JP2008118967A - Expression vector and method for producing polypeptide using the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an expression vector having high expression efficiency of exogenous genes and high probability to produce a foreign polypeptide in a host cell as a soluble polypeptide, and to provide a method for producing a protein by using the expression vector. <P>SOLUTION: The expression efficiency of a fusion protein of a desired foreign polypeptide and a tag is increased, and the probability to produce a foreign polypeptide in a host cell as a soluble polypeptide is increased by using a HAT tag as the purification tag and placing a prescribed base sequence between an initiating codon and a HAT tag coding region. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to an expression vector having a high expression efficiency of a desired foreign gene to be expressed and a high probability that a produced foreign polypeptide is produced as a soluble polypeptide, and a method for producing a polypeptide using the expression vector.

  Various expression vectors for expressing a foreign gene encoding a desired foreign protein in a microbial cell such as E. coli have been developed and are commercially available. These expression vectors basically include a replication origin that enables replication of the vector in a host cell, a drug resistance marker that enables selection of only cells into which the expression vector has been incorporated into the cell, Various restrictions for insertion of selectable markers such as nutrient and temperature sensitive markers, promoters that allow transcription in host cells, ribosome binding sites that allow translation in ribosomes, and desired foreign genes Includes multiple cloning sites including enzyme sites. Furthermore, for purification and detection of the produced protein, various tags are provided in the vector, and various expression vectors for expressing a desired foreign protein as a fusion protein with the tag are known and commercially available. ing.

  The tag to facilitate the purification of the produced protein consists of a total of 19 amino acids, a 6xHis tag consisting of an amino acid sequence consisting of 6 linked histidines, and a 6xHN tag consisting of 6 alternating histidines and asparagine. There are various known HAT tags (histidine affinity tags) that take a helix structure and are designed so that histidine is aligned in a line when the helix structure is taken. An expression vector provided downstream is commercially available (Clontech). Since histidine has an affinity for nickel, these histidine-containing tags are adsorbed to the column by passing the protein solution through a column in which nickel is immobilized on a resin. Proteins are collected and purified using this.

  In addition, as a tag for detecting the produced protein, a Lumio (trade name) tag composed of Cys-Cys-Pro-Gly-Cys-Cys (SEQ ID NO: 4) is known, and Lumio (trade name) An expression vector incorporating a region encoding a tag is also known (Invitrogen). A fluorescent substance specifically binds to the Lumio (trade name) tag and emits fluorescence when this fluorescent substance binds to the Lumio (trade name) tag. Can be detected.

  In addition, in order to separate the tag for purification and detection after purification and detection of the protein, a recognition site for a protease such as TEV protease, Factor Xa, enterokinase, thrombin or the like that cleaves a specific amino acid sequence portion is provided. In addition to the above tags, various expression vectors provided with such a sequence-specific protease recognition site are also known and commercially available.

High-throughput screening of soluble recombinant proteins.Yan-Ping Shih, 1, Wen-Mei Kung, 1, Jui-Chuan Chen, Chia-Hui Yeh, Andrew H.-J.Wang and Ting-Fang Wang.Protein Science (2002 ), 11: 1714-1719. Evaluating Representations for the Shine-Dalgarno Site in Escherichia coli.Steven Hampson & Dennis Kibler.TR # 03-14.School of Information and Computer Science.University of California, Irvine

  As described above, various tags for facilitating purification and detection of the produced protein are known, and those tags and expression vectors incorporating a protease recognition site for cleaving and removing the tag after purification and detection are available. Various commercial products are available. However, when foreign genes are expressed using them, the expression efficiency is not necessarily high, and the expression of foreign genes often does not occur. Moreover, although it is originally a soluble protein, due to the expression as a fusion protein with a tag, the originally soluble protein is often produced as an insoluble protein. Currently, analysis of the three-dimensional structure of various proteins produced in vivo is in progress, and it is desired that the protein is soluble for analysis processing. If a desired foreign protein is produced as an insoluble protein, it must be treated with high-concentration urea to solubilize it, and the three-dimensional structure of such treated protein may change. There is a risk that correct analysis results cannot be obtained.

  Accordingly, an object of the present invention is to provide an expression vector having a high expression efficiency of a foreign gene and a high probability that a foreign polypeptide produced in a host cell is produced as a soluble polypeptide, and a protein production method using the expression vector Is to provide.

