JP2008092948A - Kit and method for detecting target nucleic acid in sample - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a kit and method for directly and specifically detecting a double strand of a PCR amplification product. <P>SOLUTION: The invention relates to the kit for detecting target nucleic acid in a sample wherein the target nucleic acid is a gene of Legionella species, comprising a pair of primers set designed to amplify a zinc finger protein recognizing sequence present in the gene by a PCR reaction. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

The present invention relates to methods and kits for detecting Legionella species genes using zinc finger proteins.

  In recent years, many occurrences of legionellosis have been reported in leisure facilities, medical facilities, nursing homes, and the like equipped with bathtubs, pools, artificial ponds, artificial rivers, and the like. Examples of reports of legionellosis include outbreaks in buildings, nosocomial infections in hospitals, and outbreaks in hot spring facilities.

Legionellosis is an infectious disease caused by Legionella spp. Represented by Legionella pneumophilia , and is not limited to trans-respiratory infections caused by aerosols or water ingestion of Legionella. The possibility of infection from oral infection and trauma is also considered. Legionella spp. Are particularly prone to breed in warm water, and it has been reported that a hot spring that treats diseases in hot springs can cause pneumonia in the elderly with weakened immunity.

  By the way, as a method for examining Legionella, for example, a PCR method or a LAMP method which is a culture method or a nucleic acid amplification method is known. The culture method is a method for detecting Legionella by growing it in culture. However, Legionella spp. Are extremely difficult to grow, and when Legionella spp. Are detected by a culture method, it takes time until the Legionella spp. There is a problem that it takes time to be put. On the other hand, the PCR method is a method of amplifying and detecting Legionella genes. However, in the PCR method or the like, it is necessary to make a double-stranded gene into a single strand, which takes time and labor. The reason is that in PCR method, in order to detect PCR amplification products by hybridization, double-stranded PCR amplification products must be denatured into single strands and then hybridized with probe DNA. Can be mentioned. In the PCR method, (i) the complementary PCR amplification products have a high probability of forming base pairs with each other, so that the hybridization efficiency of the probe DNA is low, and (ii) once dissociated single strands are Since it returns to the original double strand, there is a problem that the hybridization efficiency is extremely poor. Therefore, there is a need for a method for detecting PCR amplification products in double strands.

  As a method for analyzing double-stranded DNA without denaturing, a method for analyzing double-stranded DNA in a specimen using a double-stranded DNA recognition substance immobilized on a support is disclosed (for example, JP 2002-125700 A). This method is characterized in that a double-stranded DNA recognition substance and a double-stranded DNA in a specimen are bound to each other, and the bound double strand is detected using an intercalator, an anti-DNA antibody, a DNA transcription factor, or the like. . However, although it is possible to measure the amount of double-stranded DNA present by this method, it is difficult to specifically detect the target nucleic acid. That is, when detecting using an intercalator or an anti-DNA antibody, the selectivity of the base sequence is hardly obtained, and when detecting using a DNA transcription factor, the recognition sequence is short, so that the specificity is low. High detection cannot be performed.

In addition, as a method for detecting a PCR amplification product in a double strand, for example, in JP-A-2003-285706, by detecting a zinc finger protein sequence in a PCR amplification product using a zinc finger protein, It is disclosed that a target double-stranded DNA can be specifically detected. However, in this detection method, a phage that expresses the fusion protein is used when investigating the binding ability between the zinc finger protein and the PCR amplification product. Therefore, depending on the target molecule, the molecular recognition ability is not sufficient. As a result, it is difficult to detect highly sensitive Legionella spp. Thus, in the method of detecting a PCR amplification product in a double strand, a quicker and simpler detection of Legionella is required. On the other hand, the PCR method or the like as the genetic test method has a problem in that it has not been widely used at present because an apparatus used for the test is expensive and its operation is complicated.
JP 2002-125700 A JP 2003-285706 A

  ADVANTAGE OF THE INVENTION According to this invention, the measurement system (kit) and method which can detect specifically the PCR amplification product of Legionella genus gene represented by Legionella genus gene etc. in a sample with a double strand are provided.

A kit for detecting a target nucleic acid in a specimen according to one embodiment of the present invention is:
The target nucleic acid is Legionella gene;
A primer pair designed to amplify a zinc finger protein recognition sequence present in the gene by a PCR reaction is included.

  The kit may further include a zinc finger protein that can bind to the zinc finger protein recognition sequence. In this case, the zinc finger protein is labeled with a detectable label. In this case, the zinc finger protein can be in the form of a fusion protein with a tag polypeptide. Also in this case, the tag polypeptide can be GST. Furthermore, in this case, the zinc finger protein may be Zif268 and the zinc finger protein recognition sequence may be 5'-GCGTGGGGCG-3 '. Alternatively, in this case, the zinc finger protein can be SP1, and the zinc finger protein recognition sequence can be 5'-GGGGCGGGGG-3 '. Alternatively, in this case, the zinc finger protein can be SP2, and the zinc finger protein recognition sequence can be 5'-GGGGGGACT-3 '.

  In the kit, the target nucleic acid is selected from Legionella pneumophilia 2-deoxy-D-gluconate-3-dehydrogenase gene, Legionella pneumophilia flhA gene, and Legionella pneumophilia transmembrane protein gene. Can be.

  In the above kit, the primer pair can be labeled with a detectable label.

A method for detecting a target nucleic acid in a specimen according to one embodiment of the present invention includes:
The target nucleic acid is Legionella gene;
(A) amplifying a nucleic acid in a specimen by a PCR reaction using a primer pair designed to amplify a zinc finger protein recognition sequence present in the gene by a PCR reaction; and (b) a zinc finger. Using a protein to detect a PCR amplification product obtained by the amplification,
including.

  In the above method, the zinc finger protein can be labeled with a detectable label. In this case, the zinc finger protein can be in the form of a fusion protein with a tag polypeptide. Also in this case, the tag polypeptide can be GST.

  In the above method, the zinc finger protein may be Zif268, and the zinc finger protein recognition sequence may be 5'-GCGTGGGGCG-3 '.

  In the above method, the zinc finger protein may be SP1, and the zinc finger protein recognition sequence may be 5'-GGGGCGGGGG-3 '.

  In the above method, the zinc finger protein may be SP2, and the zinc finger protein recognition sequence may be 5'-GGGGGGACT-3 '.

  In the above method, the target nucleic acid is selected from the genes for Legionella pneumophilia 2-deoxy-D-gluconate-3-dehydrogenase gene, Legionella pneumophilia flhA gene, and Legionella pneumophilia transmembrane protein gene. Can be.

  According to the kit and detection method of the present invention, since the zinc finger protein binds to a double strand, it is not necessary to denature the PCR amplification product and dissociate it into a single strand. For this reason, the detection of Legionella gene which is a target nucleic acid can be performed more rapidly and easily.

  In addition, according to the kit and detection method of the present invention, Legionella gene can be detected easily and with high sensitivity by using a zinc finger protein in the form of a fusion protein with a tag peptide.

  Hereinafter, a kit and a method for detecting a target nucleic acid according to an embodiment of the present invention will be described in detail.

1. Method for Detecting Target Nucleic Acid in Specimen A method for detecting a target nucleic acid (Legionella gene) in a specimen according to an embodiment of the present invention (hereinafter also simply referred to as “detection method”) is: a) amplifying a nucleic acid in a specimen by a PCR reaction using a primer pair designed to amplify a zinc finger protein recognition sequence present in the target nucleic acid by the PCR reaction; and (b) a zinc finger protein. And detecting a PCR amplification product obtained by amplification.

1.1. Zinc Finger Protein A zinc finger protein is a protein having a zinc finger motif that can specifically bind to a specific DNA sequence (zinc finger protein recognition sequence). To date, several hundred types of zinc finger proteins have been identified.

  A zinc finger motif is typically a motif of about 30 amino acids in length containing 4 residues (2 cysteine residues and 2 histidine residues), and an inverted equilibrium double-stranded β structure and It is mainly composed of an α-helix and has a three-dimensional structure in which these four residues are coordinated to a zinc ion.

  A zinc finger motif can specifically bind to double-stranded DNA having a specific sequence. For example, Zif268, which is a zinc finger protein derived from mouse, has a triple zinc finger motif, and recognizes 9 consecutive DNA sequences of 5′-GCGTGGGGCG-3 ′ and is a double strand containing the DNA sequence. It can bind specifically to DNA. In addition, for example, SP1 (transcriptional regulator), which is a human-derived zinc finger protein, also has a triple zinc finger motif and recognizes nine consecutive DNA sequences of 5′-GGGGCGGGGG-3 ′. It can specifically bind to double-stranded DNA containing the DNA sequence.

  When binding the zinc finger protein to the target double-stranded DNA, an α helix site is inserted into the main groove of the target double-stranded DNA, so that the DNA sequence recognized by the zinc finger protein is the zinc finger. Determined by the amino acid sequence of the alpha helix of the protein. To date, thousands of zinc finger motifs have been identified that each recognize a unique DNA sequence. By elucidating in more detail the relationship between the amino acid sequence of the α helix and the recognized DNA sequence, it is considered possible to design a zinc finger sequence that recognizes a specific target DNA sequence. In addition, a method of selecting a zinc finger sequence that can recognize a specific DNA sequence of interest using a zinc finger peptide library prepared by phage display is known.

