JP2007295934A - Promoter having activity specific to each tissue of pistil and utilization thereof - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a promoter useful for modifying character of a plant. <P>SOLUTION: The promoter contains a DNA of the following (a) or (b): (a) a DNA having a sequence at the first to 2,595th positions of the base sequence represented by a specific sequence; and (b) a DNA having a part of the sequence of (a), and exhibiting a promoter activity specific to at least one of a conductive tissue and placenta surface. In another embodiment, the promoter contains a DNA of the following (c) or (d): (c) a DNA having a sequence at the first to 2,322nd positions of the base sequence represented by a specific sequence; and (d) a DNA having a part of the sequence of (c), and exhibiting a promoter activity specific to at least one of the conductive tissue, the placenta surface, a stigma secretory region and a receptacle. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to a promoter having an expression activity specific to pistil tissue and use thereof. The present invention particularly relates to a novel promoter derived from petunia, the PEThyZPT2-10 gene promoter (ZPT2-10 promoter), the PEThyZPT3-3 gene promoter (ZPT3-3 promoter), and the PEThyZPT2-11 gene promoter (ZPT2-11). Promoter), and their use.

  To elucidate the control of plant traits, for example, flower morphogenesis, using Arabidopsis thaliana, Antirrhinum majus, and Petunia hybrida, molecular biology and molecular genetics Research has been conducted. In particular, petunia is favored as a research material. The reason for this is that petunia has a variety of varieties with high value as horticultural plants, is easy to transform, is large and easy to see, and has a wealth of genetic knowledge. (Hiroshi Takatsuki, “Molecular mechanisms that determine the shape of plants”, Cell Engineering, Plant Cell Engineering Series (Shyujunsha), pages 96-106 (1994)).

  It is extremely important to identify a promoter having a tissue-specific expression activity. For example, when it is desired to express a specific heterologous gene in a tissue-specific manner, the target heterologous gene is linked downstream of a promoter having specific expression activity in the target tissue (ie, this promoter An expression cassette is constructed in which the heterologous gene of interest is placed so that it is expressed under the control of By introducing this expression cassette into a plant, the target heterologous gene can be specifically expressed in the target organization. Specific expression of a heterologous gene in a desired organization of a plant is considered to be highly valuable for research and horticulture in that a modified trait can be imparted to the plant.

  For example, if tissue-specific promoter activity is observed in any of the pistil tissues, a heterologous gene is operably linked to the promoter and introduced into the plant to introduce the pistil group. It can be expressed specifically in knowledge. By utilizing such expression specificity for the pistil tissue, it is considered that, for example, a female sterile trait and a self-incompatible trait can be imparted to a plant.

  It is known that ethylene, whose synthesis is induced by pollination, promotes flower wilt and deteriorates flower retention. It is known that female sterile plants generally have good flower retention because induction of ethylene synthesis by pollination does not occur. It is considered that flower preservation can be improved by imparting a female sterility trait to a flower cultivar of a horticultural variety. Therefore, the effect of imparting female sterility to the horticultural industry is significant.

  Conventionally, mutation techniques such as heavy ion beam irradiation have been attempted as methods for imparting female sterile characteristics to plants. In addition, as a biotechnological method, (1) diphtheria toxin was expressed using a promoter specific to rape stigma tissue (Kandasamy, MK et al., Plant Cell, 5, 263-275 (1993)). And (2) expression of barnase (one of the enzymes that cause cell death) using a promoter specific for tobacco stigma tissue (Goldman, MH et al., EMBO J., 13, 2976-2984 (1994)).

  On the other hand, self-incompatibility is an important trait from the viewpoint of the efficiency of cross breeding. In tobacco (Nicotiana), a gene having a function of eliminating pollen using a promoter of tomato Chi2; 1 (Harikrishna, K. et al., Plant Mol. Biol., 30, 899-911 (1996)) (S -RNase gene) has been developed to give self-incompatibility by specifically expressing it in the transmitting tissue of the pistil.

As described above, identifying a promoter having an expression activity specific to pistil tissue is important not only for academic research but also for practical use. If such a promoter can be isolated, it is very useful in modifying the traits of useful plants such as horticultural varieties.

