the continuous treatment system and the presence of inhibitors from raw water, and take appropriate measures to The methane fermentation system can be prevented from losing stability earlier than in the case of monitoring based on conventional control parameters such as pH.

  Hereinafter, specific embodiments will be exemplified and described.

1st embodiment The 1st embodiment grasps the predominance situation of the fatty acid decomposing bacteria group in the anaerobic processing microbe system of various wastes by real-time PCR using the primer of the present invention. is there.

In fact, as a result of PCR detection using the primer of the present invention, the propionate-degrading bacterium, Syntrophobacter genus group, is present in many methane fermentation treatment systems; the Pelotomaculum genus group is high-temperature methane in soy milk It was found that it was present in the fermentation treatment system and the accumulation culture system of propionic acid degrading bacteria; the Desulfotomaculum genus group was not present in the methane fermentation treatment system to which sulfate ions were not added. Moreover, it was confirmed that higher fatty acids and lipolytic bacteria Syntrophomonadacea family are present in many methane fermentation treatment systems.

  By monitoring the behavior and activity of these fungal groups, it becomes possible to evaluate the fatty acid resolution of the treatment system.

Second embodiment Real-time PCR using the primer of the present invention is used to analyze the behavior of fatty acid-degrading bacteria in a high-temperature methane fermentation continuous treatment system or batch experiment system of organic waste, Knowledge about the correlation between changes in RNA concentration and fatty acid-degrading acid production activity can be obtained. First, diagnose fatty acid-degrading bacteria that predominate in the treatment system, and carry out control corresponding to the physiological characteristics of the dominant or presumably useful bacterial species This makes it possible to perform a stable anaerobic treatment. Bacterial groups that are linked to changes in bacterial DNA or RNA concentration, fatty acid degradation, accumulation status in the system, and methane production efficiency are listed as bacterial groups that should be controlled, and stable operation with reference to their physiological information It is conceivable to find a control method.

  For example, a processing system with abundant proteins such as soy milk has high methane fermentation efficiency, but a coffee koji or cellulosic waste system is difficult to perform methane fermentation. By comparing the type, amount, and activity of the dominant fatty acid-degrading bacteria group in these treatment systems, it seems that the fatty acid-degrading bacteria useful for improving the efficiency of methane fermentation can be found. For example, a hard-to-decompose coffee lees treatment system is supplemented with the same type and amount of fatty acid-degrading bacteria as in the soymilk treatment system, further supplemented with growth factors for the fungus, or an inhibitor of the fungus (high hydrogen content Improvement of methane fermentation efficiency can be expected by means such as removing pressure.

In addition, an appropriate control method can be devised by combining known physiological information of useful bacteria and knowledge newly obtained by applying the present invention. For example, it is known that sulfate-reducing bacteria contribute to organic acid fermentation and hydrogen-producing acetic acid under conditions where sulfate is present (anaerobic microbiology, Chapter 3 Types of sulfate-reducing bacteria and Ecology, Katsuji Kamiki, Shiro Nagai, Yokendo, p.51-67, 1993). Among the currently reported fatty acid-degrading bacteria group (Fig. 1), the propionic acid-degrading bacteria group includes Syntrophobacter group (a), Pelotomaculum group (b) and Desulfotomaculum group which are separated from each other on the phylogenetic diagram. (c) can be mentioned, Kingun with propionic acid resolution that does not depend on the sulfate is tuberculosis and (a) (b), Pelotomaculum Shokukingun (b) is a physiological characteristic to assimilate only propionic acid On the other hand, the Syntrophobacter genus Smithella propionica can assimilate butyric acid and crotonic acid in addition to propionic acid, and in the co-culture system with methanogens, butyric acid also slightly promotes methanogenic activity from propionic acid It is known to have features (Yitai Liu et al., Characterization of the anaerobic propionate-degrading syntrophs Smithellapropionica, gen.nov., Sp. Nov. And Syntrophobacter wolinii, International Journal of Systematic Bacteriology, 1999, vol. 49 , p.545-556 .). The detection using the primer of the present invention enables for the first time the differential detection of these bacterial groups (a), (b) and (c). Based on the physiological characteristics of these fungal groups, a control method that improves the propionic acid degrading activity seems to be effective. For example, by quantitative detection using the primer of the present invention, it was found that in a waste treatment system with a low sulfate content, the propionic acid degrading bacterium group Desulfotomaculum genus group utilizing the sulfate reduction metabolic pathway does not exist. By supplementing these sulfate-reducing bacteria and growing or maintaining them in the system to a certain concentration, it promotes the degradation of refractory propionic acid and the reduction of hydrogen partial pressure, thereby reducing the overall process of methane fermentation. High efficiency can be achieved. Furthermore, for example, by monitoring the concentration and / or sulfate reduction activity of sulfate-reducing bacteria by real-time PCR using the primer of the present invention, and adding fumaric acid according to the concentration and / or activity, sulfate-reducing bacteria By controlling the operating conditions such that the concentration is maintained within a predetermined range, the decomposition reaction of propionic acid can be promoted. Furthermore, the hydrogen concentration in the gas phase in the reaction tank and / or the acetic acid concentration in the sludge is monitored, and sulfate is added to a predetermined concentration according to the value, and the hydrogen-assimilating reaction of sulfate-reducing bacteria is performed. By promoting, the hydrogen partial pressure in the reaction tank can be reduced, and as a result, the growth and / or methanogenic activity of the methanogenic bacteria can be promoted, and a stable anaerobic treatment can be maintained.

