JP2008086324A - Human g protein chemokine receptor hdgnr10 - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a compositions and a method for treating and/or diagnosing a number of physiological and pathological states containing immunological diseases. <P>SOLUTION: There provided are new mature receptor polypeptides as well as physiologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof, wherein the receptor polypeptides of the present invention are of human origin. Or in accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding the receptor polypeptides of the present invention, including an mRNA, a DNA, a cDNA, a genomic DNA as well as antisense analogs thereof and biologically active and diagnostically or therapeutically useful fragments thereof. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, and the production of such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention are human 7-transmembrane receptors that have been putatively identified as chemokine receptors, and will be referred to hereinafter sometimes as “G protein chemokine receptors” or “HDGNR10”. It is said. The invention also relates to inhibiting the action of such polypeptides.

  It is well established that many medically important biological processes are mediated by proteins involved in signaling pathways including G proteins and / or second messengers (eg cAMP) ( Lefkowitz, Nature, 351: 353-354 (1991)). In the present specification, these proteins are referred to as proteins involved in pathways using G proteins or PPG proteins. Some examples of these proteins include GPC receptors (eg, GPC receptors for adrenergic drugs and dopamine (Kobilka, BK, et al., PNAS, 84: 46-50 (1987); Kobilka, BK). Science, 238: 650-656 (1987); Bunzow, JR, et al., Nature, 336: 783-787 (1988)), G protein itself, effector protein (eg, phospholipase C, adenyl cyclase). , And phosphodiesterases), and actuator proteins (eg, protein kinase A and protein kinase C) (Simon, MI, et al., Science, 252: 802-8). Including the 1991)).

  For example, in one form of signal transduction, the effect of hormone binding is activation of the enzyme adenylate cyclase in the cell. Activation of the enzyme by hormones depends on the presence of the nucleotide GTP, and GTP also affects hormone binding. The G protein links the hormone receptor to adenylate cyclase. The G protein has been shown to convert GTP to bound GDP when activated by hormone receptors. The form with GTP then binds to activated adenylate cyclase. Hydrolysis of GTP to GDP is catalyzed by the G protein itself, returning the G protein to its basal inactive form. Thus, the G protein serves a dual role as an intermediate that relays the signal from the receptor to the effector and as a clock that controls the duration of the signal.

  The membrane protein gene superfamily of G protein-coupled receptors has been characterized as having seven putative transmembrane domains. This domain is thought to represent a transmembrane alpha helix joined by extracellular or cytoplasmic loops. G protein coupled receptors include a wide range of biologically active receptors such as hormones, viruses, growth factors and neuroreceptors.

  G protein-coupled receptors are characterized as containing these seven conserved hydrophobic ranges of about 20-30 amino acids that bind to at least eight open hydrophilic loops. The G protein family of coupled receptors includes dopamine receptors that bind to neuroleptics used in the treatment of psychosis and neurological disorders. Other examples of this family include calcitonin, adrenergic, endothelin, cAMP, adenosine, muscarinic, acetylcholine, serotonin, histamine, thrombin, kinin, follicle stimulating hormone, opsin, endothelial differentiation gene 1 receptor and rhodopsin, odorants, Includes cytomegalovirus receptor.

  G protein-coupled receptors can be bound intracellularly to various intracellular enzymes, ion channels and transporters by heterotrimeric G proteins (Johnson et al., Endoc., Rev., 10: 317-331 (1989). )checking). Different G protein α subunits preferably stimulate specific effectors to regulate various biological functions within the cell. Phosphorylation of cytoplasmic residues of G protein-coupled receptors has been identified as an important mechanism for the regulation of G protein coupling of several G protein-coupled receptors. G protein-coupled receptors are found at many sites in the mammalian host.

  Chemokines, also referred to as intercrine cytokines, are a subfamily of structurally and functionally related cytokines. These molecules are 8-10 kd in size. In general, chemokines exhibit 20% to 75% amino acid level homology and are characterized by four conserved cysteine residues that form two disulfide bonds. Based on the arrangement of the first two cysteine residues, chemokines are classified into two subfamilies, α and β. In the α subfamily, the first two cysteines are separated by one amino acid and are referred to hereinafter as the “CXC” subfamily. In the β subfamily; the two cysteines are in a contiguous position and are therefore referred to as the “C—C” subfamily. Thus, at least nine different members of this family have been identified in humans.

  Intercrine cytokines exhibit a wide variety of functions. A striking feature is the ability to induce chemotactic migration of different cell types, including monocytes, neutrophils, T lymphocytes, basophils, and glandular fibroblasts. Many cytokines have proinflammatory activity and are involved in multiple stages during the inflammatory response. These activities stimulate stimulation of histamine release, release of lysosomal enzymes and leukotrienes, increased adhesion of target immune cells to endothelial cells, enhanced complement protein binding, induction of granule cell adhesion molecules and complement receptor expression Including respiratory explosions. In addition to their association in inflammation, certain chemokines have been suggested to exhibit other activities. For example, macrophage inflammatory protein 1 (MIP-1) can suppress hematopoietic stem cell proliferation, platelet factor 4 (PF-4) is a potential inhibitor of endothelial cell proliferation, interleukin 8 (IL-8) Promotes keratinocyte proliferation and GRO is an autocrine growth factor for melanoma cells.

  In a wide range of biological activities, chemokines are involved in many physiological and disease states, including lymphocyte trafficking, wound healing, hematopoietic regulation and immunological diseases such as allergies, asthma and arthritis That is not surprising.

  To provide compositions and methods for diagnosing and / or treating a number of physiological and disease states, including immunological diseases.

  In accordance with one aspect of the invention, novel mature receptor polypeptides and fragments, analogs and derivatives thereof that are biologically active and useful for diagnosis or therapy are provided. The receptor polypeptides of the present invention are of human origin.

  According to another aspect of the invention, there is provided an isolated nucleic acid molecule encoding a receptor polypeptide of the invention, the nucleic acid molecule comprising mRNA, DNA, cDNA, genomic DNA, and antisense analogs thereof, and It includes biologically active fragments thereof that are useful for diagnosis or therapy.

  According to a further aspect of the invention, a recombinant prokaryotic host cell comprising a nucleic acid sequence encoding a receptor polypeptide of the invention and / or under conditions that facilitate expression of the polypeptide and subsequent recovery of the polypeptide. Recombinant techniques that include culturing recombinant eukaryotic host cells provide a process for producing such receptor polypeptides.

  According to yet a further aspect of the present invention, there are provided antibodies against such receptor polypeptides.

  According to another aspect of the invention, there are provided screening methods for compounds that bind to and activate or inhibit activation of the receptor polypeptides of the invention.

  According to yet another embodiment of the invention, there is provided a step of administering to a host a compound that binds to and activates a receptor polypeptide of the invention. This compound is useful for stimulating hematopoiesis, wound healing, coagulation, angiogenesis, treating solid tumors, chronic infections, leukemias, T cell mediated autoimmune diseases, parasitic infections, psoriasis, and growth factor activity Irritate.

  According to another aspect of the present invention, a method of administering a receptor polypeptide of the present invention via gene therapy for treating conditions associated with underexpression of a polypeptide or underexpression of a ligand of a receptor polypeptide. Is provided.

  According to yet another embodiment of the invention, there is provided a step of administering to a host a compound that binds to and inhibits the activation of a receptor polypeptide of the invention. This compound is associated with allergy, atherogenesis, hypersensitivity, malignancy, chronic and acute inflammation, histamine and IgE-mediated allergic reactions, prostaglandin-independent fever, bone marrow failure, silicosis, sarcoids, rheumatoid arthritis It is useful for the prevention and / or treatment of shock and hypereosinophilic syndrome.

  According to yet another aspect of the present invention, there is provided a nucleic acid probe containing a nucleic acid molecule of sufficient length to specifically hybridize to a polynucleotide sequence of the present invention.

  According to yet another aspect of the invention, to detect diseases associated with mutations in nucleic acid sequences encoding such polypeptides, as well as to detect altered levels of soluble forms of the receptor polypeptides. Diagnostic assays are provided.