  According to the detection method according to the present embodiment, the target double-stranded DNA can be specifically detected by using a zinc finger protein.

  As the zinc finger protein, for example, any known zinc finger protein whose recognition site has been clarified may be used, or a zinc finger protein that has been genetically modified to have a desired recognition site May be used. In this technical field, various methods for changing the recognition sequence of zinc finger protein have been attempted.

  In addition, the zinc finger protein may be labeled with a detectable label. Thereby, the zinc finger protein couple | bonded with the PCR amplification product can be detected easily. Examples of such labels include radioactive labels, fluorescent labels, affinity labels such as biotin and avidin, enzyme labels, and the like. The zinc finger protein may be in the form of a fusion protein with a tag polypeptide. In this case, examples of the tag polypeptide include GST (glutathione S-transferase), His tag, and MBP (maltose binding protein). The zinc finger protein bound to the PCR amplification product can be detected by labeling the tag polypeptide with the above-mentioned label and detecting the amount or presence of the label.

  Alternatively, the zinc finger protein may be expressed as a recombinant protein in a suitable host. Alternatively, zinc finger proteins can be expressed in recombinant phage and displayed on the phage. Thus, the recombinant zinc finger protein can be used without purification, and the zinc finger protein can be easily detected using an antibody against phage. Such phage display techniques are well known in the art and are also described in detail in the Examples herein.

1.2. Preparation of Nucleic Acid In the detection method according to the present embodiment, first, nucleic acid (DNA) is prepared from a test sample. Samples include cell cultures, water (for example, water used in bathtubs, pools, artificial ponds, artificial rivers, tap water, sewage, domestic wastewater, industrial wastewater, agricultural wastewater, well water, lake water, seawater, (River water, swamp water, pond water, spring water, hot spring water), agricultural products, food, pharmaceuticals, cosmetics, and tissues and body fluids, blood, saliva, sweat, urine, feces, sputum, air conditioners from animals and humans to be examined Cooling water for outdoor cooling towers, hot water tank water, hot water system water, humidifier water, biofilm (biofilm) (Here, biofilm is the growth of microorganisms attached to the wall and , Protozoa (amoeba, etc.), circulation tub filtration device (if the filtration device is an amoeba colonization or breeding site, in the amoeba cell) Legionella bacteria grow on the It is possible to have. Techniques for preparing nucleic acids (DNA) from such samples are well known in the art. Alternatively, RNA may be prepared from a sample to be tested and cDNA synthesized by a conventional method.

1.3. (A) Amplification of nucleic acid by PCR reaction The detection method according to this embodiment comprises (a) a primer pair designed to amplify a sequence recognized by a zinc finger protein in a Legionella gene that is a target nucleic acid. And amplifying the nucleic acid in the sample by a PCR reaction. That is, PCR amplification is performed using a nucleic acid (DNA) in a specimen as a template and a primer pair and a heat-resistant DNA polymerase. The PCR amplification conditions and methods used herein are well known in the art.

  Sequences recognized by zinc finger proteins are relatively short in length, so the frequency of occurrence of sequences is high, and many sequences are found not only in the target nucleic acid sequence of interest but also in other nucleic acids that may be present in the sample. It is predicted that

  For example, the sequences recognized by Zif268 and SP1, SP2 are all composed of 9-10 consecutive nucleotides, and such a sequence exists with a probability of about 1 in about 260,000 bases. Therefore, in order to increase the specificity of detection, it is necessary to conduct an extensive search on the sequences surrounding the zinc finger protein recognition sequence and to design appropriate PCR primers.

  The PCR primer is designed so that the sequence region containing the sequence recognized by the zinc finger protein is specifically amplified. For this purpose, first, a zinc finger recognition sequence is searched for in the genome sequence of an organism to be detected (for example, microorganism, bacteria, virus, etc.).

  For example, when Zif268 is used as a zinc finger protein, a gene containing GCGTGGGCG as its recognition sequence is identified. Next, a primer pair capable of amplifying the recognition sequence is selected based on the 5 ′ side and 3 ′ side sequences of the recognition sequence. Similarly, for example, when SP1 is used as a zinc finger protein, a gene containing GGGGCGGGGG as its recognition sequence is identified. Next, a primer pair capable of amplifying the recognition sequence is selected based on the 5 ′ side and 3 ′ side sequences of the recognition sequence. Similarly, for example, when SP2 is used as a zinc finger protein, a gene containing GGGCGGGACT as its recognition sequence is identified. Next, a primer pair capable of amplifying the recognition sequence is selected based on the 5 ′ side and 3 ′ side sequences of the recognition sequence.

  The length of the primer is preferably 12-30 nucleotides, more preferably 15-25 nucleotides. Furthermore, in the selection of primers, each primer does not form a secondary structure in the molecule, and the melting temperature is a temperature suitable for PCR reaction (for example, within a range of about 58-63 ° C.). Criteria for primer selection known in the field should also be considered. The distance between each primer and the zinc finger recognition sequence can be arbitrarily selected, and the distance to the primer may be the same or different between the 5 'side and the 3' side of the zinc finger recognition sequence.

  Preferably, the distance between the primer and the zinc finger recognition sequence is 0 to 500 bp, more preferably 0 to 300 bp. The distance of 0 means that a primer is arranged adjacent to the zinc finger recognition sequence, as exemplified in the examples described later. The longer the distance, the higher the specificity of detection. However, when nucleic acid in the specimen is degraded or cleaved, it is not detected. Therefore, when using stool or a biopsy tissue section as a specimen, it is preferably shorter than 150 bp. . Next, for sequences that are amplified by PCR, i.e., sequences that include both primers and a zinc finger recognition sequence, make sure that no other homologous sequences are present in other nucleic acids that may be present in the sample. Check. Thereby, only a target nucleic acid can be specifically detected.

  Each oligonucleotide of the primer pair thus designed can be chemically synthesized using, for example, a general-purpose DNA synthesizer (for example, Model 394 manufactured by Applied Biosystems). Oligonucleotides may be synthesized using any of the other methods well known in the art.

1.4. (B) Detection of PCR amplification product The detection method according to the present embodiment is a PCR amplification product obtained by (a) amplification of a nucleic acid by PCR reaction and (b) amplification using a zinc finger protein. Detecting. Specifically, it is possible to detect whether the zinc finger protein binds to the PCR amplification product by bringing the PCR amplification product obtained in (a) above into contact with the zinc finger protein.

  For example, when a zinc finger protein appropriately labeled with a label is used, the presence or amount of the zinc finger protein bound to the PCR amplification product can be measured by measuring the amount of the label.

  For example, when the zinc finger protein is in the form of a fusion protein with a tag polypeptide (eg, GST), the zinc finger protein bound to the PCR amplification product can be detected by ELISA using an antibody specific to the tag polypeptide. it can.

  More specifically, for example, when the tag polypeptide is GST, the anti-GST antibody is bound to the GST (antigen) portion of the fusion protein, the unbound antibody is washed away, and then GST is detected by an enzyme reaction or a fluorescence reaction. By measuring the presence or amount of (tag polypeptide), the presence or amount of zinc finger protein bound to the PCR amplification product can be measured.

  Alternatively, the binding between the PCR amplification product and the zinc finger protein may be detected by labeling the PCR amplification product and detecting the labeled PCR amplification product. Such labeling can be performed by previously labeling a primer pair used in the PCR reaction or by incorporating a labeled nucleotide during the PCR amplification reaction.

  Labeling methods are well known in the art, and as the label, radioactive labels, fluorescent labels, affinity labels such as biotin and avidin, and the like can be used. Or you may detect the double stranded DNA couple | bonded with the zinc finger protein using the intercalator method or the fluorescence polarization method.

  Alternatively, when a zinc finger protein displayed on a phage is used, it can be detected using an ELISA using an antibody specific for the phage. That is, a zinc finger protein bound to a PCR amplification product by binding an appropriately labeled anti-phage antibody, washing away unbound antibody, and then measuring the presence or amount of the label by enzymatic reaction, fluorescence reaction, etc. The presence or amount of can be measured.

1.5. Use One preferred use of the detection method according to the present embodiment is to detect a target nucleic acid (Legionella gene) in a specimen by distinguishing it from closely related bacteria.

Detectable Legionella by detecting method according to the present embodiment is not particularly limited, for example, Legionella pneumophila Firia (L. pneumophilia), Legionella Bozemanii (L. bozemanii), Legionella Mikudadei (L. micdadei ), Legionella Longbeachae ( L. longbeachae ), Legionella Wadsworthii ( L. wadsworthii ), Legionella Hackelie ( L. hackeliae ), Legionella Birminghamensis ( L. birminghamensis ), Legionella Cincinnatisis ( L. cincinnatiensis ), Legionella tuxonensis ( L. tucsonensis ), Legionella lansinenensis ( L. lansingenensis )
, Legionella Deyumofi (L. dumoffii), Legionella Gorumanyi (L. gormanii), Legionella Yorudanisu (L. jordanis), Legionella Okuri Jen cis (L. oakridgensis), Legionella Ferei (L. feeleii), Legionella sign terrain cis (L. sainthelensis), Legionella Parishienshisu (L. parisiensis), Legionella map Shen Kell Nyi (L. maceachernii), Legionella Anisa (L. anisa), and the like Legionella San tickle cis (L. santicrucis) is .