  In addition, the effect on the efficiency of methane production from hydrogen and acetic acid, which is the final step of methane fermentation, can be estimated from the number or activity variation of fatty acid-decomposing acid-producing bacteria that accompanies changes in the conditions of continuous treatment and batch experiments. By taking appropriate measures based on the obtained information, it is possible to stably maintain the balance between the acid production activity and the methane production activity in the methane fermentation system.

  For example, when the concentration or activity of higher fatty acid-degrading bacteria group suddenly decreases, there is a risk of damaging methanogenic bacteria due to the accumulation of higher fatty acids in the system, particularly unsaturated higher fatty acids such as oleic acid and linoleic acid. In such a case, the present inventors, by means of increasing the amount of methanogen by adding a culture solution or sludge containing methanogen, the group of hydrogen-producing acetic acid producing bacteria and acetic acid assimilating methane in the system. Stabilize the methane fermentation treatment process by making the ratio of produced archaea and hydrogen-utilizing methanogenic archaea constant, and by adding measures such as calcium to prevent the inhibition of higher fatty acids A method for maintaining the property was described in JP-A-2002-68454. However, until now, the species of hydrogen-producing acetic acid-producing bacteria group could not be identified, so that the acid-producing bacteria group could only be reflected by a comprehensive detection method for all eubacteria. According to the present invention, the type of a hydrogen-producing acetic acid-producing bacterium that is a fatty acid-decomposing bacterium can be specifically monitored, and more appropriate treatment can be performed according to the physiological characteristics of the bacterium.

For example, the Syntrophomonada cea e family (d), which is a higher fatty acid degrading bacterium, is said to be an acid producing bacterium that produces hydrogen and acetic acid in a symbiotic environment with a methanogenic bacterium. Due to the difficulty of culturing, there is little knowledge about physiological characteristics in the high-temperature methane fermentation system. Physiological characteristics of the genus Syntrophomonas in a moderate temperature symbiotic system (Williamh. Lorowitz et al., Syntrophomonas wolfei subsp. Saponavidasubsp.nov., A Long-Chain Fatty-Acid-Degrading, Anaerobic, Syntrophic Bacterium; Syntrophomonas wolfei subsp. Wolfei subsp. Nov .; and Emended Descriptions of the Genus and Species, International Journal of Systematic Bacteriology, 1989, Vol 39, No.2, p. 122-126. and Yuji Sekiguchi et al., Syntrophothermus lipocalidus gen. Nov , sp. nov., a novel Thermophilic, syntrophic, fatty-acid-oxidizing anaerobic which utilizing isobutyrate, International Journal of Systematic Bacteriology, 2000, Vol 50, p.771-779.) May produce propionic acid, but does not have propionic acid resolution. According to the present invention, for the Syntrophomonada cea e family (d) in the high-temperature methane fermentation system, a new finding was obtained that the bacterial concentration increased by decreasing the bacterial concentration or increasing the pH before the methane gas production activity decreased. . Based on this knowledge, it seems possible to find a policy that leads to stable control of methane fermentation.

