JP2007508029A - Molecular level detection of Mycobacterium avium subsp. Paratuberculosis - Google Patents

Abstract

The present invention relates to molecular level detection and identification of Mycobacterium avium subsp. Paratuberculosis (MAP). More particularly, it results in the development of PCR assays using one or more oligonucleotide primers targeted to various genomic regions of IS900 factors specific for MAP.

Description

  The present invention relates to molecular level detection of Mycobacterium avium subsp. Paratuberculosis (MAP). More particularly, it relates to PCR assays using pairs of oligonucleotide primers targeted to various genomic regions of IS900 factors specific for MAP for use in molecular level detection and identification of MAP.

  Mycobacterium avium subsp. Paratuberculosis (MAP) is a bacterium that requires meticulous attention in terms of microbiological identification and may be severe and deadly to several animals. Many diseases can cause paratuberculosis (Johne's disease). Furthermore, with increasing reports, this particular bacterial MAP is being associated with the pathogenesis of certain human infectious bowel diseases. (Chiodini, 1989), (Chamberlin et al., 2001).

  The identification of MAP is now easy due to the wide application of molecular level techniques. However, the current method is cumbersome because of the need for verification of the results, and in practice it is often applicable only for research purposes.

  More specifically, serological diagnosis of MAP infection is to avoid the many false negative results in the early stages of infection and cross-reactivity with genetically related natural Mycobacterium species. Further confirmation is needed (Ridge et al., 1991; Nielsen et al., 2001). The usefulness of culture as a diagnostic or confirmation method is impaired by the long incubation period required for MAP to grow.

  Thus, it has long been thought that the polymerase chain reaction (PCR) is a very useful tool for detecting and identifying the above bacteria (Hance et al., 1989). However, even for molecular techniques, confirmation of results is necessary, especially when the techniques are applied to routine diagnostics. For this reason, it is usually considered to incorporate a hybridization assay, but in this case, the entire procedure becomes complicated and can be applied only for research purposes.

  Therefore, a method using a low-cost and rapid PCR that can be surely incorporated when identifying MAP from clinical materials as a daily work is very important. Even at low cost, it must be very sensitive and highly specific. It is also very important to ensure that the reproducibility of the results is very good. In particular, methods that work well in one laboratory often give results that cannot be used when used in another laboratory.

  The present invention has enabled the development of a low-cost and rapid method using PCR that can be reliably incorporated when identifying MAP from clinical materials or any other material as a routine task.

In order to ensure the reliability of the assay of the present invention and the reproducibility of the results in different laboratories, cross-laboratory verification was performed.
According to the present invention, it has become possible to develop a method for detecting and identifying MAP as a daily work from tissue samples derived from humans, animals, plants and others. The method is applicable not only to clinical materials but also to other materials derived from humans, animals or plants, dust, general foods, and the like.

The assay of the present invention combines optimum performance and cost with high reproducibility and is applicable in different laboratories, regardless of the various individual conditions and practices.
The present invention relates to the oligonucleotide primers described below, namely P1N GCATGGCCCCAGAGGAGTTGAG
P2N CTACAACAAGAGCCGCTGCG
P3N GGGTGTGGCGTTTTCCTTCG
P4N TCCTGGGGCGCTGAGGTCTCTC
This is accomplished by the development of a PCR assay using one or more of these.

  In a preferred embodiment, a combination of oligonucleotide primers is used to create a set of oligonucleotides. Preferred oligonucleotide sets are P1N / P3N, P1N / P4N, P2N / P3N, P2N / P4N, P1N / P2N / P3N, P1N / P2N / P4N, P1N / P3N / P4N, P2N / P3N / P4N. Particularly preferred is an oligonucleotide set consisting of all four oligonucleotide primers, ie P1N / P2N / P3N / P4N.

  These primers target the genomic region of IS900 element specific for MAP, and the primer can detect Mycobacterium avium subsp. Paratuberculosis (MAP) efficiently and quickly. Become. These primers were selected from many because good results were obtained.

  The use of the above-described oligonucleotide primers alone or in combination has been found to be suitable for reliably detecting MAP in a one-tube PCR assay.

  In a preferred embodiment, a combination of oligonucleotide primers is used to create a set of oligonucleotides. Oligonucleotide sets useful for the detection of MAP are P1N / P2N, P3N / P4N, P1N / P3N, P1N / P4N, P2N / P3N, P2N / P4N, P1N / P2N / P3N, P1N / P2N / P4N, P1N / P3N / P4N, P2N / P3N / P4N.