  According to a still further aspect of the invention, such receptor polypeptides, or polynucleotides encoding such polypeptides, are used for in vitro purposes related to scientific research, DNA synthesis and DNA vector production. A process is provided for use.

  These and other aspects of the invention should be apparent to those skilled in the art from the teachings herein.

The accompanying drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

  According to the present invention, in a wide range of biological activities, numerous chemokines are involved, including lymphocyte trafficking, wound healing, hematopoietic regulation and immunological diseases such as allergy, asthma and arthritis. Compositions and methods for treating and / or diagnosing physiological and disease states are provided.

  According to an aspect of the present invention, the mature polypeptide having the deduced amino acid sequence (SEQ ID NO: 2) of FIGS. 1-3, or American Type Culture Collection, 12301 as ATCC Accession No. 97183 on June 1, 1995. An isolated nucleic acid (polynucleotide) is provided that encodes a mature polypeptide encoded by the cDNA of a clone deposited with Parklawn Drive, Rockville, Maryland, 20852, United States of America.

  The polynucleotide of the present invention was discovered in a cDNA library derived from human monocytes. This is structurally related to the G protein coupled receptor family. This includes an open reading frame encoding a protein of 352 amino acid residues. The protein exhibits the highest degree of homology over a range of 347 amino acids with 70.1% identity and 82.9% similarity to the human MCP-1 receptor.

  The polynucleotides of the present invention can be in the form of RNA or in the form of DNA, which includes cDNA, genomic DNA, and synthetic DNA. DNA can be double-stranded or single-stranded, and in the case of single-stranded can be a coding strand or a non-coding (antisense) strand. The coding sequence encoding the mature polypeptide can be identical to the coding sequence shown in FIGS. 1-3 (SEQ ID NO: 1) or the coding sequence of the deposited clone, or the coding sequence can be duplicated of the genetic code or As a result of degeneracy, it may be a different coding sequence encoding the same mature polypeptide as the DNA of FIGS. 1-3 (SEQ ID NO: 1) or the deposited cDNA.

  The polynucleotide encoding the mature polypeptide of FIGS. 1-3 or the mature polypeptide encoded by the deposited cDNA can include: the coding sequence of the mature polypeptide only; the coding sequence of the mature polypeptide, as well as the transmembrane Additional coding sequences such as (TM) or intracellular domains; coding sequences of mature polypeptides (and any additional coding sequences) and non-coding sequences (eg, 5 ′ and / or 3 of coding sequences of introns or mature polypeptides) 'Non-coding array).

  Thus, the term “polynucleotide encoding a polypeptide” encompasses a polynucleotide that includes only the coding sequence of the polypeptide, as well as a polynucleotide that includes additional coding and / or non-coding sequences.

  The invention further provides variants of the polynucleotides herein above that encode a polypeptide having the deduced amino acid sequence of FIGS. 1-3, or fragments, analogs and derivatives of the polypeptide encoded by the cDNA of the deposited clone. About. A variant of the polynucleotide can be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.

Accordingly, the present invention provides a polynucleotide encoding the same mature polypeptide as shown in FIGS. 1-3 (SEQ ID NO: 2) or the same mature polypeptide encoded by the cDNA of the deposited clone, as well as such a polypeptide. Includes nucleotide variants. This variant encodes a polypeptide fragment, derivative or analog encoded by the polypeptide of FIGS. 1-3 (SEQ ID NO: 2) or the cDNA of the deposited clone. Such nucleotide variants include deletion variants, substitution variants, and addition or insertion variants.

  As indicated herein above, the polynucleotide is a coding sequence that is a naturally occurring counter-gene variant of the coding sequence shown in FIGS. 1-3 (SEQ ID NO: 1) or the coding sequence of the deposited clone. Can have. As is known in the art, an allelic variant is another form of a polynucleotide sequence that can have one or more nucleotide substitutions, deletions or additions, which impairs the function of the encoded polypeptide. Does not change substantially.

  The polynucleotide may also encode a soluble form of a G protein chemokine receptor polypeptide that is an extracellular portion of a polypeptide cleaved from the TM and intracellular domains of the full-length polypeptide of the invention.

  A polynucleotide of the invention may also have a coding sequence fused in frame to a marker sequence that allows for purification of the polypeptide of the invention. The marker sequence can be a hexahistidine tag supplied by the pQE-9 vector that provides for purification of the mature polypeptide fused to the marker in the case of bacterial hosts. Alternatively, for example, the marker sequence can be a hemagglutinin (HA) tag when a mammalian host (eg, COS-7 cells) is used. The HA tag is consistent with an epitope derived from influenza hemagglutinin protein (Wilson, I. et al., Cell, 37: 767 (1984)).

  The term “gene” refers to a DNA segment involved in the production of a polypeptide chain; it intervenes between the region preceding and following the coding region (leader and trailer) and individual coding segments (exons). Sequence (intron).

  Fragments of full-length genes of the present invention are for isolating full-length cDNAs and for isolating other cDNAs that have a high sequence similarity to this gene or have similar biological activity It can be used as a hybridization probe of a cDNA library. This type of probe preferably has at least 30 bases and may contain, for example, 50 or more bases. This probe can also be used to identify cDNA clones that correspond to full-length transcripts, as well as genomic clone (s) that contain the complete gene including regulatory and promoter regions, exons, and introns. An example of screening involves isolating the coding region of a gene by using a known DNA sequence to synthesize an oligonucleotide probe. A labeled oligonucleotide having a sequence complementary to the sequence of the gene of the present invention is used to screen a human cDNA library, genomic DNA or mRNA to determine which member of the library the probe will hybridize to. used.

  The present invention further relates to polynucleotides that hybridize to the herein above sequences when there is at least 70%, preferably at least 90% and more preferably at least 95% identity between the sequences. The invention particularly relates to polynucleotides that hybridize under stringent conditions to the polynucleotides described herein above. The term “stringent conditions” as used herein means that hybridization occurs only if there is at least 95% and preferably at least 97% identity between the sequences. In a preferred embodiment, the polynucleotide that hybridizes to the polynucleotide described herein above is substantially the same organism as the mature polypeptide encoded by the cDNA of FIGS. 1-3 (SEQ ID NO: 1) or the deposited cDNA. Encodes a polypeptide that retains either a pharmacological function or activity.

  Alternatively, the polynucleotide may have at least 20 bases, preferably 30 bases, and more preferably 50 bases. These hybridize to the polynucleotides of the invention and have identity thereto and may or may not retain activity as described herein above. For example, such a polynucleotide can be used, for example, as a probe of the polynucleotide of SEQ ID NO: 1, or as a diagnostic probe or PCR primer for recovery of the polynucleotide.

  Accordingly, the present invention relates to polynucleotides having at least 70%, preferably at least 90%, and more preferably at least 95% identity. This polynucleotide encodes the polynucleotide of SEQ ID NO: 2, as well as fragments thereof, which fragment is at least 30 bases, and preferably 50 bases. The present invention relates to a polynucleotide encoded by such a polynucleotide.

  The deposit (s) referred to herein are maintained under the Budapest Treaty on the International Approval of Deposits of Microorganisms in Patent Procedures. These deposits are provided only as a convenience to those of ordinary skill in the art and are not admitted that deposits are required under 35 USC 112. The sequence of the polynucleotide contained in the deposit, as well as the amino acid sequence of the polypeptide encoded thereby, is incorporated herein by reference and reduces any discrepancies with the description of the sequence herein. ing. A license may be required to make or sell the deposit, and no such license is granted hereby.

  The invention further provides a G protein chemokine receptor polypeptide having the deduced amino acid sequence of FIGS. 1-3 (SEQ ID NO: 2) or having the amino acid sequence encoded by the deposited cDNA, as well as of such a polypeptide. , Analogs and derivatives.