  In addition, in the degradation metabolic pathways of macromolecular organic substances (cellulose, carbohydrates, proteins, lipids, etc.), it is known that all carbon components except nitrogen produce acetic acid via lower fatty acids having 10 or less carbon atoms. . Therefore, controlling the concentration and activity of the fatty acid-degrading bacteria group (hydrogen-producing acetic acid-producing bacteria group) as a second decomposer that decomposes intermediate metabolites of organic matter is the substrate (acetic acid, hydrogen) concentration of the methanogenic reaction It is thought to be important to maintain a stable balance between acid production activity and methane production activity in the methane fermentation system. So far, the present inventors have proposed cellulose as a first decomposer of macromolecular organic matter, saccharide-decomposing hydrogen-producing acetic acid-producing bacteria group (Japanese Patent Laid-Open No. 2004-261125), proteolytic hydrogen-producing acetic acid-producing bacteria group (special (2005-253429) has been developed. Furthermore, according to the present invention, it has become possible to realize differential monitoring of higher fatty acid-degrading bacteria and propionic acid-degrading bacteria as hydrogen-producing acetic acid-producing bacteria. Furthermore, in combination with the quantitative detection method for acetic acid-utilizing methanogenic archaea and hydrogen-utilizing methanogenic archaea described in JP-A-2006-325581, the ratio of these fungal groups can be grasped more accurately and controlled. It seems to contribute greatly to the development of the method.

Third Embodiment By carrying out real-time PCR using the primer of the present invention, before the methane fermentation efficiency is reduced by monitoring the movement of bacterial groups with rapid or intense bacterial cell concentration fluctuations due to environmental fluctuations. Can be predicted. On the other hand, it is desirable to evaluate the fatty acid resolution or accumulation potential from the activity per microbial cell by quantitatively detecting and monitoring the RNA of the bacterial group with small or small microbial cell concentration fluctuations. In addition, in a microbial system in which two types of fungal groups having the same function coexist, the degree of contribution to the acid generating activity of the bacterium can be estimated from the correlation between the variation in the concentration of each bacterium and the variation in acid generating activity.

  Since a microbial cell contains a certain amount of DNA, the DNA concentration is proportional to the microbial cell concentration, and the DNA concentration can reflect the microbial cell concentration and can be used as an index for evaluating the microbial concentration of sludge. The most direct index for evaluating the methane production capacity of methane fermentation sludge is the amount of methane gas produced per unit time. By grasping the concentration of methane producing cells in the sludge, methane production per unit cell The activity can be evaluated. Alternatively, it is possible to evaluate acid generation activity and organic substance hydrolysis activity of bacterial cells by collecting data of acid generation amount and organic substance decomposition amount per unit time of sludge.

  On the other hand, the purpose of quantitative detection of RNA is as follows. At present, it is possible to easily and quickly monitor the amount of methane gas produced and the amount of volatile organic acids including acetic acid. However, analysis and measurement methods for high molecular organic substances (cellulose, lipids, sugars, proteins, etc.) are complicated and time consuming, making it difficult to perform on-line monitoring at an anaerobic treatment process. Therefore, it is conceivable to quantitatively detect messenger RNA (mRNA) to convey genetic information when synthesizing proteins of various metabolic enzymes involved in the degradation reaction of organic matter, and to evaluate the resolution of organic matter. It is short and is usually degraded by nucleases within minutes after synthesis. Due to this feature, handling of mRNA is difficult. In contrast, RNA (rRNA) contained in ribosome particles, which are protein synthesis factories, is metabolically stable RNA. The increase or decrease in the expression level is considered to reflect the protein synthesis activity of the bacterial cells.

  Therefore, the present invention provides a method for indirectly evaluating the organic matter decomposing activity or acid generating activity of the bacterial cell by evaluating the protein synthesis activity of the bacterial cell from the RNA to DNA concentration ratio of the bacterial cell. Here, the protein synthesis activity is measured using the expression level of RNA constituting the small subunit of ribosome, that is, 16S rRNA as an index. After examining the correlation between the amount of organic matter decomposition, the amount of acid produced, the amount of various gases produced and the rate, it is possible to evaluate the activity of the microbial community and the adaptability to environmental factors.