  For detection of Legionella and diagnosis of Legionellosis, it is necessary to detect Legionella and distinguish it from other bacteria.

  As a method for detecting Legionella gene, generally, culture by a separation culture method and its morphological observation, serological examination, hybridization using a specific probe, and a combination of PCR amplification and hybridization are used. ing. However, as described above, Legionella spp. Are difficult to increase by culturing, so there is a problem that it takes days in the method by culturing.

  As described in detail in Examples below, according to the detection method of the present embodiment, Legionella gene (for example, Legionella pneumophilia gene) can be specifically detected by distinguishing it from other bacteria. it can.

For example, when Zif268 is used as a zinc finger protein as a target sequence for PCR amplification for specifically detecting Legionella pneumophilia gene, Legionella pneumophilia 2-deoxy-D-gluconate-3-dehydrogenase gene (For example, Legionella pneumophilia str. Philadelphia 1 2-deoxy-D-gluconate-3-dehydrogenase gene, Legionella pneumophilia str. Lens 2-deoxy-D-gluconate-3-dehydrogenase gene, Legionella pneumophilia str. Paris 2-deoxy-D -A zinc finger protein recognition sequence in -gluconate-3-dehydrogenase gene),
When using SP1 as the zinc finger protein, the zinc finger protein recognition in the flhA gene of Legionella pneumophilia (eg, Legionella pneumophilia str. Philadelphia flhA gene, Legionella pneumophilia str. Lens flhA gene, Legionella pneumophilia str. Paris flhA gene) Preferably it comprises a sequence. In addition, when SP2 is used as a zinc finger protein, the gene for the transmembrane protein of Legionella pneumophila (locus_tag = lpg1883) (for example, the gene for Legionella pneumophila str. Philadelphia transmembrane protein, Legionella pneumophilia It preferably contains a zinc finger protein recognition sequence in the gene of str. Lens transmembrane protein and the gene of Legionella pneumophilia str.

  Therefore, Legionella pneumophilia 2-deoxy-D-gluconate-3-dehydrogenase gene, Legionella pneumophilia flhA gene and Legionella pneumophilia transmembrane protein gene (locus_tag = lpg1883 ) Are preferably target genes for detection by zinc finger proteins (Zif268, SP1, SP2).

  The 2-deoxy-D-gluconate-3-dehydrogenase gene is a gene involved in the production of 2-deoxy-D-gluconate-3-dehydrogenase, and 2-deoxy-D-gluconate-3-dehydrogenase is involved in carbohydrate metabolism. concern.

  The flhA gene is involved in the production of flagellar biosynthetic protein (flagellar biosynthetic protein), a flagellar biosynthetic protein, and FlhA is involved in chemotaxis, motility, and cell division.

  The transmembrane protein gene (locus_tag = lpg1883) is a gene involved in the production of a transmembrane protein, but the details of the protein are unknown.

1.6. Effects According to the detection method according to the present embodiment, since a double-strand denaturation step of a PCR amplification product is not required, a target nucleic acid (Legionella gene, for example, Legionella pneumophilia gene) in a sample is highly sensitive. And can be detected specifically and simply. In addition, the method for detecting a target nucleic acid in a sample according to the present embodiment can be performed by an apparatus for detecting the target nucleic acid in the sample by using, for example, a sensor or an electrode.

2. Kit A kit (hereinafter also simply referred to as “kit”) for detecting a target nucleic acid (Legionella gene) in a specimen according to an embodiment of the present invention includes the above-described primer pair. In addition, the kit according to the present embodiment can further include the above-described zinc finger protein. In this case, the zinc finger protein can be in the form of a fusion protein with the tag polypeptide, in which case the tag polypeptide is preferably GST.

  In addition, the kit according to the present embodiment includes a membrane of Legionella pneumophilia, the target nucleic acids of which are Legionella pneumophilia 2-deoxy-D-gluconate-3-dehydrogenase gene, Legionella pneumophilia flhA gene, and Legionella pneumophilia. It is preferably one selected from a transmembrane protein gene (locus_tag = lpg1883).

  The zinc finger protein may be used after being immobilized on a suitable carrier. The target nucleic acid can be detected by binding the above-mentioned PCR amplification product to the immobilized zinc finger protein and measuring the amount of the bound double-stranded DNA. In such an embodiment, it is preferable that the PCR amplification product is labeled so as to be detectable.

3. EXAMPLES Hereinafter, the present invention will be described in more detail with reference to examples, but the present invention is not limited to these examples.

3.1. Example 1
[Selection of Zif268 recognition sequence in Legionella pneumophilia genome]
First, by using NCBI nucleotide BLAST Search for short nearly exact matches, a sequence of 9 bases of gcgtggggc which is a Zif268 recognition sequence was searched from the genome of Legionella pneumophilia (see FIG. 1). The genome sequence of Legionella pneumophilia was according to the previous report (GenBank accession number: AE018354 (Strain Philadelphia 1), CR628337 (Strain Lens), CR628336 (Strain Paris)). Next, BLAST was used to search for a continuous 49-base sequence containing 20 bases each on the 5 ′ side and 3 ′ side of the 9 base sequence as a primer region, and it was examined whether other bacteria had similar sequences. (See FIG. 2). Furthermore, a gene to be targeted was selected based on the number of other gene sequences serving as comparative controls for the gene, the evolution rate, the presence or absence of horizontal mobility, and the like.

  As a result, the recognition sequence of Zif268 and its 5 ′ and 3 ′ primer regions show high homology with the Legionella pneumophilia sugar metabolism-related gene (2-deoxy-D-gluconate-3-dehydrogenase gene). It became clear. From the above results, the 2-deoxy-D-gluconate-3-dehydrogenase gene of Legionella pneumophilia was selected as a target gene.

FIG. 2 shows a 49 bp sequence alignment containing the Zif268 recognition sequence (binding site) of the three types of Legionella pneumophilia 2-deoxy-D-gluconate-3-dehydrogenase genes. According to FIG. 2, the 49 bp nucleotide sequence including the Zif268 recognition sequence and its 20 ′ primer region on each of the 5 ′ side and the 3 ′ side shows high homology between Legionella pneumophilia. The homology to the genes of other organisms performed was low. Thus, Legionella pneumophilia str. Philadelphia 1 is specifically identified by using a 49 bp base sequence including the Zif268 recognition sequence and its 5 ′ and 3 ′ 20 bp primer regions as a target sequence . Can be detected automatically.

3.2. Example 2
[Preparation of Zif268-GST fusion protein]
In this example, the Zif268-GST fusion protein was prepared according to the following procedure.

From the mouse skeletal muscle cDNA library (TaKaRa), a structural gene at the DNA binding site of Zif268 into which restriction enzyme sites (SfiI, NotI) were introduced was amplified, digested with restriction enzymes, inserted into the phagemid vector pCANTAB5, and vector pCAN / Zif268 was obtained.

From the obtained vector pCAN / Zif268, a Zif268 structural gene (300 bp) introduced with restriction enzyme sites (BamHI, EcoRI) was PCR-amplified and TA-cloned to obtain a vector pGEM / Zif268. After amplification and restriction enzyme treatment, a GST fusion expression vector pGEX derived from Schistosoma japonicum (Schistosoma japonicum)
The vector pGEX / Zif268 was obtained by ligation with -2T. The base sequence of Zif268 structural gene and pGEX-2T was in accordance with the previous report (GenBank accession number: NM_007913 (Zif268 structural gene), U13850 (pGEX-2T). The linker sequence between the Zif268 structural gene and the GST structural gene is LVPRGS.

  After the vector pGEX / Zif268 was introduced into E. coli BL21 strain, this E. coli BL21 strain was cultured at 37 ° C. and expression was induced with 0.1 mM IPTG. Thereafter, the cells were collected and washed, and the cells were crushed with a French press. A Zif268-GST fusion protein was obtained by affinity-purifying the water-soluble fraction of the disrupted microbial cells using a GSTRap ™ HF column. The purity of the hSP1-GST fusion protein was confirmed by performing GST activity measurement and SDS-PAGE.

3.3. Example 3
[Confirmation of binding ability between Zif268-GST fusion protein and target double-stranded DNA]
In this example, the binding ability between the Zif268-GST fusion protein obtained in Example 2 and double-stranded DNA was confirmed by ELASA. The structure of the ELASA kit (target nucleic acid detection kit) used in this example is shown in FIG.