  As a result of diligent research, the inventors of the present application adopt a HAT tag as a purification tag, and intervene a predetermined base sequence between an initiation codon and a HAT tag coding region to obtain a desired foreign polypeptide and The present inventors have found that the expression efficiency of the fusion protein with the tag is increased and the probability that a foreign polypeptide produced in the host cell is produced as a soluble polypeptide is increased, thereby completing the present invention.

  That is, the present invention is an expression vector including at least a promoter, a ribosome binding site, an initiation codon, a HAT tag coding region, and a cloning site for inserting a desired foreign gene from the upstream side, An expression vector comprising a region encoding an amino acid sequence consisting of 4 to 6 amino acids and having hydrophobic amino acids and polar amino acids alternately arranged between the HAT tag coding region and the HAT tag coding region is provided. The present invention also provides a method for producing a polypeptide, which comprises inserting a desired foreign gene into the expression vector of the present invention, expressing the foreign gene in a host cell, and collecting the produced polypeptide. I will provide a.

  The present invention provides a novel expression vector having high expression efficiency of a fusion protein of a desired foreign polypeptide and tag, and a high probability that a foreign polypeptide produced in a host cell is produced as a soluble polypeptide. It was. When a desired foreign gene is expressed using the expression vector of the present invention, since the expression efficiency is high, most foreign genes are expressed, and the working efficiency of protein analysis and the like can be increased. In addition, when a foreign polypeptide is produced in a host cell using the expression vector of the present invention, it is often produced as a soluble polypeptide as compared with the case where a commercially available expression vector is used. This is advantageous for analyzing a three-dimensional structure.

  As described above, the expression vector of the present invention includes, from the upstream side, at least a promoter, a ribosome binding site, an initiation codon, a HAT tag, and a cloning site for inserting a desired foreign gene. Each of these elements is well known and their base sequences are also well known, so that they can be easily chemically synthesized. In addition, since various expression vectors containing these are also commercially available, those contained therein can be used.

  Various promoters such as T7 promoter, lac promoter, trp promoter, tac promoter are well known, and any of these can be used. The base sequence from the upstream region to the terminator region of the promoter of the expression vector prepared in the following Examples is shown in SEQ ID NO: 1 in the Sequence Listing. The region from the 9th base (hereinafter referred to as “9nt”) to 27nt from the 5 ′ end of SEQ ID NO: 1 is the T7 promoter.

  There is a ribosome binding site downstream of the promoter. Ribosome binding sites themselves are well known, and 76 nt to 82 nt in SEQ ID NO: 1 are ribosome binding sites. The ribosome binding site is not limited to 76 nt to 82 nt in SEQ ID NO: 1, and other known ribosome binding sites similar to this can also be used. Further, as shown in SEQ ID NO: 1, an arbitrary spacer sequence is usually located between the promoter and the ribosome binding site. The length of this spacer is not particularly limited, but is usually about 10 to 100 bases, preferably about 30 to 70 bases.

  An initiation codon atg is located downstream of the ribosome binding position. An optional spacer sequence is usually located between the ribosome binding position and the initiation codon. The size of this spacer is usually about 3 to 15 bases, preferably about 5 to 10 bases.

  A region encoding the HAT tag (hereinafter sometimes referred to as a “HAT tag coding region” for convenience) whose reading frame coincides with the start codon is located downstream of the start codon. The HAT tag coding region itself is well known, and expression vectors containing it are also commercially available. In SEQ ID NO: 1, 109 nt to 165 nt is a HAT tag coding region. The HAT tag coding region can be chemically synthesized or cut out from a commercially available vector. Moreover, by performing PCR using a forward primer used for PCR with a HAT tag coding region added, the amplified fragment can contain the HAT tag coding region. In this case, PCR can be performed in several times, and the HAT tag coding region can be extended in several times (see Examples below).

  A cloning site for inserting a foreign gene is located downstream of the HAT tag coding region. The cloning site is a sequence having at least one restriction enzyme site therein, and preferably has a plurality of restriction enzyme cleavage sites commonly used in the field of genetic engineering. A region having a plurality of restriction enzyme cleavage sites is called a multicloning site, and any ordinary commercial expression vector contains a multicloning site. Also in the present invention, a known multicloning site can be preferably used. In the present invention, “gene” is used to include not only a natural gene but also cDNA and any nucleic acid having an artificially produced desired base sequence, and may be DNA or RNA. Usually, a nucleic acid amplified by a nucleic acid amplification method such as PCR is preferably used, but is not limited thereto.