The present invention provides the following:
(1) A promoter comprising the following DNA (a) or (b):
(A) DNA having a sequence from position 1 to position 2595 of the base sequence represented by SEQ ID NO: 1; or (b) having a partial sequence of (a), DNA exhibiting promoter activity specific to at least one of
(2) A promoter comprising the following DNA (c) or (d):
(C) DNA having a sequence from position 1 to position 2322 of the base sequence represented by SEQ ID NO: 2;
Or (d) DNA having a partial sequence of (c) and exhibiting promoter activity specific to at least one of tract tissue, placenta superficial layer, stigmatic secretion region, and floret.
(3) A promoter comprising the following DNA (e) or (f):
(E) a DNA having a sequence from the 1st position to the 2012th position of the base sequence represented by SEQ ID NO: 3; or (f) having a partial sequence of (e) and comprising vascular bundles and florets of pistil DNA exhibiting promoter activity specific to at least one of
(4) A plant expression cassette comprising the promoter according to any one of claims 1 to 3 and a heterologous gene operably linked to the promoter.
(5) A method for producing a plant with a modified trait comprising the steps of introducing the expression cassette according to claim 4 into a plant cell and regenerating the plant cell into which the expression cassette has been introduced into a plant body. .
(6) The method according to claim 5, wherein the trait is fertile and the plant whose trait has been modified is a female sterile plant.
(7) The method according to claim 5, wherein the trait is compatible, and the plant whose trait is modified is a self-incompatible plant.
(8) The method according to claim 5, wherein the plant is a dicotyledonous plant.
(9) The method according to claim 8, wherein the plant is a solanaceous plant.
(10) The method according to claim 9, wherein the plant is a Petunia plant.
(11) The method according to claim 5, wherein the expression cassette is incorporated into a plant expression vector. (12) The plant trait produced by the method according to any one of claims 5 to 11 is modified. plant.
(13) Use of the expression cassette according to claim 4 for modifying plant traits, wherein the expression cassette is introduced into a plant cell, and the heterologous gene operably linked to the promoter comprises Use expressed in plants regenerated from plant cells.
(14) The use according to claim 13, wherein the trait is fertile and the plant whose trait has been modified is a female sterile plant.
(15) The use according to claim 13, wherein the trait is compatible and the plant whose trait is modified is a self-incompatible plant.
(16) Use according to claim 13, wherein the plant is a dicotyledonous plant.
(17) The use according to claim 16, wherein the plant is a solanaceous plant.
(18) The use according to claim 17, wherein the plant is a Petunia plant.
(19) The use according to claim 13, wherein the expression cassette is incorporated into a plant expression vector.

DISCLOSURE OF THE INVENTION The present inventor has identified upstream region DNAs of genes encoding three types of zinc finger transcription factors (ZPT2-10, ZPT2-11, and ZPT3-3) (positions 1 to 2595 of SEQ ID NO: 1, respectively). And the DNA sequence from position 1 to 2322 of SEQ ID NO: 2 and the DNA sequence from position 1 to position 2012 of SEQ ID NO: 3) were isolated, and the gene expression control function was tested. As a result, the present inventor has found that these three types of upstream region DNA have different specific promoter activities with respect to the structure of pistil such as passage tissue, stigma, and vascular bundle. The present invention has been completed based on these findings.

The present invention relates to a promoter comprising the following DNA (a) or (b):
(A) DNA having a sequence from the first position to the 2595th position of the base sequence represented by SEQ ID NO: 1; or (b) a partial sequence of (a), comprising a passage tissue and a placenta surface layer DNA exhibiting promoter activity specific to at least one of

The present invention also relates to a promoter comprising the following DNA (c) or (d):
(C) DNA having a sequence from the first position to the 2232nd position of the base sequence represented by SEQ ID NO: 2; or (d) a partial sequence of (c), which is a tract tissue, placenta surface layer, stigma DNA exhibiting promoter activity specific to at least one of the secretory region and the floret.

The present invention further relates to a promoter comprising the following DNA (e) or (f):
(E) a DNA having a sequence from the 1st position to the 2012th position of the base sequence represented by SEQ ID NO: 3; or (f) a partial sequence of (e), comprising stamen vascular bundles and florets DNA exhibiting promoter activity specific to at least one of

  The present invention also relates to an expression cassette comprising any of the promoters described above and a heterologous gene operably linked to the promoter.

  The present invention further relates to a method for producing a plant with a modified trait, comprising the steps of introducing the expression cassette into a plant cell and regenerating the plant cell into which the expression cassette has been introduced into a plant body. .