  The terms “fragment”, “derivative” and “analog” refer to the polypeptides of FIGS. 1-3 or the polypeptide encoded by the deposited cDNA, or biological functions substantially the same as such polypeptides or Retains activity (ie, functions as a G protein chemokine receptor) or has the ability to bind to a ligand or receptor even if the polypeptide does not function as a G protein chemokine receptor (eg, a soluble form of this receptor). Means a polypeptide that is either retained. Analogs include proproteins that can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

  The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.

  Fragments, derivatives or analogs of the polypeptide of FIGS. 1-3 (SEQ ID NO: 2) or the polypeptide encoded by the deposited cDNA are: (i) one or more amino acid residues are conserved or non-conserved Those substituted with amino acid residues (preferably conserved amino acid residues) and such substituted amino acid residues may or may not be amino acid residues encoded by the genetic code; Or (ii) one or more amino acid residues containing a substituent, or (iii) the mature polypeptide is another compound such as a compound (eg, polyethylene glycol) that increases the half-life of the polypeptide; What is fused, or (iv) an additional amino acid is fused to the mature polypeptide for purification of the polypeptide Those are, or (v) a fragment of the polypeptide is soluble (i.e. not membrane bound), noted may be one further coupling the ligand to the membrane bound receptor. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

  The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form and are preferably purified to homogeneity.

  The polypeptide of the invention comprises SEQ ID NO: 2 (especially the mature polypeptide) and at least 70% similarity (preferably 70% identity) with the polypeptide of SEQ ID NO: 2, and more preferably SEQ ID NO: 90% similarity (more preferably 90% identity) with two polypeptides, and even more preferably 95% similarity (even more preferably 90% identity) with the polypeptide of SEQ ID NO: 2. And a polypeptide against a portion of such a polypeptide having such a portion of a polypeptide generally comprising at least 30 amino acids and more preferably at least 50 amino acids.

  “Similarity” between two polypeptides, known in the art, is determined by comparing the amino acid sequence of the polypeptide and the conserved amino acid substitutions of the polypeptide with the sequence of the second polypeptide. The

  Fragments or portions of the polypeptides of the invention can be used to produce the corresponding full length polypeptide by peptide synthesis. Thus, this fragment can be used as an intermediate to produce a full-length polypeptide. Fragments or portions of the polynucleotides of the invention can be used to synthesize full-length polynucleotides of the invention.

  The term “gene” refers to a DNA segment involved in the production of a polypeptide chain; this includes the region preceding and subsequent to the coding region (“leader” and “trailer”) and the individual coding segments (exons) It contains a sequence (intron) intervening in between.

  The term “isolated” means that the material is removed from its original environment (eg, the natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but is separated from some or all of the coexisting materials in the natural system. The nucleotide or polypeptide has been isolated. Such a polynucleotide can be part of a vector and / or such a polynucleotide or polypeptide can be part of a composition, and such a vector or composition can be of its natural environment. Since it is not part, it can still be isolated.

  The polypeptide of the present invention comprises a polypeptide of SEQ ID NO: 2 (especially a mature polypeptide) and at least 70% similarity (preferably at least 70% identity) to the polypeptide of SEQ ID NO: 2, and more Preferably at least 90% similarity (more preferably at least 90% identity) with the polypeptide of SEQ ID NO: 2, and even more preferably at least 95% similarity (even more) with the polypeptide of SEQ ID NO: 2. A portion of such a polypeptide comprising a polypeptide having preferably at least 95% identity) and also having such a portion of a polypeptide generally comprising at least 30 amino acids and more preferably at least 50 amino acids including.

  “Similarity” between two polypeptides, known in the art, is obtained by comparing the amino acid sequence of one polypeptide and its conserved amino acid substitutions to the sequence of a second polypeptide. It is determined.

  Fragments or portions of the polypeptides of the invention can be used to produce the corresponding full length polypeptide by peptide synthesis. Thus, this fragment can be used as an intermediate to produce a full-length polypeptide. Fragments or portions of the polynucleotides of the invention can be used to synthesize full-length polynucleotides of the invention.

  The invention also relates to vectors comprising the polynucleotides of the invention, host cells genetically engineered using the vectors of the invention, and production of the polypeptides of the invention by recombinant techniques.

  Host cells are genetically engineered (transduced, transformed or transfected) with the vectors of the invention, which can be, for example, a cloning vector or an expression vector. ) The vector can be in the form of, for example, a plasmid, viral particle, phage, or the like. Engineered host cells can be cultured in conventional nutrient media suitably modified to activate the promoter, select for transformants, or amplify the genes of the present invention. Culture conditions (eg, temperature, pH, etc.) are those previously used for the host cell selected for expression and will be apparent to those skilled in the art.

  The polynucleotides of the present invention can be used to produce polypeptides by recombinant techniques. Thus, for example, a polynucleotide can be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal DNA sequences, non-chromosomal DNA sequences, and synthetic DNA sequences. Such vectors include, for example, SV40 derivatives; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA (eg, vaccinia, adenovirus, fowlpox virus, And pseudorabies). However, any other vector can be used as long as it is replicable and viable in the host.

  The appropriate DNA sequence can be inserted into the vector by a variety of procedures. In general, a DNA sequence is inserted into an appropriate restriction endonuclease site by procedures known in the art. Such and other procedures are considered to be within the scope of those skilled in the art.

The DNA sequence in the expression vector is operably linked to an appropriate expression control sequence (promoter) to direct mRNA synthesis. Representative examples of such promoters may include: LTR or SV40 promoter, E.I. coli lac or trp, lambda phage P _L promoter, and prokaryotic or eukaryotic cells or other promoters known to control expression of genes in the virus. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also contain appropriate sequences for amplifying expression.

Furthermore, the expression vector preferably has a phenotypic characteristic for selection of transformed host cells (eg dihydrofolate reductase or neomycin resistance for eukaryotic cell cultures, or tetracycline resistance or ampicillin for example in E. coli . One or more selectable marker genes that provide resistance).

  Vectors containing appropriate DNA sequences as described herein above as well as appropriate promoter or control sequences can be used to transform a suitable host to express the protein in the host.

Representative examples of suitable hosts may include the following: bacterial cells (eg, E. coli , Streptomyces , Salmonella typhimurium ); fungal cells (eg, yeast); insect cells (eg, Drosophila S2 and Spodoptera Sf9 ) Animal cells (eg, CHO, COS or Bowes melanoma); adenoviruses; plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also encompasses recombinant constructs comprising one or more sequences broadly described above. The construct includes a vector (for example, a plasmid vector or a viral vector) into which the sequence of the present invention is inserted in the forward direction or the reverse direction. In a preferred aspect of this embodiment, the construct further comprises a regulatory sequence (eg, including a promoter) operably linked to the sequence. A large number of suitable vectors and promoters are known to those skilled in the art and are commercially available. The following vectors are provided as examples. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescript
SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene); pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector can be used as long as they are replicable and viable in the host.

The promoter region can be selected from any desired gene using a CAT (chloramphenicol transferase) vector or other vector with a selectable marker. Two suitable vectors are PKK232-8 and PCM7. Particularly well known bacterial promoters include lacI, lacZ, T3, T7, gpt, λP _R , P _L and trp. Eukaryotic promoters include CMV immediate form, HSV thymidine kinase, early and late SV40, LTR from retrovirus, and mouse metallothionein I. The selection of appropriate vectors and promoters is well within the level of ordinary skill in the art.

  In a further embodiment, the present invention relates to a host cell containing the above construct. The host cell can be a higher eukaryotic cell (eg, a mammalian cell) or a lower eukaryotic cell (eg, a yeast cell) or the host cell is a prokaryotic cell (eg, a bacterial cell). obtain. Introduction of the construct into the host cell can be accomplished by calcium phosphate transfection, DEAE-dextran mediated transfection, or electroporation (Davis, L., Divner, M., Battey, I., Basic Methods in Molecular Biology, 1986).

  The construct in the host cell can be used to produce the gene product encoded by the recombinant sequence in a conventional manner. Alternatively, the polypeptides of the present invention can be produced synthetically by conventional peptide synthesizers.