Moreover, the arrangement | sequence of double stranded DNA is shown in FIG. “Bio” indicates biotin, and the underline is a zinc finger protein recognition sequence.
No.1: Zif268-L.pneumophila Philadelphia 1 target (target 1)
Bio 5'-ATTGGTGTTCCGGAAGATAT CGC CCA CGC AATTGTGTTTTTGCTTAATC-3 '
3'-TAACCACAAGGCCTTCTATA GCG GGT GCG TTAACACAAAAACGAATTAG-5 '
No.2: Zif268-L.pneumophila Lens target (target 2)
Bio 5'-ATTGGTGTTCCGGAAGATAT TGC CCA CGC AATTGTGTTTTTGCTTAATC-3 '
3'-TAACCACAAGGCCTTCTATA ACG GGT GCG TTAACACAAAAACGAATTAG-5 '
No.3: Zif268-L.pneumophila random (Comparative Example 1, random mutation)
Bio 5'-ATTGGTGTTCCGGAAGATAT AGG CTC AGT AATTGTGTTTTTGCTTAATC-3 '
3'-TAACCACAAGGCCTTCTATA TCC GAG TCA TTAACACAAAAACGAATTAG-5 '
No.4: Zif268-S.typhiriumium target (Comparative Example 2)
Bio 5'-CAGAGCGTTGACTACCGAGA CGC CCA CGC CGTGCAGACCGCCGGAGACT-3 '
3'-GTCTCGCAACTGATGGCTCT GCG GGT GCG GCACGTCTGGCGGCCTCTGA-5 '
No.5: Zif268-S.typhiriumium random (Comparative Example 3)
Bio 5'-CAGAGCGTTGACTACCGAGA AGG CTC AGT CGTGCAGACCGCCGGAGACT-3 '
3'-GTCTCGCAACTGATGGCTCT TCC GAG TCA GCACGTCTGGCGGCCTCTGA-5 '
No.6: No DNA used (Control 1)
No. 7: Protein (Zif268-GST fusion protein) not used (control 2)
To a well 18 coated with streptavidin 20 (96-well plate) 18, double-stranded DNA 24 (100 pmol / well) consisting of a single-stranded DNA labeled with biotin at its 5 ′ end and its complementary DNA is added at room temperature. After incubating for 1 hour, 2% skim milk was added and blocking was performed at room temperature for 1 hour. Next, a fusion protein (Zif268-GST fusion protein obtained in Example 2) 26 (5.7 pmol / well) was added and incubated at room temperature for 1 hour, and then anti-tag polypeptide antibody 28 and substrate enzyme 30 (Anti-GST antibody-HRP (horseradish peroxidase) complex solution) was added and incubated at room temperature for 1 hour. Next, a coloring reagent 32 (ABTS solution (0.4 mM ABTS (2,2′-Azinobis (3-ethylbenzothiazolin-6-sulfonic acid), 50 mM citric acid, 0.2% H ₂ O ₂ , pH 4.0)) The absorbance of light having a wavelength of 405 nm was measured with a plate reader every 0, 15, 30, and 60 minutes after addition to the well 18. The absorbance after 60 minutes is shown in FIG.

According to FIG. 5, when using targets 1 and 2 (No. 1, No. 2) as double-stranded DNA,
Compared with random mutant double-stranded DNA (No. 3, No. 5), the absorbance was significantly higher. Thereby, it can be understood that the Zif268-GST fusion protein has the ability to bind to the target double-stranded DNA.

3.4. Example 4
[Confirmation of binding ability between Zif268-GST fusion protein and PCR amplification product]
In this example, DNA amplification by PCR was performed using each 49 bp double-stranded DNA shown in FIG. 6 as a template. More specifically, biotin-modified single-stranded DNA (sense strand) and FITC (fluorescein isothiocyanate) -modified single-stranded DNA (antisense strand) (No. 1 to No. 6 in FIG. 6) are mixed, A 49 bp double-stranded DNA was obtained by heat treatment. In FIG. 1-No. 5 double-stranded DNAs each have the same sequence as the double-stranded DNA (No. 1 to No. 5) used in Example 2.

  Next, PCR amplification was carried out under the conditions of 95 ° C. for 5 minutes → (95 ° C. for 30 seconds → 48 ° C. for 30 seconds → 74 ° C. for 30 seconds) × 30 times → 4 ° C. Each PCR amplification product was obtained. The gel electrophoresis pattern of each PCR amplification product is shown in FIG. According to FIG. 7, when the target double-stranded DNA is Legionella pneumophilia gene (No. 1 and No. 2), it can be understood that a target biotin-labeled 49 bp PCR amplification product was obtained.

  Next, in the same manner as in Example 3, the binding ability between the Zif268-GST fusion protein obtained in Example 2 and each PCR amplification product (No. 1 to No. 6) was confirmed by ELASA. The result is shown in FIG.

  According to FIG. 8, the PCR amplification products (No. 1 and No. 2) obtained using the DNA sequence in the Legionella pneumophilia gene are different from the other PCR amplification products (No. 3 to No. 6). The absorbance was higher than that. Thereby, it can be understood that the Zif268-GST fusion protein specifically binds to the target sequence (Zif268 recognition sequence). That is, it was revealed that the PCR amplification product obtained using the target sequence in the Legionella pneumophilia gene can be specifically detected using the Zif268-GST fusion protein.

3.5. Example 5
[Selection of SP1 recognition sequence in Legionella pneumophilia genome]
First, a 9 base sequence of ggggcgggg, which is an SP1 recognition sequence, was searched from the genome of Legionella pneumophilia using NCBI nucleotide BLAST Search for short nearly exact matches (see FIG. 9). The genome sequence of Legionella pneumophilia was according to the previous report (GenBank accession number: AE018354 (Strain Philadelphia
1), CR 628337 (Strain Lens), CR 628336 (Strain Paris)). Next, BLAST was used to search for a continuous 49-base sequence containing 20 bases each on the 5 ′ side and 3 ′ side of the 9 base sequence as a primer region, and it was examined whether other bacteria had similar sequences. (See FIG. 10). Furthermore, a gene to be targeted was selected based on the number of other gene sequences serving as comparative controls for the gene, the evolution rate, the presence or absence of horizontal mobility, and the like.

  As a result, it was revealed that the SP1 recognition sequence and its 5 'and 3' primer regions showed high homology with the Legionella pneumophilia flhA gene. Based on the above results, the flhA gene of Legionella pneumophilia was selected as the target gene.

FIG. 10 shows a 49 bp sequence alignment containing the SP1 recognition sequence of the flhA gene of three Legionella bacteria. According to FIG. 10, the 49 bp base sequence including the SP1 recognition sequence and the 20 bp primer region on each of the 5 ′ side and the 3 ′ side thereof is highly homologous between Legionella pneumophilia. The homology to the genes of other organisms performed was low. Thus, Legionella pneumophilia str. Philadelphia 1 is specifically used by using 49 bp base sequence including SP1 recognition sequence and its 5 ′ and 3 ′ side 20 bp primer regions as a target sequence . Can be detected automatically.

3.6. Example 6
[Preparation of SP1-GST fusion protein]
In this example, the SP1-GST fusion protein was prepared according to the procedure shown in FIG.

  The vector pGEM / hSP140 was obtained by PCR amplification of the SP1 (hSP1) structural gene (303 bp) obtained from the human lymph gland cDNA library (TaKaRa) and TA cloning. Next, a restriction enzyme site (SmaI, EcoRI) was introduced into the obtained vector pGEM / hSP140 to obtain hSP1 gene fragment (302 bp) 42. The hSP1 gene fragment 42 was amplified and treated with a restriction enzyme, and then ligated with a GST fusion expression vector pGEX-2T derived from Schistosoma japonicum (Schistosoma japonicum) to obtain a vector pGEX / hSP144. The base sequence of hSP1 structural gene and pGEX-2T was in accordance with the previous report (GenBank accession number: NM_138473 (hSP1 structural gene), U13850 (pGEX-2T)). The linker sequence between the Zif268 structural gene and the GST structural gene is LVPRGSPG.

  Next, the vector pGEX / hSP144 was introduced into E. coli BL21 strain, this E. coli BL21 strain was cultured at 37 ° C., expression was induced with 0.1 mM IPTG, and the cells were collected and washed. It was crushed. The hSP1-GST fusion protein was obtained by affinity-purifying the water-soluble fraction of the disrupted microbial cells using a GSTrap ™ HF column. The purity of the hSP1-GST fusion protein was confirmed by performing GST activity measurement and SDS-PAGE.

  FIGS. 12 (a) and 12 (b) show the electrophoresis patterns of the hSP1-GST fusion protein. FIG. 12 (a) shows the SDS-PAGE result of the water-soluble fraction of the crushed bacterial cells for 1 hour, 2 hours, 3 hours, and 4 hours after induction of expression by IPTG, and FIG. The SDS-PAGE result of an elution fraction is shown.

  In the SDS-PAGE results shown in FIGS. 12A and 12B, a 39 kDa single band different from the GST band (28 kDa) was detected. This band is assumed to be that of the hSP1-GST fusion protein. From the above, it was confirmed that a high-purity hSP1-GST fusion protein was obtained.