By monitoring the DNA and RNA of higher fatty acid degrading bacteria and propionic acid degrading bacteria over time by real-time PCR using the primer of the present invention, the metabolic activity (acid production, methane production) per anaerobic microbial cell Since each specific genus or species can be evaluated separately, it has become possible to monitor the change over time in the ratio of acid-producing activity and methanogenic activity using the behavior of the fungus as an index. Thereby, even in a system in which gas generation is stable, it is possible to realize prediction of operation conditions such as processing load and presence of environmental inhibitory factors from fluctuations in microbial cell concentration and activity. Furthermore, based on such prediction, by controlling the relative ratio between the acid production rate and the methane production rate of the fermentation system within a certain range, it can be expected that the methane fermentation reaction is efficiently processed without breaking the balance. Moreover, by comparing the DNA and RNA concentrations of various fungal groups and the relative ratios of eubacteria and the entire methanogen, it is possible to evaluate the flora composition of the acid-producing fungi and methanogens and the activity of the various fungi. . It is expected that the control conditions of the fermentation system can be found by grasping the correlation between the information and the acid production and methane production ability of the fermentation system.

EXAMPLES Hereinafter, although an Example demonstrates this invention concretely, the scope of the present invention is not limited by these Examples.

Quantitative detection of fatty acid-degrading bacteria in high-temperature methane fermentation treatment system of soy milk (Figures 7-10)
For quantitative detection of each bacterial group by real-time PCR, use LightCycler (registered trademark) FastStart DNA Master SYBR Green I (Roche No.2239264) DNA amplification kit and LightCycler (registered trademark) system (Roche Diagnostics) , Respectively, under optimized annealing temperature, extension reaction time and magnesium concentration conditions (Table 2, above).

  FIG. 7 shows the operation results of the soymilk high-temperature methane fermentation continuous treatment system. The fat and oil-containing wastewater used in the continuous experiment was diluted with commercially available soymilk (diluted with soymilk: water = 1: 3.8). As the continuous experimental apparatus, a high-temperature (55 ° C.) continuous processing apparatus including a pre-stage lipase pretreatment tank (effective volume 2.0 L) and a fully mixed methane fermentation tank (effective volume 24 L) in the subsequent stage was used.

  In the high-temperature methane fermenter, it was operated for 18 days at HRT for the first 5 months, and then, since propionic acid accumulated, it was operated for 2 months with the load reduced at 25 days for HRT, and then under low load conditions of 103 days to 41 days for HRT. He maintained driving for half a year. Accumulation of volatile organic acids in the system was observed in the range of 500 to 5000 mg COD / L. The total lipid concentration and higher fatty acid concentration in the sludge were almost stable as a result of measurement during the first 6 months.

  FIG. 8 shows the results of monitoring over time the behavior of propionic acid and total lipids in the treatment system and the fatty acid-degrading bacteria detected. There was a correlation between the increase and decrease of propionic acid in the system and the behavioral changes of the two degrading bacteria, Pilot (b) and SYN (a).

  In FIG. 9, as a result of analyzing the correlation between the concentrations of various bacteria and the propionic acid accumulation concentration in the system, a negative correlation was found between Pelot (b) and SYN (a), and the correlation was high as for Pilot (b ) Was suggested.

In FIG. 10, as a result of analyzing the correlation between the concentration of various bacteria and the total lipid accumulation concentration in the system, a positive correlation was found between Pelot (b) and SYN (a), and the correlation was high with SYN (a ) Was also recognized. It was suggested that the presence of total lipid had an effect on propionic acid degrading bacteria concentration.

Quantitative detection of fatty acid-degrading bacteria in high-temperature coffee methane fermentation treatment system (Figures 11-17)
A two-phase high-temperature methane fermentation continuous treatment experiment consisting of a methane fermenter with an effective volume of 10 L maintained at 55 ° C. was performed after the 5 L acid fermenter with pH 7.0 controlled using coffee mash as raw water.

  The HRT of the methane fermenter is shortened from 67 days to 33 days, methane fermentation is continuously processed, pH and gas volume are recorded daily, and samples for sludge analysis are collected, and volatile organic acids, higher fatty acids, total It was used for water quality analysis such as lipids and microbiota analysis. All organic substances were collected as water quality analysis data after COD conversion. In the microbiota analysis, sludge from acid fermenter and methane fermenter was collected every day, extracted, and subjected to quantitative PCR.

  FIG. 11 shows the results of summarizing changes over time in gas, total lipid, propionic acid and higher fatty acid concentrations, and fatty acid-degrading bacterial DNA and RNA concentrations in the methane fermenter.