  In another particularly preferred embodiment, an oligonucleotide set consisting of all four oligonucleotide primers, ie P1N / P2N / P3N / P4N, is used. Even more preferred is the use of one tube nested PCR with all four oligonucleotide primers, namely P1N / P2N / P3N / P4N.

  To obtain a method for reliable detection of MAP by PCR, tests were conducted in several laboratories, including some laboratories in different countries. In order to detect the accuracy and reliability of the method, not all the various parameters that normally make up a PCR reaction were unified, and this factor was also incorporated into the evaluation of the method of the invention. The above approach has never been reported for MAP.

Evaluation has begun in various laboratories for DNA extraction methods and various PCR assays for MAP detection. For DNA extraction, one uses a laboratory-specific method, one uses a commercially available method, and for PCR, a number of different assays, including primer specificity assessment using an extended search of the GenBank database. evaluated.

  Thus, we have reached a one-tube nested PCR assay, two nested PCR assays, and a single PCR assay targeting different genomic regions of IS900 elements specific for MAP. These four methods were applied to positive and negative control samples, which were obtained from pure bacterial cultures and formalin fixation collected from paratuberculosis cattle and chickens infected with Mycobacterium avium. It was assumed to be composed of a paraffin-embedded tissue sample (FFPE). When conducting the test, all samples were identified by code number and the results were communicated between laboratories in collaboration. On the basis of reliability and cost, good results were obtained by combining the one-tube nested PCR assay using the oligonucleotide primers described above with a laboratory-specific DNA extraction method. This method yielded the expected results from the positive and negative control samples used and could be distinguished from genetically relevant Mycobacterium species. Concordance of the results obtained from the various laboratories where the tests were conducted suggests that the presented assay is reliable even under different laboratory conditions.

(material)
DNA was extracted from the culture and clinical material (formalin-fixed paraffin-embedded tissue sample (FFPE)) and the molecular level techniques described below were performed on the DNA.

  More specifically, cultures of 10 Mycobacterium avium subspecies Paratuberculosis (MAP) strains and 30 other various Mycobacterium strains (described in detail in Table 1) were used. To assess the specificity of the described method, culture of several genetically relevant bacterial species (Escherichia coli, Staphylococcus aureus, Salmonella, Enterobacter) The thing was used.

  The clinical material (tissue sample) included in the conducted tests was composed of formalin-fixed paraffin-embedded tissue samples (FFPE) collected from cattle and chickens. Ten intestinal FFPE samples with typical paratuberculosis lesions were used from cattle. From chickens, equal numbers of liver and intestinal FFPE samples with lesions of typical mycobacterial infection were used. Cattle and chicken-derived clinical materials were positive for MAP and Mycobacterium avium subspecies abium (MAA) in culture, respectively. In addition, fresh intestinal and lymph node FFPE samples taken from humans and animals with no clinical or other signs of mycobacterial infection were examined. This material was used as a negative control (this data is not shown here).

(Method)
A. DNA extraction from FFPE tissue samples and bacterial cultures DNA extraction from FFPE tissue samples was performed in two ways, with either method using 2 to 3 10 μm thick paraffin sections per sample.

    A1. DNA extraction was performed as previously described (laboratory proprietary method) (Ikonomopoulos et al., 1999), but the material was repeatedly incubated in xylene at 60 ° C., 100% ethanol and finally 75 The wax was removed with% ethanol. The product obtained in the processing step is digested by incubating in SDS and proteinase K at 50 ° C. for about 1 hour.

  These proteins were removed by sequential addition of phenol and phenol-chloroform-isoamyl alcohol solutions. Subsequently, the DNA is precipitated with ethanol and sodium acetate (Sambrook et al., 1989), recovered in the form of a precipitate, which is dissolved in 50 μl of TE buffer.

    A2. Alternatively, DNA extraction from FFPE samples was performed using a MicroLysis ™ kit (Microzone) according to the manufacturer's instructions.

DNA extraction from bacteria was performed by using CTAB-proteinase K followed by a combination of phenol and phenol / chloroform / isoamyl alcohol. The DNA extract was precipitated with ethanol and sodium acetate as described above.
Quality assessment of the amount, purity, and integrity of the DNA extract was performed by optical density calculation and agarose gel electrophoresis.