  In the expression vector of the present invention, a region encoding an amino acid sequence consisting of 4 to 6 amino acids and having hydrophobic amino acids and polar amino acids alternately arranged between the initiation codon and the HAT tag coding region (hereinafter referred to as “ Which may be referred to as “alternating regions”). Here, “hydrophobic amino acid” is glycine, isoleucine, valine, leucine, alanine, methionine and proline, which are neutral amino acids having a low polarity side chain, and “polar amino acid” has a hydrophilic side chain. The neutral amino acids are asparagine, glutamine, threonine, serine, tyrosine and cysteine. Fusion of foreign gene products and HAT tags (and other tags and protease recognition sites, if any), by interposing this alternating region between the initiation codon and HAT tag coding region The protein expression efficiency increases, and the probability that the fusion protein is produced as a soluble protein increases. As a preferred example of the alternating region, a region encoding an amino acid sequence consisting of Ile Thr Pro Ser Leu (SEQ ID NO: 2) is preferred. Since there are many codons encoding one amino acid sequence, there are a plurality of base sequences encoding the amino acid sequence shown in SEQ ID NO: 2. As the base sequence encoding the amino acid sequence shown in SEQ ID NO: 2, attacaccaagttta (SEQ ID NO: 3) is most preferable. In this case, the codon encoding lysine at the N-terminal of the HAT tag is most preferably aaa. The expression efficiency is highest when the alternating region is the base sequence of SEQ ID NO: 3 and the codon encoding lysine at the N-terminal of the HAT tag is aaa. There is no spacer sequence between the start codon and the alternating region, and between the alternating region and the HAT tag coding region. SEQ ID NO: 27 shows the base sequence obtained by modifying the alternating region of the base sequence shown in SEQ ID NO: 1 and the N-terminal lysine codon of HAT tag coding region to aaa.

  The vector of the present invention preferably further comprises a fluorescent dye-binding site coding region encoding Cys-Cys-Pro-Gly-Cys-Cys (SEQ ID NO: 4) between the HAT tag coding region and the cloning site. . The amino acid sequence shown in SEQ ID NO: 4 is called a Lumio (trade name, Invitrogen) tag, and an expression vector containing this is commercially available from Invitrogen. The Lumio (trade name) tag emits fluorescence by binding to a compound represented by the following formula, which is commercially available under the trade name Lumio-Green Reagent (trade name, Invitrogen). Only this compound is present, and no fluorescence is emitted in the absence of the Lumio (trade name) tag. Accordingly, when a Lumio (trade name) tag is included in the produced polypeptide, fluorescence is emitted in the presence of the compound, so that the produced protein can be easily visualized and detected. In SEQ ID NO: 1, 178 nt to 195 nt is a fluorescent dye binding site coding region encoding a Lumio (trade name) tag. A spacer region is usually interposed between the HAT tag coding region and the fluorescent dye binding site coding region. The size of the spacer is not particularly limited, but is usually a size encoding an amino acid of about 3 to 6 amino acids.

  The expression vector of the present invention may further contain a region encoding a sequence-specific proteolytic enzyme recognition site. Examples of sequence-specific proteolytic enzymes include TEV protease, enterokinase, Factor Xa and thrombin. There may be a plurality of sequence-specific proteolytic enzyme recognition site coding regions. If the produced protein has a sequence-specific proteolytic enzyme recognition site, the fusion protein is purified and detected, and then treated with the sequence-specific proteolytic enzyme to bind to the above-mentioned HAT tag and fluorescent dye. A portion upstream of the target polypeptide including the site and the like can be cleaved and removed. The sequence-specific proteolytic enzyme recognition site coding region is located between the HAT tag coding region and the cloning site (or between the region and the multiple cloning site if a fluorescent dye binding site coding region is included). In SEQ ID NO: 1, 205nt to 225nt are TEV protease recognition sites, and 235nt to 249nt are enterokinase recognition sites. Between the HAT tag coding region (if there is a fluorescent dye binding site coding region) and the sequence-specific proteolytic enzyme recognition site coding region, and there are multiple sequence-specific proteolytic enzyme recognition site coding regions In general, a spacer region is interposed between them. The size of these spacers is not particularly limited, but is usually a size encoding about 3 to 6 amino acids.

  The base sequence of each spacer region described above is arbitrary, but it is set so that intramolecular hybridization does not occur (that is, the opposing bases do not become complementary when folded in half at any site). It is preferable to increase the expression efficiency.

  The nucleotide sequence of a specific example of a preferable expression vector designed as described above is shown in SEQ ID NO: 27 as described above, and among these, the region from the T7 promoter to the 3 ′ end of the enterokinase recognition site, An expression vector containing a region of 91 nt to 249 nt is particularly preferred. By including this region in the expression vector, the expression efficiency is particularly high, and the possibility that a foreign polypeptide is obtained as a soluble polypeptide is particularly high.

