JP2008104461A - Multicolor fluorescent protein including fluorescent color of ultra-long wavelength - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To obtain a fluorescent protein emitting a plurality of fluorescences including fluorescence of ultra-long wavelength (red fluorescence), having a big difference between an exciting wavelength and a fluorescent wavelength and is excited even by a light of relatively long wavelength. <P>SOLUTION: The multicolor fluorescent protein is a fluorescent protein being a natural type fluorescent protein derived from Scleronephthya gracillima (Kuekenthal) or obtained by application of gene recombination and exhibits a plurality of fluorescent colors identifiable in a visible region according to an exciting wavelength. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to a fluorescent protein, and more particularly to a novel fluorescent protein capable of emitting a plurality of fluorescence including ultra-long wavelength fluorescence.

Fluorescent proteins play an important role in research fields such as biochemistry, biology, and medicine as markers for labeling cells and other proteins.
Many of the fluorescent proteins such as GFP (Green Fluorescent Protein) that are currently widely used emit fluorescence having a wavelength close to the wavelength of excitation light. If the difference between the excitation wavelength and the fluorescence wavelength (Stokes shift) is large, a clear image with little influence of the background due to the excitation wavelength can be obtained. Red fluorescence is long-wavelength fluorescence, which is preferable because it increases the difference from the excitation wavelength, but there are few fluorescent proteins that can emit red fluorescence. As for the excitation wavelength, excitation with short wavelength light may damage live cells and the like. Furthermore, if a single fluorescent protein can emit a plurality of fluorescences having different colors, there is an advantage that a plurality of reactions can be simultaneously analyzed with multiple fluorescent colors, but there are few fluorescent proteins suitable for this purpose.

  The object of the present invention is to generate ultra-long wavelength fluorescence, that is, multiple fluorescence including red fluorescence, and there is a large difference between excitation wavelength and fluorescence wavelength, and it is also excited by relatively long wavelength light. It is to provide a new fluorescent protein capable of

  As a result of extensive research, the present inventor has found that fluorescent proteins are present in marine organisms, such as soft corals (Scleronephthya gracillima (Kuekenthal)), and performed separation, purification, electrophoresis and LC / MS / MS. The partial amino acid sequence was determined by the method. Based on this information, the inventors succeeded in expressing a novel fluorescent protein by gene recombination and derived the present invention.

Therefore, according to the present invention, the following fluorescent proteins and DNA are provided.
1. A multi-color fluorescent protein that emits a plurality of fluorescent colors that can be identified in the visible range according to an excitation wavelength.
2. 2. The fluorescent protein according to 1 above, which emits orange fluorescence, green fluorescence, blue fluorescence and / or purple fluorescence in addition to red fluorescence.
3. 3. The fluorescent protein according to 1 or 2 above, wherein the fluorescent protein is a natural fluorescent protein derived from soft coral (Scleronephthya gracillima (Kuekenthal)) or a fluorescent protein obtained by genetic recombination.
4). 4. The fluorescent protein according to any one of the above 1 to 3, which represents a difference between an excitation wavelength and a fluorescence wavelength and has a Stokes shift of at least 45 nm.
5. 5. The fluorescent protein according to any one of 1 to 4, which emits fluorescence having a maximum fluorescence wavelength within a range of 400 to 680 nm when excited at an excitation wavelength of 298 nm.
6). 5. The fluorescent protein according to any one of 1 to 4, which emits fluorescence having a maximum fluorescence wavelength in a range of 400 to 680 nm when excited at an excitation wavelength of 436 nm.
7). 5. The fluorescent protein according to any one of 1 to 4, which emits fluorescence having a maximum fluorescence wavelength within a range of 400 to 680 nm when excited at an excitation wavelength of 564 nm.
8). (A) the amino acid sequence represented by SEQ ID NO: 1, 2, 3, 4, 5, 6 or 7, or (b) 1 to 25 amino acids deleted in the amino acid sequence represented by SEQ ID NO: 4, A fluorescent protein comprising a substituted or added amino acid sequence and emitting at least red fluorescence.
9. (A) the amino acid sequence represented by SEQ ID NO: 1, 2, 3, 4, 5, 6 or 7, or (b) 1 to 25 amino acids deleted in the amino acid sequence represented by SEQ ID NO: 4, A DNA comprising a substituted or added amino acid sequence and encoding a fluorescent protein emitting at least red fluorescence.
10. A protein having a molecular weight of 17 to 28 kDa comprising an amino acid sequence comprising any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6 or 7 and having a wavelength of at least 400 to 680 nm when excited at an excitation wavelength of 298 nm A multicolor fluorescent protein characterized by emitting a plurality of fluorescent colors.