B. Polymerase chain reaction (PCR)
Numerous PCR assays were evaluated, including primer specificity assessment using an extended search of the GenBank database by NCBI BLAST. Thus, four different PCR assays using a total of seven pairs of oligonucleotide primers targeting the MAP-specific IS900 factor genomic region were reached and evaluated. These different PCR assays are described below in each of the items B1, B2, B3, and B4. More specifically, it will be described below.

  B1. Oligonucleotide primers IS900-F and IS900-R (shown in Table 2) were used in the first control PCR assay. These primers amplify a 707 bp DNA fragment of MAP IS900 factor (Green et al., 1989).

  B2. Another control PCR assay was a nested PCR using primers s204 and s749 (Table 2) that amplify a 563 bp DNA fragment of IS900 factor of MAP. A 1:10 dilution of the product of this reaction was incorporated into a second reaction using primers s345 and s535 (Table 2), which was internal to the 563 bp DNA fragment amplified with the s204 and s749 primers. The primer which amplifies a 210 bp DNA fragment (Englund et al., 1999).

  B3. Another control PCR assay was a nested PCR using primers IS01 and IS04 (Table 2) that amplify a 302 bp DNA fragment of the IS900 factor. A 1:10 dilution of the product of this reaction was incorporated into a second reaction using primers IS02 and IS03 (Table 2), which was 159 bp internal to the previously amplified 302 bp DNA fragment. It is a primer which amplifies the DNA fragment.

  B4. Finally, one PCR assay according to the present invention was a 1 tube nested PCR containing primers P1N, P2N, P3N, and P4N (Table 2). All primers are added simultaneously to a PCR reaction mixture that amplifies a 257 bp DNA fragment of IS900 factor.

The reaction mixture for each of the PCR assays described above was added to 50 mM KCl, 10 mM
Tris-HCl (pH 8.4 at room temperature), 1.5 mM MgCl ₂ , 0.25 μM of each oligonucleotide primer, 200 μM dNTP, 2.5 units of Taq polymerase (Promega), 0.05-0. 1 μg DNA was prepared using HPLC water with a final volume of 50 μl for assays B1 and B4 and 25 μl for assays B2 and B3.

  The temperature settings used for assays B1-B3 (Table 3) were 94 ° C for 5 minutes initial denaturation step followed by 94 ° C for 1 minute at 63 ° C (assay B1 and B2) or 62 ° C (assay B3). A cycle of 1 minute at 72 ° C. for 1 minute was performed 35 times. This step was followed by an incubation step of 10 minutes at 72 ° C. to complete the DNA product (Table 3). Nested reactions B2 and B3 were carried out at the same temperature settings in each stage, but assay B4 had different temperature settings for each of the two stages of the nested reaction (Table 3). The first step consists of an initial denaturation step at 94 ° C for 1 minute followed by 16 cycles of 94 ° C for 1 minute, 54 ° C for 1 minute, 72 ° C for 1 minute, and 94 ° C for 1 minute, 67 30 cycles of 1 minute at 72 ° C. and 1 minute at 72 ° C. followed by a final extension step of 3 minutes at 72 ° C. (Table 3). PCR products were analyzed by electrophoresis on a 2% agarose gel, stained with ethidium bromide and photographed.

  The sensitivity of each of the above methods was evaluated by applying the method to a 10-fold serial dilution of DNA extracted from the MAP culture, as previously reported (Ikonomopoulos et al., 1998).

(Reproducibility evaluation)
DNA extraction methods and PCR assays were applied to the reference and clinical materials described above under different specific conditions (thermal cycler type, DNA polymerase type, buffer) in each of the various laboratories. Samples were identified by code number and the results were compared between laboratories.

(result)
A. DNA extraction Methods A1 and A2 provided sufficient quality and quantity of DNA from the FFPE samples used. The amount of DNA obtained from 2-3 10 μm thick paraffin sections was estimated at 1 μg / μl and the quality (in terms of purity and integrity) was the same regardless of the method used for DNA extraction. However, the laboratory-specific method (A1) has been found to be much less expensive, though more complicated.
As expected, the quality of the DNA product extracted from the bacterial culture with the laboratory-specific method (A1) was quite satisfactory with respect to the amount and completeness of the product.

B. PCR
The four PCR assays described above (B1, B2, B3, B4) were applied to DNA extracted from the bacterial cultures used (Table 1), resulting in specific detection of all MAP strains used and Identification was possible. On the other hand, none of the negative controls produced positive results with any of the evaluated primer pairs, either for bacterial cultures or for FFPE samples. The numbers of positive results recorded using methods B1, B2, B3, and B4 from 10 FFPE samples from Johne's cattle were 6, 9, 6, and 10 respectively (Table 4). (FIG. 1).