  In addition, although the above demonstrated the area | region from a promoter to a cloning site, the expression vector of this invention has the replication origin for enabling replication in a host cell like other expression vectors normally. . In addition, downstream of the cloning site, it usually has a terminator sequence that completely stops transcription. In the base sequence shown in SEQ ID NO: 1, 703nt to 746nt are T7 terminators. Furthermore, it usually contains a selection marker such as a drug resistance marker, a nutrient selection marker, and a temperature sensitive marker so that only cells in which the expression vector is incorporated into the cell can be selected. Each of these elements is well known and is included in any commercially available expression vector, and can be easily obtained from various commercially available products.

  The host of the expression vector of the present invention is not limited and may be any prokaryotic organism such as Escherichia coli or Bacillus subtilis, yeast, insect cell, plant cell, or mammalian cell. Of these, Escherichia coli having high production efficiency of the target polypeptide is preferable. An expression vector for E. coli contains an origin of replication that can replicate in E. coli, such as f1 origin, pBR322 origin, and the like. These origins of replication are well known and are included in any commercially available expression vector for E. coli. The expression vector may be used for a cell-free protein synthesis system. In this case, a replication origin is not particularly required. However, since the cell-free protein synthesis system can be used even if it has a replication origin, the replication origin is usually included in order to enhance the versatility of the expression vector.

  The method for producing a polypeptide using the expression vector of the present invention is exactly the same as various conventionally known expression vectors that are commercially available. That is, the expression vector and the foreign gene to be inserted are digested with the restriction enzyme of the restriction enzyme site contained in the cloning site, the plasmid is closed by annealing them, inserting the foreign gene into the cloning site, and treating with a ligase It can be. A host cell is transformed with the obtained recombinant vector by a conventional method, and the host cell is cultured to express a foreign gene to produce a desired polypeptide. Since the produced polypeptide has a HAT tag, it is passed through a Ni-immobilized column, adsorbed and recovered. When the recovered polypeptide has a fluorescent dye-binding site, it can be visualized with the above-described fluorescent dye, and when subjected to electrophoresis, the electrophoresis band can be clearly visualized. Furthermore, when having a recognition site for a sequence-specific protease, the target foreign protein can be obtained by treating with the protease to cleave and remove the tag portion. Alternatively, the resulting recombinant vector can be used to produce a foreign polypeptide in a cell-free (cell-free) protein synthesis system. A cell-free protein synthesis system has already been established, and a kit for that purpose is also commercially available.

  As described above, the method for inserting the foreign gene into the cloning site may be performed by a conventional method using a restriction enzyme and ligase. However, when the foreign gene is amplified by PCR, LIC is used. Preferably, the (ligation independent cloning) method is used. The LIC method itself is well known, and an expression kit using the LIC method is also commercially available (Novagen). The LIC method uses the single-stranded exonuclease activity of T4 DNA polymerase (the activity of cleaving one of the double strands from the 3 'end), so that the adhesion part is more than the normal restriction enzyme adhesive end. This is a method in which a long (ten bases) cohesive end is artificially created, an expression vector and a foreign gene are annealed, and then transformed directly into a host cell without a ligation reaction. That is, as a forward and reverse primer for amplifying a foreign gene by PCR, complementary to a partial region in the multicloning site of the expression vector on the 5 ′ side of the base sequence complementary to the foreign gene to be amplified. An oligonucleotide to which a base sequence (ten bases) is added (hereinafter referred to as “addition region”) is used. In the first cycle of PCR, each primer hybridizes with a portion complementary to the foreign gene to be amplified, which functions as a primer and causes elongation. At this time, the additional region does not hybridize with the foreign gene and remains single-stranded. However, since the DNA strand formed in the first cycle contains an additional region at the end, the additional region also functions as a template after the second cycle, and eventually each additional region is added to both ends of the foreign gene. Double stranded DNA fragments are obtained as amplification products. When this is treated with T4 DNA polymerase, one of the double strands is cleaved one base at a time from the end due to its exonuclease activity, and an adhesive end is formed. The treatment is performed under the condition that the single-stranded protruding region becomes 10 or more bases. On the other hand, the expression vector is also digested with an appropriate restriction enzyme and opened, and similarly treated with T4 DNA polymerase to prepare a sequence complementary to the additional region to be a single strand, and annealing these, A double-stranded closed plasmid is obtained. This closed plasmid is stable because the region where the expression vector and the insert fragment are hybridized is as long as several dozen bases, and can be used as it is for transformation or cell-free synthesis system without ligation reaction by ligase. be able to. In addition, after transformation, ligation occurs in the host cell by the natural ligase of the host cell, resulting in a completely closed double-stranded plasmid in which the DNA backbone is covalently bound. Use of the LIC method is convenient because a ligation reaction using ligase is not necessary. In the base sequence shown in SEQ ID NO: 1, the EcoT22I site (250 nt to 255 nt of SEQ ID NO: 1) is located immediately downstream of the enterokinase recognition site, and the NotI site is located from 593 nt to 600 nt. In the LIC vector shown in SEQ ID NO: 1, the vector is digested with restriction enzymes EcoT22I and NotI, and then opened and treated with T4 DNA polymerase as described above. Therefore, between the EcoT22I site and NotI site (256 nt of SEQ ID NO: 1) ˜592nt) is a region removed by EcoT22I-NotI treatment, and this portion may be an arbitrary sequence.