3.7. Example 7
[Confirmation of binding ability between hSP1-GST fusion protein and target double-stranded DNA]
In this example, the binding ability between the hSP1-GST fusion protein obtained in Example 6 and double-stranded DNA was confirmed by the same method (ELASA) as in Example 3.

Moreover, the sequence of the double-stranded DNA used is shown below (No. 1 to No. 6). “Bio” indicates biotin, and the underline is a zinc finger protein recognition sequence.
No.1: SP1-L.pneumophila Philadelphia 1 target (target 3)
Bio 5'-GATCCTGACTGA CCC CGC CCC CA GTGA-3 '
3'-TGACT GGG GCG GGG GTCACTAG-5 '
No.2: SP1-L.pneumophila Lens 1 mutation (Comparative Example 4, 1 base mutation)
Bio 5'-GATCCTGACTGA CCC CAC CCC CAGTGA-3 '
3'-TGACT GGG GTG GGG GTCACTAG-5 '
No.3: SP1-L.pneumophila 1 mutation-2 (Comparative Example 5, 1 base mutation)
Bio 5'-GATCCTGACTGA CCC CGC CCT CAGTGA-3 '
3'-TGACT GGG GCG GGA GTCACTAG-5 '
No. 4: SP1-L.pneumophila 1 random (Comparative Example 6, random mutation)
Bio 5'-GATCCTGACTGA TCA ATC GCA CAGTGA-3 '
3'-TGACT AGT TAG CGT GTCACTAG-5 '
No. 5: SP1-L.pneumophila 1 random-2 (Comparative Example 7, random mutation)
Bio 5'-GATCCTGACTGA ATC CTC ATT CAGTGA-3 '
3'-TGACT TAG GAG TAA GTCACTAG-5 '
No.6: DNA not used (control)
To a well 18 coated with streptavidin 20 (96-well plate) 18, double-stranded DNA 24 (100 pmol / well) consisting of a single-stranded DNA labeled with biotin at its 5 ′ end and its complementary DNA is added at room temperature. After incubating for 1 hour, 2% skim milk was added and blocking was performed at room temperature for 1 hour. Next, a fusion protein (SP1-GST fusion protein obtained in Example 2) 26 (5.7 pmol / well) was added and incubated at room temperature for 1 hour, and then anti-tag polypeptide antibody 28 and substrate enzyme 30 (Anti-GST antibody-HRP complex solution) was added and incubated at room temperature for 1 hour. Coloring reagent 32 (ABTS solution (0.4 mM ABTS, 50 mM citric acid, 0.2% H ₂ O ₂ , pH 4.0)) is then added to well 18 and plated every 0, 10, 30, 60 minutes. The absorbance of light having a wavelength of 405 nm was measured with a reader. The absorbance after 60 minutes is shown in FIG.

  According to FIG. 13, when the target 3 (No. 1) is used as the double-stranded DNA, the single-base mutation double-stranded DNA (No. 2, No. 3) and the random mutant double-stranded DNA (No. 4). , No. 5), the absorbance was high. Thereby, it can be understood that the hSP1-GST fusion protein has the ability to bind to double-stranded DNA.

3.8. Example 8
[Confirmation of binding ability between hSP1-GST fusion protein and target double-stranded DNA]
In this example, the binding ability between the hSP1-GST fusion protein obtained in Example 6 and the double-stranded DNA was confirmed by the same method (ELASA) as in Example 7.

Moreover, the arrangement | sequence of the used double stranded DNA is shown in FIG. “Bio” indicates biotin, and the underline is a zinc finger protein recognition sequence.
No.1: SP1-L.pneumophila target (target 1)
Bio 5'-GCACTTACTTCAGATACTCT CCC CGC CCC TTTTGTCACTACAACAAAGT-3 '
3'-CGTGAATGAAGTCTATGAGA GGG GCG GGG AAAACAGTGATGTTGTTTCA-5 '
No.2: SP1-L.pneumophila random (Comparative Example 8, random mutation)
Bio 5'-GCACTTACTTCAGATACTCT AGG CTC AGT TTTTGTCACTACAACAAAGT-3 '
3'-CGTGAATGAAGTCTATGAGA TCC GAG TCA AAAACAGTGATGTTGTTTCA-5 '
No.3: No DNA used (Control 1)
No.4: Protein (hSP1-GST fusion protein) not used (control 2)
The sequence of target 1 is the same between Legionella pneumophila Philadelphia 1 and Lens, Paris . Moreover, the result of having confirmed the binding ability by ELISA is shown in FIG. As shown in FIG. 15, high absorbance was confirmed only in the presence of target 1 (SP1-Legionella pneumophila Target sequence). From this, it can be understood that the use of hSP1 enables specific detection of Legionella gene ( Legionella pneumophila philadelphia1, Lens, Paris ).

3.9. Example 9
[Confirmation of binding ability between Zif268 (or hSP1) -GST fusion protein and PCR amplification product]
In this example, in the presence of the genome (No. 1 to No. 4) of each bacterium shown in FIG. 16 (a) and the following, double-stranded DNA (A, B) of 49 bp shown below as a template, DNA amplification by PCR was performed. More specifically, biotin-modified single-stranded DNA (sense strand) and FITC (fluorescein isothiocyanate) -modified single-stranded DNA (antisense strand) were mixed, and double-stranded DNA of 49 bp each was obtained by heat treatment. . “Bio” indicates biotin, and the underline is a zinc finger protein recognition sequence.

(template)
A: Zif268-L.pneumophila Philadelphia 1
Bio 5'-ATTGGTGTTCCGGAAGATAT CGC CCA CGC AATTGTGTTTTTGCTTAATC-3 '
3'-TAACCACAAGGCCTTCTATA GCG GGT GCG TTAACACAAAAACGAATTAG-5 'FITC
B: SP1-L.pneumophila Philadelphia 1
Bio 5'-GCACTTACTTCAGATACTCT CCC CGC CCC TTTTGTCACTACAACAAAGT-3 '
3'-CGTGAATGAAGTCTATGAGA GGG GCG GGG AAAACAGTGATGTTGTTTCA-5 'FITC
(genome)
No.1: Legionella pneumophila philadelphia1 (NC_002942)
No.2: Escherichia coli DH5α (NC_000913: E. coli K12 strain complete genome)
No.3: Lactobacillus Plantarum (IAM1216)
No.4: Proteus vulgaris (IAM1054)
In the presence of each bacterium (No. 1 to No. 4), using 49 bp double-stranded DNA as a template, 95 ° C. for 5 minutes → (95 ° C. for 30 seconds → 48 ° C. for 30 seconds → 74 ° C. for 30 seconds) × 30 times -> PCR amplification was performed under the condition of 4 ° C to obtain PCR amplification products. The gel electrophoresis pattern of each PCR amplification product is shown in FIG. According to FIG. 16 (b), it can be understood that when PCR amplification was performed in the presence of Legionella pneumophilia (No. 1), the target biotin-labeled 49 bp PCR amplification product was obtained.

  Next, in the same manner as in Example 3, the ability to bind the PCR amplification product to the Zif268-GST fusion protein obtained in Example 2, and the PCR amplification product to the SP1-GST fusion obtained in Example 6 The ability to bind to the protein was confirmed by ELASA. The result is shown in FIG.

  According to FIG. 16 (c), when using either A or B as a template, only the PCR amplification product (No. 1) obtained in the presence of Legionella pneumophilia showed high absorbance. Thereby, it can be understood that the zinc finger protein-GST fusion protein and the target sequence are specifically bound to each other when the zinc finger protein is Zif268 or SP1. That is, it was revealed that the PCR amplification product obtained using the target sequence in the Legionella pneumophilia gene can be specifically detected using the zinc finger protein-GST fusion protein.

3.10. Example 10
[Confirmation of detection limit of SP1-GST fusion protein and PCR amplification product]
In this example, DNA amplification by PCR was performed using Legionella pneumophila subsp. Pneumophila philadelphia1 genome of various copy numbers as a template. More specifically, using a biotin-modified primer and a FITC (fluorescein isothiocyanate) -modified primer, 10,000 copies, 10,000 copies, 1000 copies, 100 copies, 10 copies, 0 copies of Legionella pneumophila subsp. Pneumophila philadelphia1 genome as a template Using Herculase II fusion enzyme (STRATAGENE) in the presence of Escherichia coli DH5α genome and Lactobacillus plantarum genome, 95 ° C. for 2 minutes → (95 ° C. for 20 seconds → 55 ° C. for 20 seconds → 74 ° C. for 30 seconds) × 35 times → 74 ° C. 2 PCR amplification was performed under the conditions of minutes → 4 ° C. to obtain a PCR amplification product.

  The gel electrophoresis pattern of each PCR amplification product is shown in FIG. According to FIG. 17A, it can be understood that when a Legionella pneumophila subsp. Pneumophila philadelphia1 genome of 100 copies or more was used as a template, a target biotin-labeled 49 bp PCR amplification product was obtained.