  The present invention still further relates to the use of the above expression cassette for modifying plant traits, wherein the expression cassette is introduced into a plant cell and the heterologous gene operably linked to the promoter is expressed. .

  In one embodiment, the trait is fertile and the plant whose trait has been modified is a female sterile plant.

  In one embodiment, the trait is compatible and the plant whose trait has been modified is a self-incompatible plant.

  In one embodiment, the plant is a dicotyledonous plant. Preferably, the dicotyledonous plant is a solanaceous plant, more preferably a petunia plant.

  In one embodiment, the heterologous gene is incorporated into a plant expression vector.

  The present invention further relates to a plant having a modified plant trait produced by any one of the methods described above.

  The present invention will be described in more detail below.

In the present invention, a promoter having a tissue-specific expression activity in any of the pistil tissues may include any of the following DNAs:
(A) DNA having a sequence from position 1 to position 2595 of the base sequence represented by SEQ ID NO: 1;
(B) a partial sequence of (a) that, when expressed in a plant, exhibits promoter activity specific for at least one of tract tissue and placenta surface;
(C) DNA having a sequence from position 1 to position 2322 of the base sequence represented by SEQ ID NO: 2;
(D) a partial sequence of (c) that, when expressed in a plant, exhibits a promoter activity specific to at least one of tract tissue, placenta superficial layer, stigma secretion region, and floret; DNA;
(E) DNA having a sequence from the 1st position to the 2012th position of the base sequence represented by SEQ ID NO: 3; or (f) a partial sequence of (e) and expressed in a plant, DNA exhibiting promoter activity specific to at least one of the stamen vascular bundle and the floret.

Preferably, the promoter in the present invention may comprise any of the following DNA:
(A) DNA having a sequence from position 1 to position 2595 of the base sequence represented by SEQ ID NO: 1;
(B) a partial sequence of '(a), which, when expressed in a plant, exhibits specific promoter activity in tract tissue and placenta surface;
(C) DNA having a sequence from position 1 to position 2322 of the base sequence represented by SEQ ID NO: 2;
(D) a partial sequence of '(c), which, when expressed in a plant, exhibits specific promoter activity in tract tissue, placenta surface layer, stigma secretion region, and florets;
(E) DNA having a sequence from the 1st position to the 2012th position of the base sequence represented by SEQ ID NO: 3; or (f) a partial sequence of (e) and expressed in a plant DNA that exhibits specific promoter activity in the stamen vascular bundles and florets.

  Particularly preferred promoters in the present invention are the promoters of the ZPT2-10, ZPT2-11, and ZPT3-3 genes encoding petunia zinc finger transcription factors. This promoter is a DNA having the sequence from position 1 to position 2595 of SEQ ID NO: 1, the sequence from position 1 to position 2232 of SEQ ID NO: 2, and the sequence from position 1 to position 2012 of SEQ ID NO: 3, respectively. .

  An expression activity specific to at least one pistil tissue obtained by removing a sequence not essential for tissue-specific expression activity of the promoter regions of ZPT2-10, ZPT2-11, and ZPT3-3 genes The sequences they have are within the scope of the present invention. Such a sequence can be obtained by conducting a promoter deletion experiment according to a conventional method. Briefly, various deletion mutants of promoter regions of ZPT2-10, ZPT2-11, and ZPT3-3 genes (eg, promoter regions of ZPT2-10, ZPT2-11, and ZPT3-3 genes are 5 ′ Measure tissue-specific promoter activity of deletion mutants using plasmids fused with upstream mutants of various lengths) and appropriate reporter genes (eg, GUS genes) Thus, a region essential for its activity can be identified.

  Once a region essential for promoter activity has been identified, it is possible to further modify the sequence in the region or adjacent sequences to increase the level of promoter expression activity or to change the specificity of the tissue to be expressed. It is. The variant thus obtained is also within the scope of the present invention as long as it exhibits a promoter activity specific to at least one pistil tissue.

  As used herein, the term “tissue-specific promoter activity” refers specifically to a tissue that a promoter exhibits in a natural plant or when incorporated into an expression cassette and introduced into a plant. It means the ability to express. Here, the expression “specific” means that in a certain organization, the expression activity of the promoter is higher than in at least one of other tissues of the same plant. The degree of expression activity of the promoter can be evaluated by comparing the expression level of the promoter in a given tissue with the expression level of the same promoter in another tissue according to a conventional method. The expression level of a promoter is usually determined by the amount of gene product expressed under the control of that promoter. A “tissue-specific expression activity” of a promoter is also used herein as synonymous with “tissue-specific promoter activity”.