  The sensitivity of the PCR method evaluated was sufficient especially for nested assays. The minimum amount of DNA necessary to obtain a positive result from a bacterial culture was estimated to be 8 pg (Method B4), which corresponds to about 1500 bacterial cells (Baess et al., 1984).

C. Evaluation of reproducibility Application of methods B1-B4 to detect MAP from bacterial cultures and FFPE tissue samples gave completely consistent results in all participating laboratories.

  More specifically, methods B2 and B3 have been found to be capable of diagnosing all types of MAPs only when used in combination, and the same problem is found for method B1. It was. In Method 4, MAP could be detected regardless of the material used.

  Based on our experimental data, method B4, a one-tube nested PCR, simultaneously demonstrates the highest sensitivity, specificity, and reproducibility, and results are achieved in the shortest possible time and with the least cost. It is shown that direct confirmation is possible at the same time. Methods B1 and B4 were found to detect MAP specifically among bacteria extracted from cultures. However, although all primers were designed to detect MAP and the synthesis of the primers was defined based on the same genomic region (IS900), it was detected for all positive FFPE samples used Only methods B2 and B4. This fact suggests additional parameters for the significance of the present invention, and proves the correctness of the designed evaluation method. As a result, the method using the primer provided by the present invention is not only used for research but also for daily use. To ensure minimal error in results for reliable use.

  The discrepancy between the results recorded by methods B1 and B3, which was also verified by collaborative research between laboratories, was not surprising. Method B1 is expected to be less sensitive than the nested response, while Method B3 is specifically designed to practice and increase the diagnostic effectiveness of Method B2. The accuracy of this was proved in practice because the combination of methods B2 and B3 did not accurately identify all of our positive control FFPE samples (FIG. 1).

  It is also possible that the discrepancy in results recorded by methods B1 and B3 is due to the genetic diversity of the MAP strain, at least for the FFPE samples evaluated. The same DNA product was used for all PCR reactions (Method B2), particularly with respect to the presence of PCR inhibitors (Hermon-Taylor et al., 2000) that often cause false negative results for FFPE samples. This also applies to B4 and B4), and thus cannot cause the above-mentioned discrepancy. For the same reason, the results of DNA extraction are always evaluated by electrophoresis and spectroscopic methods, and samples with poor quality DNA are always discarded, so the above results are due to possible DNA fragmentation. It cannot be a thing. Finally, the selection of the IS900 factor as a common target for all of the above PCR reactions should also be excluded from factors that could invalidate methods B1 and B3. Selecting this particular target DNA region is essential because demonstrating the presence of IS900 factors is now considered a prerequisite in the molecular level identification of MAP (Green et al., 1998). It was.

Despite the fact that both methods B4 and B2 have been found to be diagnostically sufficient, method B4 represents an important advantage over method B2. More specifically, method B2 is a PCR assay consisting of two consecutive steps. In order to proceed from one stage to another, the tube used in the first stage must be opened, which is likely because the previous reactant is likely to enter the mixture. Risk of being affected by DNA products from earlier positive assays that are common in the laboratory (carryover effect). In contrast, the fact that often causes an increase in false positive results is avoided by method B4. This is because all the components of this nested assay are put together in a reaction tube and the tube is not opened during the assay. In addition to the above, method B4 has significant advantages over method B2, but also has advantages over method B3. This is because the time required for the method B4 is remarkably short, and since the reaction is performed only once, the amount of consumables required is small and the cost is low.

  As with the above advantages of Method B4 and the other PCR assays described above, it does not use internal controls that would significantly increase the cost and complexity of the assay and particularly increases the time required for the method. Due to the fact that the results are controlled without the use of DNA hybridization that would be, method B4 is clearly superior to any other method evaluated.

  In addition to the above, Method B4 showed very high sensitivity, but due to the high sensitivity, the proportion of false negative results is very low. Furthermore, the fact that this assay (B4) provided by the present invention completely detected only MAP from all the materials used shows the high specificity of the assay, and it is also false because of the high specificity. The rate of negative results can be very low. In this regard, it is important to note that the assay is not only for extracted bacteria in culture, but also from Mycobacterium avium infected chickens, which show a particularly high genetic association with MAP. The bacteria in the FFPE sample also showed absolute specificity. In contrast to the inefficiencies expected for some of the other methods that were evaluated, the complete reproducibility of the results recorded by the laboratories collaborating on method B4 increases reliability, It supports the above.