  Subsequently, the binding ability between the SP1-GST fusion protein obtained in Example 6 and each PCR amplification product was confirmed by ELASA in the same manner as in Example 3. The result is shown in FIG. According to FIG. 17 (B), the PCR amplification product obtained using the Legionella pneumophila subsp. Pneumophila philadelphia1 genome of 100 copies or more shows higher absorbance than the 10 copies of the template and the PCR amplification product not containing the template. It was. Thereby, it can be understood that the SP1-GST fusion protein specifically binds to a PCR amplification product containing the SP1 recognition sequence amplified from a template of 100 copies or more. That is, it was revealed that a PCR amplification product obtained from a small amount of Legionella pneumophila subsp. Pneumophila philadelphia1 genome of about 100 copies can be specifically detected using the SP1-GST fusion protein.

3.11. Example 11
[Confirmation of specificity of SP1-GST fusion protein for PCR amplification product]
In this example, using the Legionella pneumophila subsp. Pneumophila philadelphia1 genome as a template, the target sequence containing the SP1 recognition sequence and the control sequence not containing the recognition sequence were amplified by PCR, and the SP1-GST fusion protein specific to the PCR amplification product The sex was confirmed.
More specifically, using a different biotin-modified primer and FITC (fluorescein isothiocyanate) -modified primer and using Legionella pneumophila subsp. Pneumophila philadelphia1 genome as a template, a 49 bp target sequence containing SP1 recognition sequence and 49 bp containing no recognition sequence PCR amplification was performed under the conditions of 95 ° C. for 5 minutes → (95 ° C. for 30 seconds → 48 ° C. for 30 diseases → 74 ° C. for 30 seconds) × 30 times → 4 ° C. An amplification product was obtained.

  The gel electrophoresis pattern of each PCR amplification product is shown in FIG. According to FIG. 18B, it can be understood that the target biotin-labeled 49 bp PCR amplification product was obtained from the Legionella pneumophila subsp. Pneumophila philadelphia1 genome using either primer.

  Subsequently, the binding ability between the SP1-GST fusion protein obtained in Example 6 and each PCR amplification product was confirmed by ELASA in the same manner as in Example 3. The result is shown in FIG. According to FIG. 18C, the PCR amplification product of the SP1 target sequence showed higher absorbance than the PCR amplification product of the control sequence. Thereby, it can be understood that the SP1-GST fusion protein specifically binds to the PCR amplification product containing the SP1 recognition sequence. That is, it was revealed that the target PCR amplification product and other PCR amplification products can be specifically distinguished using the SP1-GST fusion protein.

3.12. Example 12
[Confirmation of binding ability between SP1-GST fusion protein and PCR amplification product using fluorescence depolarization method]
In this example, the binding ability between a PCR amplification product obtained by PCR amplification using Legionella pneumophila subsp. Pneumophila philadelphia1 genome as a template and the SP1-GST fusion protein was confirmed by fluorescence depolarization. More specifically, using a biotin-modified primer and a FITC (fluorescein isothiocyanate) -modified primer, 10,000 copies, 10,000 copies, 1000 copies, 100 copies, 10 copies, 0 copies of Legionella pneumophila subsp. Pneumophila philadelphia1 genome as a template Using Herculase II fusion enzyme (STRATAGENE) in the presence of Escherichia coli DH5α genome and Lactobacillus plantarum genome, 95 ° C. for 2 minutes → (95 ° C. for 20 seconds → 55 ° C. for 20 seconds → 74 ° C. for 30 seconds) × 35 times → 74 ° C. 2 PCR amplification was performed under the conditions of minutes → 4 ° C. to obtain a PCR amplification product.

  Subsequently, the binding ability between the SP1-GST fusion protein obtained in Example 6 and each PCR amplification product was confirmed by a fluorescence depolarization method. More specifically, the obtained PCR amplification product and the SP1-GST fusion protein were mixed, and the fluorescence polarization degree of FITC modified to the PCR amplification product was measured at an excitation wavelength of 485 nm and a fluorescence wavelength of 530 nm. Binding of the SP1-GST fusion protein to the PCR amplification product slows the rotation of FITC modified to DNA, and changes the degree of polarization of the fluorescence wavelength.

  The result is shown in FIG. According to FIG. 19, the PCR amplification product amplified from more than 10 copies of Legionella pneumophila subsp. Pneumophila philadelphia1 genome changes greatly in fluorescence polarization compared to the PCR amplification product not containing the template in 1 minute after mixing. did. Thereby, it can be understood that the SP1-GST fusion protein specifically binds to a PCR amplification product containing the SP1 recognition sequence amplified from a template of 100 copies or more. That is, it was revealed that a PCR amplification product obtained from a small amount of Legionella pneumophila subsp. Pneumophila philadelphia1 genome of about 100 copies can be specifically detected using the SP1-GST fusion protein.

3.13. Example 13
[Selection of SP2 target sequence in Legionella pneumophilia genome]
First, by using NCBI nucleotide BLAST Search for short nearly exact matches, a 10 base sequence of GGGCGGGACT, an SP2 recognition sequence, was searched from the genome of Legionella pneumophila. The genome sequence of Legionella pneumophila was according to the previous report (GenBank accession number: AE018354 (Strain Philadelphia 1), CR628337 (Strain Lens), CR628336 (Strain Paris)). Next, BLAST was used to search for a continuous 52-base sequence containing 21 bases as a primer region on each of the 5 ′ side and 3 ′ side of this 10 base sequence, and it was examined whether other bacteria had similar sequences. . Furthermore, a gene to be targeted was selected based on the number of other gene sequences serving as comparative controls for the gene, the evolution rate, the presence or absence of horizontal mobility, and the like.

  As a result, it was revealed that the SP2 recognition sequence and its 5 'and 3' primer regions showed high homology with the gene for the transmembrane protein of Legionella pneumophilia (locus tag = lpg1883). Based on the above results, the gene for the transmembrane protein of Legionella pneumophilia (locus tag = lpg1883) was selected as the target gene.

  FIG. 20 shows a 52 bp sequence alignment including the SP2 recognition sequence of the transmembrane protein gene (locustae = lpg1883) of three Legionella bacteria. According to FIG. 20, the 52 bp nucleotide sequence including the SP2 recognition sequence and the 21 bp primer region on each of the 5 ′ side and the 3 ′ side thereof shows high homology between Legionella pneumophilia. The homology to the genes of other organisms performed was low. Thus, it is considered that Legionella pneumophila Philadelphia1 can be specifically detected by using the 52 bp base sequence including the SP2 recognition sequence and the 21 bp primer region on each of the 5 'and 3' sides as a target sequence.

3.14. Example 14
[Preparation of SP2-GST fusion protein]
In this example, the SP2-GST fusion protein was prepared according to the procedure shown in FIG. 21 in the same manner as the SP1-GST fusion protein in Example 6.

  The vector pGEM / hSP2 was obtained by PCR amplification of the SP2 (hSP2) structural gene (264 bp) obtained from the human lymph gland cDNA library (TaKaRa) and TA cloning. Next, a restriction enzyme site (BamHI, EcoRI) was introduced into the obtained vector pGEM / hSP2, thereby obtaining an hSP2 gene fragment (276 bp). The hSP2 gene fragment was amplified and treated with a restriction enzyme, and then ligated with Schistosoma japonicum (Schistosoma japonicum) -derived GST fusion expression vector pGEX-2T to obtain vector pGEX / hSP2. The nucleotide sequences of the hSP2 structural gene and pGEX-2T were in accordance with the previous report (GenBank accession number: AE018354 (hSP2 structural gene), U13850 (pGEX-2T). The linker sequence between the SP2 structural gene and the GST structural gene was LVPRGS.

  Next, the vector pGEX / hSP2 was introduced into E. coli BL21 strain, this E. coli BL21 strain was cultured at 37 ° C., expression was induced with 0.1 mM IPTG, and the cells were collected and washed, and the cells were disrupted with a French press. did. The hSP2-GST fusion protein was obtained by affinity-purifying the water-soluble fraction of the disrupted microbial cells using a GSTrap ™ HF column. The purity of the hSP2-GST fusion protein was confirmed by performing GST activity measurement and SDS-PAGE.

  FIG. 22 shows the SDS-PAGE result of each eluted fraction. In the SDS-PAGE result of FIG. 22, a 34 kDa single band different from the GST band (28 kDa) was detected. This band is assumed to be that of the hSP2-GST fusion protein. From the above, it was confirmed that a high-purity hSP2-GST fusion protein was obtained.

3.15. Example 15
[Confirmation of binding ability between hSP2-GST fusion protein and target double-stranded DNA]
In this example, the binding ability between the hSP2-GST fusion protein obtained in Example 14 and the double-stranded DNA was confirmed by the same method (ELASA) as in Example 3.