  A promoter that exhibits expression activity specific to at least one of the pistil tissues is a promoter contemplated in the present invention.

  Examples of pistil tissues include tract tissue, placenta superficial layer, stigma secretion region, florets, and stamen vascular bundles (see FIG. 8). Pathway tissue and placenta superficial layer are elongation pathways through which pollen tubes that extend from pollen after pollination pass to reach the ovule. The stigmatic secretion area is an area where pollen adheres. The flower bud is the part where the flowers and leaves of the tip of the floral pattern are attached. The stamen vascular system consists of substances necessary for the expression of pistil function in the stigmatic secretion region (for example, secretion necessary for pollen adhesion, filling compound that promotes pollen tube elongation in the pollen tube elongation pathway, style and It is an organization presumed to play an important role in the supply of nutrients to the capital.

  In the present specification, the term “modification” used for a plant trait is that a transformed plant is given a trait that does not exist in the plant (wild species or horticultural variety) before transformation, or It means that the degree of a trait existing in a plant (wild type or horticultural variety) before transformation is enhanced or reduced. Such a trait modification is expressed in a tissue-specific manner under the control of the promoter of the present invention in a transgenic plant into which any heterologous gene operably linked to the promoter of the present invention has been introduced. As a result. The degree of modification of this trait can be evaluated by comparing the trait of the plant after transformation with the trait of the plant (wild type or horticultural variety) before transformation.

  Preferred traits to be modified include, but are not limited to, female sterility, self-incompatibility, and pest resistance.

  The promoter of the present invention can be obtained, for example, by screening a plant genomic library using a known cDNA as a probe and isolating a corresponding genomic clone. Examples of such cDNA include the cDNAs of ZPT2-10, ZPT2-11, and ZPT3-3, which are zinc finger type transcription factors derived from petunia.

  Methods for producing genomic libraries, stringent conditions used for hybridization with probes, and methods for gene cloning are well known to those skilled in the art. See, for example, Maniatis et al., Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989).

  The base sequence of the obtained gene can be determined by a nucleotide sequence analysis method known in the art or a commercially available automatic sequencer.

  The promoter in the present invention is not limited to those isolated from nature, and may include synthetic polynucleotides. Synthetic polynucleotides can be obtained, for example, by synthesizing or modifying the promoter sequence sequenced as described above or the active region thereof by techniques well known to those skilled in the art.

  The promoter in the present invention can be introduced into a plant cell using a known gene recombination technique as an expression cassette operably linked to a desired heterologous gene using methods well known to those skilled in the art. The introduced expression cassette is incorporated into DNA in the plant cell. The DNA in plant cells includes not only chromosomes but also DNAs contained in various organelles (for example, mitochondria and chloroplasts) contained in plant cells.

  As used herein, the term “plant” includes both monocotyledonous and dicotyledonous plants. A preferred plant is a dicotyledonous plant. Dicotyledonous plants include both petal flower subclasses and joint flower subclasses. A preferred subclass is the joint flower subclass. The joint flower subclass includes any of Gentian, Eggplant, Perilla, Abagoceae, Psyllium, Oleander, Pleurotus, Akane, Nematode, and Chrysanthemum. Preferred eyes are eggplant eyes. The solanidae includes any of the solanaceae, sericidaceae, red-breasted, lanterns, and convolvulaceae. A preferred family is the solanaceous family. The solanaceae includes Petunia, Datura, Tobacco, Eggplant, Tomato, Pepper, Physalis, and Culicidae. Preferred genera are Petunia, Datura, and Tobacco, more preferably Petunia. The Petunia genus includes P. hybrida species, P. axillaris species, P. inflata species, P. violacea species, and the like. A preferred species is the P. hybrida species. “Plant” means a plant having a flower and a seed obtained from the plant unless otherwise indicated.

  Examples of “plant cells” include cells of each tissue, callus, and suspension culture cells in plant organs such as flowers, leaves, and roots.

  As used herein, the term “expression cassette” refers to a nucleic acid sequence comprising the promoter of the present invention and a heterologous gene operably linked to this promoter (ie, in frame).