  The mature protein can be expressed under the control of a suitable promoter in mammalian cells, yeast, bacteria, or other cells. Cell-free translation systems can also be used to produce such proteins using RNA derived from the DNA constructs of the present invention. Suitable cloning and expression vectors for use in prokaryotic and eukaryotic hosts are described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor, N .; Y. (1989), the disclosure of which is incorporated herein by reference.

  Transcription of the DNA encoding the polypeptide of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to about 300 bp, that act on a promoter to increase its transcription. Examples include the late SV40 enhancer bp 100-270 of the origin of replication, the early promoter enhancer of cytomegalovirus, the polyoma enhancer late of the origin of replication, and the adenovirus enhancer.

In general, recombinant expression vectors direct the transcription of an origin of replication and selectable markers that allow for host cell transformation (eg, the E. coli ampicillin resistance gene and the S. cerevisiae TRP1 gene) and downstream structural sequences. Contains a promoter derived from a highly expressed gene. Such promoters can be derived from operons encoding glycolytic enzymes (eg, 3-phosphoglycerate kinase (PGK)), alpha factor, acid phosphatase, or heat shock proteins. The heterologous structural sequence is assembled in appropriate phase with a translation initiation and translation termination sequence, and preferably a leader sequence that can direct secretion of the translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein comprising an N-terminal identification peptide that confers the desired characteristics (eg, stabilization or simplified purification of the expressed recombinant product).

Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding the desired protein, together with appropriate translation initiation and termination signals, in a functional promoter and operable reading phase. The The vector contains one or more phenotypic selection markers and an origin of replication to ensure maintenance of the vector and optionally provide amplification in the host. Suitable prokaryotic hosts for transformation, E. Although various species within the genera E. coli , Bacillus subtilis , Salmonella typhimurium , and Pseudomonas, Streptomyces, and Staphylococcus, other species can also be used as selection targets.

As a representative but non-limiting example, expression vectors useful for bacterial use include selectable markers and bacterial origins of replication derived from commercial plasmids containing the gene element of the well-known cloning vector pBR322 (ATCC 37017). May be contained. Such commercially available vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega).
Biotec, Madison, WI, USA). These pBR322 “backbone” parts are combined with a suitable promoter and the structural sequence to be expressed.

  Following transformation of the appropriate host strain and growth of the host strain to the appropriate cell density, the selected promoter is induced by appropriate means (eg, temperature shift or chemical induction) and the cells are cultured for an additional period of time. Is done.

  Cells are typically collected by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.

  Microbial cells used in protein expression can be disrupted by any convenient method, including freeze-thaw cycles, sonication, mechanical disruption, or the use of cytolytic agents. Such methods are well known to those skilled in the art.

  Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 strain of monkey kidney fibroblasts described in Gluzman, Cell, 23: 175 (1981), and other cell lines that can express compatible vectors (eg, C127, 3T3, CHO, HeLa, and BHK cell lines). Mammalian expression vectors contain an origin of replication, appropriate promoters and enhancers, and any necessary ribosome binding sites, polyadenylation sites, splice donor and splice acceptor sites, transcription termination sequences, and 5 ′ flanking non-transcribed sequences. contains. DNA sequences derived from SV40 splice sites and polyadenylation sites can be used to provide the necessary non-transcribed genetic elements.

  G protein chemokine receptor polypeptides can be recovered from recombinant cell culture and purified by methods including the following. Ammonium sulfate precipitation or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography. If necessary, protein refolding steps can be used to complete the placement of the mature protein. Finally, high performance liquid chromatography (HPLC) can be used for final purification steps.

  The polypeptides of the present invention can be natural purified products, or products of chemical synthesis procedures, or prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects in culture, And mammalian cells) by recombinant techniques. Depending on the host used for the recombinant production procedure, the polypeptides of the invention may or may not be glycosylated. The polypeptides of the present invention may also contain an initial methionine amino acid residue.

  The polynucleotides and polypeptides of the invention can be used as research reagents and materials for the discovery of treatments and diagnoses for human diseases.

  The G protein chemokine receptor of the present invention can be used in a process for screening for an activation compound (agonist) or activation inhibitory compound (antagonist) of the receptor polypeptide of the present invention.

  In general, such screening procedures involve providing appropriate cells that express the receptor polypeptide of the present invention on the cell surface. Such cells can be mammalian, yeast, Drosophila, or E. coli. Including cells derived from Coli. In particular, a polynucleotide encoding the receptor of the present invention is used to transfect cells, thereby expressing the G protein chemokine receptor. The expressed receptor is then contacted with a test compound to observe binding, stimulation or inhibition of a functional response.

  One such screening procedure involves the use of melanophore cells transfected to express the G protein chemokine receptor of the invention. Such screening techniques are described in PCT WO 92/01810 (published February 6, 1992).

  Thus, for example, such assays may include compounds that inhibit activation of the receptor polypeptides of the invention by contacting both the receptor ligand and compound to be screened with the melanophore cells encoding the receptor. Can be used to screen. Inhibition of the signal produced by the ligand indicates that the compound is a potential antagonist for this receptor, ie, inhibits activation of the receptor.

  This screen can be used to determine compounds that activate the receptor by contacting such cells with the compound being screened, and determining whether such a compound produces a signal, That is, it can be used to determine whether such compounds activate the receptor.

  Other screening techniques are described in, for example, a system that measures extracellular pH changes caused by receptor activation, as described in Science 246, 181-296 (October 1989). Includes the use of cells that express the G protein chemokine receptor (eg, transfected CHO cells). For example, a compound can be contacted with a cell that expresses a receptor polypeptide of the invention, and a second messenger response (eg, signal transduction or pH change) determines whether a potential compound activates or inhibits the receptor. Can be measured to determine.

  Another such screening technique involves introducing RNA encoding the G protein chemokine receptor into Xenopus oocytes and causing the receptor to express temporarily. When screening for a compound that appears to inhibit receptor activation, the receptor oocyte can then be contacted with the receptor ligand and the compound being screened, followed by detection of inhibition or activation of the calcium signal. .

  Another screening technique involves the expression of a G protein chemokine receptor whose receptor is linked to phospholipase C or D. Representative examples of such cells include endothelial cells, smooth muscle cells, fetal kidney cells and the like. Screening can be accomplished by detection of inhibition of receptor activation by receptor activation or a secondary signal of phospholipase, as described hereinabove.

  Another method involves screening for compounds that inhibit the activation of receptor polypeptides of the antagonists of the present invention by determining inhibition of binding of the labeled ligand to cells having the receptor on the cell surface of the labeled ligand. Such a method comprises transfecting a eukaryotic cell with DNA encoding a G protein chemokine receptor such that the cell expresses the receptor on its surface, and the cell and compound in the presence of a labeled form of a known ligand. A step of contacting the surface. The ligand can be labeled, for example, by radioactivity. The amount that the labeled ligand binds to the receptor is measured, for example, by measuring the radioactivity of the receptor. When the compound binds to the receptor as determined by a decrease in labeled ligand binding to the receptor, binding of the labeled ligand to the receptor is inhibited.

  The antibody may antagonize the G protein chemokine receptor of the present invention, or in some cases, an oligonucleotide that binds to the G protein chemokine receptor but does not elicit a second messenger response that inhibits the activity of the G protein chemokine receptor. . Antibodies generally include anti-idiotype antibodies that recognize unique determinants that associate with the antigen-binding site of the antibody. Potential antagonist compounds also include proteins closely related to the ligands of G protein chemokine receptors, ie, fragments of the ligand, which lack biological functions and bind to G protein chemokine receptors. Sometimes does not provoke a response.

Antisense constructs prepared by the use of antisense technology can be used to control triple helix formation or gene expression via antisense DNA or RNA, both of which can be used when the polynucleotide is DNA or RNA. Based on joining. For example, the 5 ′ coding portion of a polynucleotide sequence encoding a mature polypeptide of the invention is used to design an antisense RNA oligonucleotide of about 10-40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of genes involved in transcription (triple helix-Lee et al., Nucl. Acids Res., 6: 3073 (1979); Cooney et al., Science, 241: 456 (1988); And Dervan et al., Science, 251: 1360 (1991)), thereby inhibiting transcription and production of G protein chemokine receptors. Antisense RNA oligonucleotides hybridize to mRNA in vivo and block translation of mRNA molecules to G protein-coupled receptors (Antisense-Okano, J. Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors). of Gene
Expression, CRC Press, Boca Raton, FL (1988)). The above oligonucleotides can also be delivered to cells so that antisense RNA or DNA can be expressed in vivo to inhibit the production of G protein chemokine receptors.

