AU2004280001A1 - Molecular detection of Mycobacterium avium subsp. Paratuberculosis - Google Patents

Description

WO 2005/035787 PCT/GR2004/000051 MOLECULAR DETECTION OF MYCOBACTERIUM AVIUM subsp. PARA TUBERCULOSIS Field of the Invention 5 The present invention relates to the molecular detection of the Mcobacteriun avium subsp. pcatuherculosis (MAP). More particularly it relates to PCR assays with pairs of oligonucleotide primers targeted to different genomic regions of the IS900 element specific for MAP, for use in the molecular detection and identification of MAP. 10 Prior art The Mycobacterium aviun subsp. paratuberculosis (MAP) is a very fastidious bacterium from the point of view of microbiological identification, that can cause a serious and often fatal disease, namely paratuberculosis, to several animal species. Furthermore, an increasing number of reports are implicating the specific bacteria MAP to the pathogenesis of 15 certain forms of Infectious Bowel Disease of man (Chiodini, 1989), (Chamberlin et al., 2001), Identification of MAP is nowadays 'facilitated by the broad application of molecular techniques. However, the need for verification of results often makes existing techniques laborious and practically applicable only for research use. More specifically, MAP infections' diagnosis obtained by serology requires further 20 confirmation, in order to avoid false-negative results that are often recorded at the early stages of infection and cross-reactions with genetically related mycobacterial species found in nature (Ridge, et al. 1991; Nielsen, et al. 2001). The usefulness of culture, as a diagnostic or confirmatory method, is impaired by the long incubation period required for the growth of MAP. 25 Thus, the Polymerase Chain Reaction (PCR) has long been considered a very useful tool for the detection and identification of the above bacterium (Hance et al., 1989). However, confirmation of results is necessary also for molecular techniques, especially when they are applied for routine diagnosis. This usually suggests the incorporation of hybridization assays, which however make the entire process laborious and practically applicable only for research 30 use. Thus, a low-cost and rapid PCR-based method that could be incorporated reliably to the routine identification of MAP from clinical material is of considerable significance. Low cost must be combined with very high sensitivity and specificity. It is also very important to secure that the results may be repeated very often, especially because it is often found in WO 2005/035787 2 PCT/GR2004/000051 practice that methods that function satisfactorily in a laboratory, when used in another laboratory may give results that cannot be used. Summary of the Invention 5 The present invention has enabled the development of a low-cost and rapid PCR-based method that can be incorporated reliably to the routine identification ofMAP from clinical or from any other material, In order to secure the reliability of the proposed assay and the reproducibility of the results in different laboratories, intra-laboratory crosschecking has taken place. 10 The invention made it possible to develop a method for the routine detection and identification ofMAP, from tissue samples of human, animal, vegetal or other origin. The said method may be applied not only on clinical material, but also on other material of human, animal or plant origin, on dust, on food products in general etc. The proposed assay combines optimum performance and cost with high 15 reproducibility, regardless the various specific conditions and practices and it is applicable in different laboratories. The invention is realized through the development of a PCR assay using one or more of the oligonucleotide primers that are described below: PIN GCATGGCCCACAGGACGTTGAG P2N CTACAACAAGAGCCGTGCCG P3N GGGTGTGGCGTTTTCCTTCG P4N TCCTGGGCGCTGAGTTCCTC 20 In a preferred embodiment combinations of the oligonucleotide primers, in order to form sets of oligonucleotides, are used. Preferred sets of oligonucleotides are P1N/P3N, PlN/P4N, P2N/P3N, P2N/P4N, P1N/P2N/P3N, P1N/P2N/P4N, P1N/P3N/P4N, P2N/P3N/P4N. Particularly preferred is the set of oligonucleotides comprising all four 25 oligonucleotide primers, namely P IN/P2N/P3N/P4N. These primers are targeted to genomic region of the IS900 element specific for MAP and enable the effective, fast and reliable detection of Mycobacterium avium subsp.