  As used herein, the term “heterologous gene” refers to an endogenous gene in Petunia other than the ZPT2-10 gene, ZPT2-11 gene, and ZPT3-3 gene, or an endogenous gene in another plant, or a plant A foreign gene (for example, a gene derived from an animal, an insect, a bacterium, and a fungus) whose expression is desired in any of the pistil tissues.

  The “plant expression vector” refers to a nucleic acid sequence in which various regulatory elements are operably linked in a host plant cell in addition to the promoter in the expression cassette. Suitably, a terminator, a drug resistance gene, and an enhancer may be included. It is well known to those skilled in the art that the type of plant expression vector and the type of regulatory element used can vary depending on the host cell. The plant expression vector used in the present invention may further have a T-DNA region. The T-DNA region increases the efficiency of gene transfer, particularly when plants are transformed with Agrobacterium.

  A “terminator” is a sequence that is located downstream of a region encoding a protein of a gene, and is involved in termination of transcription when DNA is transcribed into mRNA and addition of a poly A sequence. Terminators are known to contribute to mRNA stability and affect gene expression levels. Examples of the terminator include, but are not limited to, CaMV35S terminator and terminator (Tnos) of nopaline synthase gene.

  The “drug resistance gene” is preferably one that facilitates selection of transformed plants. A neomycin phosphotransferase II (NPTII) gene for conferring kanamycin resistance, a hygromycin phosphotransferase gene for conferring hygromycin resistance, and the like can be preferably used, but are not limited thereto.

  An “enhancer” can be used to increase the expression efficiency of a target gene. As the enhancer, an enhancer region containing an upstream sequence in the CaMV35S promoter is preferable. A plurality of enhancers can be used per one plant expression vector.

  The plant expression vector in the present invention can be prepared using gene recombination techniques well known to those skilled in the art. For the construction of a plant expression vector, for example, a pBI vector or a pUC vector is preferably used, but is not limited thereto.

  For introduction of a plant expression vector into a plant cell, a method well known to those skilled in the art, for example, a method using Agrobacterium and a method of directly introducing into a cell can be used. As a method using Agrobacterium, for example, the method of Nagel et al. (FEMS Microbiol. Lett., 67, 325 (1990)) can be used. In this method, Agrobacterium is first transformed with a plant expression vector (for example, by electroporation), and then transformed Agrobacterium is introduced into plant cells by a well-known method such as the leaf disk method. It is a method to do. Examples of methods for directly introducing a plant expression vector into cells include an electroporation method, a particle gun, a calcium phosphate method, and a polyethylene glycol method. These methods are well known in the art, and a method suitable for the plant to be transformed can be appropriately selected by those skilled in the art.

  Cells into which a plant expression vector has been introduced are selected based on drug resistance such as kanamycin resistance, for example. The selected cells can be regenerated into a plant body by a conventional method.

  In the regenerated plant body, the expression of the target heterologous gene can be confirmed using techniques well known to those skilled in the art. This confirmation can be performed, for example, using Northern blot analysis. Specifically, total RNA is extracted from the tissue in which the promoter of the present invention is specifically expressed, and after electrophoresis with denatured agarose, it is blotted on an appropriate membrane. By hybridizing a labeled RNA probe complementary to a part of the target heterologous gene to this blot, mRNA of the target heterologous gene can be detected. When the heterologous gene is endogenous to the introduced plant, the mRNA level of the target heterologous gene in the tissue in which the promoter of the present invention is specifically expressed and the same tissue in the non-transformed control plant A change in the expression level of the target heterologous gene can be evaluated by comparing the mRNA level of the target heterologous gene.

  Confirmation of the tissue-specific expression activity of the promoter in the present invention can be performed using the above-described method. For example, by examining the distribution of GUS activity in a plant transformed with an expression vector in which the promoter in the present invention and the GUS gene are operably linked, by conducting tissue chemical staining in a conventional manner, Tissue-specific expression activity can be identified.

  The plant in the present invention is a plant transformed with the target heterologous gene operably linked to the promoter in the present invention by the above-described method, and the target heterologous gene is controlled by the promoter in the present invention in the plant. Traits are altered as a result of tissue-specific expression underneath. The traits to be modified include, but are not limited to, fertility, compatibility, and pest resistance.