  Small molecules that bind to a G protein chemokine receptor that renders inaccessible ligands that inhibit normal biological activity, such as small peptides or peptide-like molecules, also include receptor polypeptides of the invention Can be used to inhibit the activation of.

  Soluble forms of the G protein chemokine receptor (eg, a fragment of the receptor) bind to the ligand for the polypeptide of the invention and activate the receptor by protecting the ligand from interaction with the membrane bound G protein chemokine receptor. Can be used to inhibit.

  Compounds that bind to and activate the G protein chemokine receptor of the present invention are solid tumors, chronic infections, leukemias, T cell mediated self-stimulation to stimulate haematopoiesis, wound healing, coagulation, angiogenesis. It can be used to treat immune diseases, parasitic infections, psoriasis and stimulate the activity of growth factors.

  Compounds that bind to and inhibit the G protein chemokine receptor of the present invention include allergies, atherogenesis, hypersensitivity, malignant, chronic and acute inflammation, histamine and IgE mediated allergic reactions, prostaglandin independent fever, It can be used to treat bone marrow failure, silicosis, sarcoidosis, rheumatoid arthritis, shock and eosinophilia syndrome.

  The compounds can be used in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the compound, and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.

  The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the pharmaceutical composition of the present invention. For such container (s), the product label may be labeled in a form prescribed by a government agency that controls the manufacture, use or sale of the drug or biological product. Represents the approval by the institution in the manufacture, use or sale of. In addition, the compounds of the invention can be used in combination with other therapeutic compounds.

  The pharmaceutical composition can be administered in a convenient manner, eg, by topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, or intradermal routes. The pharmaceutical composition can be administered in an amount effective to treat and / or prevent specific symptoms. In general, the pharmaceutical compositions are administered in an amount of at least about 10 μg / kg body weight, and often they are administered in an amount not exceeding about 8 mg / kg body weight per day. In many cases, the dosage is about 10 μg / kg body weight to about 1 mg / kg body weight per day, and the route of administration, symptoms, etc. are considered (CONFIRM DOSAGES).

  G protein chemokine receptor polypeptides and antagonists or agonists, which are polypeptides, can also be used in accordance with the present invention by expression of such polypeptides in vivo. This is often referred to as “gene therapy”.

  Thus, for example, a patient-derived cell can be engineered ex vivo using a polynucleotide (DNA or RNA) encoding the polypeptide, and the engineered cell is then provided to the patient to be treated with the polypeptide. Is done. Such methods are well known in the art. For example, cells can be manipulated by procedures known in the art through the use of retroviral particles containing RNA encoding a polypeptide of the invention.

  Similarly, cells can be manipulated in vivo for expression of the polypeptide in vivo, for example, by procedures known in the art. As is known in the art, production cells for producing retroviral particles containing RNA encoding a polypeptide of the invention can be used to manipulate cells in vivo and to express polypeptides in vivo. Can be administered to patients. These and other methods for administering the polypeptides of the present invention by such methods will be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for manipulating the cell can be something other than a retrovirus (eg, an adenovirus). This can be used to manipulate cells in vivo after combining with a suitable delivery vehicle.

  The retroviruses derived from retroviral plasmid vectors that can be derived herein are Moloney murine leukemia virus, splenic necrosis virus, retrovirus (eg, Rous sarcoma virus), Harvey sarcoma virus, chicken leukemia virus, gibbon leukemia virus, This includes, but is not limited to, human immunodeficiency virus, adenovirus, spinal growth sarcoma virus, and mammalian tumor virus. In one embodiment, the retroviral plasmid vector is derived from Moloney murine leukemia virus.

  The vector contains one or more promoters. Suitable promoters that can be used are the retroviral LTR; SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller et al., Biotechniques, 7, 9, 980-990 (1989), or any Other promoters include, but are not limited to, cell promoters such as, but not limited to, histone, pol III, and β-actin promoters. Other viral promoters that can be used include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of an appropriate promoter will be apparent to those skilled in the art from the techniques included herein.

  The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter. Suitable promoters that may be used include, but are not limited to: adenovirus promoters such as the adenovirus major late promoter; also heterologous promoters such as the cytomegalovirus (CMV) promoter; RS virus (respiratory synchronization) virus) (RSV) promoter; inducible promoter such as MMT promoter; metallothionein promoter; heat shock promoter; albumin promoter; ApoAI promoter; human globulin promoter; viral thymidine kinase promoter such as herpes simple thymidine kinase promoter; Including the modified retroviral LTR as defined herein above); β-actin Promoter; and human growth hormone promoter. The promoter can also be a native promoter that controls the gene encoding the polypeptide.

Retroviral plasmid vectors are used to transduce packaging cell lines to form producer cell lines. Examples of packaging cells that can be transfected include PE501, PA317, ψ-2, ψ-AM, PA12, T19-14X, VT-19-17-H2, ψCRE, ψCRIP, GP + E-86, GP + envAm12, and the present specification Miller, Human Gene, which is incorporated by reference in its entirety
These include, but are not limited to, the DAN cell line described in Therapy, Volume 1, pages 5-14 (1990). The vector can transduce the packaging cells through any method known in the art. Such techniques include, but are not limited to, electroporation, the use of liposomes, and CaPO ₄ precipitation. In one other method, the retroviral plasmid vector can be encapsulated in liposomes or associated with lipids and then administered to the host.

  The producer cell line produces infectious retroviral vector particles that include the nucleic acid sequence (s) encoding the polypeptide. Such retroviral vector particles can then be used to transduce eukaryotic cells either in vitro or in vivo. Transduced eukaryotic cells express the nucleic acid sequence (s) encoding the polypeptide. Eukaryotic cells that can be transduced include, but are not limited to, embryonic stem cells, embryonic cancer cells, and hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells. Not.

  The present invention also provides a method for determining whether a ligand that is not known to be capable of binding to a G protein chemokine receptor can bind to such a receptor, the method comprising the ligand G Contacting a mammalian cell expressing a G protein chemokine receptor under conditions that permit binding of the ligand to the protein chemokine receptor with the ligand, detecting the presence of the ligand bound to the receptor, and thereby the ligand is a G protein Determining whether it binds to a chemokine receptor. The systems for determining agonists and / or antagonists described herein can also be used to determine ligands that bind to receptors.

  The present invention also provides a method for detecting the expression of a G protein chemokine receptor polypeptide of the present invention on the surface of a cell by detecting the presence of mRNA encoding the receptor, the method comprising: Contacting the obtained mRNA with a nucleic acid probe containing a nucleic acid molecule of at least 10 nucleotides capable of specifically hybridizing to a sequence contained in the sequence of the nucleic acid molecule encoding the receptor, under hybridizing conditions. And detecting the presence of mRNA hybridized to the probe, and thereby detecting receptor expression by the cell.

  The present invention also provides a method for identifying receptors associated with the receptor polypeptides of the present invention. These related receptors interact by homology to the G protein chemokine receptor polypeptides of the invention, by low stringency cross-hybridization, or with related natural or synthetic ligands, and / or chemokine receptors of the invention By identifying receptors that elicit similar behavior after genetic or pharmaceutical blockade of the polypeptide, it can be identified by homology to the G protein chemokine receptor polypeptides of the invention.