  (1) The fluorescent protein of the present invention emits red fluorescence in the wavelength range of 600 to 700 nm, and the Stokes shift (difference between the maximum fluorescence wavelength and the maximum excitation wavelength) is generally at least about 50 nm, and the Stokes shift is about 370 nm. Some will reach Thus, when the fluorescent protein of the present invention is used as a fluorescent marker, a clear imaging image in which the fluorescence spectrum and the excitation spectrum do not overlap can be obtained.

  (2) The fluorescent protein of the present invention can be excited at a wavelength longer than the ultraviolet region or the vicinity thereof used in conventional fluorescent proteins, for example, at the maximum excitation wavelengths of 436 nm and 564 nm. Since excitation light having a long wavelength can be used in this way, there is an advantage that there is little influence on a labeled sample such as a living cell.

  (3) The fluorescent protein of the present invention can emit fluorescence of a plurality of colors such as orange fluorescence, green fluorescence, blue fluorescence and purple fluorescence in addition to red fluorescence. Therefore, when the fluorescent protein of the present invention is used as a marker, it is possible to perform a multicolor analysis, a multicolor imaging image, or the like by simultaneously sensing a plurality of reactions with a multicolor fluorescent color by giving one excitation wavelength.

  (4) Since the fluorescent protein according to the present invention can emit a multi-color fluorescence wavelength by being excited at one excitation wavelength, it can be applied as a multi-color fluorescent biological element.

  (5) Using the genes akane, akane1, akane2, akane3 (SEQ ID NOs: 4, 5, 6 and 7) according to the present invention to produce a fusion protein with the target protein, FRET (Fluorescence resonance energy transfer: (Fluorescence resonance energy transfer method).

  The fluorescent protein of the present invention is a natural fluorescent protein from soft coral (Scleronephthya gracillima (Kuekenthal)) and its partial amino acid sequence obtained by separating and purifying it, and obtained as a recombinant protein by genetic recombination based on that information It is. In the following description, as a general term for the fluorescent protein of the present invention, and for the specific sequence of the natural type and the gene recombinant, the name akane (茜) is used, and it is particularly necessary to distinguish (for example, Add numbers such as akane1, akane2, and akane3 to the mutant.

  Such fluorescent proteins include fluorescent proteins that exhibit multiple fluorescent colors that can be distinguished in the visible range depending on the excitation wavelength, more specifically, for example, 400-680 nm when excited at 298 nm. Fluorescence having a peak in the range, more particularly in the range of 620 to 680 nm (eg 664 nm), in the range of 400 to 680 nm when excited at 436 nm or 564 nm (eg 475 nm when excited at an excitation wavelength of 436 nm, and Fluorescent proteins were found to fluoresce at 506 nm and include fluorescent proteins that exhibit fluorescence having one or more fluorescence wavelengths at 612 nm or 628 nm when excited at 564 nm.

Specifically, (a) the amino acid sequence represented by SEQ ID NO: 4 or (b) the amino acid sequence represented by SEQ ID NO: 4 in which 1 to 25 amino acids are deleted, substituted or added And a fluorescent protein characterized by emitting at least red fluorescence. Sequences similar to the amino acid sequence represented by SEQ ID NO: 4 include, for example, SEQ ID NOs: 5, 6, and 7, and more specifically, the sequences represented by SEQ ID NOs: 4, 5, 6 and 7, or these Amino acid sequences in which one to several amino acids are deleted, substituted or added in the sequence are included. Here, the term “several” means 10 or less, more specifically 6 or less, and more specifically 4 or less.
Moreover, according to the present invention, a fluorescent protein having a Stokes shift of 45 nm or more is provided. The upper limit of the Stokes shift is not particularly limited, but is typically in the range of 50 nm to 450 nm, and a Stokes shift in the range of 100 to 400 nm can be realized.