Moreover, the sequence of the double-stranded DNA used is shown below (No. 1 to No. 3). “Bio” indicates biotin, and the underline is a zinc finger protein recognition sequence.
No.1: SP2-L.pneumophila target (Target 1)
Bio 5'- AAGCCAGTCATTATTTTTTTA GGG CGG GACT CTGAACATAACAGGTTTTGTC -3 '
3'- TTCGGTCAGTAATAAAAAAAT CCC GCC CTGA GACTTGTATTGTCCAAAACAG -5 '
No.2: SP2-L.pneumophila 1-mutation (Comparative Example 1, single nucleotide mutation)
Bio 5'- AAGCCAGTCATTATTTTTTTA GAG CGG GACT CTGAACATAACAGGTTTTGTC -3 '
3'- TTCGGTCAGTAATAAAAAAAT CTC GCC CTGA GACTTGTATTGTCCAAAACAG -5 '
No.3: SP2-L.pneumophila random (Comparative Example 2, random mutation)
Bio 5'- AAGCCAGTCATTATTTTTTTA CAC CCT GCGT CTGAACATAACAGGTTTTGTC -3 '
3'- TTCGGTCAGTAATAAAAAAAT GTG GGA CGCA GACTTGTATTGTCCAAAACAG -5 '
To a well coated with streptavidin (96-well plate), a double-stranded DNA (100 pmol / well) consisting of a single-stranded DNA labeled with biotin at its 5 ′ end and its complementary DNA is added at room temperature. After incubation for 2 hours, 2% skim milk was added, and blocking was performed at room temperature for 1 hour. Next, a fusion protein (SP2-GST fusion protein obtained in Example 14) 26 (5.7 pmol / well) was added and incubated at room temperature for 1 hour, and then anti-tag polypeptide antibody and substrate enzyme (anti-antigen). GST antibody-HRP (horseradish peroxidase) complex solution) was added and incubated at room temperature for 1 hour. Next, a coloring reagent (ABTS solution (0.4 mM ABTS (2,2′-Azinobis (3-ethylbenzothiazolin-6-sulfonic acid), 50 mM citric acid, 0.2% H 2 O 2, pH 4.0)) was added to well 18. Then, the absorbance of light having a wavelength of 405 nm was measured with a plate reader every 0, 15, 30, and 60 minutes, and the absorbance after 60 minutes is shown in FIG.

  According to FIG. 23, when target 1 (No. 1) is used as the double-stranded DNA, the absorbance is superior to that of single-base mutation and random mutant double-stranded DNA (No. 2, No. 3). it was high. Thereby, it can be understood that the SP2-GST fusion protein has the ability to bind to the target double-stranded DNA.

3.16. Example 16
[Confirmation of binding ability between SP2-GST fusion protein and PCR amplification product]
In this example, DNA amplification by PCR was performed using Legionella pneumophila subsp. Pneumophila philadelphia1 genome as a template. More specifically, biotin-modified primer and FITC (fluorescein isothiocyanate) -modified primer are used, Legionella pneumophila subsp. Pneumophila philadelphia1 genome is used as template, DNA polymerase is Herculase II fusion enzyme (STRATAGENE), and 95 ° C. for 2 minutes → (95 ° C. for 20 seconds → 55 ° C. for 20 seconds → 74 ° C. for 30 seconds) × 35 times → 74 ° C. for 2 minutes → 4 ° C. The PCR amplification product was obtained. As a control, Escherichia coli DH5α genome and Proteum vulgaris (IAM 1025) genome were used as templates, and a sample not containing the template was similarly subjected to PCR amplification to obtain PCR amplification products.

  The gel electrophoresis pattern of each PCR amplification product is shown in FIG. FIG. 24 (A) shows that when the Legionella pneumophila subsp. Pneumophila philadelphia1 genome was used as a template (No. 1), the target biotin-labeled 52 bp PCR amplification product was obtained.

  Subsequently, the binding ability between the SP2-GST fusion protein obtained in Example 14 and each PCR amplification product (No. 1 to 4) was confirmed by ELASA in the same manner as in Example 3. The result is shown in FIG. According to FIG. 24 (B), the PCR amplification product (No. 1) obtained using Legionella pneumophila subsp. Pneumophila philadelphia1 genome is higher than the other PCR amplification products (No. 2 to No. 4). Absorbance was shown. Thereby, it can be understood that the SP2-GST fusion protein specifically binds to the PCR amplification product containing the SP2 recognition sequence. That is, it was revealed that a PCR amplification product obtained using Legionella pneumophila subsp. Pneumophila philadelphia1 genome can be specifically detected using SP2-GST fusion protein.

3.17 Example 17
[Confirmation of detection limit of SP2-GST fusion protein and PCR amplification product]
In this example, DNA amplification by PCR was performed using Legionella pneumophila subsp. Pneumophila philadelphia1 genome of various copy numbers as a template. More specifically, 10000 copies, 1000 copies, 100 copies, 10 copies, 0 copies of Legionella pneumophila subsp. Pneumophila philadelphia1 genome were used as templates using biotin modified primers and FITC (fluorescein isothiocyanate) modified primers. Using Herculase II fusion enzyme (STRATAGENE) in the presence of Escherichia coli DH5α genome, 95 ° C for 2 minutes → (95 ° C for 20 seconds → 55 ° C for 20 seconds → 74 ° C for 30 seconds) x 35 times → 74 ° C for 2 minutes → 4 ° C PCR amplification was performed under the conditions to obtain a PCR amplification product.

  The gel electrophoresis pattern of each PCR amplification product is shown in FIG. 25A, it can be understood that the target biotin-labeled 52 bp PCR amplification product was obtained when 10 or more copies of Legionella pneumophila subsp. Pneumophila philadelphia1 genome was used as a template.

  Subsequently, in the same manner as in Example 3, the binding ability between the SP2-GST fusion protein obtained in Example 14 and each PCR amplification product (No. 1 to 5) was confirmed by ELASA. The result is shown in FIG. According to FIG. 25 (B), PCR amplification products (No. 1 to 4) obtained using 10 or more copies of Legionella pneumophila subsp. Pneumophila philadelphia1 genome are PCR amplification products (No. 5) that do not contain a template. The absorbance was higher than that. Thereby, it can be understood that the SP2-GST fusion protein specifically binds to the PCR amplification product containing the SP2 recognition sequence amplified from 10 or more copies of the template. That is, it was revealed that a PCR amplification product obtained from a small amount of Legionella pneumophila subsp. Pneumophila philadelphia1 genome of about 10 copies can be specifically detected using the SP2-GST fusion protein.

3.18. Example 18
[Confirmation of specificity of SP2-GST fusion protein for PCR amplification product]
In this example, the specificity of SP2 for the target sequence was confirmed. More specifically, 95 ° C. for 2 minutes → (95 ° C. for 20 seconds → 55 ° C. for 20 seconds → 74 ° C. for 30 seconds) using a total of 10 types (see FIG. 26) of mutation sequences in the recognition sequence and the primer region as templates. PCR amplification was performed under the conditions of × 35 times → 74 ° C. for 2 minutes → 4 ° C. to obtain a PCR amplification product.
The gel electrophoresis pattern of each PCR amplification product is shown in FIG. According to FIG. 27 (A), it can be understood that a 52 bp PCR amplification product was obtained in any sequence. This is probably because the primer regions are similar.

  Subsequently, the binding ability between the SP2-GST fusion protein obtained in Example 14 and each PCR amplification product (No. 1 to 10) was confirmed by ELASA in the same manner as in Example 3. The result is shown in FIG. According to FIG. 27 (B), the PCR amplification product (No. 1) of the target sequence showed higher absorbance than the PCR amplification product (No. 2 to 10) of the similar sequence. Thereby, it can be understood that the SP2-GST fusion protein recognizes a 1-2 base mutation and specifically binds only to the target sequence. That is, it was revealed that the PCR amplification product containing the target sequence can be specifically detected using the SP2-GST fusion protein.

3.19. Example 19
[Specificity of SP2-GST fusion protein for recognition sequence and confirmation of detection limit]
In this example, the specificity and binding ability of SP2 for the recognition sequence were confirmed. More specifically, in the same manner as in Example 3, the binding ability to the sequence mutated in the recognition sequence (see FIG. 26) was confirmed by ELISA.

  The result is shown in FIG. According to FIG. 28, the sequences containing the recognition sequence (No. 1, 4, 7) and the sequence having the single base mutation at the fourth residue of the recognition sequence (No. 5, 6) are the PCR amplification products of similar sequences. It showed higher absorbance than (No. 2-3, 8-10). Thus, it can be understood that the SP2-GST fusion protein cannot distinguish the mutation of the fourth residue of the recognition sequence, but can distinguish the other single nucleotide sequence. That is, it was revealed that SP2-GST fusion protein alone can be detected to a certain extent, but can be detected more specifically by combining with PCR. Subsequently, in order to confirm the detection limit for a target sequence having a recognition sequence, the binding ability to various concentrations of the target sequence was confirmed by ELISA in the same manner as in Example 3.

The result is shown in FIG. According to FIG. 29, the target sequence of 10 ¹² copies or more showed higher absorbance than the target sequence of less copy number. This revealed that the SP2-GST fusion protein can be detected if there are 10 ¹² or more copies of the target sequence.

  Kits and methods for detecting Legionella gene in a sample according to the present invention are not only used in laboratories, but also, for example, leisure facilities, baths, pools, artificial ponds, artificial rivers, etc. In addition to detection of Legionella in facilities, etc., and detection of Legionella infection in subjects at medical institutions, it is also used to detect Legionella spp. In the management of building facilities such as cooling water in outdoor cooling towers of air conditioners and hot water supply systems Available.