  A fragment of a gene can be used as a hybridization probe in a cDNA library to isolate other genes that have a high sequence similarity to the gene of the present invention or have similar biological activity. This type of probe is at least 20 bases, preferably at least 30 bases, and most preferably at least 50 bases or more. The probe is also used to identify cDNA clone (s) corresponding to the full-length transcript and genomic clone (s) containing the complete gene of the present invention including regulatory and promoter regions, exons and introns. Can be done. An example of this type of screen involves isolating the coding region of a gene using a known DNA sequence for synthesizing oligonucleotide probes. A labeled oligonucleotide having a sequence complementary to the sequence of the gene of the present invention screens a library of human cDNA, genomic cDNA, or mRNA to determine which member of the library hybridizes to the probe. Used.

  The present invention also contemplates the use of the gene of the present invention as a diagnostic agent. For example, some diseases are caused by inherited defective genes. These genes can be detected by comparing the sequence of the defective gene with the sequence of the normal gene. Consequently, “mutant” genes can be demonstrated to be associated with aberrant receptor activity. Further, as yet another means for demonstrating and identifying mutations, mutant receptor genes can be expressed using functional assay systems (eg, colorimetric assays in HEK293 cell receptor-deficient strains, expression on MacConkey plates, For expression in a complementation test) it can be inserted into a suitable vector. Once a “mutant” gene is identified, a population of carriers of “mutant” receptor genes can then be screened.

  Individuals with mutations in the genes of the present invention can be detected at the DNA level by various techniques. Nucleic acids for diagnosis can be obtained from patient cells including, but not limited to, blood, urine, saliva, tissue biopsy, and autopsy material. Genomic DNA can be used directly for detection or can be amplified enzymatically by using PCR prior to analysis (Saiki et al., Nature, 324: 163-166 (1986)). RNA or cDNA can also be used for the same purpose. As an example, PCR primers complementary to the nucleic acids of the invention can be used to identify and analyze mutations in the genes of the invention. For example, deletions and insertions can be detected by a change in the size of the amplified product in comparison to the normal genotype. Point mutations can be detected by hybridizing amplified DNA to radiolabeled RNA of the present invention or to radiolabeled antisense DNA sequences of the present invention. Perfectly paired sequences can be distinguished from mismatched duplexes by ribonuclease A digestion or differences in melting temperatures. Such a diagnosis is particularly useful for prenatal testing or neonatal testing.

  Sequence differences between related genes and “mutant” genes can be revealed by direct DNA sequencing. In addition, the cloned DNA segment can be used as a probe to detect a specific DNA segment. The sensitivity of this method is greatly enhanced when combined with PCR. For example, sequence primers are used with double stranded PCR products or single stranded template molecules generated by modified PCR. Sequencing is performed by conventional methods using radiolabeled nucleotides or by automated sequencing using fluorescent tags.

  Genetic testing based on DNA sequence differences can be accomplished by detecting changes in the electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Sequence changes at specific positions are also revealed by nuclease protection assays (eg, RNase protection and S1 protection or chemical cleavage methods (eg, Cotton et al., PNAS, USA, 85: 4397-4401 (1985))). obtain.

  In addition, some diseases are the result of or characterized by changes in gene expression that can be detected by changes in mRNA. Alternatively, the genes of the present invention can be used as a reference to identify individuals that express the reduced function associated with this type of receptor.

  The invention also relates to diagnostic assays for detecting altered levels of soluble forms of the G protein chemokine receptor polypeptides of the invention in various tissues. Assays used to detect the level of soluble receptor polypeptide in a sample derived from a host are well known in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and preferably ELISA assays. To do.

  An ELISA assay initially comprises preparing an antibody (preferably a monoclonal antibody) specific for an antigen of a G protein chemokine receptor polypeptide. In addition, receptor antibodies are prepared against monoclonal antibodies. To the receptor antibody is attached a detectable agent such as, for example, radioactivity, fluorescence, or in this example, a horseradish peroxidase enzyme. The sample is then removed from the host and incubated on a solid support (eg, a polystyrene dish) that binds to the protein in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. The monoclonal antibody is then incubated in the dish, during which time the monoclonal antibody binds to any G protein chemokine receptor protein attached to the polystyrene dish. All unbound monoclonal antibody is washed with buffer. The receptor antibody linked to horseradish peroxidase is then placed in a dish, resulting in binding of the receptor antibody to any monoclonal antibody bound to the G protein chemokine receptor protein. Unbound receptor antibody is then washed. A peroxidase substrate is then added to the dish, and the amount of color that appears at a given time interval is a measure of the amount of G protein chemokine receptor protein present in a given volume of patient sample as compared to a standard curve. is there.

  The sequences of the present invention are also useful for chromosome identification. This sequence can specifically target a specific location on an individual human chromosome and hybridize to that location. Furthermore, it is now necessary to identify specific sites on the chromosome. Currently, there are few chromosomal labeling reagents based on actual sequence data (repetitive polymorphisms) available for chromosomal location labeling. The mapping of DNA to chromosomes according to the present invention is an important first step in correlating these sequences with genes related to disease.

  Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from cDNA. Computer analysis of cDNA is used to quickly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

  PCR mapping of somatic cell hybrids is a rapid procedure for assigning specific DNA to specific chromosomes. Using the present invention with the same oligonucleotide primers, sublocalization can be achieved using a panel of fragments from a particular chromosome or a pool of large genomic clones in a similar manner. Other mapping schemes that can also be used to map to chromosomes include in situ hybridization, pre-screening on labeled flow-sorted chromosomes, and high-level constructs for building chromosome-specific cDNA libraries. Includes pre-selection by hybridization.

  Fluorescence in situ hybridization (FISH) to the metaphase chromosome spread of cDNA clones can be used to provide accurate chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases. For a review of this technology, see Verma et al., Human Chromosomes: A Manual of Basic Technologies, Pergamon Press, New York (1988).

  Once a sequence has been mapped to a precise chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. Such data is, for example, V. McKusick, found in Mendelian Inheritance in Man (available online from the Johns Hopkins University Welch Medical Library). The relationship between the gene mapped to the same chromosomal region and the disease is then identified by linkage analysis (simultaneous inheritance of physically adjacent genes).

  Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If the mutation is observed in some or all affected individuals but not in normal individuals, the mutation appears to be a causative factor of the disease.

At the current resolution of physical and genetic mapping techniques, a cDNA that is accurately positioned in a chromosomal region associated with a disease can be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and 1 gene per 20 kb.)
This polypeptide, fragments or other derivatives thereof, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies against them. These antibodies can be, for example, polyclonal antibodies or monoclonal antibodies. The invention also encompasses chimeric antibodies, single chain antibodies and humanized antibodies, as well as Fab fragments, or products of Fab expression libraries. Various procedures known in the art can be used for the production of such antibodies and fragments.

  Antibodies raised against a polypeptide corresponding to a sequence of the invention can be obtained by direct injection of the polypeptide into an animal or by administration of the polypeptide into an animal. This animal is preferably non-human. The antibody thus obtained then binds to the polypeptide itself. In this way, even sequences that encode only fragments of a polypeptide can be used to generate antibodies that bind to the entire native polypeptide. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.

  For the preparation of monoclonal antibodies, any technique that provides antibodies produced by continuous culture of cell lines can be used. Examples produce hybridoma technology (Kohler and Milstein, 1975, Nature, 256: 495-497), trioma technology, human B cell hybridoma technology (Kozbor et al., 1983, Immunology Today 4:72), and human monoclonal antibodies. EBV hybridoma technology (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).

  Techniques described for producing single chain antibodies (US Pat. No. 4,946,778) can be adapted to produce single chain antibodies to the immunogenic polypeptide products of the invention. Transgenic mice can also be used for expression of humanized antibodies against the immunogenic polypeptide products of the invention.

  The invention will be further described with reference to the following examples; however, it is to be understood that the invention is not limited to such examples. All parts or amounts are on a weight basis unless otherwise specified.

  In order to facilitate understanding of the following examples, certain frequently occurring methods and / or terms are described.

  A “plasmid” is manifested by showing a capital letter and / or number before and / or following a lowercase p. The starting plasmids herein are either commercially available, publicly available without limitation, or can be constructed from plasmids available according to published procedures. In addition, plasmids equivalent to the plasmids described are known in the art and are generally apparent to those skilled in the art.