  Furthermore, the fluorescent protein of the present invention is a protein having a molecular weight of 17 to 28 kDa consisting of an amino acid sequence containing any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6 or 7, and when excited at an excitation wavelength of 298 nm. A multi-color fluorescent protein characterized by emitting a plurality of fluorescent colors in the range of at least 400 to 680 nm.

  The present invention also relates to a protein having a molecular weight of 17 to 28 kDa consisting of an amino acid sequence comprising any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6 or 7, and a soft coral (Scleronephthya gracillima (Kuekenthal)). And a protein characterized by acting primarily as an allergen of asthmatic allergy in humans.

Analysis of natural protein (first form)
The process and results of an analysis for identifying a natural fluorescent protein derived from soft coral (Scleronephthya gracillima (Kuekenthal)) will be described.
First, as extraction and purification of a sample from homogenization treatment to a crude antigen, soft coral was homogenized in a 10 mM PBS solution, and the extract was centrifuged, and 80% saturated ammonium sulfate precipitation was performed. After dialysis, a solution obtained by freeze-drying the solution was used as a crude sample.

  The sample at this stage was electrophoresed on a 15% polyacrylamide gel by SDS-PAGE, and then a CBB-stained protein band with a molecular weight of about 21 kDa was excised, and this sample was subjected to gel decolorization, reductive alkylation of cysteine residues, Gln-Ser-Phe-Pro-Glu-Gly-Phe-Ser was analyzed by gel washing, trypsin digestion, peptide fragment extraction, vacuum drying, dissolution in sample solution, and LC / MS / MS. An amino acid sequence of -Trp-Glu-Arg (SEQ ID NO: 1) was obtained.

(Second form)
As in the first embodiment, the process and results of an analysis for identifying a natural fluorescent protein derived from soft coral (Scleronephthya gracillima (Kuekenthal)) will be described.
First, as extraction and purification of a sample from homogenization treatment to a crude antigen, soft coral was homogenized in a 10 mM PBS solution, and the extract was centrifuged, and 80% saturated ammonium sulfate precipitation was performed. After dialysis, a solution obtained by freeze-drying the solution was used as a crude sample.

  A solution obtained by dissolving the crude extract sample in distilled water is applied to a gel filtration column (Sephadex-75), several samples having a large amount of protein therein are concentrated, and further applied to an anion column (Q-Sepharose High Performance). After eluting with (0.1-0.5N) -NaCl in 10 mM Tris HCl buffer (pH 8.5), the fractionated sample was electrophoresed by SDS-PAGE, and then a CBB-stained protein band having a molecular weight of about 27 kDa was excised. This sample was subjected to gel decolorization, reductive alkylation of cysteine residues, gel washing, trypsin digestion, peptide fragment extraction, drying under reduced pressure, dissolution in sample solution, and mass spectrometry by LC / MS / MS. As a result, an amino acid sequence of Tyr-Pro-Ala-Asp-Ile-Pro-Asp-Tyr-Phe-Lys (SEQ ID NO: 2) was obtained.

(Third form)
As in the second embodiment, the process and results of an analysis for identifying a natural fluorescent protein derived from soft coral (Scleronephthya gracillima (Kuekenthal)) will be described.
Soft coral is homogenized in a 10 mM PBS solution, and the extract is centrifuged, 80% saturated ammonium sulfate is precipitated, the precipitated protein is dialyzed through a dialysis membrane, and then the solution is freeze-dried as a crude sample. did.