  Finally, to provide evidence that the nested PCR assay B4 is characterized by its speed and relatively low cost, and that it is also possible to detect MAP from formalin-fixed paraffin-embedded tissue samples. it can. The latter was demonstrated not only by our bacterial culture, but also by MAA-positive FFPE samples from chickens (despite high genetic similarity to MAP). Finally, from the concordance of the results obtained with method B4 by collaborating laboratories, B4 response is the most promising method for MAP diagnosis as a reliable routine task.

  Considering the technical principle of the PCR reaction, assuming that the DNA extraction method produces DNA of the same quality as described above, the method of the present invention using specific oligonucleotide primers is equivalent for samples other than clinical samples ( Sensitivity and specificity) can be obtained. The optimal performance of the assay of the present invention using specific oligonucleotide primers has been verified by detection of MAP from cheese and milk samples taken from Greece and the Czech Republic and evaluated by various PCR assays and cultures .

(Explanation of the table)
Table 1 shows the prototype strains of Mycobacterium species used for the evaluation of the PCR method of the present invention.
Table 2 shows the nucleotide sequence composition of the primers used.
Table 3 shows the temperature settings for PCR reactions B1, B2, B3, and B4.
Table 4 shows a comparison of PCR results for FFPE samples with typical Johne's disease lesions taken from cattle.

The figure which shows the result of the electrophoresis of the PCR product of method B1, B2, B3 and B4 taken in the test | inspection of the FFPE sample extract | collected from the cattle and the chicken. More specifically, lane 1 shows a 100 bp DNA ladder (Biolabs), lanes 2 to 4 show DNA products of PCR performed on samples derived from the small intestine of cattle, and lane 5 shows mesenteric lymph of cattle. The DNA products of PCR performed on the samples derived from knots are shown, lanes 6-7 show the DNA products of PCR performed on the samples derived from the ileum of cattle, lane 8 shows the PCR results obtained from the chicken spleen samples, Lane 9 shows the PCR results obtained from the chicken liver sample, and Lane T shows the PCR results obtained from the negative control sample (no DNA).

Claims (10)

Oligonucleotides useful for detecting Mycobacterium avium subsp. Paratuberculosis (MAP) and having the following sequences:
P1N GCA TGG CCC ACA GGA CGT TGA G
P2N CTA CAA CAA GAG CCG TGC CG
P3N GGG TGT GGC GTT TTC CTT CG
P4N TCC TGG GCG CTG AGT TCC TC
An oligonucleotide selected from the group consisting of:   A set of oligonucleotides comprising one or more oligonucleotides according to claim 1 alone or in combination, in particular P1N / P2N, P3N / P4N, P1N / P3N, P1N / P4N, P2N / P3N, P2N / P4N, P1N / P2N / P3N, P1N / P2N / P4N, P1N / P3N / P4N, P2N / P3N / P4N, and an oligo comprising a combination of at least one of P1N / P2N / P3N / P4N A set of nucleotides. A method for detecting at least one of MA and MAP in a sample, comprising:
(A) isolating DNA from the sample;
(B) performing at least one to one tube PCR of the oligonucleotide of claim 1 using the isolated DNA;
(C) screening for positive PCR amplification results;
(D) comprising the step of identifying a sample containing MAP,
A method characterized in that at least one of the oligonucleotides according to claim 1 is used in PCR.   4. A method according to claim 3, wherein a set of one or more oligonucleotides according to claim 2 is used, in particular a set comprising all four oligonucleotides.   MAP in at least one of a sample derived from a living animal, a product derived from an organism such as a human or an animal, particularly a product derived from cattle, poultry or chicken, and a sample derived from a non-living material, particularly dust or a plant. Use of the method according to claim 3 or 4 for detection.   Use of the method according to claim 3 or 4 for diagnosing MAP infection in organisms such as humans, in particular cattle, poultry or chickens. A kit for detecting MAP in a specimen,
a) means for isolating DNA from the sample;
b) at least one of the oligonucleotide of claim 1 and the set of oligonucleotides of claim 2;
c) means for screening for positive PCR amplification results;
d) A kit comprising means for identifying a sample containing MAP.   A kit comprising at least one of the one or more oligonucleotides according to claim 1 and the set of one or more oligonucleotides according to claim 2 and a container.   A kit comprising all four oligonucleotides according to claim 1 and a container.   Use of the kit according to claim 7, 8, or 9 for the method according to at least one of claims 3 and 4.

Images