  “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at specific sequences in the DNA. The various restriction enzymes used herein are commercially available, and their reaction conditions, cofactors, and other requirements were used as known to those skilled in the art. For analytical purposes, typically about 2 units of enzyme are used in about 20 μl of buffer solution for 1 μg of plasmid or DNA fragment. For the purpose of isolating DNA fragments for plasmid construction, typically 5-50 μg of DNA is digested in larger volumes with 20-250 units of enzyme. Appropriate buffers and substrate weights for specific restriction enzymes are specified by the manufacturer. An incubation time of about 1 hour at 37 ° C is usually used, but this can vary according to the supplier's instructions. After digestion, the reaction is directly electrophoresed on a polyacrylamide gel to isolate the desired fragment.

  Size separation of cleaved fragments is described by Goeddel, D. et al. Et al., Nucleic Acids Res. 8: 4057 (1980), using an 8% polyacrylamide gel.

  “Oligonucleotide” refers to either a single-stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands, which can be chemically synthesized. Such synthetic oligonucleotides do not have a 5 'phosphate and therefore do not ligate to another oligonucleotide without the addition of phosphate and ATP in the presence of a kinase. Synthetic oligonucleotides are ligated to fragments that are not dephosphorylated.

  “Ligation” refers to the process of forming a phosphodiester bond between two double stranded nucleic acid fragments (Maniatis, T et al., Supra, page 146). If not otherwise provided, ligation can be accomplished using 10 units of T4 DNA ligase (“ligase”) per 0.5 μg of DNA fragments to be ligated in known buffers and conditions. .

  Unless stated, transformation was performed in Graham, F .; And Van der Eb, A.M. Virology, 52: 456-457 (1973).

Example 1 Bacterial Expression and Purification of HDGNR10
PCR oligonucleotide corresponding to the DNA sequence encoding HDGNR10 (ATCC Accession No. 97183) to the 5 ′ sequence of the processed HDGNR10 protein (excluding the signal peptide sequence) and the 3 ′ vector sequence to the HDGNR10 gene Amplify first using primers. Additional nucleotides corresponding to HDGNR10 were added to the 5 ′ and 3 ′ sequences, respectively. The 5 'oligonucleotide primer has the sequence 5'CGGAATTCCTCCATCATGGATTATCAAGGTCA3' and contains an EcoRI restriction enzyme site followed by an 18 nucleotide HDGNR10 coding sequence starting from the predicted terminal amino acid of the processed protein codon. The 3 ′ sequence, 5′CGGAAGCTTCGTCACAAGCCCCACAGATAT3 ′, contains a sequence complementary to the HindIII site and subsequently contains 18 nucleotides of the coding sequence of HDGNR10. The restriction enzyme site corresponds to the restriction enzyme site on the bacterial expression vector pQE-9 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91111). pQE-9 encodes antibiotic resistance (Amp ^r ), bacterial origin of replication (ori), IPTG regulatable promoter operator (P / O), ribosome binding site (RBS), 6-His tag, and restriction enzyme site To do. PQE-9 was then digested with EcoRI and HindIII. The amplified sequence was ligated to pQE-9 and inserted in frame with sequences encoding histidine tag and RBS. The ligation mixture is then used to, E. E. coli strain M15 / rep4 (Qiagen, Inc.). Et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15 / rep4 contains multiple copies of plasmid pREP4 that expresses the lacI repressor and also confers resistance to kanamycin (Kan ^r ). Transformants were identified by their ability to grow on LB plates and ampicillin / kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction enzyme analysis. A clone containing the desired construct was grown overnight (O / N) in liquid culture in LB medium supplemented with both Amp (100 μg / ml) and Kan (25 μg / ml). Large cultures are inoculated with O / N cultures at a ratio of 1: 100 to 1: 250. Cells were grown until the optical density of ⁶⁰⁰ (OD ⁶⁰⁰ ) was between 0.4 and 0.6. IPTG (“Isopropyl-BD-thiogalactopyranoside”) was then added to a final concentration of 1 mM. IPTG clears P / O and induces increased gene expression by inactivating the lacI repressor. Cells were grown for an additional 3-4 hours. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic drug 6M guanidine HCl. After clarification, the solubilized HDGNR10 was purified from this solution by chromatography on a nickel-chelate column under conditions that allow it to bind more tightly to the protein containing the 6-hist tag. Hochuli, E et al. Chromatography 411: 177-184 (1984). HDGNR10 was eluted from the column with 6M guanidine HCl (pH 5.0) and adjusted to 3M guanidine HCl, 100 mM sodium phosphate, 10 mM glutathione (reduced), and 2 mM glutathione (oxidized) for regeneration purposes. After 12 hours incubation in this solution, the protein was dialyzed against 10 mM sodium phosphate.

(Example 2 Expression of recombinant HDGNR10 in COS cells)
Expression of the plasmid, HDGNR10 HA, is derived from the vector pcDNAI / Amp (Invitrogen). The vector pcDNAI / Amp contains: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E. coli. E. coli origin of replication, 4) CMV promoter followed by polylinker region, SV40 intron and polyadenylation site. The complete HDGNR10 precursor and a DNA fragment encoding the HA tag fused in-frame to its 3 ′ end were cloned into the polylinker region of the vector. Therefore, recombinant protein expression is governed under the CMV promoter. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984). , Cell 37,767). The fusion of the HA tag to the target protein allows easy detection of the recombinant protein using an antibody that recognizes the HA epitope.

The plasmid construction strategy is described below:
The DNA sequence encoding HDGNR10 (ATCC Accession No. 97183) was constructed by PCR using two primers: 5 ′ primer 5′GTCCCAAGCTTGCCACCATGGATTATCAAGGTCA3 ′ is a HindIII site followed by 18 of the HDGNR10 coding sequence starting from the start codon. 3 'sequence 5' CTAGCTCGAGTCCAAGCGTAGTCTGGGGACGTCGTCATGGCTAGCACAAGCCCACAGAATTATTC 3 'includes a sequence complementary to the XhoI site, translation stop codon, HA tag, and the last 18 nucleotides of the HDGNR10 coding sequence (not including the stop codon). Therefore, the PCR product contains a HindIII site, an HDGNR10 coding sequence followed by an in-frame fused HA tag, a translation stop codon adjacent to the HA tag, and an XhoI site. PCR amplified DNA fragments and vectors (pcDNAI / Amp) were digested with HindIII and XhoI restriction enzymes and ligated. The ligation mixture is treated with E. coli. E. coli strains (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, Calif. 92037) were inoculated into ampicillin media plates and resistant colonies were selected. Plasmid DNA was isolated from the transformants and tested for restriction fragments by restriction analysis. For expression of recombinant HDGNR10, COS cells were transfected with an expression vector by the DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring 198 (Spring Lab 9). )). The expression of HDGNR10 HA protein was detected by radiolabeling and immunoprecipitation. (E. Harlow, D. Lane, Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells were labeled for 8 hours with ³⁵ S-cysteine two days after transfection. The culture medium was then collected and the cells were washed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris (pH 7. 5)) (Wilson, I., et al., Ibid 37: 767 (1984)) Both cell lysates and culture medium were precipitated with HA-specific monoclonal antibodies. Analysis on PAGE gel.

Example 3 Cloning and Expression of HDGNR10 Using Baculovirus Expression System
The DNA sequence encoding the full length HDGNR10 protein (ATCC Accession No. 97183) was amplified using PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of the gene.

  The 5 ′ primer has the sequence 5′CGGGATCCCTCCATGGATTATCAAGGTCA3 ′ and 4 nucleotides (J. Mol. Biol. 1987, 196, similar to a BamHI restriction enzyme site followed by an efficient signal for initiation of translation in eukaryotic cells. 947-950, Kozak, M.), and immediately thereafter, the first 18 nucleotides of the HDGNR10 gene (the translation initiation codon is “ATG”).