  In the methane fermenter, an increase in pH due to the consumption of organic acid was observed, and this was expected to significantly disturb the balance of the microflora. Therefore, on the 336th day, pH adjustment with 18% hydrochloric acid was started. Therefore, after the 336th day, the pH of both the acid fermenter and the methane fermenter was controlled artificially. However, since it was thought that the environment in the fermenter had not recovered after this, the raw water was stopped and sludge was replaced. On the 434th day, 5L of the sludge from the methane fermentation tank was withdrawn, and the same amount of excess sludge from the other series of methane fermentation tanks was added, and normal operation was resumed.

  In SYM (d), the amounts of DNA and RNA move almost identically, and the amount of accumulated lipid increases as the number of bacteria decreases, so the SYM (d) group decomposes lipids to a certain level. The lipid accumulated to about 1.8 times the level before the decrease in the number of bacteria. This indicates that SYM (d) monitoring is effective in estimating lipid degradation activity.

  In SYN (a), there is a portion that does not link in part with the amount of DNA and RNA, but there is a correlation between the amount of propionic acid that is the fermentation substrate and the number of bacteria, and SYN (a) You can see that they are involved.

  FIG. 12 shows the result of comparing the RNA / DNA concentration ratio of SYN (a) with the total lipid and fatty acid accumulation in the system. A phenomenon was observed in which the accumulated concentration of higher fatty acids increased as the reaction to decompose the accumulated propionic acid in the system progressed. In addition, it was confirmed that when the RNA / DNA concentration ratio of SYN (a) was increased, the time required for the propionic acid degradation reaction to proceed was confirmed. It was suggested that the increase in the bacterial concentration of SYN (a) and the time when the propionic acid degradation activity increased. It is conceivable to understand the physiological characteristics of SYN (a) and find out the operating conditions that keep its propionic acid decomposing activity high.

  FIG. 13 shows the results of examining the correlation between the bacterial concentration and activity of SYN (a) and the total lipid in the sludge. SYN (a) DNA and RNA concentrations were positively correlated with total lipid concentration. This result was consistent with the result obtained with the soymilk treatment system. From these results, it was suggested that the detected SYN (a) may be involved in the degradation of total lipids or higher fatty acids.

  FIG. 14 shows the results of examining the correlation between the bacterial concentration and activity of SYN (a) and the higher fatty acids in the sludge. There was a tendency for SYN (a) DNA concentration to decrease as higher fatty acid concentration in sludge increased.

  FIGS. 15 and 16 show the results of examining the correlation between the microbial concentration and activity of SYM (d) and the total lipids and fatty acids (propionic acid and higher fatty acids) in the sludge. In both cases, a decrease in the concentration and activity of the SYM (d) bacterium was observed when it accumulated more than a certain concentration. From these findings, information on the contribution and characteristics of the contribution of total lipid and fatty acid degradation of SYM (d) and SYN (a) can be obtained.

  FIG. 17 shows the results of examining the correlation between the detected bacterial concentration and activity of SYN (a) and SYM (d) and the pH in the sludge. A positive correlation was observed between these two fungal group concentrations and an increase in pH. If fatty acid-degrading bacteria are activated in a high pH range and the methanogenic activity cannot be fully exerted under these conditions, it is thought that fatty acids in the system accumulate, so the pH should be within the common range of the two bacterial groups. It was found that it was necessary to control the operation while maintaining it.

A systematic diagram of bacterial species involved in fatty acid degradation and the detection primer of the present invention are shown. The kind of fatty acid decomposing bacteria detected with the primer (a) for propionic acid degrading bacteria detection of this invention is shown. The kind of fatty acid decomposing bacteria detected by the primer (b) for detecting propionic acid degrading bacteria of the present invention is shown. The kind of fatty acid-decomposing bacterium detected with the primer (c) for detecting propionic acid-degrading bacteria of the present invention is shown. The kind of fatty acid decomposing bacteria detected with the primer (d) for fatty acid decomposing bacteria detection of this invention is shown. The result of having examined the specificity of the literature report primer is shown. The operation result of the soymilk high-temperature methane fermentation continuous treatment system is shown. The results of monitoring over time the concentration of propionic acid and total lipid in the continuous treatment system of high-temperature methane fermentation of soymilk and the behavior of each fatty acid-degrading bacterium detected. The result of having analyzed the correlation of various microbe density | concentrations and the propionic acid density | concentration in a system is shown. The result of analyzing the correlation between the concentration of various bacteria and the total lipid concentration in the system is shown. The result which put together the time-dependent change of gas of a methane fermenter, total lipid, propionic acid and higher fatty acid concentration, fatty-acid-decomposing bacteria DNA, and RNA concentration is shown. The result of comparing the RNA / DNA concentration ratio of SYN (a) with the total lipid and fatty acid accumulation in the system is shown. The results of investigating the correlation between the bacterial concentration and activity of SYN (a) and the total lipid in the sludge are shown. The result of investigating the correlation between fungal concentration and activity of SYN (a) and higher fatty acids in sludge is shown. The result of investigating the correlation between the bacterial concentration and activity of SYM (d) and the total lipid concentration in sludge is shown. The result of investigating the correlation between the fungus concentration and activity of SYM (d) and the fatty acid concentration in sludge is shown. The results of investigating the correlation between bacterial concentration and activity of SYN (a) and SYM (d) and sludge pH are shown.