  According to the present invention, a practical promoter having specific expression activity in any of pistil tissues derived from a petunia gene is provided. The promoter of the present invention can be used to modify plant traits. For example, under the control of this promoter, a gene product that can damage that tissue in any of the pistil tissue (eg, tract tissue, placenta surface layer, stigma secretion region, flower bud, and stamen vascular bundle) ( For example, by specifically expressing an enzyme having an activity causing cell death, these tissues can be destroyed and the reproductive function of the pistil can be inhibited. As a result, plants can be imparted with female sterility traits. Alternatively, a gene having a function of eliminating pollen having a specific genotype (for example, S-RNase gene) can be expressed in an appropriate tissue, particularly a passage tissue. As a result, plants can be given a self-incompatible trait. Alternatively, pest-resistant plants that can kill or repel pests that contact the stigmas can be created by expressing proteins with anti-pest activity in the stigmas.

  Hereinafter, the present invention will be described based on examples. The scope of the present invention is not limited to only the examples. Restriction enzymes, plasmids, etc. used in the examples are available from commercial sources.

Example 1: Isolation of ZPT2-10 promoter region and ligation with GUS reporter gene
ZPT2-10 of cDNA (Kubo, K., Et al., Nucleic Acids Research, 26,608-616 (1998 )) , and conventional random prime method (Sambrook et al., Supra) and according to the [α- ³² P] dCTP A radiolabeled probe is produced by labeling. Using this labeled probe, a petunia (Petunia hybrida var. Mitchell) genomic library prepared in the EMBL3 vector (Stratagene) was screened. From the obtained clone, a genomic DNA fragment of about 3.0 kb including the upstream region of the gene was subcloned into the EcoRV-XbaI site of the pBluescriptSK vector (pBS-ZPT2-10EX), and the nucleotide sequence was determined (SEQ ID NO: 1) ( FIG. 1). Next, using this plasmid as a template, PCR was performed using a primer containing a BamHI recognition sequence (CCGGGGATCCATCATCTTGTAGAAGATCCAT; SEQ ID NO: 4) and a commercially available M13-20 primer. As a result, a BamHI site was introduced immediately downstream of the translation start point of the ZPT2-10 protein (position 2595 in the base sequence of FIG. 1). The DNA fragment obtained by PCR was cleaved at the EcoRV and BamHI sites, and then the resulting restriction fragment was cloned into the pBluescript vector to confirm the sequence. Thereafter, a DNA fragment obtained by cutting the cloned vector with SalI and BamHI was inserted upstream of the GUS coding region of commercially available pUCAPGUSNT (pUCAP-ZPT2-10-GUS-NT). As a result, the GUS region was linked in-frame in the region near the N-terminus of the coding region of the ZPT2-10 gene. In addition, a DNA fragment (including ZPT2-10 promoter, GUS, NOS, and terminator) obtained by digesting pUCAP-ZPT2-10-GUS-NT with AscI and EcoRI is inserted into the pBINPLUS vector and pBINPLUS -ZPT2-10-GUS was obtained (FIG. 4a).

Example 2: Isolation of ZPT3-3 promoter region and ligation with GUS reporter gene ZPT3-3 genomic DNA was isolated in the same manner as in Example 1. An approximately 2.5 kb DNA fragment (KpnI-EcoRI) containing the upstream region of the ZPT3-3 gene was subcloned into the pBluescriptSK vector (pBS-ZPT3-3-KE), and then the nucleotide sequence of this DNA fragment was determined (SEQ ID NO: 2) (FIG. 2). Using this plasmid as a template, PCR was performed with a primer containing the BamHI recognition sequence (CCGGGGATCCACATGACTTGTGTTTCTCCAT; SEQ ID NO: 5) and a commercially available M13-20 primer, and immediately downstream of the translation start point of the ZPT3-3 protein (base sequence of FIG. BamHI site was introduced at position 2322). The thus prepared DNA fragment was ligated so that ZPT3-3 and GUS were in-frame, and pBN-ZPT3-3-GUS was prepared in the same manner as in Example 1 (FIG. 4b).

Example 3: Isolation of ZPT2-11 promoter region and ligation with GUS reporter gene In the same manner as in Example 1, ZPT2-11 genomic DNA was isolated. An approximately 2.1 kb DNA fragment (EcoRV-EcoRI) containing the upstream region of the ZPT2-11 gene was subcloned into the pBluescriptSK vector (pBS-ZPT2-11-EE), and then the nucleotide sequence of this DNA fragment was determined (SEQ ID NO: 3) (Figure 3). Using this plasmid as a template, PCR was performed with a primer containing the BamHI recognition sequence (CCGGGGATCCTTCTTGCATTTGAACTTCCAT; SEQ ID NO: 6) and a commercially available M13-20 primer. BamHI site was introduced in 2012). The thus prepared DNA fragment was ligated so that ZPT2-11 and GUS were in-frame, and pBN-ZPT2-11-GUS was prepared in the same manner as in Example 1 (FIG. 4c).

Example 4: Introduction of a fusion gene of ZPT2-10, ZPT3-3, and ZPT2-11 promoter and GUS into Petunia (1) Agrobacterium tumefaciens LBA4404 strain (CLONTECH Laboratories Inc., Palo Alto, Calif.), 250 μg The cells were cultured at 28 ° C. in L medium containing / ml streptomycin and 50 μg / ml rifampicin. Cell suspensions were prepared according to the method of Nagel et al. The plasmid vectors constructed in Examples 1, 2, and 3 were each introduced into this strain by electroporation in cell suspension.

  (2) Polynucleotides encoding the fusion genes of ZPT2-10, ZPT3-3, and ZPT2-11 promoter and GUS were introduced into petunia cells by the following method: Transformation obtained in (1) above Agrobacterium tumefaciens LBA4404 strain was cultured with shaking (28 ° C., 200 rpm) in YEB medium (DNA Cloning Vol. 2, page 78, edited by DMGlover, IRL Press, 1985). Next, the obtained culture broth diluted 20-fold with sterilized water was co-cultured with petunia (Petunia hybrida var. Mitchell) leaf pieces. After 2 to 3 days, the bacteria were removed by culturing the leaf pieces in a medium containing antibiotics. Transformed petunia cells based on the presence or absence of kanamycin resistance caused by expression of NPTII gene derived from pBINPLUS introduced with the above three fusion genes, passaged on selective medium every 2 weeks Was selected. The selected cells were induced to callus by a conventional method and then redifferentiated into a plant body.

Example 5: Tissue specificity of ZPT2-10 promoter activity
The distribution of GUS activity was examined for the flowers of transformants obtained by introducing a fusion gene between the upstream region of the ZPT2-10 gene and GUS (Gallagher, SR (ed.) GUS protocols: using the GUS gene as a reporter of gene expressin, Academic Press, Inc., San Diego (1992)). As a result, GUS activity was specifically detected in the trochanteric tissue of the pistil style and the cell layer of the uppermost layer of the locus (ie, the surface layer of the locus) (FIG. 5 and FIG. 8 (a)).

Example 6: Tissue specificity of ZPT3-3 promoter activity
The distribution of GUS activity was examined in the same manner as in Example 5 using flowers of transformants obtained by introducing a fusion gene between the upstream region of the ZPT3-3 gene and GUS. As a result, the GUS activity was specifically detected in the secretory tissue of the pistil stigma, the tract tissue of the style, the surface layer of the locus, and the floret (FIGS. 6 and 8 (b)).

Example 7: Tissue specificity of ZPT2-11 promoter activity
The distribution of GUS activity was examined in the same manner as in Example 5 using flowers of transformants obtained by introducing a fusion gene between the upstream region of the ZPT2-11 gene and GUS. As a result, GUS activity was detected specifically in the vascular tissue from the stamen stigma to the style and the locus, and in the floret (FIGS. 7 and 8 (c)).

(Industrial applicability)
The petunia-derived ZPT2-10, ZPT2-11, and ZPT3-3 promoters in the present invention exhibit specific promoter activity in pistil tissues. These promoters are useful for modifying plant traits by genetic manipulation of pistil tissue.

FIG. 1 shows the nucleotide sequence of the promoter region, coding region, and 3 ′ untranslated region of the PEThyZPT2-10 (hereinafter referred to as ZPT2-10) genomic gene, and the deduced amino acid sequence of the coding region. FIG. 1 shows the nucleotide sequence of the promoter region, coding region, and 3 ′ untranslated region of the PEThyZPT2-10 (hereinafter referred to as ZPT2-10) genomic gene, and the deduced amino acid sequence of the coding region. FIG. 1 shows the nucleotide sequence of the promoter region, coding region, and 3 ′ untranslated region of the PEThyZPT2-10 (hereinafter referred to as ZPT2-10) genomic gene, and the deduced amino acid sequence of the coding region. FIG. 2 shows the nucleotide sequence of the promoter region, coding region, and 3 ′ untranslated region of the PEThyZPT3-3 (hereinafter referred to as ZPT3-3) genomic gene, and the deduced amino acid sequence of the coding region. FIG. 2 shows the nucleotide sequence of the promoter region, coding region, and 3 ′ untranslated region of the PEThyZPT3-3 (hereinafter referred to as ZPT3-3) genomic gene, and the deduced amino acid sequence of the coding region. FIG. 3 shows the nucleotide sequence of the promoter region, coding region, and 3 ′ untranslated region of the PEThyZPT2-11 (hereinafter referred to as ZPT2-11) genomic gene, and the deduced amino acid sequence of the coding region. FIG. 3 shows the nucleotide sequence of the promoter region, coding region, and 3 ′ untranslated region of the PEThyZPT2-11 (hereinafter referred to as ZPT2-11) genomic gene, and the deduced amino acid sequence of the coding region. FIG. 4 shows (a) a plant expression vector (pBIN-ZPT2-10-GUS) for analyzing the ZPT2-10 promoter, (b) a plant expression vector (pBIN-ZPT3) for analyzing the ZPT3-3 promoter. -3-GUS) and (c) Schematic diagrams showing the construction of a plant expression vector (pBIN-ZPT2-11-GUS) for analyzing the ZPT2-11 promoter. GUS represents a β-glucuronidase gene, Pnos represents a nopaline synthase promoter, Tnos nopaline synthase terminator, and NPTII represents a neomycin phosphotransferase gene. Fig. 5 shows the morphology of organisms obtained by photographing (a) stigma and style, (b) ovary, and (c) style (cross section) of a pistil GUS-stained petunia introduced with pBIN-ZPT2-10-GUS. It is a photograph which shows. Fig. 5 shows the morphology of organisms obtained by photographing (a) stigma and style, (b) ovary, and (c) style (cross section) of a pistil GUS-stained petunia introduced with pBIN-ZPT2-10-GUS. It is a photograph which shows. Fig. 5 shows the morphology of organisms obtained by photographing (a) stigma and style, (b) ovary, and (c) style (cross section) of a pistil GUS-stained petunia introduced with pBIN-ZPT2-10-GUS. It is a photograph which shows. Fig. 6 shows the morphology of organisms obtained by photographing (a) stigma and style, (b) ovary, and (c) style (cross section) of a pistil GUS-stained petunia introduced with pBIN-ZPT3-3-GUS. It is a photograph which shows. Fig. 6 shows the morphology of organisms obtained by photographing (a) stigma and style, (b) ovary, and (c) style (cross section) of a pistil GUS-stained petunia introduced with pBIN-ZPT3-3-GUS. It is a photograph which shows. Fig. 6 shows the morphology of organisms obtained by photographing (a) stigma and style, (b) ovary, and (c) style (cross section) of a pistil GUS-stained petunia introduced with pBIN-ZPT3-3-GUS. It is a photograph which shows. FIG. 7 shows (a) stigma and style, (b) ovary, and (c) style (cross section; (d) is an enlarged view) of pistil GUS-stained petunia introduced with pBIN-ZPT2-11-GUS. Is a photograph showing the form of the living thing. FIG. 7 shows (a) stigma and style, (b) ovary, and (c) style (cross section; (d) is an enlarged view) of pistil GUS-stained petunia introduced with pBIN-ZPT2-11-GUS. Is a photograph showing the form of the living thing. FIG. 7 shows (a) stigma and style, (b) ovary, and (c) style (cross section; (d) is an enlarged view) of pistil GUS-stained petunia introduced with pBIN-ZPT2-11-GUS. Is a photograph showing the form of the living thing. FIG. 8 is a schematic diagram showing expression sites of (a) ZPT2-10 promoter, (b) ZPT3-3 promoter, and (c) ZPT2-11 promoter. The symbols in the figure are: pollen (80), pollen tube (80 '), stigma (81), secretory region (82), passage tissue (83), style (84), ovary (85), ovule ( 86), placenta (87), flower buds (88), and vascular tissue (89). The expression site of each promoter is indicated by a dark diagonal line. (Sequence Listing)

Claims (1)

A promoter having activity specific to each tissue of the pistil as described herein.