  The 3 'primer has the sequence 5'CGGGATCCCGCTCCACAAGCCCCACAGATAT 3' and contains 18 nucleotides complementary to the restriction endonuclease BamHI cleavage site and the 3 'untranslated sequence of the HDGNR10 gene. Amplified sequences were isolated from a 1% agarose gel using a commercially available kit (“Geneclean” BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the endonuclease BamHI and purified as described above. This fragment is referred to as F2.

  The vector pRG1 (a variant of the pVL941 vector, described below) is used for the expression of HDGNR10 protein using a baculovirus expression system (for review, Summers, MD and Smith, GE 1987, A manual of methods). For baculovirus vectors and insect cell culture procedures, see Texas Agricultural Experimental Bulletin No. 1555). This expression vector contains the strong polyhedrin promoter of Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition site for the restriction endonuclease BamHI. The polyadenylation site of simian virus (SV) 40 is used for efficient polyadenylation. For easy selection of recombinant viruses, The β-galactosidase gene from E. coli is inserted in the same direction as the polyhedrin promoter, followed by a polyadenylation signal for the polyhedrin gene. The polyhedrin sequence is flanked on both ends with viral sequences for cell-mediated homologous recombination of co-transfected wild type viral DNA. Many other baculovirus vectors can be used in place of pRG1. For example, pAc373, pVL941, and pAcIM1 (Luckow, VA and Summers, MD, Virology, 170: 31-39).

  The plasmid was digested with the restriction enzyme BamHI and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA was then isolated from a 1% agarose gel as described above. This vector DNA is referred to as V2.

  Fragment F2 and dephosphorylated plasmid V2 were ligated using T4 DNA ligase. Then E. E. coli HB101 cells were transformed and the enzyme BamHI was used to identify bacteria containing a plasmid carrying the HDGNR10 gene (pBacHDGNR10). The sequence of the cloned fragment was confirmed by DNA sequencing.

Plasmid pBacHDGNR10 of 5 [mu] g, lipofection method (Felgner et al. Proc.Natl.Acad.Sci.USA, 84: 7413-7417 (1987) ) using a commercially available linearized baculovirus 1.0 [mu] g ( "BaculoGold ^TM Baculovirus DNA ", Pharmingen, San Diego, CA.).

1 μg of BaculoGold ^™ virus DNA and 5 μg of plasmid pBacHDGNR10 were mixed in sterile wells of a microtiter plate containing 50 μl of serum-free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Then 10 μl Lipofectin and 90 μl Grace's medium were added, mixed and incubated for 15 minutes at room temperature. The transfection mixture was then added dropwise to Sf9 insect cells (ATCC CRL 1711) seeded in 35 mm tissue culture plates with 1 ml of serum-free Grace's medium. The plate was shaken back and forth to mix the newly added solution. The plates were then incubated for 5 hours at 27 ° C. After 5 hours, the transfection solution was removed from the plate and 1 ml of Grace insect medium supplemented with 10% fetal calf serum was added. Plates were returned to the incubator and culture continued at 27 ° C. for 4 days.

  After 4 days, supernatants were collected and plaque assays were performed as described by Summers and Smith (supra). As a modification, an agarose gel with “Blue Gal” (Life Technologies Inc., Gaithersburg), which allows easy isolation of blue-stained plaques, was used. (A detailed description of the “plaque assay” can also be found in the user's guide to insect cell culture and baculovirology distributed at Life Technologies Inc., Gaithersburg, page 9-10).

  Four days after serial dilutions of the virus were added to the cells, the blue stained plaques were picked up with an Eppendorf pipette tip. The agar containing the recombinant virus was then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar was removed by simple centrifugation and the supernatant containing the recombinant baculovirus was used to infect Sf9 cells seeded in 35 mm dishes. After 4 days, the supernatants of these culture dishes were collected and then stored at 4 ° C.

Sf9 cells were cultured in Grace's medium supplemented with 10% heat-inactivated FBS. Cells were infected with recombinant baculovirus V-HDGNR10 at a multiplicity of infection (MOI) of 2. After 6 hours, the medium was removed and replaced with SF900 II medium (Life Technologies Inc., Gaithersburg) without methionine and cysteine. After 42 hours, 5 μCi ³⁵ S-methionine and 5 μCi ³⁵ S cysteine (Amersham) were added. The cells were further incubated for 16 hours, after which the cells were harvested by centrifugation and the labeled protein was visualized by SDS-PAGE and autoradiography.

Example 4 Expression via Gene Therapy
Fibroblasts were obtained from subjects by skin biopsy. The resulting tissue was placed in tissue culture medium and divided into small sections. A small section of tissue is placed on the wet surface of a tissue culture flask and approximately 10 sections are placed in each flask. Rotate the flask up and down, seal tightly and leave at room temperature overnight. After 24 hours at room temperature, the flask is inverted and the tissue section is kept fixed at the bottom of the flask and fresh medium (eg, Ham's F12 medium with 10% FBS, penicillin, streptomycin) is added. To do. This is then incubated at 37 ° C. for about 1 week. At this time, fresh medium is added and replaced every few days thereafter. After a further 2 weeks of culture, a monolayer of fibroblasts results. The monolayer is trypsinized and scaled to a larger flask.

  PMV-7 (Kirschmeier, PT et al., DNA, 7: 219-25 (1988)) adjacent to the long terminal repeat of Moloney murine sarcoma virus is digested with EcoRI and HindIII and then calf intestinal phosphatase Process with. The linear vector is separated on an agarose gel and purified using glass beads.

  The cDNA encoding the polypeptide of the present invention is amplified using corresponding PRC primers of 5 'and 3' end sequences, respectively. The 5 'primer contains an EcoRI site and the 3' primer contains a HindIII site. Equal amounts of Moloney murine sarcoma virus linear backbone and EcoRI and HindIII fragments are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions suitable for ligation of the two fragments. The ligation mixture is used for transformation of bacterial HB101, which is then plated on an agar plate containing kanamycin for the purpose of confirming that the vector has the gene of interest properly inserted. To do.

  Amphoteric pA317 or GP + am12 packaging cells are grown to confluent density in tissue culture in Dulbecco's modified Eagle medium (DMEM) containing 10% calf serum (CS), penicillin and streptomycin. The MSV vector containing the gene is then added to the medium and the packaging cells are transduced with the vector. At this point, the packaging cells produce infectious viral particles that encompass the gene (at this point the packaging cells are called producer cells).

Fresh medium is added to the transduced producer cells, after which the medium is recovered from a 10 cm plate of confluent producer cells. The spent medium containing infectious virus particles is filtered through a Millipore filter to remove the separated producer cells, and this medium is then used to infect fibroblasts. The medium is removed from the sub-confluent plate of fibroblasts and quickly replaced with medium from the producer cells. Remove this medium and replace with fresh medium. If the virus titer is high, virtually all fibroblasts are infected and no selection is required. If the titer is very low, it is necessary to use a retroviral vector with a selectable marker (eg, neo or his ).

  The engineered fibroblasts are then injected into the host, either alone or after confluent growth on cytodex 3 microcarrier beads. The fibroblast then produces a protein product.

  Many modifications and variations of the present invention are possible in light of the above teachings, and therefore, the invention may be practiced within the scope of the appended claims unless otherwise specified.

It is a figure which shows the cDNA sequence of the G protein coupled receptor of this invention, and a corresponding deduced amino acid sequence. Use standard single letter abbreviations for amino acids. Sequencing was performed using a 373 automated DNA sequencer (Applied Biosystems, Inc.). It is a continuation of FIG. It is a continuation of FIG. It is a figure which illustrates alignment of the amino acid sequence between G protein chemokine receptor of this invention, and a human MCP-1 receptor.

Claims (1)

An isolated polynucleotide containing a member selected from the group consisting of:
(a) a polynucleotide encoding the polypeptide represented by SEQ ID NO: 2;
(b) a polynucleotide encoding a mature polypeptide encoded by DNA contained in ATCC Deposit No. 97183;
(c) a polynucleotide capable of hybridizing to said polynucleotide (a) or (b) and having at least 70% identity; and
(d) The polynucleotide fragment of the polynucleotide (a), (b) or (c).

Images