A solution obtained by dissolving the crude extracted sample in distilled water is applied to a gel filtration column (Sephadex-75), and it is run with 10 mM PBS (pH-7.5). The amount of protein in all fractions is measured with a spectrophotometer wavelength of 280 nm. did. The fraction with high absorbance is collected, concentrated, then applied to an anion column (Q Sepharose High Performance) and eluted with (0.1N-0.5N) -NaCl in 10 mM Tris HCl buffer (pH-8.5) for separation and purification. Thereafter, the eluted fraction was concentrated. The fractionated sample was analyzed by LC / MS / MS method for an approximately 18 kDa protein in a protein band stained with CBB after electrophoresis on a 15% polyacrylamide gel.
For the approximately 18 kDa protein, Thr-Met-Thr-Tyr-Glu-Asp-Lys-Gly-Ile-Cys-Thr-Ile-Arg (SEQ ID NO: 3) was obtained as the amino acid sequence.
Next, the production of the recombinant protein performed based on the above data will be described.

Production of recombinant protein (1) RNA was prepared using RNA isolation kit (Gentra). 100 mg of soft coral (Scleronephthya gracillima (Kuekenthal)) was placed in 1.2 ml of cell lysis solution and homogenized. To this, 400ul of Protein-DNA precipitation solution was added and mixed by inversion 10 times. To the supernatant obtained by centrifugation at 15000 rpm for 5 minutes, 1.2 ml of isopropanol was added and mixed 50 times. This was centrifuged at 15000 rpm for 5 minutes to precipitate RNA. Thereafter, the precipitate was washed with 70% ethanol and then dried. From 100 ug of the obtained total RNA, 70 ng of poly (A) + RNA was obtained using an mRNA purification kit. cDNA was performed using SMART RACE cDNA amplification kit.

(2) Among the amino acid sequences determined by mass spectrometry, gene-specific primer DnippoFP5 (GCCNGAYYTNCCCNGAYTAYTTYAA) was created based on ADLPDYFK. 3'RACE was performed using Universal primer mix attached to this primer and kit as a primer and Advantage 2 polymerasse (Clontech) as an enzyme. The PCR cycle was 94 ° C., 1′-57 ° C., 30 ″ -72 ° C., 2 ′ 35 times. The amplified 700 bp band is the QIAEX II DNA
After purification using extraction kit (Qiagen), ligation into pCR4-topo vector and transformation into competent cell TOP10. This was sequenced using DYEnamic ET sequencing kit (Amersham Bioscience).

(3) After preparing primer FP5-RACE (GCTTTTCCCTTGAGCCCTCACTCT) from the determined base sequence, 5′RACE was performed under the same conditions as 3′RACE. The nucleotide sequences obtained by both RACEs were linked to form a fluorescent protein cDNA.

(4) Primers AgFP5Ex (CACCCATGAATCCGATTAAAGAAGA) and AgFP3Ex (CTACCTGGCCTGACTGGGCACCAA) were prepared based on the determined base sequence. Using the 5′RACE product linked to the plasmid as a template, the translation sequence was amplified using Advantage 2 polymerase. PCR cycles were 94 ° C, 1'-60 ° C, 30 ''-72 ° C, 2 '20 times. The obtained sequence was inserted into the pET100 / D-TOPO vector. The recombinant protein is expressed with a histidine tag added to the N-terminus. This was transformed into E. coli BL21 (DE3). Protein expression was performed using 100 &micro; g / ml ampicillin TB medium at 25 ° C. and inducing protein expression in the presence of 1 mM isopropylthiogalactoside.

(5) After collecting E. coli by centrifugation, the suspension was suspended in 50 mM Tris-HCl, pH 8.0, 0.5 M-NaCl, ultrasonically disrupted, and centrifuged to obtain a crude extract. Thereafter, the buffer was changed to 50 mM Tris-HCl, pH 8.5 by HiTrap Desalting (Amersham Bioscience). The obtained protein fraction was eluted with a NaCl concentration gradient using Resource Q (Amersham Bioscience).

(6) FIG. 1 shows the entire amino acid sequence (SEQ ID NO: 4) of the recombinant fluorescent protein of the present invention [named Akane (茜)] determined as described above. The presence of three types of amino acid sequences (SEQ ID NOs: 1 to 3) obtained from proteome analysis is observed. In addition, the presence of a sequence forming a chromophore was also confirmed.