FIG. 1 schematically shows a Legionella pneumophilia gene and a zinc finger protein (Zif268) recognition sequence. FIG. 2 shows the zinc finger protein (Zif268) recognition sequence in the 2-deoxy-D-gluconate-3-dehydrogenase gene of Legionella pneumophilia and the nucleotide sequence alignment of its 5 'and 3' primer regions. FIG. 3 schematically shows the target nucleic acid detection kit used in Examples 3, 4 and 7. FIG. 4 shows the sequence alignment of the nucleotide sequence (biotin-labeled double-stranded DNA) 24 used in Example 3. FIG. 5 shows the results (absorbance) of ELISA for the Zif268-GST fusion protein that binds to the nucleotide sequence (biotin-labeled double-stranded DNA) 24 used in Example 3. FIG. 6 shows the sequence alignment of the PCR amplification product used for the ELISA in Example 4. FIG. 7 shows the electrophoresis pattern of the PCR amplification product obtained in Example 4. FIG. 8 shows the results (absorbance) of ELISA for the Zif268-GST fusion protein that binds to the PCR amplification product obtained in Example 4. FIG. 9 schematically illustrates the Legionella pneumophilia gene and the zinc finger protein (SP1) recognition sequence. FIG. 10 shows the nucleotide sequence alignment of the zinc finger protein (SP1) recognition sequence in the flhA gene of Legionella pneumophilia and its 5 'and 3' primer regions. FIG. 11 schematically illustrates a method for preparing an expression vector for a fusion protein of a zinc finger protein (SP1) and a tag polypeptide (GST) in Example 6. 12 (a) and 12 (b) show the results of SDS-PAGE of the fusion protein of the zinc finger protein (SP1) and the tag polypeptide (GST) obtained in Example 6. FIG. FIG. 13 shows the results (absorbance) of the ELISA for the nucleotide sequence used in Example 7. FIG. 14 shows a sequence alignment of the nucleotide sequence (biotin-labeled double-stranded DNA) 24 used in Example 8. FIG. 15 shows the results (absorbance) of ELISA for the Zif268-GST fusion protein that binds to the PCR amplification product obtained in Example 8. FIG. 16 (a) is a diagram schematically showing the genomic and zinc finger protein (Zif268, SP1) recognition sequences used in Example 9, and FIG. 16 (b) is the PCR amplification obtained in Example 9. The electrophoresis pattern of the product (the left figure shows the PCR amplification product when using template A containing the Zif268 recognition sequence, and the right figure shows the PCR amplification product when using template B containing the SP1 recognition sequence). FIG. 16 (c) shows a zinc finger protein-GST fusion protein that binds to the PCR amplification product obtained in Example 9 (the left figure shows the fusion protein when the fusion protein is a Zif268-GST fusion protein). Shows the result (absorbance) of ELISA for (when is a SP1-GST fusion protein). FIG. 17 (A) shows electrophoresis patterns of PCR amplification products obtained in Example 10 using various copy numbers of Legionella pneumophila subsp. Pneumophila philadelphia1 genome. FIG. 17 (B) shows the results (absorbance) of ELASA for confirming the binding ability between the SP1-GST fusion protein obtained in Example 6 and each PCR amplification product obtained in Example 10. FIG. 18 (A) shows the SP1 target sequence and the control sequence amplified by PCR in Example 11. FIG. 18 (B) shows an electrophoresis pattern of a PCR amplification product obtained from Legionella genome using two kinds of primers in Example 11. FIG. 18C shows the results (absorbance) of ELASA for confirming the binding ability of the SP1-GST fusion protein obtained in Example 6 to the PCR amplification product obtained in Example 11. FIG. 19 shows the degree of fluorescence polarization for confirming the binding ability between the SP1-GST fusion protein and the PCR amplification product using the fluorescence depolarization method in Example 12. FIG. 20 shows the results of a homology search for target sequences containing the SP2 recognition sequence in Example 13. FIG. 21 shows the cloning of the SP2-GST fusion protein in Example 14. FIG. 22 shows the results of SDS-PAGE of the purified SP2-GST fusion protein in Example 14. FIG. 23 shows the results (absorbance) of ELASA for confirming the binding ability of the SP2-GST fusion protein to the target double-stranded DNA in Example 15. FIG. 24 (A) shows the electrophoresis pattern of PCR amplification products from each genome in Example 16. FIG. 24B shows the results (absorbance) of ELASA for confirming the binding ability of the SP2-GST fusion protein to the PCR amplification product obtained in Example 16. FIG. 25 (A) shows electrophoresis patterns of PCR amplification products obtained using Legionella pneumophila subsp. Pneumophila philadelphia1 genome of various copy numbers in Example 17. FIG. 25 (B) shows the results (absorbance) of ELASA for confirming the binding ability of the SP2-GST fusion protein to the PCR amplification product in Example 17. FIG. 26 shows an SP2 recognition sequence in Example 18 and a similar sequence having a mutation introduced into the primer region. FIG. 27 (A) shows the electrophoresis pattern of PCR amplification products obtained using the 10 types of sequences in Example 18. FIG. 27 (B) shows the results (absorbance) of ELASA for confirming the binding ability of the SP2-GST fusion protein to the 10 types of PCR amplification products obtained in Example 18. FIG. 28 shows the results (absorbance) of ELASA for confirming the binding ability of SP2-GST fusion protein to the recognition sequence and the mutagenesis sequence in Example 19. FIG. 29 shows the results (absorbance) of ELASA for confirming the detection limit of SP2-GST fusion protein against the target sequence in Example 19.

Explanation of symbols

10 ... Legionella pneumophilia gene 12 ... Zinc finger protein (Zif268) recognition site 18 ... Well (96-well plate)
20 ... Streptavidin 22 ... Biotin 24 ... Biotin-labeled double-stranded DNA
26 ... Fusion protein of tag polypeptide and zinc finger protein 28 ... Anti-tag polypeptide antibody (anti-GST antibody)
30 ... Substrate enzyme (HRP)
32 ... Coloring reagent (ABTS)
40 ... pGEM / hSP1
42 ... hSP1 gene fragment 44 ... vector pGEX / hSP1

Claims (18)

A kit for detecting a target nucleic acid in a specimen,
The target nucleic acid is Legionella gene;
A kit comprising a primer pair designed to amplify a zinc finger protein recognition sequence present in the gene by a PCR reaction.   The kit according to claim 1, further comprising a zinc finger protein capable of binding to the zinc finger protein recognition sequence.   The kit according to claim 2, wherein the zinc finger protein is labeled with a detectable label.   The kit according to claim 2, wherein the zinc finger protein is in the form of a fusion protein with a tag polypeptide.   The kit according to claim 4, wherein the tag polypeptide is GST. The zinc finger protein is Zif268;
The kit according to any one of claims 2 to 5, wherein the zinc finger protein recognition sequence is 5'-GCGTGGGGCG-3 '. The zinc finger protein is SP1,
The kit according to any one of claims 2 to 5, wherein the zinc finger protein recognition sequence is 5'-GGGGCGGGGG-3 '. The zinc finger protein is SP2,
The kit according to any one of claims 2 to 5, wherein the zinc finger protein recognition sequence is 5'-GGGGGGACT-3 '.   The target nucleic acid is one selected from the genes for Legionella pneumophilia 2-deoxy-D-gluconate-3-dehydrogenase gene, Legionella pneumophilia flhA gene and Legionella pneumophilia transmembrane protein. The kit according to any one of 1 to 8.   The kit according to any one of claims 1 to 9, wherein the primer pair is labeled with a detectable label. A method for detecting a target nucleic acid in a sample, comprising:
The target nucleic acid is Legionella gene;
(A) amplifying a nucleic acid in a specimen by a PCR reaction using a primer pair designed to amplify a zinc finger protein recognition sequence present in the gene by a PCR reaction; and (b) a zinc finger. Using a protein to detect a PCR amplification product obtained by the amplification,
Including methods.   The method of claim 11, wherein the zinc finger protein is labeled with a detectable label.   The method according to claim 12, wherein the zinc finger protein is in the form of a fusion protein with a tag polypeptide.   14. The method of claim 13, wherein the tag polypeptide is GST. The zinc finger protein is Zif268;
The method according to any one of claims 11 to 14, wherein the zinc finger protein recognition sequence is 5'-GCGTGGGGCG-3 '. The zinc finger protein is SP1,
The method according to any of claims 11 to 14, wherein the zinc finger protein recognition sequence is 5'-GGGGCGGGGG-3 '. The zinc finger protein is SP2,
The method according to any one of claims 11 to 14, wherein the zinc finger protein recognition sequence is 5'-GGGGGGACT-3 '.   The target nucleic acid is one selected from the genes for Legionella pneumophilia 2-deoxy-D-gluconate-3-dehydrogenase gene, Legionella pneumophilia flhA gene and Legionella pneumophilia transmembrane protein. The method according to any one of 11 to 17.