  Hereinafter, the present invention will be described more specifically based on examples. However, the present invention is not limited to the following examples.

Example 1
1. Construction of expression vector
(1) A commercially available vector, pET160-DEST (trade name, Invitrogen) is an expression vector for Escherichia coli, and contains a Lumio (trade name) tag coding region and a TEV protease recognition site used in this example. A portion from the immediately downstream of the 6xHis tag of pET160-DEST (trade name, Invitrogen) to the T7 terminator region was amplified by PCR (see FIG. 1). The forward primer used was tgtcctggctgttgcggtggcggcgaaaacctgtattttcag (SEQ ID NO: 5), and the reverse primer was aaggggttatgctagttattgctcagcggtggcagcag (SEQ ID NO: 6). PCR was performed by repeating 30 cycles of a denaturation step at 94 ° C. for 15 seconds, an annealing step at 50 ° C. for 30 seconds, and an extension step at 74 ° C. for 1 minute. A second PCR was performed using the obtained amplified fragment as a template. In the second PCR, an oligonucleotide having the base sequence shown in SEQ ID NO: 6 was used as the reverse primer, and acaacaagggtggtggtggctgttgtcctggctgtt (SEQ ID NO: 7) was used as the forward primer. The primer having the base sequence shown in SEQ ID NO: 7 has a region that does not hybridize with the template added to the 5 ′ side. When PCR is performed using such a forward primer, the resulting amplified fragment becomes a double-stranded DNA containing up to the 5 ′ end of the forward primer, so that the amplified fragment can be obtained by the first PCR. The obtained amplified fragment includes the forward primer used in the second PCR up to the 5 ′ additional region, and is extended to the 5 ′ side accordingly. And since this newly extended | extended area | region is set to the base sequence of the primer to chemically synthesize | combine, arbitrary base sequences can be extended to the 5 'side. Thereafter, the third, fourth and fifth PCRs are performed in the same manner, and the region including the spacer region, start codon, alternating region and HAT region upstream of the start codon is moved to the 5 ′ side by the second to fifth PCR. Finally, a fragment including the spacer region upstream from the start codon to the T7 terminator was amplified (see FIG. 2). The forward primers used in the third, fourth and fifth PCR are shown in SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, respectively. The reverse primer was the same as that used in the first PCR in all PCRs, and the PCR conditions were also the same as in the first time. Note that the initiation codon and three bases upstream thereof, that is, the catatg region is a restriction enzyme NdeI cleavage site. Each amplification product was used after purification by agarose gel electrophoresis (hereinafter the same).

(2) Using the double-stranded DNA amplified fragment obtained in (1) above as a template, a region from the 5 ′ end of the amplified fragment to a little downstream of the TEV protease recognition site coding region was amplified. At this time, a reverse primer was added with a region containing a BamHI site on the 5 ′ side of the reverse primer (see FIG. 3). The forward primer used in this case is shown in SEQ ID NO: 11, and the reverse primer is shown in SEQ ID NO: 12. The obtained amplified fragment was digested with NdeI and BamHI to obtain double-stranded DNA fragments having sticky ends at both ends by NdeI and BamHI digestion, respectively. The restriction enzyme digest was purified by agarose gel electrophoresis (hereinafter the same). On the other hand, a commercially available expression vector, pET-23b (trade name, Novagen) is an expression vector containing a T7 promoter, a ribosome binding site, a multicloning site (MCS), a T7 terminator, f1 origin, an ampicillin resistance gene, and the like. (See FIG. 4, MCS and its base sequence are shown in SEQ ID NO: 13). pET-23b (trade name, Novagen) was similarly digested with NdeI and BamHI, annealed with the above double-stranded DNA fragment, and ligated with T4 DNA ligase (see FIG. 3).