In order to clarify the characteristics of the fluorescent protein of the present invention more specifically, a fluorescence measurement performed by comparing a natural fluorescent protein derived from a soft coral (Scleronephthya gracillima (Kuekenthal)) with a recombinant fluorescent protein. The results are shown as examples. The apparatus used is a fluorescence spectrophotometer (RF-5300 manufactured by Shimadzu Corporation).
As is well known, differences in the excitation wavelength and fluorescence wavelength in fluorescence measurements due to differences in experimental conditions and equipment used are recognized. Therefore, it should be understood that the excitation wavelength and the fluorescence wavelength shown in the claims, the specification, and the drawings of the present application may generally include an error of about ± 5 nm. In this measurement, the bandwidth settings are set to EX: 5.0 nm and EM: 5.0 nm.

<Natural fluorescent protein>
Samples of native fluorescent protein were prepared as follows, as before:
Soft coral was homogenized in 10 mM PBS solution, 3 times the amount of the sample, and the extract was centrifuged at 4 ° C, 10,000 rpm for 30 minutes, and 80% saturated ammonium sulfate precipitation was performed.
Dialyzed by cut off). The dialyzed solution was freeze-dried overnight and used as a crude sample. This crude extract sample was applied to a gel filtration column (Sephadex-75), then an anion column (Q Sepharose High Performance), and it was run in 10 mM Tris-HCl buffer (pH 8.5). Then, the amount of protein was measured at a wavelength of 280 nm of a spectrophotometer (0.1 M to 0.5 M NaCl). The fraction with high absorbance of the protein was further separated and purified, and the eluted fraction was concentrated with an ultrafilter. When staining was performed after SDS-PAGE electrophoresis on a 15% polyacrylamide gel, protein bands with molecular weights of 27 kDa and 21 kDa were obtained in the natural sample (2-10) and the recombinant-type sample.

<Gene recombinant fluorescent protein>
For the recombinant fluorescent protein sample, replace the purified recombinant protein with HiPrep Desalting 26/10 (Amersham Bioscience), 50 mM Tris-HCl, pH 8.5 for buffer exchange. And then using an anion exchange column, Resource Q (Amersham Biosciences), 50 mM Tris-HCl, pH 8.5, 0-1M
Prepared by elution with a NaCl gradient. The flow rate was eluted at 1 ml / min and each fraction was monitored at Abs. 280 nm.

<Fluorescence measurement>
The result of the fluorescence measurement is shown in FIG. In a recombinant fluorescent protein (indicated as “recombinant-type” in FIG. 2), when excited at a (maximum) excitation wavelength of 298 nm as shown in FIG. A fluorescence spectrum is obtained.
Fr (2-10) and Fr (2-12) are anion columns and the buffer is a sample obtained by separating and purifying from natural soft coral (shown as native-type in Fig. 2). , A fraction obtained by elution with 10 mM Tris 0.1N-NaCl. Similarly, when excited at an excitation wavelength of 298 nm, fluorescence wavelengths of 668 to 669 nm were obtained.
Thus, the fluorescent protein of the present invention obtained from soft coral emits an ultra-long wavelength fluorescence spectrum, and the difference between the (maximum) excitation wavelength and the (maximum) fluorescence wavelength is close to 370 nm. It is understood that it is excellent.
In all fluorescence spectra, a strong peak appears at the excitation wavelength of 298 nm and twice the excitation wavelength (596 nm: secondary excitation wavelength), but usually the primary excitation wavelength and the secondary excitation wavelength. These occur at wavelengths and are not peaks in the fluorescence spectrum to be measured.