Claims (9)

Primer set comprising any one of the following oligonucleotides (a) to (d) for differential quantitative detection of fatty acid degrading bacteria at the genus or family level:
(A) having the base sequence of SEQ ID NO: 1 or a base sequence substantially homologous thereto, and the base sequence of SEQ ID NO: 2 or a base sequence substantially homologous thereto, targeting the Syntrophobacter genus group Oligonucleotides;
(B) An oligonucleotide having the base sequence of SEQ ID NO: 3 or a base sequence substantially homologous thereto, and the base sequence of SEQ ID NO: 4 or a base sequence substantially homologous thereto, targeting the Pelotomaculum group Oligonucleotides;
(C) An oligonucleotide having the base sequence of SEQ ID NO: 5 or a base sequence substantially homologous thereto, and the base sequence of SEQ ID NO: 6 or a base sequence substantially homologous thereto, targeting the genus Desulfotomaculum Oligonucleotides;
(D) having the base sequence of SEQ ID NO: 7 or a base sequence substantially homologous thereto, targeting the Syntrophomonadaceae family, and the base sequence of SEQ ID NO: 8 or a base sequence substantially homologous thereto Oligonucleotide.   A method for detecting a fatty acid-degrading bacterium of a predetermined genus or family in a sample by PCR using the primer set according to claim 1.   The method according to claim 2, characterized in that the sample is a sample taken from a methane fermentation microbial system.   A method for diagnosing a methane-fermenting microbial system, which is directed to a sample collected from the methane-fermenting microbial system, and any one of primer sets comprising the oligonucleotides (a) to (d) according to claim 1 The diagnostic method comprising performing quantitative PCR using two or more and detecting a predetermined group of fatty acid-degrading bacteria in the methane-fermenting microorganism system.   Performing real-time PCR as quantitative PCR, monitoring the number and / or activity of a predetermined fatty acid-degrading bacterial group in the methane-fermenting microbial system over time, and predicting the methane-producing ability of the methane-fermenting microbial system, The method of claim 4.   A predetermined acid-producing bacterium involved in propionic acid degradation in a methane fermentation microorganism system by performing quantitative PCR using any one or more of the primer sets comprising the oligonucleotides of (a) to (c) according to claim 1 The method according to claim 4, wherein the method comprises quantifying the number and / or activity of the methane fermentation microorganism and estimating the propionic acid resolution of the methane-fermenting microbial system.   Real-time PCR using any one or more of the primer sets containing the oligonucleotides (a) and (d) according to claim 1 is carried out to obtain a predetermined acid-producing bacterium related to lipid degradation in a methane fermentation microorganism system. 5. The method of claim 4, comprising monitoring bacterial counts and / or activity over time to predict lipid resolution of the methane fermentation microbial system.   Targeting a sample collected from a methane fermentation microbial system, quantitative PCR using any one or more of the primer sets containing the oligonucleotides (a) to (d) according to claim 1 is performed, Investigating the prevailing status of certain fatty acid-degrading bacteria in the methane-fermenting microbial system, estimating the bacteria that may be useful for the methane-fermenting microbial system, and controlling the number and activity of the bacteria that are considered useful An anaerobic treatment method.   Targeting a sample collected from a methane fermentation microbial system, performing real-time PCR using any one or more of the primer sets containing the oligonucleotides (a) to (d) according to claim 1, The activity per cell of a predetermined fatty acid-degrading microbial group in the methane fermentation microbial system is monitored over time, the operation control conditions appropriate for the methane fermentation microbial system are predicted, and the appropriate control conditions are implemented. An anaerobic treatment method.