(3) The obtained recombinant vector was transformed into E. coli strain TOP10 (Invitrogen) by a conventional method, and seeded on an agar plate to form colonies. Plasmid DNA was recovered from the obtained transformant and confirmed to contain the intended base sequence by a DNA sequencer.

2. Inserting foreign genes
(1) Foreign gene was inserted by LIC method. That is, as a forward primer used when a foreign gene is amplified by PCR, cgggatccggatgacgacgacaagatgcat (SEQ ID NO: 5) is further added to the 5 ′ side of a 15 base pair region having the same base sequence as the 5 ′ end region of the foreign gene to be amplified. What added 14) was used. As the reverse primer, a primer obtained by further adding cgccggcgaagaggatgagctcgcc (SEQ ID NO: 15) to the 5 ′ side of a 13 base pair region having the same base sequence as the complementary strand of the 3 ′ end region of the foreign gene to be amplified was used. As a result, double-stranded DNA fragments having the nucleotide sequences shown in SEQ ID NO: 14 and SEQ ID NO: 15 added to both ends of the desired foreign gene were amplified. The forward primer used contains a BamHI site and an enterokinase recognition site, and the reverse primer contains an XhoI site and a NotI site. The obtained amplification product was digested with BamHI and XhoI, and both ends were used as adhesive ends.

(2) On the other hand, the expression vector prepared in 1 above was similarly digested with BamHI and XhoI, and the amplified fragment digested with BamHI and XhoI prepared in (2) above was annealed and ligated with T4 DNA ligase. Thus, a recombinant vector incorporating a foreign gene was obtained.

3. Production of foreign protein Using the obtained recombinant vector, a foreign protein was produced in a wheat germ cell-free synthesis system. For the wheat germ cell-free synthesis system, a commercially available kit (manufactured by Cell Free Science) was used, and the experimental operation was performed according to the instructions attached to the kit. The product was purified by agarose gel electrophoresis, and the band was detected with fluorescence using a Lumio tag (trade name). The protein expression efficiency can be generally known from the band intensity.

4). Elimination of the ribosome binding site in the TEV protease recognition site When the obtained recombinant vector was expressed in a cell-free synthesis system, it was found from the electrophoresis band that two types of proteins were produced. This shows that there is a ribosome binding site-like sequence in the TEV protease recognition site, which functions as a ribosome binding site and produces an undesired second protein whose downstream is the N-terminus. It was. Therefore, silent mutation was introduced into this part to eliminate an unwanted ribosome binding site. That is, tct of 217nt to 219nt in the base sequence shown in SEQ ID NO: 1 was changed to ttt, and gga of 223nt to 225nt was changed to tcc. As a result, the ribosome binding site in the TEV protease recognition site was eliminated, and the problem of producing unwanted proteins was solved. This silent mutation was specifically introduced as follows. Using the pre-mutation vector as a template, primers having 217 nt to 219 nt tct changed to ttt and 223 nt to 225 nt gga changed to tcc were prepared as shown below (the changed sequence corresponds to the underlined portion). For-1: 5'-ATATACATATGATTACGCCAAGCTTGAAGGATCATCTCATCCAC-3 '(SEQ ID NO: 28)
Rev-1: 5'-GCTCGAATTCGGATCCCG GGA CTG AAA ATACAGGTTTTCGCCGCCACCGCAACAGCCAGGACAACAGCC-3 '(SEQ ID NO: 29)
For-2: 5'-GGCGAAAACCTGTAT TTT CAG TCC CGGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCA-3 '(SEQ ID NO: 30)
Rev-2: 5'-GGTGGCAGCAGCCAACTCAGCTTCCTTTCGGG-3 '(SEQ ID NO: 31)
PCR was performed in pairs of (For-1, Rev-1) and (For-2, Rev-2) to obtain PCR fragments of fragment 1 and fragment 2, respectively. Furthermore, primers For-1 and Rev-2 and fragments 1 and 2 were added, and a second PCR was performed. The obtained fragment was treated with restriction enzymes NdeI and Bpu1102I on the insert side. Similarly, the pre-mutation vector was treated with restriction enzymes NdeI and Bpu1102I on the host side. The insert and host were annealed, transformed into E. coli Top10 (Invitrogen), and propagated to an agar plate. A colony formed by standing at 37 ° C. was further cultured overnight in 10 mL of LB medium, and a plasmid was extracted therefrom. After extraction, the sequence was confirmed by a DNA sequencer (ABI3700). The nucleotide sequence from the vicinity of the T7 promoter to the T7 terminator of the obtained recombinant vector is shown in SEQ ID NO: 1.