The native-type sample (Fr. 2-10) used in Example 1 was excited at an excitation wavelength of 564 nm. The result of the fluorescence measurement is shown in FIG. As shown in FIG. 3, a fluorescence spectrum having a maximum fluorescence wavelength at 628 nm was obtained.
Next, when the excitation spectrum was measured using 628 nm as the fluorescence wavelength, an excitation spectrum having a maximum excitation wavelength at 571 nm was obtained. A spectrum with very good symmetry between the maximum fluorescence spectrum and the excitation spectrum was observed. Red Fluoresent Protein (RFP) having a long fluorescence wavelength of 628 nm was obtained. Furthermore, the natural fluorescent protein containing this RFP is named (Akane (茜)), but the Stokes shift (difference between the maximum fluorescence wavelength and the maximum excitation wavelength) of this Akane (と) is 57 nm, which is the conventional RFP fluorescent protein. This shows a large Stokes shift, which is very easy to see when the cell is expressed by incorporating this (Akane (茜)) into the gene, with little influence of the background due to the excitation wavelength. The advantage is that a fluorescent image can be provided. Furthermore, by setting the excitation wavelength to 564 nm, when the present fluorescent protein is incorporated into a living cell, the influence on the living cell is reduced.

Recombinant-type (genetically modified fluorescent protein) (also named Akane (茜)) sample is also desalted, applied to an anion exchange column, and excited at an excitation wavelength of 564 nm. (FIG. 4), and a fluorescence characteristic with a large Stokes shift (48 nm) was confirmed. Although not shown in FIG. 4, when excited at 564 nm, it is recognized that orange fluorescence at 576 nm is also emitted.
In the Recombinant sample, after purification, the solution obtained immediately was diluted 120 times with pure water, and then the fluorescence spectrum was measured. A fluorescence spectrum having an excitation wavelength of 564 nm and a maximum fluorescence wavelength of 612 nm was obtained (solid line in FIG. 4). Further, after 18 days, the fluorescence spectrum was measured under the same conditions as above (dotted line in FIG. 4). The maximum fluorescence wavelength was 612 nm, the fluorescence intensity was 47/52, about 93%, and the fluorescence spectrum pattern did not change. Recombinant samples have been shown to provide a stable and continuous red fluorescent protein.

  When the natural type sample (Fr 2-10) was excited at an excitation wavelength of 436 nm, fluorescence was observed at 475 nm (cyan) and 506 nm (green). Again, large Stokes shifts (39 nm) and (70 nm) were obtained.

  When a natural type sample (Fr 2-10) was excited at 472 nm, it was observed that strong fluorescence of three wavelengths was emitted simultaneously at wavelengths of 508 nm, 558 nm and 624 nm.

  A natural fluorescent protein was obtained from another individual's soft coral (Scleronephthya gracillima (Kuekenthal)) in the same manner as in Example 1. The natural fluorescent protein was purified with a gel filtration column and then separated with anion column fractions 3-6, 3-5, 3-7, 3-8, 3-9 (in the figure, a, b, c respectively) , D, and e), each was excited at an excitation wavelength of 298 nm. The results are shown in FIG. At the same time, 660 nm (red fluorescence), 628 nm (red fluorescence), 570 nm (orange fluorescence), 505 nm (green fluorescence), 480 nm (blue fluorescence), and further 430 nm (purple fluorescence) can also be found as fluorescence wavelengths.

When a natural type sample (Fr 2-10) was excited at 472 nm, it was observed that strong fluorescence of three wavelengths was emitted simultaneously at wavelengths of 508 nm, 558 nm and 624 nm.

  FIG. 6 shows the fluorescence spectrum when the akane gene recombinant was excited at an excitation wavelength of 564 nm. A plurality of colors of fluorescence wavelengths are emitted at 577 nm, 612 nm, and 673 nm. Further, fluorescence is seen at 419 nm although the shoulder has a slight intensity.

As PCR primers, Primer 1 (CCTTCTGGAGAGAAGACGTGAATACAGC) and Primer 2 (TGAGCCTCTACCTGGCCTGACTGG) were prepared from the previously determined akane cDNA sequence.
Amplification of the fluorescent protein gene was performed using Advantage 2 polymerase (BD) based on the prepared cDNA. The amplified PCR product was ligated to plasmid pCR4 and then transformed into competent cell DH5α. After preparing a plasmid from the colony, the base sequence was determined using BigDye terminater DNA sequencing kit (Applied Biosystems).
PCR
The PCR product amplified by was a single band of 850 bp. When the nucleotide sequence of 75 clones obtained by transforming this plasmid after ligation was determined, about half of the clones were akane, but another sequence was found from the remaining clones. These (SEQ ID NOS: 5 to 7) were named akane 1, akane 2, and akane 3. These sequences were very similar to the akane sequence and contained one chromophore. These sequences are shown in comparison with FIG. 7 and FIG.