WO 2005/035787 PCT/GR2004/000051 paratuberculosis (MAP). These primers were selected among more because they have better results. Detailed description 5 The use of the above mentioned oligonucleotide primers - alone or in combination were found to be preferable in a one-tube PCR assay for the reliable detection of the MAP. In a preferred embodiment combinations of the oligonucleotide primers, in order to form sets of oligonucleotides, are used. The sets of oligonucleotides useful for the detection of MAP are PIN/P2N, P3N/P4N, P1N/P3N, PIN/P4N, P2N/P3N, P2N/P4N, P1N/P2N/P3N, 10 P1N/P2N/P4N, P1N/P3N/P4N, P2N/P3N/P4N. In a further and particularly preferred embodiment the set of oligonucleotides comprising all four oligonucleotide primers, namely P1N/P2N/P3N/P4N, is used. Further preferred is the use of a one-tube nested PCR, using all four oligonucleotide primers, namely P1N/P2N/P3N/P4N. 15 In order to reach a method for the reliable detection of MAP by PCR, tests were conducted in several laboratories, some of which were even in different countries. In order to detect the exactitude and the reliability of the method, all the different parameters that normally compose a PCR reaction were not harmonized and this factor was also incorporated for the assessment of our method. The above approach has never been described before with 20 reference to MAP. Different laboratories undertook to evaluate the DNA extraction procedures and the different PCR assays for the detection of MAP. For DNA extraction one in-house, and one commercial method were used, whereas for PCR a significant number of different assays were assessed, starting with the evaluation of primer specificity with extended GenBank 25 database search. Thus, we concluded to a one tube-nested, a two nested, and a single, PCR assay, targeted to different genomic regions of the IS900 element specific for MAP. These four methods were applied on positive and negative control samples, consisted of pure bacterial cultures and formalin-fixed paraffin embedded tissue samples (FFPE) collected from cattle 30 with paratuberculosis and chickens with Mycobacterium avium infections. In the tests carried out all the samples were identified with coded numbers and the results were communicated among the collaborating laboratories. Based on the criteria of reliability and cost, the procedure that performed better was the one-tube nested PCR assay that uses the oligonucleotide primers mentioned above, combined with the in-house DNA extraction WO 2005/035787 PCT/GR2004/000051 method. This method produced the expected result from the positive and negative control samples used, allowing differentiation even among genetically related mycobacterial species. The agreement of the results obtained by the different laboratories where tests were performed indicates the reliability of the proposed assay even under different laboratory conditions. 5 Examples Materials: DNA was extracted from cultures and from clinical material (formalin-fixed paraffin embedded tissue samples (FFPE)) and the molecular techniques described below were 10 performed on those. In more detail, cultures of 10 strains ofMycobacterium avium subsp. paratuberculosis (MAP) and 30 strains of various other members of the Mycobacterium spp. were utilized (as described in detail in Table 1). For the evaluation of specificity of the method described, cultures of several genetically related bacterial species (Escherichia coli, Staphylococcus 15 aureus, Salmonella spp., Enterobacter spp.) were used. The clinical material (tissue samples) that was included in the tests performed consisted of formalin fixed paraffin embedded (FFPE) samples collected from cattle and chickens. 10 intestine FFPE samples from cattle, with typical lesions of paratuberculosis w-ere used. An equal number of liver and intestine, FFPE samples from chickens, bearing typical 20 lesions of mycobacterial infection were used. Corresponding clinical material from the cattle and the chickens was positive by culture for MAP and Mycobacterium aium subsp. cirni (A4A) respectively. Additionally 30 fresh and FFPE, intestine and lymph node samples, collected from humans and animals with no clinical or other indication of mycobacterial infection were examined. This material was used as negative control (this data is not showr1 in 25 the present specification). Methods: A) DNA extraction from FFPE tissue samples and bacterial cultures. DNA extraction from the FFPE samples was performed in two ways, both used on 2 to 30 3 paraffin sections 10pim-thick per sample: Al. For DNA extraction, carried out as previously described (in-house method) (Ikonomopoulos et al., 1999), the material was dewaxed by repeated incubations in xylene at 60'C, and ethanol 100% and finally ethanol 75%. The product of the above process is WO 2005/035787 5 PCT/GR2004/000051 incubated for approximately one hour in SDS and proteinase K in 50 (C temperature so that it is subsequently digested. These proteins were removed with the addition successively of phenol and phenol chloroform - isoamyl alcohol solution. Subsequently, the DNA is precipitated ethanol and 5 natrium acetate (Sambrook et al., 1989) and is collected in form of sediment which is then eluted in 50pl of TE buffer. A2. Alternatively, DNA extraction from FFPE samples was performed with the MicroLysis kit (Microzone) according to the manufacturer 's instructions. DNA extraction from bacteria was performed with CTAB-proteinase K followed by a 10 combination of phenol and phenol-chlorophorm-isoamyl alcohol. The DNA extract was precipitated by ethanol and natrium acetate as described above. Evaluation of the quality of the DNA extract with reference to quantity, purity, and integrity was performed with optical density counts and agarose gel electrophoresis. 15 B) Polymerase Chain Reaction (PCR): A significant number of PCR assays were assessed, starting with the evaluation of primer specificity with extended GenBank database search with NCBI BLAST. Thus, 4 different PCR assays with a total of 7 pairs of oligonucleotide primers, targeted to different genomic regions of the IS900 element specific for MAP were concluded to and assessed. 20 Those different PCR assays are described below under B 1, B2, B3 and B4. More specifically: B1. The first control PCR assay was with the oligonucleotide primers IS900-F and IS900-R (shown in Table 2). These primers amplify a 707 bp DNA fragment of the IS900 element of MAP (Green et al 1989). B2. Another control PCR assay was nested PCR assay with the primers s204 and 25 s749 (Table 2) that amplify a 563 bp DNA fragment of the IS900 element of MA4P. The product of this reaction diluted 1:10, is incorporated into the second reaction with the primers s345 and s535 (Table 2) that amplify a 210 bp DNA fragment within the 563 bp DNA fragment amplified by the s204-s749 primers (Englund et al 1999). B3. Another control PCR assay was nested PCR assay with the primers ISO1 and 30 IS04 (Table 2) that amplify a 302 bp DNA fragment of the IS900 element. The product of this reaction diluted 1:10, is incorporated into the second reaction with the primers IS02 and IS03 (Table 2) that amplify a 159 bp DNA fragment within the 302 bp DNA fragment amplified previously.