Example 2 Improvement of Expression Efficiency by Silent Mutation of Alternating Regions Although the expression vector obtained in Example 1 has sufficient expression efficiency by itself, the aim is to further improve the expression efficiency. Various silent mutations were introduced into the region encoding lysine at the 5 ′ end of the HAT tag, and the expression efficiency was compared. The introduced silent mutation is shown in FIG. These silent mutations were introduced by modifying the base sequence of the forward primer used in Example 1 (1) to include the sequence shown in FIG. As a result of protein synthesis in a wheat germ cell-free synthesis system, agarose gel electrophoresis, and band detection using a Lumio tag (trade name), S1 shown in FIG. 5 has the highest band intensity and expression level. It was confirmed that there are many. That is, the expression level was the highest when the alternating region was the base sequence of SEQ ID NO: 3 and the codon encoding lysine at the N-terminal of the HAT tag was aaa. Therefore, in the following experiment, an expression vector having the base sequence of S1 shown in FIG. 5 was used. The base sequence of this expression vector is shown in SEQ ID NO: 27.

Example 3 Production of various foreign proteins The recombinant vector prepared in Example 2 was treated with BamHI and XhoI to cut out foreign genes, and other various foreign genes were inserted into this part to produce foreign proteins. . The recombinant vectors prepared in Examples 1 and 2 are so-called LIC vectors that can be easily subjected to the LIC method. That is, when expressing other foreign genes, the above recombinant vector is digested with BamHI and XhoI to remove the original foreign gene contained in the recombinant vector and treated with T4 DNA polymerase. As a primer for amplifying a new foreign gene to be amplified by PCR, the double-stranded portion at both ends is digested by the exonuclease activity to project a single-stranded portion of more than a dozen bases. 14 and SEQ ID NO: 15 or a partial region thereof is amplified using a primer added to the 5 ′ end of each of the forward and reverse primers, and treated with T4 DNA polymerase to protrude a single strand at the end. And annealing them, a stable recombinant vector hybridized with a size of dozens of bases can be obtained. This can be directly used for transformation or cell-free protein synthesis system without performing ligation reaction. The LIC method was performed according to a conventional method described in the package insert of a kit for this purpose, which is commercially available from Novagen. The amplified fragment does not need to have a BamHI site and an Xho site unlike the case of creation of the LIC vector described above, and therefore, the forward primer is the same as the 15 base region of the 5 ′ terminal region of the foreign gene to be amplified. The oligonucleotide having a sequence having a 5 'end added with gac gac gac aag atg (SEQ ID NO: 25) is used, and the reverse primer is the same as the 13 bases of the complementary strand of the 3' end region of the foreign gene to be amplified An oligonucleotide having tc ctc ttc gcc gga aat (SEQ ID NO: 26) added to the 5 ′ end of the oligonucleotide having the sequence of: The amplified fragment and the vector digested with BamHI and XhoI were treated with T4 DNA polymerase in the presence of 0.1% bovine serum albumin (BSA) and 1.7 mM dTTP, respectively (5 min at 0 ° C, 5 min at 37 ° C). Each single strand was projected. These were then annealed to obtain a closed recombinant vector. This recombinant vector was directly subjected to a wheat germ cell-free synthesis system without performing a ligation reaction to produce a foreign protein.

  By this method, dozens of foreign genes were expressed, and it was examined whether or not a protein was produced, and if produced, it was produced as a soluble protein. Table 1 below shows the GenBank accession number of the expressed foreign gene, the sequence number in the sequence listing describing the base sequence and amino acid sequence of the gene, and the region in each foreign gene expressed in this experiment. In Table 1, the column of “base sequence of expressed region” is a sequence number describing the base sequence of the full length of the original gene, the region expressed in this experiment in the base sequence, and necessary Accordingly, the stop codon added to the region is indicated. For example, No. 1 shows that a sequence in which the stop codon TAA is added to the region from the 245th base to the 895th base of SEQ ID NO: 32 is expressed. Similarly, the column “amino acid sequence of expressed region” indicates that, for example, in No. 1, the region from amino acid 15 to amino acid 231 in SEQ ID NO: 33 was expressed.