2 shows the entire amino acid sequence (SEQ ID NO: 4) of the fluorescent protein (akane) of the present invention. It is a fluorescence spectrum characteristic view when the fluorescent protein of the genetic recombinant of the present invention and the fluorescent protein of the natural type (Scleronephthya gracillima (Kuekenthal) body color light brown) are respectively excited at an excitation wavelength of 298 nm. It is a fluorescence spectrum characteristic view at the time of exciting the natural fluorescent protein derived from the soft coral according to the present invention at 564 nm. FIG. 5 is a fluorescence spectrum characteristic diagram when the gene recombinant fluorescent protein of the present invention is excited at 564 nm, and a fluorescence spectrum characteristic diagram in which the same gene recombinant fluorescent protein is excited at 564 nm after 18 days. It is a fluorescence spectrum characteristic view when the natural type (akane) fluorescent protein of the present invention is excited at an excitation wavelength of 298 nm. (Soft coral (Scleronephthya gracillima (Kuekenthal)) body color purple) It is a fluorescence spectrum characteristic figure at the time of exciting the fluorescent protein of the gene recombinant (akane) of this invention by excitation wavelength 564nm. The figure which contrasted and showed the amino acid sequence of akane, akane1, akane2, and akane3 in Example 8 (each block is the order of akane, akane1, akane2, and akane3 from the top, and the amino acid different from the sequence of akane is enclosed in a square. ).

Claims (10)

  A multi-color fluorescent protein that emits a plurality of fluorescent colors that can be identified in the visible range according to an excitation wavelength.   The fluorescent protein according to claim 1, which emits orange fluorescence, green fluorescence, blue fluorescence and / or purple fluorescence in addition to red fluorescence.   The fluorescent protein according to claim 1 or 2, wherein the fluorescent protein is a natural fluorescent protein derived from soft coral (Scleronephthya gracillima (Kuekenthal)) or a fluorescent protein obtained by genetic recombination.   The fluorescent protein according to any one of claims 1 to 3, wherein a Stokes shift representing a difference between an excitation wavelength and a fluorescence wavelength is at least 45 nm.   The fluorescent protein according to any one of claims 1 to 4, which emits fluorescence having a maximum fluorescence wavelength within a range of 400 to 680 nm when excited at an excitation wavelength of 298 nm.   The fluorescent protein according to any one of claims 1 to 4, which emits fluorescence having a maximum fluorescence wavelength within a range of 400 to 680 nm when excited at an excitation wavelength of 436 nm.   The fluorescent protein according to any one of claims 1 to 4, which emits fluorescence having a maximum fluorescence wavelength within a range of 400 to 680 nm when excited at an excitation wavelength of 564 nm. (A) the amino acid sequence represented by SEQ ID NO: 1, 2, 3, 4, 5, 6 or 7, or (b) 1 to 25 amino acids deleted in the amino acid sequence represented by SEQ ID NO: 4, A fluorescent protein comprising a substituted or added amino acid sequence and emitting at least red fluorescence. (A) the amino acid sequence represented by SEQ ID NO: 1, 2, 3, 4, 5, 6 or 7, or (b) 1 to 25 amino acids deleted in the amino acid sequence represented by SEQ ID NO: 4, A DNA comprising a substituted or added amino acid sequence and encoding a fluorescent protein emitting at least red fluorescence.   A protein having a molecular weight of 17 to 28 kDa comprising an amino acid sequence comprising any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6 or 7 and having a wavelength of at least 400 to 680 nm when excited at an excitation wavelength of 298 nm A multicolor fluorescent protein characterized by emitting a plurality of fluorescent colors.