WO 2005/035787 6 PCT/GR2004/000051 B4. Finally, one PCR assay according to the invention was a one-tube nested PCR assay comprising the primers PIN, P2N, P3N and P4N (Table 2). All the primers are added simultaneously in the mixture of the PCR reaction that amplifies a 257 bp DNA fragment of the IS900 element. 5 The reaction mixture for each one of the PCR assays mentioned above was prepared with 50 mM KCI, 10mM Tris-HCI (pH 8,4 at room temperature), 1.5mM MgCl 2 , .25pM of each of the oligonucleotide primers, 200pM dNTPs, 2.5 units Taq polymerase (Promega), 0.05-0.1 pg DNA, and HPLC quality water to a final volume of 50 pl for the assays BI and 10 B4, and 25 pl for the assays B2 and B3. The temperature profile that was used for the assays B1-B3 (Table 3), consisted of an initial 5min denaturation step at 94 0 C, followed by 35 cycles of 1 min at 94 0 C, 1 min at 63 0 C (for the assays B 1 and B2) or 62 0 C (for the assay B3) and 1 min at 72'C. This stage was followed by a 10-min incubation step at 72 0 C for the completion of the DNA product (Table 15 3). Both stages of the nested reactions B2 and B3, were performed at the same temperature profile as opposed to the assay B4 that involved different temperature profiles for each of the two stages of the nested reaction (Table 3). The first stage consisted of an initial denaturation step at 94'C for 1 min, followed by 16 cycles, with 1 min at 94 OC, 1 min at 54 'C, and 1 rnin at 72 'C, and 30 cycles with 1 min at 94 'C, 1 min at 67'C, and 1 min at 72 'C, followed by a 20 final extension step of 3 min at 72 'C (Table 3). The PCR products were analysed by electrophoresis in 2% agarose gels, stained by ethidium bromide, and photographed. The evaluation of the sensitivity of each of the above methods was determined as previously described (Ikonomopoulos et al., 1998) with their application on decimal dilutions of DNA extracted from MAP cultures. 25 Evaluation of reproducibility: The DNA extraction methods and PCR assays were applied on the reference and clinical material described above, under the different specific conditions of each different laboratory (type of thermocycler, type of DNA-polymerase, buffers). The samples were identified with 30 coded numbers and the results were communicated between the different laboratories and compared. Results WO 2005/035787 PCT/GR2004/000051 A. DNA extraction: The methods Al and A2, produced DNA of satisfactory quality and quantity from the FFPE samples used. The amount of DNA produced by two to three lOpm-thick paraffin sections was estimated to Ip g/pl and its quality, with reference to purity and integrity, was the 5 same regardless of the method that was utilized for the DNA extraction. However, the in house method (Al), proved to be of considerably lower cost although more laborious. The quality of the DNA product extracted from bacterial cultures with the in-house method (Al) was, as expected, very satisfactory with reference to quantity and integrity of the product. 10 B. PCR: The application of the four PCR assays (B1, B2, B3 and B4) described above, on DNA extracted from the bacterial cultures used (Table 1), allowed the specific detection and identification of all the MAP strains that were utilized. On the other hand, none of the 15 negative controls, both with reference to bacterial cultures and FFPE samples, produced positive results with any of the primer pairs that were evaluated. The number of positive results that were recorded with the methods B1, B2, B3 and B4, from the 10 FFPE samples derived from cattle with Johne 's disease, was 6, 9, 6, and 10, respectively (Table 4) (Figure 1). 20 The sensitivity of all the PCR methods that were evaluated was satisfactory, especially with reference to the nested assays. The minimum amount of DNA necessary for a positive result from bacterial cultures was estimated to 8 pg (method B4) corresponding to about 1500 bacterial cells (Baess et al., 1984). 25 C. Evaluation of reproducibility: The application of the methods B1 to B4 to the detection of MAP from bacterial cultures and FFPE tissue samples produced completely consistent results in all the participating laboratories. More specifically, it was found that methods B2 and B3 may cover diagnostically the 30 whole range of MAP, only when used in combination, while the same problem was found also for method Bl. Method B4 allowed the detection of MAP, regardless of the material used. Based on our experimental data, it is shown that method B4, a one-tube nested PCR, that has at the same time the highest sensitivity, specificity and reproducibility, while at the WO 2005/035787 8 PCT/GR2004/000051 same time it enables directly to check the results in the least possible time and with the least necessary cost. It was found that methods B1 and B4 detected with specificity the MAP, among bacteria that was extracted from cultures. However, only methods B2 and B4 detected all the positive FFPE samples used. This, despite the fact that all primers were designed to 5 detect MAP and their synthesis was defined based on the same genomic region (IS900). This fact indicates yet another parameter of the significance of the present invention, justifying the evaluation procedure that was designed, so that the method with the primers proposed by the present invention secures minimum false results for reliable routine application and not merely for research. 10 The discrepant results recorded with the methods B 1 and B3 that were also verified by the intra-laboratory collaboration, were not surprising. The method BI was expected to be less sensitive than the nested reactions, whereas the method B3 was designed specifically to implement and increase the diagnostic efficiency of the method B2. This was indeed proven accurate since the combination of the methods B2 and B3 did not identify correctly all our 15 positive-control FFPE samples (Figure 1). The discrepancies of the results recorded with the methods BI and B3 could also be attributed to the genetic diversity of the MAP strains, at least with reference to the FFPE samples that were assessed. The presence of PCR inhibitors that can often lead to false negative results, especially with FFPE samples (Hermon-Taylor et al., 2000), cannot consist 20 the cause of this discrepancy since the same DNA products were used for all the PCR. reactions (also with the methods B2 and B4). For the same reason these results cannot be attributed to possible DNA fragmentation, since the product of the DNA extraction procedure was always assessed by electrophoresis and spectrophotometry and samples producing poor DNA quality were always discarded. Finally, the selection of the IS900 element as the 25 common target of all the PCR reactions described above, should also be excluded from the factors that could result to the inefficiency of the methods B1 and B3. The selection of the certain DNA-target area was compulsory since the demonstration of the presence of the IS900 element is nowadays considered a prerequisite for the molecular identification of MAP (Green et al., 1998). 30 Method B4 presents important advantages compared also to method B2, irrespective of the fact that both methods are known to be diagnostically sufficient. More specifically, method B2 is a PCR assay comprising two consecutive stages. In order to proceed from one stage to the other, the tube that was used during the first stage must be opened and this is dangerous for infection, due to high possibility of entrance in the mix of the last reaction, of 9 WO 2005/035787 PCT/GR2004/000051 DNA products from previous positive assays that are to be found a lot in the laboratory (carry-over effect). On the contrary, this fact, which often leads to the increase of the false positive results, is avoided by the method B4, since all the constituents of the nested assay are inserted together into the reaction tube and this is not opened during the assay. In addition to 5 the above, method B4 has significant advantages compared to method B2, but also to method B3, because it requires significantly less time and less cost since less consumables are necessary as it involves one single reaction. The above advantages of method B4 and the fact that, like for the other pre-mentioned PCR assays, the results are controlled without the need to use an internal control, which 10 would significantly augment the cost and complexity of the assay, but also without the need for DNA hybridization, which among others would also augment the time needed for the procedure, constitute method B4 clearly superior to all the other methods that were assessed. Besides the above, method B4 showed extremely high sensitivity, which makes it possible that the percentage of false negative results is extremely low. Further, the fact that 15 the proposed assay (B4) detected exclusively only the MAP from all the materials used, shows its very high specificity, which also makes it possible that the percentage of false negative results is extremely low. In this respect, it is important to state that the said assay showed absolute specificity, not only with the bacteria that were extracted in culture. But also in FFPE samples originating from chicken infected by Mycobacterium cvium, which presents 20 especially high genetic relation to MAP. As opposed to the expected inefficiency of some of the other methods that were assessed, the complete reproducibility of the results that were recorded by the collaborating laboratories in respect of method B4, increases its reliability and supports the above. In conclusion, it can be sustained that the nested PCR assay B4 is characterized by 25 speed and relatively low cost, while it also allows to detect MAP from formalin-fixed paraffin embedded tissue samples. The latter was demonstrated not only with our bacterial cultures but also with the MAA-positive FFPE samples derived from chickens, despite the high genetic similarity of the latter with MAP. Finally, the consistency of the results obtained with the said method (B4) by the collaborating laboratories, renders the reaction B4 a most promising 30 method for reliable routine diagnosis ofMAP. Considering the technical basis of a PCR reaction, the proposed method with the specific oligonucleotide primers can produce results of equal value (sensitivity - specificity) with samples other that clinical, provided that the DNA extraction procedure produces DNA of similar quality as that mentioned above. The optimum performance of the proposed assay WO 2005/035787 10 PCT/GR2004/000051 with the specific oligonucleotide primers has been verified with the detection of MAP from cheese and milk samples that were collected from Greece and the Czech Republic and were evaluated with different PCR assays and with culture. 5 Description of the Figures and Tables Table 1 shows the prototype strains of the mycobacterial species that were utilized for the evaluation of the proposed PCR methods. Table 2 shows the composition of the nucleotide sequences of the primers used. Table 3 shows the temperature profiles of the PCR reactions B 1, B2, B3 and B4. 10 Table 4 shows comparative PCR results on the FFPE samples with typical lesions of Johne's disease, collected from cattle. Figure 1 shows representative results from electrophoresis of PCR products of the methods BI, B2, B3 and B4, incorporated to the examination of FFPE samples collected from cattle and chickens. 15 More specifically, Lane 1 shows 1 00bp (Biolabs) DNA ladder. Lanes 2-4 show DNA products of PCR performed on samples from the small intestine of cattle. Lane 5 shows DNA products of PCR performed on samples from a mesenteric lymph node of 20 cattle. Lanes 6-7 show DNA products of PCR assays performed on samples from the ileum of cattle. Lane 8 shows PCR results produced from a chicken-spleen sample. Lane 9 shows PCR results produced from a chicken-liver sample. Lane T shows PCR results produced from negative control samples (no DNA). 25 WO 2005/035787 1 PCT/GR2004/000051 References - Baess I. Determination and re-examination of genome sizes and base ratios on deoxyribonucleic acid from mycobacteria. Scta Pathol Microbiol Immunol Scand Sect 5 1984, B92:209-211. - Chamberlin W, Graham DY, Hulten K, El-Zimaity HM, Schwartz Naser, S, Shafran I, El Zaatari FA. Mycobacterium avium subsp. paratuberculosis one cause of Crohn's disease, Aliment Pharmacol Ther 2001, 15:337-346. - Chiodini RJ. Crohn's disease and the mycobacterioses: a review and comparison of two 10 disease entities. Clin Microbiol Rev. 1989 Jan;2(l):90-117. Review. - Englund S, Ballagi-Pordany A, Bolske G and Johansson K (1999) Single PCR and nested PCR with a mmnic molecule for detection of Mycobacterium avium subsp paratuberculosis. Diagn Microbiol Infect Dis 33, 163-171. - Gazouli M, Ikonomopoulos JA, Zacharatos P et al. Incidence of Mycobacterium avium 15 subsp. Paratuberculosis in soft cheese in Greece. Proceedings of the 8 t" international conference on environmental science and technology, Lemnos, Greece, 2003 A pp 240 244. - Hance AJ, Grandchamp B, Levy-Frebault V, lecossier D, Rauzier J, Bocart D, Giquel B. Detection and identification of mycobacteria by amplification of mycobacterial DNA. 20 Mol. Microbiol. 1989, 3:843-849. - Hermon-Taylor J, Bull TJ, Sheridan J, Cheng J, Stellakis ML, Sumar N. Causation of Crohn's disease by Mycobacterium avium subsp paratuberculosis. Can J Gastrenterol 2000, 14:521-539. - Ikonomopoulos JA., Gorgoulis VG, Zacharatos PV., et al. Multiplex PCR assay for the 25 detection of mycobacterial DNA directly from sputum. In Vivo 1998;12:547-552. - Ikonomopoulos JA., Gorgoulis VG, Zacharatos PV., et al. Multiplex polymerase chain reaction for the detection of mycobacterial DNA in cases of tuberculosis and sarcoidosis. Mod Pathol 1999;12:854-862. - Ikonomopoulos J, Kokotas S, Gazouli M, Zavras A, Stoitsiou M, Gorgoulis V. Molecular 30 diagnosis of leishmaniosis in dogs. Comparative application of the traditional diagnostic methods and the proposed assay on clinical samples. Veterinary Parasitol 2003; 113/2:99 113. - Green EP, Tizard MLV, Moss MT, Thompson J, Winterbourn DL, McFadden JJ and Hermon-Taylor J (1989) Sequence and characteristics of IS900, an insertion element 12 WO 2005/035787 PCT/GR2004/000051 identified in a human Crohn's disease isolate of Mycobacterium paratuberculosis. Nucl. Ac Res 17, 9063-9073. - Nielsen SS, Houe H, Thamsborg SM, Bitsch V. Comparison of two enzyme-linked immunosorbent assays for serologic diagnosis of paratuberculosis (Johne's disease) in 5 cattle using different subspecies strains of Mycobacterium avium. J Vet Diagn Invest. 2001 Mar;13(2):164-6. - Ridge SE, Morgan IR, Sockett DC, Collins MT, Condron RJ, Skilbeck NW, Webber JJ. Comparison of the Johne's absorbed EIA and the complement-fixation test for the diagnosis of Johne's disease in cattle. 10 Aust Vet J. 1991 Aug;68(8):253-7. Erratum in: Aust Vet J 1991 Dec;68(12):399. - Sambrook J., Fritsche E.F., Maniatis T. Molecular Cloning , A laboratory Manual. Cold Spring Harbor Press 1989 2 Edition 15 WO 2005/035787 13 PCT/GR2004/000051 Table 1: Number of strains of the mycobacterial species that were utilized for the evaluation of the proposed PCR methods. 5 Number of Species Source strains 1 M tuberculosis RIVM, the Netherlands 1 M cannetti 1 M bovisBCG 5 M aniun 1 M. intracellulare type I 1 M intracellulare type II 1 M gordonae I 1 M fortuitum 1 M scrofulaceum 1 M kansasii 1 M. avium paratuberculosis 8 M. tuberculosis Hospital of Thoracic 3 Al. avium Diseases, Greece 3 M. gordonae 1 M celatum 1 M. fortuitun 9 M. aviun paratuberculosis VRI, Cz Republic RIVM: National Institute of Public Health and Environment, the Netherlands VRI: Veterinary Research Institute, Cz Republic WO 2005/035787 14 PCT/GR2004/000051 Table 2: Composition of the oligonucleotide primers. 5 PCR assay Primer Primer composition BI IS900-F ACGCCGCGGGTAGTTA IS900-R GGGGCGTTTGAGGTTTC B2 s204 TGATCTGGACAATGACGGTTACGGA s749 CGCGGCACGGCTCTTGTT s345 GCCGCGCTGCTGGAGTTGA s535 AGCGTCTTTGGCGTCGGTCTTG B3 ISO1 CTTACCTTTCTTGAAGGGTGTTC IS04 GTCGTTAATAACCATGCAGTAATG IS02 GTATGGCTTTCATGTGGTTGCT IS03 TAACCGTCATTGTCCAGATCAAC B4 PIN GCATGGCCCACAGGACGTTGAG P2N CTACAACAAGAGCCGTGCCG P3N GGGTGTGGCGTTTTCCTTCG P4N TCCTGGGCGCTGAGTTCCTC 10 WO 2005/035787 15 PCTGR2004/000051 Table 3 Temperature profiles of the reactions B 1, B2, B3 and B4. Temperature profile 1 3'st age reaction 2"- stage reaction Dena/ration Annealing Extension Number Dena/ration Annealing Extension Number

(

0 C/nin) (fC/min) ( 0 C/min) of ( 0 C/min) ( 0 C/miin) ( 0 C/min) of Reaction cycles Cycles Bi 94/1 63/1 72/1 35 -* .* .. .. B2 94/1 63/1 72/1 35 94/1 63/1 72/1 35 B3 94/1 62/1 72/1 35 94/1 62/1 72/1 35 B4 94/1 54/1 72/1 16 9411 67/1 72/1 30 5 * Reaction B 1 is performed in a single stage WO 2005/035787 16 PCTGR2004/000051 Table 4: PCR results of the methods B1, B2, B3 and B4 on the FFPE samples with typical lesions of Johne 's disease, collected from cattle. 5 PCR assay Description Positive results B1 PCR 6/10(60%) B2 Nested-PCR 9/10 (100%) B3 Nested-PCR 6/10 (60%) B4 One tube nested PCR 10/10 (100%)

Claims (10)

1. Oligonucleotide useful for the detection ofMycobacterium avium subspecies paraiuberculosis (MP) selected from the group consisting of oligonucleotides of the following sequences: 5 PIN GCA TGG CCC ACA GGA CGT TGA G P2N CTA CAA CAA GAG CCG TGC CG P3N GGG TGT GGC GTT TTC CTT CG P4N TCC TGG GCG CTG AGT TCC TC. 10

2. Set of oligonucleotides comprising alone or in combination one or more of the oligonucleotides according to claim 1, particularly the combinations of oligonucleotides P1N/P2N, P3N/P4N, P1N/P3N, P1N/P4N, P2N/P3N, P2N/P4N, PlN/P2N/P3N, P1N/P2N/P4N, P1N/P3N/P4N, P2N/P3N/P4N and/or 15 P1N/P2N/P3N/P4N.

3. Method for the detection of MA and/or MAP in a sample comprising the steps (a) isolating DNA from the sample; (b) performing a one-tube PCR using the isolated DNA from at least one of the 20 oligonucleotides according to Claim 1; (c) screening for positive PCR amplification results; (d) identification of MAP containing samples, Which method is characterized in that at least one of the oligonucleotides according to Claim 1 are used in the PCR. 25

4. Method according to Claim 3 using one or more sets of oligonucleotides according to Claim 2, particularly a set comprising all four oligonucleotides.

5. Use of the method according to Claims 3 or 4 for the detection of MAP ir a sample 30 from a living animal, in a product derived from a living creature, including human beings or animals, particularly from cattle, poultry or chicken, and/or in a sample derived from non-living origin, particularly from dust or plants. WO 2005/035787 20 PCT/GR2004/000051

6. Use of the method according to Claims 3 or 4 for the diagnosis of MAP infection in a living creature, including human, particularly in cattle, poultry or chicken.

7. Kit for the detection of MAP in a speciment, which comprises: 5 a) means of isolating DNA from the sample; b) oligonucleotides according to Claim 1 and/or set of oligonucleotides according to Claim 2; c) means of screening for positive PCR amplification results; d) means of identification of MAP containing samples. 10

8. Kit comprising one or more oligonucleotides according to Claim 1 and/or one or more sets of oligonuleotides according to Claim 2 and a container.

9. Kit comprising all four oligonucleotides according to Claim I and a container. 15

10. Use of the Kit according to Claim 7, 8 or 9 for the method according to Claim 3 and/or 4. 20