  As a result of the above production experiment, 57 types out of 65 types of foreign proteins were produced (88%). Of 65 types, 39 types were produced as soluble proteins (60%).

Comparative Example 1
For comparison, various commercially available expression vectors (pET-19b, pET-11d, pET-15b, pET-21a and pET-28a (from Novagen)), (pET-160 (Invitrogen)), and Using pGEX-1, pGEX-2T, pGEX-4T2 and pGEX-6P (manufactured by GE Healthcare), foreign genes were incorporated into their MCS by a conventional method, and protein was produced in the same synthetic system as above. As a result, 20 out of 86 foreign proteins were produced (23%).

  From these results, the expression vector of the present invention has clearly higher expression efficiency than the commercially available expression vector (that is, many kinds of foreign polypeptides can be produced), and the probability of being produced as a soluble polypeptide is also high. It became clear that it was obviously higher.

In the Example of this invention, it is a figure which shows the gene map and partial base sequence of commercially available expression vector pET160-DEST (trade name, Invitrogen) which cut out fluorescent dye binding site coding region, TEV protease recognition site, etc. In the Example of this invention, it is a figure for demonstrating PCR method which amplifies the DNA fragment containing an alternating region, a HAT tag coding region, a fluorescent dye binding site coding region, a TEV protease recognition site, etc. In Examples of the present invention, PCR for amplifying a DNA fragment containing an alternating region, a HAT tag coding region, a fluorescent dye binding site coding region, a TEV protease recognition site, and the like, and an amplified fragment obtained by the PCR, a commercially expressed It is a figure for demonstrating the method of incorporating in vector pET-23b (brand name, Novagen). It is a figure which shows the gene map of the commercially available expression vector pET-23b (brand name, Novagen) used in the Example of this invention, and the base sequence of the multicloning site vicinity. It is a figure which shows the various silent mutation put into the alternating region of the expression vector produced in the Example of this invention, and the codon of the lysine of the N terminal of HAT tag.

Claims (13)

  From the upstream side, an expression vector comprising at least a promoter, a ribosome binding site, an initiation codon, a HAT tag coding region, and a cloning site for inserting a desired foreign gene, wherein the initiation codon and the HAT tag coding region An expression vector comprising a region encoding an amino acid sequence consisting of 4 to 6 amino acids, wherein hydrophobic amino acids and polar amino acids are alternately arranged.   The expression vector according to claim 1, wherein the amino acid sequence consists of 5 amino acids.   The expression vector according to claim 2, wherein the amino acid sequence is Ile Thr Pro Ser Leu.   The expression vector according to claim 3, wherein the base sequence encoding the amino acid sequence is attacaccaagttta.   The expression according to any one of claims 1 to 4, further comprising a fluorescent dye-binding site coding region encoding Cys-Cys-Pro-Gly-Cys-Cys between the HAT tag coding region and the cloning site. vector.   The expression vector according to any one of claims 1 to 4, further comprising a region encoding a sequence-specific proteolytic enzyme recognition site between the HAT tag coding region and the cloning site.   The expression vector according to claim 6, wherein the sequence-specific proteolytic enzyme recognition site is a TEV protease recognition site and / or an enterokinase recognition site.   From the upstream side, a promoter, a ribosome binding site, an initiation codon, a region directly coding for the amino acid sequence consisting of Ile Thr Pro Ser Leu directly linked to the initiation codon, a HAT tag directly linked to the region, and Cys-Cys- The expression vector according to claim 1, comprising a fluorescent dye binding site coding region encoding Pro-Gly-Cys-Cys, a TEV recognition region, an enterokinase recognition region, a multicloning site, and a terminator.   The expression vector according to claim 8, wherein the base sequence encoding the amino acid sequence is attacaccaagttta and the codon encoding the N-terminal lysine of the HAT tag is aaa.   10. A spacer region is interposed between the HAT tag, a fluorescent dye binding site coding region, a TEV recognition region, and an enterokinase recognition region, respectively, and the spacer region has a base sequence that does not cause intramolecular hybridization. The expression vector described.   The expression vector according to claim 10, comprising a region of 91nt to 249nt in the base sequence represented by SEQ ID NO: 27.   The expression vector according to any one of claims 1 to 11, wherein Escherichia coli is used as a host. A desired foreign gene is inserted into the expression vector according to any one of claims 1 to 12, the foreign gene is expressed in a host cell or in a cell-free synthesis system, and the produced polypeptide is recovered. A method for producing a polypeptide, comprising: