JP2007289198A - Gold-binding protein - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a gold-binding protein which is capable of specifically binding to gold and can be used for binding the gold to a target protein in a fine structure, to provide a conjugated protein having the protein, and to provide a technique used for the detection of the target substances. <P>SOLUTION: This gold-binding protein is characterized in that protein contains at least one part of an antibody. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

The present invention relates to a gold-binding protein, a complex protein containing a gold-binding protein, and applications for detecting these target substances.

With the recent miniaturization of devices accompanying improvements in semiconductor microfabrication technology, the semiconductor industry has developed greatly. At present, the precision of micro-processing technology represented by lithography has reached several hundred nanometers. The fields of materials and devices that apply them are widely used,
Expectations are expected in a wide range of fields such as optical and electrical communications, biotechnology, and energy. However, considering the processing of 100 nanometers or less in the extension of the current microfabrication technology, in addition to technical problems, there are many problems in terms of time and cost required for processing and industrial use. As the field expands, new precision structure fabrication techniques to replace these are eagerly desired.

Under such circumstances, research and development for new materials using the bottom-up method that controls at the atomic and molecular level and creates the desired structure and properties is actively conducted instead of the conventional top-down processing technology. . One example of bottom-up precision structure fabrication technology is the development of molecular devices with molecular alignment controlled on metal surfaces. One of such molecular alignment control technologies is the use of self-organization of materials. The use of methods is being considered. As a recent study example, Lindsay et al. (Science, 300: p1413, 2003) uses a self-assembled film in which alkanethiol and alkanedithiol having a thiol group at the molecular end are aligned on a gold substrate. We are studying.

Biomolecules represented by nucleic acids and proteins are known to construct precise structures controlled at the atomic level in order to exert their functions. Utilizing the characteristics of such biomolecules,
Consideration of application of biomolecules to various devices in which biomolecules are arranged on a metal, metal oxide, or semiconductor is also considered. As a first step for developing such a device, a technique for producing a minute structure in which a biomolecule is arranged on a substrate is important. For example, when considering immobilization of deoxyribonucleic acid (DNA) and peptides having amino acid sequences having various functions on a gold substrate, DNA and peptides can be chemically synthesized. It is widely known that these substances are coordinated on a gold substrate by using S-Au surface adsorption by chemically modifying the ends of these substances with a thiol group (-SH). Utilizing this, an experimental system in which DNA or peptide is immobilized on gold and studies on devices have been conducted.

On the other hand, proteins having functions such as enzymes and antibodies have a high molecular weight, and it is very difficult to chemically synthesize such high molecular weight compounds to form higher-order structures and perform their functions. Although various studies have been carried out, in reality, there are many cases where functional proteins having functions and higher order structures have not yet been synthesized (Science,
302: p1364, 2003). When functional protein is immobilized on a substrate material, the substrate side is treated with various surface treatment agents typified by a silane coupling agent for binding to the substrate,
In general, a functional group capable of binding to the surface-treated surface is introduced on the protein side (Proteomics, 3: p254, 2003). However, introduction of a reactive functional group into such a functional protein is generally performed by chemical modification. Since the introduction site is determined non-selectively, a functional expression site of the functional protein is determined. It has been pointed out that there is a possibility that the resulting activity may be fixed on the substrate in a shape that is difficult to function by being modified, and the resulting activity may be reduced.

It is also possible to produce a fusion protein in which a binding site is introduced into the protein by genetic engineering techniques. For example, all of (strept) avidin known to bind to biotin, which is a low molecular compound, or the biotin binding site at the N-terminus of the desired protein,
A method is known that is introduced into the C-terminal by genetic engineering, expressed as a fusion protein, and immobilized via biotin arranged on a desired substrate surface.

Recently, a technique has been disclosed in which a peptide is obtained from five or more amino acids that can be bound to a substrate material to be immobilized, fused with a desired protein to produce a fusion protein, and bound to and immobilized on a substrate. Belcher et al. Disclosed a peptide consisting of 12 amino acids that can specifically recognize a crystal plane of GaAs by the phage display method (Nature, 40).
5: p665, 2000), a new possibility of device investigation using the self-organization ability of biomaterials was shown. Furthermore, amino acid sequences of peptides consisting of 7 to 14 amino acids for other semiconductors (PbS, CdS) and the like are disclosed (WO03 / 029431). Br
Own et al. disclose several amino acid sequences in which peptides having a repeating structure with an amino acid sequence consisting of 14 residues as a unit showed affinity for gold (Nature).
Biotechnology, 15: p269, 1997). In addition, metal so far (
Au, Pt, Pd, Ag), metal oxides (SiO ₂ , ZnO, Cr ₂ O ₃ , Fe ₂ O ₃ ), and a large number of affinity peptides for semiconductors have been obtained by the phage display method or the like.

By immobilizing a desired biomolecule on the substrate via such a substrate material affinity peptide, the desired function / shape is periodically formed by self-organization by interaction between biomolecules or different substances. It is also possible to construct a structure with. For example, the Belch
er et al. disclose a technique for producing a liquid crystal-like film by aligning M13 phage displaying a ZnS affinity peptide bound to ZnS particles by self-assembly (Sc).
ence, 296: 892, 2002).

Furthermore, as described above, the desired functional protein fused with the substrate-binding site is genetically engineered to set the functional protein to the desired site other than the functional site. Several technical examples show that this is possible. However, when a substrate material affinity peptide is linked to a functional protein terminus directly or via a linker consisting of several amino acids and bound to a solid phase (for example, a substrate) to try to immobilize the protein, the functional protein Active sites (for example, several amino acid residues constituting the antigen-binding site of an antibody) are close to the substrate, and some interaction from the substrate surface (for example, electrostatic action)
May cause structural changes and the like, and the desired function may not be sufficiently exhibited. Even when the linker is set longer, if the degree of freedom of molecular motion of the peptide serving as the linker is high, it may be placed close to the functional site and inhibit its function.

From the above, the present inventors have determined that the substrate binding site for immobilizing a functional polymer material such as a functional protein linker is fixed from the substrate without inhibiting the desired activity of the protein to be immobilized. It came to the idea that it is necessary to have a structure part (scaffold structure) that serves as a spacer for securing a distance of 2 mm and a part that binds to the substrate.

Antibodies are best known as molecular recognition molecules having such a scaffold structure. The antibody functions in a self-protection mechanism that recognizes and specifically binds various structures on the surface of the foreign body to various foreign bodies that the animal enters into its body fluid and detoxifies it by its immune system. Is one of the proteins The diversity of the antibodies (the number of antibodies having different amino acid sequences for binding to various foreign substances) is estimated to be 10 ^{7 to} 10 ⁸ species per animal. The structure is formed of two long and short polypeptide chains, and the long polypeptide chain is called a heavy chain and the short polypeptide chain is called a light chain.

Each of these heavy and light chains has a variable region and a constant region. The light chain is a polypeptide chain composed of two domains, one variable region (VL) and one constant region (CL), while the heavy chain is composed of one variable region (VH) and three constant regions ( It is a polypeptide chain composed of four domains (CH1 to CH3). Each of the above domains has about 1 amino acid
A layered structure consisting of 10 sheets and a β sheet group arranged in antiparallel orientation is formed, and this layered structure is joined by one SS bond to form a very stable structure. ing. In addition, the binding of the antibody to various antigen species is performed by three complementary determining regions (complementarity determination regions) each of which the variable region (VH or VL) has.
Ning region (CDR) is known to be caused by the diversity of amino acid sequences. There are three CDRs in each of VH and VL, which are separated by the framework region and can recognize higher spatial and specific molecular recognition by recognizing the spatial arrangement of the functional group of the target recognition site. It is said.

The diversity of the CDRs is exhibited by DNA rearrangement that occurs at the antibody locus when bone marrow stem cells differentiate into B lymphocytes that are antibody-producing cells. It is known that it occurs by DNA rearrangement in the heavy chain, which consists of VH gene fragment, D gene fragment, JH gene fragment, and in the light chain, which consists of Vλ or Vκ gene fragment, Jλ or Jκ gene fragment. It has been. Since such DNA rearrangement occurs independently for each B cell, one B cell produces only one type of antibody. However, various antibodies can be produced in the entire B cell within the individual.

An antibody capable of binding to a specific substance as described above has been artificially prepared using the antibody production mechanism in the immune system of an animal as described above, and is used in various industrial fields. As an example of the production method, there is a method of immunizing an immunized animal (rabbit, goat, mouse, etc.) with an antigenic substance together with an adjuvant at a predetermined interval and recovering an antibody damaged in the serum. The antibody thus obtained is a mixture of a plurality of antibodies recognizing various structures on the surface of the antigenic substance used for immunization. Such serum containing a plurality of antibodies that bind to one antigen is called a polyclonal antibody.

On the other hand, various B lymphocytes that produce antibodies that bind to the target antigen exist in the spleen of the immunized animal. Such antibody-producing B cells are fused with established tumor cells to produce hybridoma cells. As described above, one B lymphocyte produces one kind of antibody.
A system has been established that can permanently culture B cells producing one type of antibody. The antibody thus produced is called a monoclonal antibody.

As a molecular recognition structure using the structure of the antibody as a scaffold, JP-A-05-055534
Discloses a multi-binding antibody that recognizes two different antigens and a method of forming a multi-layer using the same. According to this technique, a fusion antibody that recognizes the first antigen and the second antigen can be obtained. Furthermore, a multilayer can be formed without chemical modification by sequentially arranging the first antigen, the fusion antibody, and the second antigen on the surface of the substrate. However, in order to obtain the disclosed fusion antibody, it is necessary to use animal cells, which is problematic in terms of cost and work complexity. Furthermore, in the case of forming a multilayer film, a step for arranging an antigen recognizable by the fusion protein on the substrate surface in advance must be provided.

Antibody fragments, Fab, Fab, obtained by treating the above antibodies with certain proteolytic enzymes
It is known that ', F (ab') 2 also has the ability to bind to the same antigen as the parent antibody.

The above-mentioned VH, VL or their complex Fv, and further, in the complex composed of VH or VL, a single chain Fv linked via a peptide composed of one carboxy terminal and the other amino terminal several amino acids. Similarly, (single chain Fv: scFv) and the like are known to show binding properties to the same antigen as the parent antibody.

Skerra and Better disclose a method of expressing antibody genes by Escherichia coli using Fab-type and Fv-type antibody fragments in which a secretory signal sequence is added to the N-terminus by genetic engineering methods (Science, 240: p1038, 1988). , (Science, 24
0: p1041, 1988). In addition, Japanese Patent Publication No. 07-501451 discloses a multivalent antigen-binding protein and a production method thereof, and Japanese Patent Publication No. 08-504100 discloses a technique relating to a multivalent and multispecific binding protein and a production method thereof. ing. In these two techniques, the binding protein is an antibody variable region (V) that binds to one or more antigens.
H and / or VL). Special table 07-
No. 501451 discloses a structure of a binding protein that recognizes vancarcinoma antigen TAG-72 and fluorescein, a bispecific binding protein that recognizes them, and an amino acid sequence, as well as a base sequence that encodes them. ing. Special table 08-5
In the publication No. 04100, a bivalent consisting of an antibody fragment complex against a known protein (cell membrane protein, cancer antigen CEA, FcRγ1, etc.) or a low molecular compound at the time of filing of the application related to JP-T-08-504100 in the Examples. And bispecific binding proteins.

However, the disclosed technology does not disclose a technology related to a binding protein that directly recognizes and binds to the surface of a substrate material typified by an inorganic substance. for that reason,
In the case of producing a structure in which the binding protein is arranged on a substrate, a conventionally known method,
For example, the substrate or the binding protein must be chemically modified and placed on the substrate by a covalent bond or the like. Similarly, when binding to fine particles of a metal or a semiconductor substance, it is necessary to chemically modify the fine particles or binding protein to be bound in the same manner. Such chemical modifications often target amino residues and carboxyl groups that proteins have in their molecules, and the sites involved in the reaction are non-selective.
For this reason, the site exhibiting the desired activity may also become a substrate fixing or labeling site, and as a result, the desired activity of the protein may be reduced. Moreover, such problems are not limited to microdevice technology, and molecules that capture target substances such as antibodies can be fully exerted on the substrate with a molecular orientation that can fully exhibit the capture function even in the production of sensing elements such as biosensors. Immobilization in is an important technique.

Studies are also underway to impart various molecular recognition capabilities to proteins having the same scaffold structure as the above-described antibodies. For example, anticolin (Review in Molec
ultra Biotechnology, 74: p257, 2001), fibronectin type III domain (J. Mol. Biol, 284: p1141, 1998) and the like. Anticolin is a capture protein modified based on lipocalin. Liocalin is a protein composed of 160 to 180 amino residues and functions as a transport and storage of a low water-soluble substance. The structure is a barrel-shaped structure composed of eight β sheets. Objects can be recognized and combined by the four loop structures connecting the β sheets. Fibronectin is generally a protein composed of amino acids of 100 residues or less, and plays an important role in joining with an extracellular matrix and joining between cells. Like the above two proteins, it has a β sheet structure, and is a protein that recognizes a target substance by a loop structure between β sheets. Anticolin above
A novel binding protein is constructed by introducing a random amino acid sequence into a loop structure between fibronectin β-sheets. Since these molecules have a strong molecular structure consisting of β-sheets separately from the molecular recognition site, they can specifically recognize and bind to the substrate by fusing with the desired functional polymer material. It is expected to have a spacer function that secures a certain distance from the substrate without inhibiting the desired activity of the polymer material to be immobilized. However, examples of specifically recognizing and binding inorganic substances typified by metals and semiconductor materials in the molecular recognition proteins having the above-mentioned structurally stable scaffold structure typified by the antibody have been described so far. No.

On the other hand, in the field of detection of various substances (target substances), detection and / or quantification of target substances has been established several times, particularly with respect to proteins such as antigens and antibodies, and sugars, lectins and nucleic acids. Has been. For example, it is known that detection or quantification via a labeling substance is possible by binding the labeling substance to an antibody that specifically recognizes and binds to the target substance. As the labeling substance, it is possible to use fine particles from a metal such as gold or an organic material such as latex, a fluorescent substance that emits fluorescence by excitation light in a specific wavelength region, or an enzyme (for example, HRP) that uses the fluorescent substance as a reaction product. It is common. Examples of the method for labeling proteins such as antibodies include a physical bonding method and a chemical bonding method in which a functional group having a reactive activity is introduced into a labeling substance / or a labeling substance, and a chemical bond is formed using the functional group as a crosslinking point. .

Hereinafter, the prior art will be described using an antibody used for detection as an example. Patent No. 03108
No. 115 shows an example of a method for gold labeling by physically adsorbing gold fine particles to an antibody. According to this method, a monoclonal antibody is added to a colloidal gold dispersion prepared in advance, the supernatant is removed by centrifugal sedimentation, and a gold-labeled antibody can be obtained through several washing steps.

Next, a method for labeling an antibody by a chemical bonding method will be described. The antibody has an amino group or SH group of a protein, and a labeling substance such as a fluorescent substance and a labeling substance such as an antibody are prepared by providing a functional group having reactivity to these in advance on the labeling substance side. It is possible to chemically bond with For example, a method of introducing a labeling substance having an N-hydroxysuccinimide, isothiocyanate group, nitroaryl halide group, or acid chloride group that reacts with an amino group can be mentioned. N-hydroxysuccinimide is known to react efficiently with an amino group in an environment of pH 7 or higher to form a very stable amide bond, and is widely used as a cross-linking agent for labeling proteins (Biochemistry). Vol.
11, pp 2291, 1972). The amino group at the α position on the protein and the ε position of the lysine side chain can be the reaction target of the succinimide group. In particular, the ε-position amino group is considered as a general succinimide target. For example, when gold fine particles are chemically bound to a protein such as an antibody as a labeling substance, first, the gold fine particles have an SH group at least at one end, and the other has a functional group highly reactive with the side chain residue of the protein. Modification with a compound having The protein can then be linked by crosslinking with the reactive functional group. However, in these methods, a residue having a lysine or a free α-amino group is non-selectively targeted for reaction, and thus there is a risk of inhibiting the function of a protein such as an antibody to be labeled. Moreover, although FITC is known as a fluorescent substance having an isothiocyanate group, there is a concern that a desired characteristic of a protein to be labeled is deteriorated due to a non-specific reaction with an amino group as in the case of succinimide.

Moreover, -SH group can be used as a crosslinking point. Methods using SH groups can be broadly divided into maleimide methods and pyridyl disulfide methods. The maleimide method is a method using a crosslinking agent having maleimide as an SH group-selective reactive group, and it is known that selective crosslinking can be performed under mild conditions. For example, when the binding target is an antibody, the SH group obtained by cleaving the disulfide at the hinge part of the antibody molecule is irrelevant to the antigen recognition part. Therefore, even if the SH group is modified, the specificity of the antibody is not impaired. It is expected. By using this SH group as a crosslinking point, it is possible to bind the labeling substance without impairing the desired function. However, there are 16 SS bonds in the entire antibody molecule, among which are CDRs (complementary) that are antigen recognition sites.
a heavy chain variable region (VH) having a (disition region), a light chain variable region (V
The SS bond for maintaining the structure of L) is also included, and if the reduction site is not site-specific, the function may be impaired.

Japanese Examined Patent Publication No. 04-070320 discloses a protein labeling technique using a metallothionein or a fragment thereof, which is a low molecular weight protein chelating with high affinity to a wide variety of metal ions. This publication discloses a technique in which metallothionein binds to a metal ion serving as a labeling substance at a sulfhydryl moiety and binds to an antibody or the like using other functional groups such as an amine group, a hydroxyl group, and a carboxyl group as a crosslinking point. . In metalloneotine, the metal ion binding site and the labeling substance binding site are distinguished, and each binding substance can bind. However, the binding site of the labeling substance is not clear as in other crosslinking methods. However, it is considered that the same problem as described above may still remain.

Furthermore, as a means for solving non-selective modification by the immobilization method on the labeling substance by chemical crosslinking as described above, a genetic engineering modification method can be mentioned. It is also possible to produce a fusion protein in which a binding site is introduced into a protein by genetic engineering techniques. As an example, biotin, which is a low molecular weight compound, is chemically introduced at the end of a labeling substance such as a fluorescent substance, and is bound to the biotin (strept). A method is known in which a protein of interest is bound to a target substance by introducing it into the N terminus and C terminus of the protein by genetic engineering, expressing it as a fusion protein, and via the biotin-avidin bond. In this way, a low molecular weight compound is introduced into a labeling substance, for example, a fluorescent substance, a fusion protein with the target protein into which a protein capable of recognizing and binding is introduced is genetically engineered, and a selective binding site is introduced. can do.
Japanese Translation of National Publication No. 07-501451 JP-T-08-504100 Japanese Translation of National Publication No. 07-501451 Japanese Patent Publication No. 04-070320 Japanese Patent No. 03108115 International Publication No. 03/029431 Pamphlet Science, 300: p1413, 2003 Science, 302: p1364, 2003. Proteomics 3: p254, 2003 Nature, 405: p665, 2000 Nature Biotechnology, 15: p269, 1997 Science, 296: 892, 2002. Science, 240: p1038, 1988 Science, 240: p1041, 1988 Review in Molecular Biotechnology, 74: p257, 2001 J. et al. Mol. Biol, 284: p1141, 1998 Biochemistry, Vol. 11, pp 2291, 1972

However, the above disclosed technique does not disclose a technique relating to a binding protein that recognizes and binds to a substrate material surface typified by an inorganic substance or a labeling substance in a molecular selective manner. Therefore, when a structure in which the binding protein or the complex protein is arranged on the substrate is prepared, a conventionally known method, for example, the substrate or the binding protein is chemically modified and arranged on the substrate by covalent bonding. It must be arranged by a method such as Similarly, when binding to fine particles of metal or a semiconductor substance and a labeling substance, it is necessary to chemically modify the fine particles or binding proteins to be bound in the same manner. Such chemical modifications often target amino residues and carboxyl groups that proteins have in their molecules, and the sites involved in the reaction are non-selective. For this reason, the site exhibiting the desired activity may also become a substrate fixing or labeling site, and as a result, the desired activity of the protein may be reduced.

Moreover, such problems are not limited to microdevice technology, and molecules that capture target substances such as antibodies can be fully exerted on the substrate with a molecular orientation that can fully exhibit the capture function even in the production of sensing elements such as biosensors. Immobilization in is an important technique.

The protein capable of binding to gold according to the present invention is a protein having binding ability to gold, and has a gold binding site containing at least a part of an antibody against gold.

The gold-binding complex protein according to the present invention includes (1) a first domain containing a protein having binding ability to gold according to any one of claims 1 to 9, and (2) binding to a specific substance. And a second domain containing a protein having a site.

On the other hand, the structure according to the present invention is a structure having a substrate and a protein, wherein the substrate contains gold on at least a part of its surface, and the protein is a gold-binding complex protein having the above-described configuration. It is what.

Further, the nucleic acid according to the present invention is a nucleic acid encoding the gold-binding complex protein having the above-described configuration. Furthermore, the vector according to the present invention is characterized by containing this nucleic acid.

Furthermore, the manufacturing method of the structure having the above-described configuration according to the present invention includes (1) a step of preparing the substrate,
(2) A method for producing a structure comprising the step of producing the gold-binding complex protein and (3) the step of arranging the gold-binding complex protein on the substrate.

A detection kit for detecting a target substance according to the present invention comprises a substrate for forming a structure having the above-described structure, a gold-binding complex protein, and a detection for detecting the binding of the target substance to the structure. Means for detecting a target substance.

Further, the connection member for labeling the target substance with the labeling substance according to the present invention is a connection member for labeling the target substance with the labeling substance, and binds the site to which the target substance is bound to the labeling substance. Each of the sites has one or more sites, and these sites bind to a bound substance independently of each other, and at least one of a site for binding the labeling substance or a site for binding the target substance is any one of claims 1 to 10. The connection member characterized by including the protein as described in above.

The target substance detection method according to the present invention is a target substance detection method by binding a target substance to a labeling substance and labeling, and detecting the target substance to which the labeling substance is bound. A method of detecting a target substance, comprising the step of binding to the target substance via a connecting member.

A kit for detecting a target substance according to the present invention includes a labeling substance, a connection member having the above-described configuration, and a detection unit for detecting a state in which the labeling substance is bound to the target substance via the connection member, It is a kit characterized by having.

Since the gold-binding complex protein according to the present invention has a gold-binding site and a structural part, when the functional substance that is linked and bonded thereto is immobilized on the gold substrate surface, the functional substance The effect of immobilization on the function is not exerted, and since no reagent is used for the immobilization, no chemical reaction affecting the function is incurred. Furthermore, the functional substance does not receive an interaction from the substrate that affects its function by keeping the distance from the gold substrate.

Furthermore, the gold-binding complex protein of the present invention has at least gold and a plurality of binding portions for a specific substance. Thus, at least (i) a substrate having gold on at least a part of the surface, (ii) the gold-binding complex protein of the present invention, and (iii) a specific substance that can bind to the gold-binding complex protein of the present invention It can be set as the structure which forms the multilayer body comprised from these. In this case, since the gold-binding complex protein according to the present invention has a sterically stable β-sheet structure of the antibody variable region domain, the spatial position is maintained between the binding site between the gold substrate and the specific substance. The gold-binding protein domain (for example, the second domain) that binds gold or a substance other than gold (for example, the target substance) does not receive any interaction from the substrate containing gold. , The binding ability can be retained. Moreover, it is possible to form a very thin dense multilayer structure. By utilizing these characteristics of the gold-binding protein of the present invention, a detection device can be obtained. For example, a sensing element for a desired substance can be obtained by providing the gold-binding complex protein of the present invention capable of binding to a desired substance on a gold thin film. As the detection method, optical means, for example, means using surface plasmon resonance can be provided.

On the other hand, the gold-binding protein according to the present invention uses a substance containing gold as a labeling substance,
It can be used as a connecting member for binding a labeling substance containing gold to a target substance. According to the form as the connecting member, the following typical effects can be obtained.

The first effect is that there is a problem in the conventional labeling method by having at least one site for binding the target substance and one site for binding the labeling substance, and each binding site binds to the bound substance independently of each other. Thus, it is possible to provide a connecting member that can label an excellent target substance, in which a decrease in target substance binding ability of the target substance that occurs when the labeled substance has been bound is not observed. As a second effect, high binding properties resulting from the interaction between a plurality of amino residues of the protein and the surface of the target substance can be expected due to being a biopolymer and further a protein. As a third effect, since the connecting member is an antibody variable region, since the binding site is defined by a configuration defined by a higher order structure, high binding specificity can be expected. As a fourth effect, since the labeling substance is a substance containing gold, in addition to optical measurement using the principle of enhanced Raman and localized plasmons, not only the measurement of the amount of scattered light on the sample, but also its electrical characteristics were used. Electrical measurements can also be possible. As a fourth effect, by using the connection member according to the present invention, it is possible to provide a detection method and a detection kit capable of adding the target substance / connection member / labeling substance simultaneously or arbitrarily.

Hereinafter, the gold-binding protein according to the present invention, a complex protein using the same, and uses thereof will be described.
(1) Gold-binding protein-Antibody The gold-binding protein of the present invention comprises at least a part of an antibody. The antibody used for binding to gold as shown in the present invention includes antibodies having binding ability to gold produced in all vertebrate lymphoid cells, and one or the number of amino acids in their amino acid sequences. These include proteins that have amino acid sequences that are deleted, substituted, or added, and that are related in their structure and function, that is, that maintain the desired gold-binding properties. Antibodies are classified according to their properties (immunological or physical) as IgG, IgM, I
Although classified into gA, IgD, and IgE, any classification may be sufficient. Furthermore, these may form multimers. For example, IgA forms a dimer and IgM forms a pentamer, but there is no problem as long as it has a shape capable of binding to gold. Moreover, when the usage is in vitro, it is not limited to mammals, and there is no problem with IgW and IgY.

-Acquisition of gold-binding antibody As a method for acquiring the antibody exhibiting gold-binding property of the present invention, a conventional antiserum preparation technique and a monoclonal antibody production technique by cell fusion may be selected as appropriate. it can.
For example, an appropriate immunized animal is immunized with gold fine particles to be bound according to the present invention, and the antibody is recovered from the serum when an increase in antibody titer is confirmed. In the immunization, gold fine particles as an antigen are diluted to an appropriate concentration with an appropriate solvent, for example, physiological saline, and this solution is administered intravenously or intraperitoneally. A method of administration in combination and administering to an animal about 3 to 4 times at intervals of 1 to 2 weeks is common. The immunized animal is dissected on the third day after the final immunization, and spleen cells obtained from the removed spleen are used as immune cells. The gold fine particles to be immunized are preferably 10 nm or less, and more preferably 2 nm or less. Furthermore, it is more preferable that a protein such as serum albumin is covalently bound to be haptenized. Even antigens that are unlikely to cause an immune response are expected to be recognized as part of protein antigens by being complexed with certain protein antigens to induce production.

The obtained antibody may be polyclonal, but by making it monoclonal, it becomes possible to select a clone with higher specificity for gold. Monoclonal antibodies can be obtained by cloning the cells that produce them. In general,
Hybridomas can be formed by fusing immunoglobulin producing cells such as spleen collected from immunized animals with cancerous cells (Gulfur G., Nature 2).
66.550-552, 1977). For example, mouse-derived myeloma P is used as a cancerous cell.
3 / X63-AG8.653 (ATCC No. CRL-1580), P3 / NSI /
1-Ag4-1 (NS-1), P3 / X63-Ag8. U1 (P3U1), SP2 / 0-
Ag14 (Sp2 / O, Sp2), NS0, PAI, F0 or BW5147, rat-derived myeloma 210RCY3-Ag. 2.3. , Human-derived myeloma U-266AR1
And myeloma cells such as GM1500-6TG-A1-2, UC729-6, CEM-AGR, D1R11 and CEM-T15.

Screening of cells producing monoclonal antibodies is performed by culturing the cells in a titer plate and determining the reactivity of the culture supernatant of the wells in which proliferation has been observed with the gold microparticles, for example, RIA (radio immunoassay) or ELISA (enzyme). -Lin
It can be measured by enzyme immunoassay such as ked immuno-solvent assay) or immunoprecipitation. Alternatively, surface plasmon resonance (surface pla)
It is also possible to quantitatively measure the gold binding property using a monstrance (SPR) apparatus.

Antibody fragment The antibody fragment described in the present invention means a partial region of a monoclonal antibody, specifically, F (ab ′) 2, Fab ′, Fab, Fd, Fv (variable fragment).
of antibody), scFv (single chain Fv), dsFv
(Disulphide stabilized Fv) or single domain dAb (single domain an) consisting of variable region (VH) or light chain variable region (VL)
tibody) and the like.

Here, “F (ab ′) 2” and “Fab ′” can be obtained by treating an antibody with a protease such as pepsin or papain. It means an antibody fragment produced by digestion before and after a disulfide bond existing between two heavy chains (H chains) in the hinge region of an antibody. For example, when IgG is treated with papain, a light chain consisting of a light chain variable region (VL) and a light chain constant region (CL) is cleaved upstream of a disulfide bond existing between two heavy chains in the hinge region ( L chain), heavy chain variable region (VH) and heavy chain constant region 1 (CH
Two homologous fragments are obtained in which the heavy chain (H chain) fragment consisting of 1) is linked by a disulfide bond in the C-terminal region. Each of these two homologous antibody fragments is Fab
'I say. In addition, when IgG is treated with pepsin, an antibody fragment that is cleaved downstream of the disulfide bond existing between the two heavy chains in the hinge region to produce a slightly larger antibody fragment than the two Fab's connected in the hinge region is produced. Can do. This antibody fragment is labeled with F (
ab ′) 2.

Such a gold-binding protein of the present invention may be Fab ′ and F (ab ′) 2 described above. Further, it may be an Fd fragment in which VH and CH1 are combined.

Furthermore, it may be a variable region part (Fv) of an antibody or a part thereof, for example, a heavy chain variable region (VH), a light chain variable region (VL) constituting the Fv, or a part thereof. . On the other hand, in the complex composed of VH or VL, a single chain Fv (single ch) linked via a peptide consisting of several amino acids at one carboxy terminal and the other amino terminal.
ain Fv: scFv) can also be used. VH / VL forming the scFv
It is desirable to provide a linker composed of one or more amino acids between them (in random order). It is important that the residue length of the amino acid linker is designed so as not to have a binding force that prevents the formation of a structure necessary for the binding between VH or VL and an antigen. As a specific example, the length of amino acid linkers is generally 5 to 18 residues, and 15 residues are most frequently used.
These fragments can be obtained by genetic engineering techniques.

Furthermore, either VH or VL may be a single domain dAb. However, since the single domain structure is generally unstable, stabilization by chemical modification such as PEG modification may be performed. . Moreover, the variable region VHH (J. Mol. Biol, 311) of a camel heavy chain antibody, which is known to exist and function in vivo as a heavy chain antibody.
: P123, 2001), the variable region IgNAR of an immunoglobulin-like molecule of Nurse shark. Furthermore, when VH and VL of an antibody molecule composed of heavy chains and light chains typified by humans or mice are used as a single domain as shown in FIG. 1 to FIG. Stability may be improved by introducing a mutation with reference to a substantial part of the antibody.

Gold binding sites are selected from (1) antibody heavy chain variable region (VH), variants thereof and parts thereof, and (2) antibody light chain variable region (VL), variants thereof and parts thereof. At least one selected from the group consisting of As an antibody heavy chain variable region (VH),
A protein comprising at least one of the amino sequences of SEQ ID NOs: 1-48 is used as an antibody light chain variable region (VL), and a protein comprising at least one of the amino sequences of SEQ ID NOs: 49-57 is used. It can be mentioned as a preferable one. These SEQ ID NOs: 1-5
A protein having one or more amino acid sequences in which one or several amino acids of each of the seven amino sequences are deleted, substituted or added and having gold-binding properties can be used as well.

-Acquisition of gold-affinity antibody fragment-Acquisition by enzyme treatment In addition, an antibody fragment having the antigen-binding site and antigen-binding ability of the antibody to some extent can be obtained by subjecting the antibody to a certain enzyme treatment. For example, Fab fragments or analogs thereof can be obtained by treating the obtained antibody with papain, and Fps can be obtained by pepsin treatment.
(Ab ′) ₂ fragments or analogs thereof are obtained. In addition to the enzymatic method, the antibody fragment may be prepared by chemical degradation. These antibody fragments can be used without any problem as long as they have binding ability to gold.

As a method for obtaining the Fab ′, Fv, VH, or VL dAb according to the present invention, acquisition using a genetic engineering technique is also possible. For example, there is a method in which the VH or VL gene library is prepared, and these are comprehensively expressed as proteins and selected according to the binding property to gold or a target substance while corresponding to the gene. The gene library can be obtained from, for example, umbilical cord blood, tonsils, bone marrow, or peripheral blood cells or spleen cells. For example, mRNA is extracted from human peripheral blood cells and cDNA is synthesized. Next, a human VH or VL cDNA library is prepared using a sequence encoding human VH or VL as a probe. For example, primers that can amplify the human VH family (VH1 to VH7) widely for each family and primers that can amplify human VL are known. RT-PCR is performed by combining primers for each of these VH and VL, and genes encoding VH and VL are obtained. It is also possible to use a phage display method. Phage display methods include VH, VL or complexes containing them (eg, Fab, scFv
) Is linked to a gene encoding a phage coat protein to produce a phagemid library, transformed into E. coli, and having various VH or VL as part of the coat protein Expressed as These phages can be used for selection according to the binding property to gold or a target substance in the same manner as described above. Since the gene encoding VH or VL displayed as a fusion protein on the phage is encoded by the phagemid in the phage, it can be identified by DNA sequence analysis.

The present invention also includes a nucleic acid encoding the gold-binding protein. Furthermore, a host cell (eg, a conventionally known protein expression cell derived from Escherichia coli, yeast, mouse, human, etc.) is transformed with the protein as a protein, and from a nucleic acid serving as a gene vector for expressing the gold-binding protein. The composition which comprises is also included. The gold-binding protein of the present invention that can be expressed by one expression vector is F (ab ′) 2, Fab, which is a whole antibody molecule, or an antibody fragment thereof.
It can be designed by selecting from Fv (scFv), VH, VL, or a complex thereof. When a plurality of fragments are encoded in one expression vector, each antibody fragment can be expressed as an independent individual polypeptide chain. It is also possible to adopt a vector configuration in which the domains are expressed as a single polypeptide chain in which the domains are continuously linked or linked via amino acids.

The structure of the gold-binding protein expression vector of the present invention can be designed and constructed by incorporating it into a structure necessary for expressing a transgene such as a known promoter according to the selected host cell. The vector structure can be constructed by referring to the structure of a known promoter or the like according to the selected host cell. Further, when E. coli or the like is used as a host cell, degradation by protease can be reduced by quickly excluding the gold-binding protein of the present invention, which is a foreign gene product, or its component from the cytoplasm. In addition, even when this foreign gene product is toxic to the microbial cells, it is known that the influence can be reduced by secreting it outside the microbial cells. Usually, many of the proteins secreted through the known cytoplasmic membrane or inner membrane have a signal peptide at the N-terminus of the precursor, and are cleaved by a signal peptidase in the secretion process to become a mature protein. Many signal peptides have a basic amino acid, a hydrophobic amino acid, and a cleavage site by a signal peptidase at the N-terminus.

Pe which is a signal peptide on the 5 ′ side of the nucleic acid encoding the gold-binding protein of the present invention
Secretion expression can be achieved by arranging a nucleic acid encoding a conventionally known signal peptide represented by 1B.

It is also possible to insert a plurality of polypeptide chains composed of the gold-binding protein of the present invention or a plurality of antibody fragments independently into one vector. in this case,
A nucleic acid encoding pelB can be placed 5 ′ of the nucleic acid encoding each domain or polypeptide chain to promote secretion. Furthermore, when expressing as a polypeptide chain composed of one or more domains, secretion can be promoted by placing a nucleic acid encoding pelB in the same manner at the 5 ′ end of the polypeptide chain. As described above, the gold-binding protein of the present invention in which the signal peptide is fused to the N-terminus can be purified from the periplasma fraction and the culture supernatant.

In consideration of the convenience of purification of the expressed protein, the N of the polypeptide chain formed by sequentially combining antibody molecules or individual antibody fragments or a plurality of antibody fragments.
Alternatively, it is possible to arrange a purification tag at the C-terminal by genetic engineering. Examples of the purification tag include a histidine tag in which 6 residues of histidine are continuous (hereinafter, His × 6), a glutathione-binding site of glutathione-S-transferase, and the like. As a method for introducing the tag, a method for inserting a nucleic acid encoding a purification tag into the 5 ′ or 3 ′ end of a nucleic acid encoding a gold-binding protein in the expression vector or a commercially available vector for introducing a purification tag is used. Etc.

Below, the manufacturing method of the gold | metal binding protein of this invention using the said expression vector is described. The gold-binding protein of the present invention or a polypeptide chain constituting the component thereof is transformed into a conventionally known protein-expressing host cell by the above-described gold-binding protein expression vector designed according to the host cell, It is synthesized in the host cell using a protein synthesis system in the host cell. Thereafter, the target protein accumulated or secreted inside or outside the host cell can be obtained by purifying the inside of the cell or the cell culture supernatant. For example, when Escherichia coli is used as a host cell, pelB is located on the 5 ′ side of the nucleic acid encoding the gold-binding protein of the present invention.
By arranging a nucleic acid encoding a conventionally known signal peptide represented by (2), it is possible to make it easy to secrete and express outside the cytoplasm.

When a plurality of polypeptide chains constituting the gold-binding protein of the present invention are expressed with one expression vector of the present invention, a nucleic acid encoding pelB is arranged on the 5 ′ side of the nucleic acid encoding each polypeptide chain. It is possible to promote secretion outside the cytoplasm at the time of expression. As described above, the gold-binding protein of the present invention in which the signal peptide is fused to the N-terminus can be purified from the periplasma fraction and the culture supernatant. As a purification method, when the purification tag is a His tag, it can be purified by using a nickel chelate column or a GST and a glutathione-immobilized column.

It is also possible to obtain the gold-binding protein of the present invention expressed in cells as insoluble granules. In this case, the insoluble granules can be centrifuged from a cell lysate obtained by pulverizing bacterial cells obtained from the culture solution with a French press or ultrasonic waves. The insoluble granule fraction obtained was urea,
After solubilization with a buffer solution containing a conventionally known denaturing agent containing a guanidine hydrochloride salt, column purification similar to the above can be performed under denaturing conditions. The resulting column elution fraction can be subjected to refolding work to remove the denaturant and rebuild the active structure. As a refolding method, a conventionally known method can be appropriately used. Specifically, step dialysis, dilution, or the like can be used depending on the target protein.

Each domain or each polypeptide chain of the gold-binding protein of the present invention can be expressed in the same host cell, or coexisted after being expressed using a different host cell. Is also possible.

Furthermore, it is also possible to express a protein in vitro using a cell extract using a vector encoding the gold-binding protein of the present invention. Suitable cell extracts include Escherichia coli, wheat germ, rabbit reticulocyte and the like. However, protein synthesis using the cell-free extract is generally performed under reducing conditions. Therefore, it is more preferable to perform some kind of treatment to form a disulfide bond in the antibody fragment.

The preferred dissociation multiplier (K _D ) of the gold binding protein of the present invention is 0.1% Tween 20
It is 10 ⁻⁶ M or less, more preferably 10 ⁻⁸ M or less under the buffer conditions in the presence.
Under the above conditions, the present inventors have confirmed that even protein materials such as BSA that are relatively nonspecifically adsorbed to gold cannot be adsorbed to gold. K _D
If the value is 10 ⁻⁶ M or less, it can be sufficiently distinguished from the adsorption behavior of the non-specifically adsorbing protein as described above, and if it is 10 ⁻⁸ M or less, the anchor for immobilization can be obtained. -It can function sufficiently as a molecule.

Antibody fragment protein expression The gold-binding protein is cleaved with a desired restriction enzyme, for example, NcoI / NheI in the above example, to obtain a gold-binding antibody fragment-encoding DNA. An antibody fragment can be obtained by introducing this into a conventionally known protein expression plasmid according to the host cell. For example, in the case of Escherichia coli, when it is desired to recover the target antibody fragment from the extracellular expression or periplasm fraction, a conventionally known signal peptide can be introduced upstream of the antibody fragment encoding gene. Examples of the signal peptide include pelB. In addition, after expression, in order to facilitate purification of the target protein from the culture supernatant or the bacterial cell fraction, a conventionally known purification tag may be fused. Specifically, a histidine 6 residue (His × 6) or a glutathione-binding portion of glutathione-S-transferase can be introduced to obtain a fusion protein. These are Hi
In the case of the s tag, it can be easily purified by a metal chelate column such as nickel. In the case of a GST tag, it can be purified by a column in which glutathione is immobilized on a carrier in Sepharose or the like.

Further, when the target protein expressed in the microbial cells cannot be obtained in insoluble granules, it can be refolded after solubilizing them with a conventionally known buffer solution containing urea and guanidine hydrochloride. As a refolding method, a conventionally known method can be appropriately used. Specifically, step dialysis, dilution, or the like can be used depending on the target protein.

Antibodies obtained from these, and fragments thereof, such as Fab, (Fab ′) 2, Fd, V
From the scope of the present invention, any amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence such as H or VL or a complex thereof, as long as it exhibits gold-binding properties. It is not over.

The preferred dissociation multiplier (K _D ) of the gold-binding protein of the present invention is 10 ⁻⁶ M or less, more preferably 10 ⁻⁸ M or less under buffer conditions in the presence of 0.1% Tween20. Under the above conditions, the present inventors have confirmed that even protein materials such as BSA that are relatively nonspecifically adsorbed to gold cannot be adsorbed to gold.

If the K _D value is 10 ⁻⁶ M or less, it can be sufficiently distinguished from the adsorption behavior of the non-specifically adsorbing protein as described above, and if it is 10 ⁻⁸ M or less, it can be used for immobilization. Can sufficiently function as an anchor molecule.

-To-be-coupled object having gold The to-be-coupled object having gold can be selected from various substances having gold on at least a part of its surface. When selecting a gold-binding protein by immunization or panning,
More preferably, the surface of the object to be bound is only gold in order to remove contamination of proteins adsorbed to substances other than gold. The material used as the inner core substrate other than the surface can be selected from various known materials as well as gold. Further, in the form of particles, more preferably 1
It is preferable that the specific surface area related to the bonding is increased by using fine particles having a diameter of 100 μm to 100 μm,
In addition, when collecting at the end of panning, it can be easily collected by centrifugation. Moreover, you may use it by vapor-depositing gold | metal | money to various commercially available plastic plates, for example, a culture petri dish, a 96-hole titer plate as follows. In this case, it is preferable to determine the size and the number of wells in view of the liquid contact area on the gold surface and the molecular diffusion effect by stirring.

The shape of the object to be coupled can be appropriately selected from known shapes such as a flat plate, a sphere, a needle, and a porous shape. The formation method can be appropriately selected from a physical or chemical vapor deposition method and a chemical production method using gold chloride. In order to remove impurities such as oxide films, by-products, and contamination, the surface containing gold thus obtained is washed in advance with an acidic solution, an alkaline solution, an organic solvent, etc., and a desired gold exposure state is produced. It may be used.

-Substrate A structure that can be used for various applications can be obtained from a gold-binding protein and a substrate having at least a part of the surface formed of gold. This base is one in which gold is disposed on at least a part of its surface, and any material can be used as long as it can form the structure of the present invention.
Shapes are also available. The base material used in the present invention may be any material that can form the structure of the present invention. Metal, metal oxide, inorganic semiconductor, organic semiconductor, glass, ceramics, natural polymer, synthetic polymer It is a material comprising at least one selected from molecules and plastics or a complex thereof. The shape of the substrate used in the present invention may be any shape as long as it can form the structure of the present invention, such as a plate shape, a particle shape, a porous shape, a protrusion shape,
The shape includes one or more shapes selected from a fibrous shape, a cylindrical shape, and a mesh shape.

Examples of the organic polymer compound for forming the substrate include styrene, α-methylstyrene, β-methylstyrene, o-methylstyrene, m-methylstyrene, p-methylstyrene, 2,4-dimethylstyrene, and pn-butyl. Styrene, p-tert-butyl styrene, pn-hexyl styrene, pn-octyl styrene, pn-nonyl styrene, pn-decyl styrene, pn-dodecyl styrene, p-methoxy styrene, p -Styrene polymerizable monomers such as phenylstyrene, methyl acrylate, ethyl acrylate, n-propyl acrylate, iso-propyl acrylate, n-butyl acrylate, iso-butyl acrylate, tert-butyl acrylate, n-amyl acrylate, n-hexyl Acrylate, 2-ethylhe Xyl acrylate, n-octyl acrylate, n-
Acrylic polymerizable monomers such as nonyl acrylate, cyclohexyl acrylate, benzyl acrylate, dimethyl phosphate ethyl acrylate, diethyl phosphate ethyl acrylate, dibutyl phosphate ethyl acrylate, 2-benzoyloxyethyl acrylate, methyl methacrylate, ethyl methacrylate, n-propyl Methacrylate, iso-propyl methacrylate, n-butyl methacrylate, is
Methacrylic series such as o-butyl methacrylate, tert-butyl methacrylate, n-amyl methacrylate, n-hexyl methacrylate, 2-ethylhexyl methacrylate, n-octyl methacrylate, n-nonyl methacrylate, diethyl phosphate ethyl methacrylate, dibutyl phosphate ethyl methacrylate Polymerizable monomer,
Methylene aliphatic monocarboxylic acid esters, vinyl acetate, vinyl propionate, vinyl benzoate, vinyl butyrate, vinyl benzoate, vinyl formate, etc., vinyl ethers such as vinyl methyl ether, vinyl ethyl ether, vinyl isobutyl ether And organic polymer compounds produced by polymerizing a polymerizable monomer selected from the group consisting of vinyl polymerizable monomers such as vinyl ketones such as vinyl methyl ketone, vinyl hexyl ketone, vinyl isopropyl ketone, and the like. .

Examples of inorganic solids include clay minerals such as kaolinite, bentonite, talc and mica; alumina, titanium dioxide, zinc oxide, magnetite, ferrite, Nb
Metal oxide such as Ta complex oxide, WO ₃ , In ₂ O ₃ , MoO ₃ , V ₂ O ₅ , SnO ₂ , etc .; Insoluble inorganic salts such as silica gel, hydroxyapatite, calcium phosphate gel; Gold, silver, platinum, copper Metals such as GaAs, GaP, ZnS, CdS, CdSe, and other semiconductor compounds,
Glass, silicon, or a composite thereof can be used, but is not limited to these.

The substrate of the present invention is a film made of a plastic such as polyethylene terephthalate (PET), diacetate, tricetate, cellophane, celluloid, polycarbonate, polyimide, polyvinyl chloride, polyvinylidene chloride, polyacrylate, polyethylene, polypropylene, polyester, polyvinyl chloride, Porous polymer film made of polyvinyl alcohol, acetyl cellulose, polycarbonate, nylon, polypropylene, polyethylene, Teflon, wood board, glass board, silicon substrate, cotton, rayon, acrylic, silk, polyester, etc., fine paper, medium quality Paper, art paper, bond paper, recycled paper, baryta paper, cast coated paper, cardboard paper, resin coated paper, etc. can be used to form a film or sheet. But, of course, not limited thereto. These film-like and sheet-like materials may be smooth or uneven.

Examples of the substrate include silicon, silica, glass, quartz glass, and the like, and microchannels and holes (holes) formed on the substrate by a technique such as photolithography, etching, and sandblasting, or gold on the surface thereof. A thin film made of metal, silver, platinum, PDMS (polydimethylsiloxane), PMMA (polymethyl methacrylate), PET (polyethylene terephthalate) PC (polycarbonate) PS (polystyrene), etc. Channels, holes, carbon nanotubes, carbon nanohorns,
Fullerene diamond or aggregates thereof, alumina, carbon, fullerene, Zn
Nano whisker made of O, SiO ₂ , aluminosilicate, other metallosilicates, mesoporous thin film made of TiO ₂ , SnO ₂ , Ta ₂ O ₅ , fine particles, and monolith structure, gold, silver, copper, platinum, etc. Fine particles, magnetite, ferrite, hematite, gamma
Examples include, but are not limited to, iron oxide fine particles such as hematite and maghemite, aluminum silicon mixed films and silicon oxide nanostructures obtained by anodizing them, porous alumina thin films, alumina nanohole structures, and silicon nanowires. It is not a thing.
Further, the size of the substrate of the present invention can be variously selected according to the intended use.
-Kit for detecting a target substance A kit for detecting a target substance can be obtained by using a structure in which a binding property to a target substance is added to the gold-binding protein according to the present invention. For example, a kit for detecting a target substance comprising a substrate for forming the above structure and a gold-binding complex protein, and detection means for detecting the binding of the target substance to the structure it can. For example, for binding to a protein containing a gold-binding protein to a target substance, gold or a labeling substance containing gold is added to the target substance to which the protein containing the gold-binding protein is bound, and this is physically Or it can carry out by detecting with a chemical method. Alternatively, if the target substance contains gold, the binding property of the gold-binding protein to gold is used to bind the gold-binding protein to the target substance containing gold, and the binding state is determined using a label. Can be detected. As a marker used in this case, those described later in the description of the connecting member can be used. Furthermore,
For example, the binding between the target substance and the gold-binding protein can be detected by a change in physical quantity such as an optical change, an electrical change, or a thermal change.

In addition, as a structure which added the binding property with such a target substance, the case where the gold binding complex protein mentioned later and the case where a gold binding protein is utilized as a binding member of a target substance and a labeling substance are mentioned as a preferable thing. it can.

-Surface plasmon resonance apparatus In addition, the coupling | bonding of the protein containing the gold-binding protein with respect to gold | metal | money can be measured quantitatively with the conventionally known surface plasmon resonance measuring apparatus, for example. Surface plasmon resonance is
Resonance between evanescent waves generated at the glass / gold interface and free electrons on the gold thin film (surface plasmon resonance) generated by light incident on the glass thin film with a refractive index change on the glass substrate below the total reflection angle. This is a method of measuring from a change in resonance angle caused by. The measured refractive index change can be converted and evaluated as the amount of binding of the protein of interest to gold.

・ Dissociation constant (K _D )
The “dissociation constant (K _D )” is a value obtained by dividing the “dissociation rate (kd)” value by the “binding rate (ka)” value. These constants are used as an index indicating the affinity of the monoclonal antibody or a fragment thereof for gold. The constants can be analyzed according to various methods. In the present invention, a measurement instrument Biacore 2000 (manufactured by Amersham Pharmacia) is used, and according to the analysis software attached to the apparatus, the binding curve is obtained. Obtained by analysis.

(2) Gold-binding complex protein The gold-binding complex protein according to the present invention is composed of two or more domains, and one or more domains have the above-structured gold-binding protein. Examples of the complex protein include the following structures.
(A) A composite protein having a first domain containing a gold-binding protein having the above structure and a second domain containing a protein having a binding site for a specific substance.
(B) In addition to the first domain and the second domain described above, at least a third domain that forms a complex with the first domain and a fourth domain that forms a complex with the second domain A complex protein further comprising one.

Note that at least one of the second to fourth domains can have a gold-binding protein, and in that case, these domains can be formed by containing the gold-binding protein having the above-described configuration. In addition, the binding property of the first to fourth domains to the binding substance can be set independently in each domain, and two or more domains having the same binding property may exist in these domains, and are different. These domains may be composed of binding domains.

Furthermore, at least two selected from the first to fourth domains may be contained in the same polypeptide chain. Examples of such a configuration include the following configurations.
(1) A configuration in which the first domain and the second domain form a single polypeptide chain.
(2) A configuration in which the first domain and the second domain are bound via one or more amino acids.
(3) A configuration in which the third domain and the fourth domain form one polypeptide chain.
(4) A configuration in which the third domain and the fourth domain are bound via one or more amino acids.
(5) A configuration comprising a first polypeptide chain comprising a first domain and a second domain, and a second polypeptide chain comprising a third domain and a fourth domain.
(6) A configuration comprising a first polypeptide chain comprising a first domain and a second domain, and a third polypeptide chain comprising a third domain and a second domain.
(7) A configuration comprising a first polypeptide chain comprising a first domain and a second domain, and a fourth polypeptide chain comprising a first domain and a fourth domain.
(8) A structure consisting of one polypeptide chain comprising at least a first domain, a second domain, and a third domain.
(9) A configuration consisting of one polypeptide chain comprising at least a first domain, a second domain, and a fourth domain.
(10) A structure consisting of one polypeptide chain comprising the first to fourth domains.

-Gold-binding complex protein A protein as a component of a gold-binding complex protein comprises at least one polypeptide chain formed by combining at least two or more amino acids, and these polypeptide chains are in a specific three-dimensional form. A molecule that can be folded to form a structure and exhibit its unique functions (conversion, molecular recognition, etc.). The gold-binding complex protein of the present invention has at least one or more binding sites for gold and further has at least one or more binding sites for gold or a substance other than gold, and has multivalent or multispecific binding properties. The complex protein shown is a complexed protein comprising at least: As a preferred configuration, a first domain having a binding site for gold and containing at least a part of an antibody light chain variable region (VL) or heavy chain variable region (VH), and a specific substance (hereinafter referred to as a target substance) And a second domain having at least a part of VH or VL. (
Hereinafter, VH and VL that bind to gold are VH (G) and VL (G), and VH and V that bind to a target substance.
Let L be VH (T) and VL (T). )
The antibody heavy chain variable region (VH) and the antibody light chain variable region (VL) are variable regions possessed by the antibody heavy chain and the antibody light chain as described above. Antibody heavy chain variable region (VH), antibody light chain variable region (V
L) is generally composed of about 110 amino acids each and takes a cylindrical structure, and a layered structure is formed by β sheets arranged in antiparallel directions, and this layered structure is connected by one SS bond. And a very stable structure is formed. The variable region (VH or VL
) Is the complementary determining region that determines the binding of the antibody to various antigens.
It is known to have a part called it determining region (CDR). There are three CDRs in each of VH and VL, separated by a framework region that is an amino acid sequence with relatively little diversity, and by recognizing the spatial arrangement of the functional group of the target recognition site , Enabling more advanced and specific molecular recognition.

Hereinafter, an example of the gold-binding complex protein of the present invention will be described. The minimum unit of the gold-binding protein of the present invention is composed of the first domain and the second domain, and a schematic diagram thereof is shown in FIG. Examples of such combinations include VH (G) -VH (T), VH (G
) -VL (T), VL (G) -VH (T), and VL (G) -VL (T). In this example, the gold-binding complex protein is independent of the first domain being gold and the second domain being independent of the target substance without the first and second domains forming complementary binding sites. Are combined. The first domain and the second domain may be independent polypeptide chains or polypeptide chains in which domains are continuously linked, but polypeptides in which polypeptide chains are continuously linked Forming a chain is a more preferable form in terms of simplifying the production process and expressing its function. In the case of a polypeptide chain in which the first domain and the second domain are continuously linked, the first domain and the second domain may be directly linked, or through a linker consisting of one or more amino acids. It may be chained. The linker composed of amino acids is preferably composed of 1 to 10 amino acids. More preferably, it consists of 1 to 5 amino acids. When the linker has an amino acid length of 11 to 15, the first domain and the second domain are not limited by the arrangement, and may form complementary bonds (scFv) between the domains. In order to suppress the formation of a complementary complex between VH / VL, it is known that it is effective to shorten the linker length and to apply structural constraints between domains. It is desirable that the influence of the structural change caused when each of the first or second domains is bound to the target substance does not affect the binding ability to the desired target substance. For this reason, the linker has a secondary structure such as an α-helix, or insertion of a polypeptide domain that is not originally related to the desired binding properties does not significantly affect the desired properties and productivity. Is possible.

Furthermore, the gold-binding complex protein of the present invention is a VH that forms a complex with the first domain.
Alternatively, the third domain including at least part of VL, and / or the fourth domain including at least part of VL or VH forming a complex with the second domain may be used. . More preferably, the third domain forms a gold binding site complementary to the first domain by forming a complex with the first domain.

For example, as shown in the schematic diagram of FIG. 2a, when the first domain is VH (G), the third domain is preferably a VL that can form Fv with the first domain, more preferably the first domain. One domain and the third domain form a gold binding site in association.

Thus, it can be expected that the first domain is structurally stabilized by the third domain forming Fv, and the functional deterioration due to the structural change is suppressed. Furthermore, it is expected that the binding ability (for example, improvement of the binding rate, suppression of the dissociation rate, etc.) is further improved by the third domain being associated with the first domain to form a gold binding site.

Furthermore, as shown in FIG. 2b, the first domain and the third domain may be provided as independent polypeptide chains or may be polypeptide chains formed in a chain. (For example,
3rd domain-first domain-second domain as shown in the schematic diagram of FIG. 2b. The configuration can be determined as appropriate so that the binding ability to gold and the target is exhibited. )
As another example, a configuration as shown in the schematic diagram of FIG. 3 is also possible. That is, a complex composed of a polypeptide chain composed of the first domain and the second domain, a polypeptide chain composed of the third domain and the second domain. In this case, Fv or Fv-like complex formed from the first domain and the third domain binds to gold, and the first domain functions as an anchor that binds to the target substance by the second domain. Is.

In addition, the gold-binding protein of the present invention may have a configuration including at least a fourth domain consisting of at least a part of VH or VL that forms a complex with the second domain. It is desirable that the fourth domain complementarily forms a binding site for the target substance together with the second domain. For example, as shown in the schematic diagram of FIG. 4a, when the second domain is VL, the fourth domain is preferably VH capable of forming Fv with the second domain, more preferably the second domain. In this configuration, the domain and the fourth domain form a binding site for the target substance. Moreover, as shown in the schematic diagram of FIG. 4b, a polypeptide chain in which the first domain, the second domain, and the fourth domain are linked may be formed. In particular, in the configuration of FIG. 4b, when the first domain binds to a substrate having gold on at least a part of its surface and binds to a target substance in the second and fourth domains, the first domain Even when an irreversible structural change occurs when linking, it is possible to minimize the influence on the binding ability of the second and fourth domains with the target substance by designing a linker or the like. Is possible.

Furthermore, a configuration as shown in the schematic diagram of FIG. 5 is also possible. That is, it is a complex comprising a polypeptide chain comprising the first domain and the second domain, and a polypeptide chain comprising the first domain and the fourth domain. In this case, the target substance is bound by the Fv or Fv-like complex formed from the second domain and the fourth domain, and the first domain functions as an anchor that binds both the polypeptide chains to gold. Is.

In addition, the gold-binding protein can be composed of both the third and fourth domains. As shown in the schematic diagram of FIG. 6, the third and fourth domains may be independent polypeptide chains, or may be polypeptide chains linked as shown in the schematic diagram of FIG. In the case of a linked polypeptide chain, the third domain and the fourth domain may be linked directly or via a linker consisting of one or more amino acids as shown in FIG. Regarding the setting of the linker length, the linker composed of amino acids is preferably 1 to 10 amino acids as described above. More preferably, it is 1 to 5.

Moreover, as shown in the schematic diagram of FIG. 8, the first to fourth domains may be linked in one polypeptide chain. In this case, the first domain and the third domain form a complex and bind to gold, and the second and fourth domains form a complex and bind to substances other than gold and gold It is configured to be able to. Therefore, it is preferable to provide the linker between domains. For example, there are 1 to 5 amino acids between the first and second domains, between the third and fourth domains, and between 15 and 25 amino acids between the domains of the second and third amino acids. In the same configuration, the first domain and the second domain, the third domain and the fourth domain can be interchanged with each other / both.

The sequence of each domain in these single-chain polypeptides can be selected and determined as appropriate according to desired properties such as binding to gold or target and long-term stability of the gold-binding protein. .

The first domain comprises, for example, at least one sequence of SEQ ID NO: 1 to SEQ ID NO: 57, and in these amino acid sequences, one or several amino acids are deleted, substituted or substituted Even if the amino acid sequence is added, there is no problem as long as the binding property to gold can be maintained. Furthermore, even a sequence that forms a part of the amino acid sequence described above or a complex containing these can be used as the gold-binding protein of the present invention without any problem as long as it exhibits gold-binding properties. is there. Specific examples of the VH of the present invention having SEQ ID NO: 1 to SEQ ID NO: 57 are shown in SEQ ID NO: 58 to SEQ ID NO: 74, and specific examples of the VL of the present invention are shown in SEQ ID NO: 75 to SEQ ID NO: 77.

The third domain preferably has one or more amino acids selected from SEQ ID NO: 1 to SEQ ID NO: 57. Furthermore, the first domain is selected from SEQ ID NO: 58 to SEQ ID NO: 77. It is more preferable to select and set accordingly.

The present invention also includes a nucleic acid encoding the gold-binding complex protein. Furthermore, a host cell (eg, a conventionally known protein expression cell derived from Escherichia coli, yeast, mouse, human, etc.) is transformed with the protein as a protein, and from a nucleic acid serving as a gene vector for expressing the gold-binding protein. The composition which comprises is also included. Sequence examples of nucleic acids encoding the first and third domains that can constitute the gold-binding protein of the present invention are shown in SEQ ID NO: 98 to SEQ ID NO: 116.

Each domain of the gold-binding protein of the present invention that can be expressed by one expression vector can be selected from 1 to 4 and designed. When a plurality of domains of the gold-binding protein of the present invention are encoded in one expression vector, each domain can be expressed as an independent individual polypeptide chain. It is also possible to adopt a vector configuration in which the domains are expressed as a single polypeptide chain in which the domains are continuously linked or linked via amino acids. The structure of the gold-binding protein expression vector of the present invention can be designed and constructed by incorporating it into a structure necessary for expressing a transgene such as a known promoter according to the selected host cell. The vector structure can be constructed by referring to the structure of a known promoter or the like according to the selected host cell.
In addition, when Escherichia coli or the like is used as a host cell, protease degradation can be reduced by quickly excluding the gold-binding protein of the present invention, which is a foreign gene product, from the cytoplasm. In addition, even when this foreign gene product is toxic to the microbial cells, it is known that the influence can be reduced by secreting it outside the microbial cells. Usually, many of the proteins secreted through the known cytoplasmic membrane or inner membrane have a signal peptide at the N-terminus of the precursor, and are cleaved by a signal peptidase in the secretion process to become a mature protein. Many signal peptides have a basic amino acid, a hydrophobic amino acid, and a cleavage site by a signal peptidase at the N-terminus.

Secretion expression can be achieved by arranging a nucleic acid encoding a conventionally known signal peptide represented by pelB, which is a signal peptide, on the 5 ′ side of the nucleic acid encoding the gold-binding complex protein of the present invention. Moreover, it is also possible to insert a plurality of polypeptide chains composed of each domain or a plurality of domains constituting the gold-binding complex protein of the present invention independently into one vector. In this case, a nucleic acid encoding pelB can be arranged on the 5 ′ side of the nucleic acid encoding each domain or polypeptide chain to promote secretion. Furthermore, when expressing as a polypeptide chain composed of one or more domains, secretion can be promoted by placing a nucleic acid encoding pelB in the same manner at the 5 ′ end of the polypeptide chain. As described above, the gold-binding complex protein of the present invention in which the signal peptide is fused to the N-terminus, or the domain for its constituent use, can be purified from the periplasma fraction and the culture supernatant. In addition, considering the ease of work in purifying the expressed protein, a purification tag is attached to the N- or C-terminus of the polypeptide chain formed by binding each independent domain or domains. It is possible to arrange in Examples of the purification tag include a histidine tag in which 6 residues of histidine are continuous (hereinafter, His × 6), a glutathione-binding site of glutathione-S-transferase, and the like. As a method for introducing the tag, a method for inserting a nucleic acid encoding a purification tag into the 5 ′ or 3 ′ end of a nucleic acid encoding a gold-binding protein in the expression vector or a commercially available vector for introducing a purification tag is used. Etc.

The method for producing the gold-binding complex protein of the present invention using the above expression vector is described below.
The gold-binding complex protein of the present invention, or the polypeptide chain constituting the component thereof, is transformed into a conventionally known protein-expressing host cell using the gold-binding complex protein expression vector designed according to the host cell. However, it is synthesized in the host cell using a protein synthesis system in the host cell. Thereafter, the target protein accumulated or secreted inside or outside the host cell can be obtained by purifying the inside of the cell or the cell culture supernatant.

For example, when Escherichia coli is used as a host cell, it is secreted outside the cytoplasm by arranging a nucleic acid encoding a conventionally known signal peptide represented by pelB on the 5 ′ side of the nucleic acid encoding the gold-binding complex protein of the present invention. It can be configured to be easily expressed. When expressing a plurality of polypeptide chains for obtaining each domain constituting the gold-binding complex protein of the present invention with one expression vector, pe is placed on the 5 ′ side of the nucleic acid encoding each polypeptide chain.
A nucleic acid encoding 1B can be placed to promote secretion outside the cytoplasm during expression. As described above, the gold-binding protein of the present invention in which the signal peptide is fused to the N-terminus can be purified from the periplasma fraction and the culture supernatant. As a purification method, the purification tag is His.
In the case of a tag, in the case of a nickel chelate column or GST, it can be purified by using a glutathione-immobilized column.

It is also possible to obtain the gold-binding complex protein of the present invention expressed in cells as insoluble granules. In this case, the insoluble granules can be centrifuged from a cell lysate obtained by pulverizing bacterial cells obtained from the culture solution with a French press or ultrasonic waves. The obtained insoluble granule fraction is solubilized with a buffer solution containing a conventionally known denaturing agent containing urea and guanidine hydrochloride, and then subjected to column purification as described above under denaturing conditions. The resulting column elution fraction can be subjected to refolding work to remove the denaturant and rebuild the active structure. As a refolding method, a conventionally known method can be appropriately used. In particular,
Step dialysis or dilution can be used depending on the target protein.

Each domain or each polypeptide chain of the gold-binding protein of the present invention can be compounded after being expressed in the same host cell, or coexisted after being expressed using another host cell. It is also possible to make it complex.

Furthermore, it is also possible to express a protein in vitro using a cell extract using a vector encoding the gold-binding protein of the present invention. Suitable cell extracts include Escherichia coli, wheat germ, rabbit reticulocyte and the like. However, protein synthesis using the cell-free extract is generally performed under reducing conditions. Therefore, it is more preferable to perform some kind of treatment to form a disulfide bond in the antibody fragment.

The preferred dissociation multiplier (K _D ) of the gold binding complex protein of the present invention is 0.1% Tween.
10 ⁻⁶ M or less, more preferably 10 ⁻⁸ M or less, under buffer conditions in the presence of 20. Under the above conditions, the present inventors have confirmed that even protein materials such as BSA that are relatively nonspecifically adsorbed to gold cannot be adsorbed to gold.
If the K _D value is 10 ⁻⁶ M or less, it can be sufficiently distinguished from the adsorption behavior of the non-specifically adsorbing protein as described above, and if it is 10 ⁻⁸ M or less, it can be used for immobilization. Can sufficiently function as an anchor molecule.

Such an antibody heavy chain variable region (VH) capable of binding to a target substance containing gold of the present invention
), Or one of the methods for obtaining the antibody light chain variable region (VL), the VH or V
There is a method of preparing an L gene library, expressing them comprehensively as proteins, and selecting them by binding to gold or a target substance while corresponding to the genes. The gene library can be obtained from, for example, umbilical cord blood, tonsils, bone marrow, or peripheral blood cells or spleen cells. For example, mRNA is extracted from human peripheral blood cells and cDNA is synthesized. Next, using human VH and VL coding sequences as probes, human VH or VL
A cDNA library is prepared. For example, primers that can amplify the human VH family (VH1 to VH7) widely for each family and primers that can amplify human VL are known. RT-PCR is performed by combining primers for each VH and VL.
Acquire genes encoding H and VL. It is also possible to use a phage display method. Phage display methods include VH, VL or complexes containing them (eg,
A gene library encoding Fab, scFv) is combined with a gene encoding a phage coat protein to produce a phagemid library, which is transformed into E. coli,
It is expressed as a phage having various VH or VL as part of the coat protein. These phages can be used for selection according to the binding property to gold or a target substance in the same manner as described above. Since the gene encoding VH or VL displayed as a fusion protein on the phage is encoded by the phagemid in the phage, it can be identified by DNA sequence analysis.

Furthermore, cells that produce the antibody of interest are collected from animals immunized with gold or a target substance,
Using the same primer as described above, the base sequence and amino acid sequence of VH or VL can be specified.

Further, the third domain and the fourth domain of the present invention can be designed based on the amino sequences of the variable regions of known antibodies and antibody fragments against the target substance. In addition, when an antibody or antibody fragment against the target substance has not been obtained, it can be designed in the same manner as described above by analyzing the amino acid sequence after obtaining the antibody against the target substance. The third domain and the fourth domain may be domains constituting the gold-binding protein of the present invention. Thus, it is possible to produce the gold-binding complex protein of the present invention using the obtained VH or VL base sequence.

-To-be-bound object having gold As the to-be-bound object used when selecting a gold-binding protein by immunization, panning or the like, those exemplified above for the gold-binding protein can be used.
-Substrate The gold-binding complex protein according to the present invention can be combined with a substrate to obtain a structure that can be used for various applications. As the substrate that can be used for this purpose, those exemplified above for the gold-binding protein can be used.
-Target substance The gold-binding complex protein according to the present invention is configured to include a domain having a binding property to gold and a domain having a binding property to the target substance, thereby detecting a target substance. It can be used as a complex protein. As a target substance to be detected, any molecule can be used as long as it can be an antigen by each technique using an antigen-antibody reaction. For example, target substances are roughly classified into non-biological substances and biological substances.

Industrially valuable non-biological substances include PCBs with different chlorine substitution numbers / positions as environmental pollutants, dioxins with different chlorine substitution numbers / positions, endocrine disrupting substances called environmental hormones (examples) : Hexachlorobenzene, pentachlorophenol, 2,4,5-trichloroacetic acid, 2,4-dichlorophenoxyacetic acid, amitrol, atrazine, alachlor, hexachlorocyclohexane, ethylparathion, chlordane, oxychlordane, nonachlor, 1,2-dibromo -3-Chloropropane, D
DT, kelsen, aldrin, endrin, dieldrin, endosulfan (benzoepin), heptachlor, heptachlorepoxide, malathion, mesomil, methoxychlor, milex, nitrophene, toxaphene, trifluralin, alkylphenol (5 to 9 carbon atoms), nonylphenol, octononylphenol, 4 -Octylphenol, bisphenol A, di-2-ethylhexyl phthalate, butylbenzyl phthalate,
Di-n-butyl phthalate, dicyclohexyl phthalate, diethyl phthalate, benzo (a)
Pyrene, 2,4-dichlorophenol, di-2-ethylhexyl adipate, benzophenone, 4-nitrotoluene, octachlorostyrene, aldicarb, benomyl, kipon (chlordecone), manzeb (mancozeb), manneb, methylam, metribidine
Cypermethrin, esfenvalerate, fenvalerate, permethrin, vinclozolin, dineb, dilam, dipentyl phthalate, dihexyl phthalate, dipropyl phthalate) and the like.

Biological materials include biological materials selected from nucleic acids, proteins, sugar chains, lipids, and complexes thereof, and more specifically, biomolecules selected from nucleic acids, proteins, sugar chains, and lipids. Specifically, selected from DNA, RNA, aptamer, gene, chromosome, cell membrane, virus, antigen, antibody, lectin, hapten, hormone, receptor, enzyme, peptide, sphingosaccharide, sphingolipid The present invention can be applied to any substance as long as it contains any other substance. Furthermore, bacteria and cells themselves that produce the above-mentioned “biological substances” can also be target substances as “biological substances” targeted by the present invention.

Specific proteins include so-called disease markers. Examples are acidic glycoproteins produced in hepatocytes in the fetal period and present in fetal blood, hepatocellular carcinoma (primary liver cancer),
Α-fetoprotein (AFP) as a marker of hepatoblastoma, metastatic liver cancer, and Yorksack tumor
), PIVKA-II, which is an abnormal prothrombin that appears at the time of liver parenchymal disorder, and is confirmed to appear specifically in hepatocellular carcinoma, a glycoprotein that is a breast cancer-specific antigen immunohistochemically, primary advanced breast cancer, BCA225, a marker of recurrent / metastatic breast cancer, is a basic fetal protein found in human fetal serum, intestinal and brain tissue extracts, ovarian cancer, testicular tumor, prostate cancer, pancreatic cancer,
Bile tract cancer, hepatocellular carcinoma, kidney cancer, lung cancer, stomach cancer, bladder cancer, basic fetoprotein (BFP) as a marker for colon cancer, sugar chain antigen as marker for advanced breast cancer, recurrent breast cancer, primary breast cancer, ovarian cancer CA19-9 which is a sugar chain antigen serving as a marker for certain CA15-3, pancreatic cancer, biliary tract cancer, gastric cancer, liver cancer, colon cancer, ovarian cancer, saccharide serving as a marker for ovarian cancer, breast cancer, colorectal cancer, gastric cancer, pancreatic cancer CA72-4, a chain antigen, a glycan antigen that serves as a marker for ovarian cancer (especially serous cystadenocarcinoma), endometrial adenocarcinoma, fallopian tube cancer, cervical adenocarcinoma, pancreatic cancer, lung cancer, colon cancer CA125, epithelial ovarian cancer, fallopian tube cancer, lung cancer, hepatocellular carcinoma, CA130, which is a glycoprotein marker for pancreatic cancer, ovarian cancer (especially serous cystadenocarcinoma), endometrial adenocarcinoma, cervical adenocarcinoma CA602 which is a core protein antigen serving as a marker, ovarian cancer ( , Cervical adenocarcinoma, cervical adenocarcinoma, CA54 / 61 (CA546), a nucleoside sugar-related antigen that is a marker of endometrial adenocarcinoma, colon cancer, stomach cancer, rectal cancer, biliary tract cancer, pancreatic cancer, Carcinoembryonic antigen (CEA), which is currently most widely used to assist cancer diagnosis as a tumor-related marker antigen such as lung cancer, breast cancer, uterine cancer, urinary tract cancer, pancreatic cancer, biliary tract cancer, hepatocellular carcinoma, gastric cancer DUPAN-2, a sugar chain antigen that serves as a marker for ovarian cancer and colon cancer, exocrine pancreatic protein that exists in the pancreas and specifically hydrolyzes the elastic fiber elastin (which constitutes arterial walls and tendons) in the connective tissue Elastase 1 which is a degrading enzyme, a marker for pancreatic cancer, pancreatic sac cancer, biliary tract cancer, glycoprotein present in high concentration in ascites and serum of human cancer patients, lung cancer, leukemia, esophageal cancer, pancreatic cancer, ovarian cancer, Renal cancer, bile duct cancer, stomach cancer, bladder cancer, colon cancer Thyroid cancer, immunosuppression acidic protein as the marker of malignant lymphoma (IAP), pancreatic cancer, biliary tract cancer, breast cancer, colon cancer, hepatocellular carcinoma,
NCC-ST-439, a sugar chain antigen that serves as a marker for lung adenocarcinoma and gastric cancer, γ-seminoprotein (γ-Sm), a glycoprotein that serves as a marker for prostate cancer, glycoprotein extracted from human prostate tissue Prostate-specific antigen (PSA), which is present only in prostate tissue and is therefore a marker for prostate cancer, is an enzyme that hydrolyzes phosphate esters under acidic pH secreted from the prostate, and as a tumor marker for prostate cancer Prostatic acid phosphatase (PAP) used
), A glycolytic enzyme that exists specifically in nerve tissue and neuroendocrine cells, including lung cancer (particularly small cell lung cancer), neuroblastoma, nervous system tumor, pancreatic islet cancer, esophageal small cell cancer, gastric cancer, Nerve specific enolase (NSE), which is a marker for kidney cancer and breast cancer, is a protein extracted and purified from liver metastases of cervical squamous cell carcinoma, uterine cancer (cervical squamous cell carcinoma), lung cancer, esophageal cancer, Squamous cell carcinoma associated antigen (SCC antigen) that is a marker for head and neck cancer, skin cancer, lung adenocarcinoma, esophageal cancer, stomach cancer, colon cancer, rectal cancer, pancreatic cancer, ovarian cancer, uterine cancer there sialyl Le ^X -i antigen (SLX), pancreatic, biliary tract cancer, liver cancer, stomach cancer, a carbohydrate antigen of a marker of colorectal cancer SP
an-1, esophageal cancer, gastric cancer, colorectal cancer, breast cancer, hepatocellular carcinoma, biliary tract cancer, pancreatic cancer, lung cancer, uterine cancer marker, especially in combination with other tumor markers, predicting advanced cancer and predicting recurrence -Tissue polypeptide antigen (TPA), which is a single-chain polypeptide that is useful for treatment follow-up
Ovarian cancer, metastatic ovarian cancer, gastric cancer, colorectal cancer, biliary tract cancer, pancreatic cancer, sialyl Tn antigen (STN) which is a nucleoside sugar chain antigen as a marker for lung cancer, non-small cell lung cancer, especially squamous epithelium of lung It is an inactive precursor of two kinds (PG I and PG II), an inactive precursor of Shifura (CYFRA) which is an effective tumor marker for detecting cancer, and pepsin which is a protein digestive enzyme secreted into gastric juice, Pepsinogen (PG), which is a marker of especially low-level gastric ulcer), duodenal ulcer (especially relapsed or refractory), Brunel adenoma, Solinger-Ellison syndrome, and acute gastritis
An acute phase reaction protein that changes in plasma due to tissue damage or infection. When necrosis occurs in myocardium due to acute myocardial infarction or the like, C-reactive protein (CRP), which shows a high value, plasma due to tissue damage or infection, Serum amyloid A protein (SAA), an acute phase reaction protein that changes in the blood, is a heme protein with a molecular weight of about 17500, mainly present in the heart muscle and skeletal muscle, and is a marker for acute myocardial infarction, muscular dystrophy, polymyositis, dermatomyositis It is an enzyme that mainly exists in the soluble fraction of myoglobin, skeletal muscle, and myocardium, and is released into the blood by cell damage. Acute myocardial infarction, hypothyroidism, progressive muscular dystrophy, polymyositis Creatine kinase (CK) that is a marker of skeletal muscle (CK-MM type derived from skeletal muscle, CK-BB type derived from brain and smooth muscle, and CK-MB type derived from myocardium) And mitochondrial isozymes and immunoglobulin-binding CK (macro CK)), a troponin complex formed with troponins I and C on thin filaments of striated muscle, and has a molecular weight of 39 involved in the regulation of muscle contraction Is a protein contained in cells of both skeletal muscle and myocardium, troponin T, which is a marker of rhabdomyolysis, myocarditis, myocardial infarction, and renal failure. , Meaning myocardial damage and necrosis, ventricular myosin light chain I as a marker of acute myocardial infarction, muscular dystrophy, renal failure, and chromogranin A, thioredoxin, 8-OhdG, which have recently been attracting attention as stress markers , Etc.

-Target substance detection kit A target substance detection kit can be constructed using the gold-binding complex protein of the present invention. For example, a gold-binding complex protein using an antibody that specifically binds to a target substance to the second domain and, if necessary, the fourth domain and a variant thereof, and a substrate having a surface containing gold, A target substance detection kit comprising a detection means for detecting a target substance immobilized on a substrate via a gold-binding complex protein can be constructed.
For detection of a target substance immobilized on a gold substrate via a gold-binding complex protein, measurement can be performed using the surface plasmon resonance measuring apparatus described above. Further, a method for detecting a target substance can be used by using a substrate containing at least a part of gold as a labeling substance. As such a gold substrate and a target substance, and a substance that mediates a labeling substance and a target substance, the aforementioned gold-binding complex protein can be used. An antibody fragment that recognizes and binds to these target substances can be used in the present invention by forming a gold-binding complex protein.

Hereinafter, acquisition and evaluation of proteins showing binding to gold will be described in detail as examples of the present invention. The present invention is not limited to the description of the embodiment.

Example 1 (Preparation of antibody heavy chain variable region VH library)
Using a Fab library derived from human adult peripheral blood B lymphocytes as a template, DNA replication is performed according to the recommended method using PCR (Takara Bio, LA kit) using the following primers for the VH-encoding gene. Primers were set as follows.
・ Back primers
(SEQ ID NO: 78)
5'-TCGCAACTGCCGGCCCAGCCGG CCATGG CCCAGGTGCA
GCTGGTGCAGTCTGGG-3 '
(SEQ ID NO: 79)
5'-TCGCAACTGCCGGCCCAGCCGG CCATGG CCCAGRTYCA
GCTGGTGCAGTCTGGG-3 '
(SEQ ID NO: 80)
5'-TCGCAACTGCCGGCCCAGCCGG CCATGG CCCAGSTRCA
GCTGCAGSAGTCRGG-3 '
(SEQ ID NO: 81)
5'-TCGCAACTGCCGGCCCAGCCGG CCATGG CCSARGTGCA
GKTGGTGGAGTCTGG-3 '
(SEQ ID NO: 82)
5'-TCGCAACTGCCGGCCCAGCCGG CCATGG CCCCAGTGTG
AGGTGCAGCTGGTGG-3 '
(SEQ ID NO: 83)
5'-TCGCAACTGCCGGCCCAGCCGG CCATGG CCCAGGTGCA
GCTACAGSAGTGGGG-3 '
・ Forward primers
(SEQ ID NO: 84)
5'-ATTCTCGACTGCTAGCTGAGGAGACGGTGACCAGGGGT
GCC-3 '
(SEQ ID NO: 85)
5'-ATTCTCGACTGCTAGCTGAAGAGCGGTGACCATGTGT
CCC-3 '
(SEQ ID NO: 86)
5'-ATTCTCGACTGCTAGCTGAGGAGACGGTGACCAGGGGT
TCC-3 '
(SEQ ID NO: 87)
5'-ATTCTCGACTGCTAGCTGAGGAGACGGTGACCCGTGGT
CCC-3 '
(1) VH by PCR using the Fab library as a template and the above primers
Amplify the coding gene. PCR conditions: 95 ° C. × 10 min, (94 ° C. × 1 min, 6
0 ° C. × 2 min, 72 ° C. × 2 min) × 35 cycle, 72 ° C. × 6 min).

(2) As a protein expression vector, pLUCK (Biochem Biophys
Res Commun. 218, pp682, 1996), a plasmid pRA-XX having an improved multicloning site as shown in FIG. 11 is prepared. (Hind
Following III, a nucleic acid sequence encoding pelB, which is a signal peptide, is placed, followed by a restriction enzyme site in the order of NheI / SacII / SpeI between NcoI and EcoRI, and His × 6 between SacII / SpeI. Provide the nucleic acid sequence to encode. The ampicillin resistance gene, T7 promoter, lac operator, and T7 terminator sequence were the same as the plaque. )
(3) NcoI / NheI (each New En
cleave with a restriction enzyme according to the recommended method (Grand Biolabs).
The plasmid restriction enzyme cleavage solution is subjected to spin column 400HR (Amersham Science).
(4) A PCR fragment solution cleaved with a restriction enzyme was converted into a commercially available gel purification kit (SV Gel).
and PCR Clean-up system: Promega).
(5) The above two fragments are ligated by preparing a commercially available T4 ligase kit (Roche) according to the method recommended by the manufacturer. The VH-encoding gene insertion vector shown in FIG. 12a is obtained.
(6) The E. coli DS12S strain was transformed by electroporation using the ligation product. Plasmid preparation was performed on a large scale.
(7) These plasmid solutions are serially diluted, and each solution is transformed into E. coli BL21 (DE3) by electroporation. After adding 700 μL of LB medium to the same solution, shaking culture is performed at 37 ° C. for 1 hour. did. After centrifuging the culture at 6000 rpm for 5 minutes,
650 μL of supernatant was discarded.
(8) The remaining supernatant and the precipitate fraction are suspended, and LB / Amp. It plated on the plate and left still at 37 degreeC overnight. As a result, an antibody VH library containing about 5 × 10 ⁵ clones was finally obtained.
(9) Next, arbitrarily select 1000 colonies from the three 10 ³ -fold dilution plates,
The crude protein extract is prepared by the following steps. Each colony is labeled LB / amp. Transfer to 3 mL liquid medium and shake culture at 28 ° C. for 6 hours. Next, IPTG was added to a final concentration of 1 mM, and the shaking culture was further performed for 12 hours.
(10) Subsequently, a culture fraction and a supernatant cell fraction were obtained by centrifugation (10,500 rpm × 5 min).
(11) An osmotic solution (0.5 M sucrose, 1
Add 200 μL of M Tris-HCl (pH 8.0), 0.5 mM EDTA), suspend, and leave on ice for 10 minutes. Next, 1 mL of chilled sterilized water is added and left in ice for 1 hour. After centrifugation (6000 rpm × 30 min), the supernatant is dialyzed back (MWCO 10,0
00) and the external solution was added to Tris + 0.1% Tween20 solution (20 mM Tris,
Dialysis is performed for 18 hours while changing the external solution every 6 hours.

The dialysis internal solution obtained in the above step was used as a sample for screening of the gold-binding antibody heavy chain variable region (VH).

Example 2 (Screening of gold-binding antibody heavy chain variable region (VH))
As a substrate for screening of the gold-binding antibody heavy chain variable region (VH), gold deposition (thickness of 10
0-nm) 96-well titer plate was prepared. 250 μL of the 1000 sample solution obtained in Example 1 is dispensed into each well and gently shaken for 1 hour. Discard the supernatant, turn the plate over, and tap 10 times on a paper towel to remove moisture. As a cleaning process, Tris +
Add 200 μL of 0.1% Tween 20 to each well and gently shake for 10 minutes, repeating this procedure 3 times. 1: 1000 HRP-conjugated anti-His antibody (Invitrogen)
200 μL of antibody solution diluted with Tris + 0.1% Tween20 solution at 0
Dispense into 1 and shake gently for 1 hour. Subsequently, the same operation as the cleaning step is performed. HR
Dispense 100 μL each of P substrate and Detect Reagents 1 and 2 (Amersham Science Co., Ltd.) to be colorants into each well, and gently permeate for 1 minute.
Quantify the amount of chemiluminescence of luminol.

Fifteen sample colonies in which chemiluminescence was observed as described above were identified as LB / amp. 1.5
Transfer to mL and shake culture overnight at 37 ° C. From the cells obtained, SV MiniPr
The plasmid is purified using an ep DNA purification system (Promega). The DNA sequences of the 17 VL-displayed phagemids obtained above are determined by the following method. The sequencing primer is set in the pelB sequence portion located upstream of the VH coding gene of the expression vector. The sequencers are as follows.
pelB-back
(SEQ ID NO: 88) 5'-ccgct ggatt gttat tactc gc-3 '
Using the above primer, the sequence reaction kit and reaction solution composition recommended by the manufacturer
The igDye-PCR reaction was performed. The temperature cycle is 96 ° C. × 3 min → (94 ° C. × 1 mi
n → 50 ° C. × 1 min → 68 ° C. × 4 min) × 30 cycle. Next, the base sequence of the PCR product purified by ethanol precipitation was determined with a sequencer (ABI 377). As a result, the sequences of SEQ ID NO: 58 to SEQ ID NO: 74 were obtained.

Example 3 (Preparation of antibody light chain variable region VL library)
In the same manner as in Example 1, a VL gene library is prepared from a Fab library of human peripheral blood cells. Primers are as follows.
・ Back primer
(SEQ ID NO: 89)
5'-TCGCAACTGCCGGCCCAGCCGG CCATGG CCGMCATYCA
GWTGACCCAGTCCTCC-3 '
(SEQ ID NO: 90)
5'-TCGCAACTGCCGGCCCAGCCGG CCATGG CCGARTTTGT
GATGACYCAGWCTCC-3 '
(SEQ ID NO: 91)
5'-TCGCAACTGCCGGCCCAGCCGG CCATGG CCGAAATTGT
GWTGACCGCAGTCTCC-3 '
(SEQ ID NO: 92)
5'-TCGCAACTGCCGGCCCAGCCGG CCATGG CCGACATCGW
GHTGACCCAGTCCTCC-3 '
・ Forward primer
(SEQ ID NO: 93)
5'-TTTCTCGAACTTGCGGCCCCACGTTTGATTTCCCACTTT
GGTCCC-3 '
(SEQ ID NO: 94)
5'-TTTCTCGAACTTGCGGCCCCACGTTTGATCTCCAGCTTG
GTCCC-3 '
(SEQ ID NO: 95)
5'-TTTCTCGAACTTGCGGCCCCACGTTTGATATCCCACTTT
GGTCCC-3 '
(SEQ ID NO: 96)
5'-TTTCTCGAACTTGCGGCCCCACGTTTGATCTCCACCTT
GGTCCC-3 '
(SEQ ID NO: 97)
5'-TTTCTCGAACTTGCGGCCCCACGTTTAATCTCCAGTCG
TGTCCC-3 '
In addition, when preparing the plasmid for protein expression in (2) of Example 1, Nc
A plasmid was prepared and used in the same manner except that NheI between oI / SacII was changed to NotI. Furthermore, the VL protein dialysis internal solution obtained at the end of the step (11) of Example 1 was used as a sample for screening for the gold-binding antibody light chain variable region (VL).

Example 4 (Screening of gold-binding antibody light chain variable region (VL))
The gold-binding VL is screened in the same manner as in Example 2 except that the screening sample is the sample obtained in Example 3. As a result, SEQ ID NO: 75 to SEQ ID NO: 7
Seven sequences were obtained.

Hereinafter, a phagemid is prepared from the human peripheral blood cell Fab gene library of Example 1, and gold-binding VL or VH is screened.

Example 5 (Screening of gold-affinity VL display phage group)
According to the following procedure, a VL-displayed phage library is prepared, and a phage group exhibiting binding property to gold is selected.
(1) Phagemid for VL display Using a human adult peripheral blood B lymphocyte-derived Fab library as a template, the VL-encoding gene is replicated using SEQ ID NO: 89 to SEQ ID NO: 97 used in Example 3 as primers. Furthermore, a VL-displayed phagemid prepared such that a part of the N-terminus of the PIII protein, which is a coat protein of M13 phage, is deleted and the VL protein is fused and expressed (
The library of FIG. 12b) is used. (Biochem Biophys Res Co
mmun. (1996, 218, pp682)
(2) Preparation of VL fragment-displaying phage library 1) Transformation 1 μL of the above VL-encoding gene library (350 ng / μL) was transformed into E. coli DH12S
Electroporation to 40 μL (applied voltage: 1.5 KV, resistance: 186Ω capacity: 50
Transformation with μF). Next, the VL-displayed phage library is prepared according to the following procedure.
2) Culture (i) 800 μL of LB medium is added to the DH12S solution after transformation, and shaking culture (140 rpm) is performed at 37 ° C. for 1 hour.
(Ii) The above culture broth was added to 20 mL LB medium + final concentration ampicillin 100 μg / mL (LB /
amp. In addition, the cells are cultured at 37 ° C. for 3 to 4 hours.
(Iii) 40 μL of M13KO7, a helper phage, was added, and then for 1 hour, 100 r
Culture with shaking at pm.
(Iv) Add 50 mg / mL kanamycin solution to a final concentration of 50 μg / mL,
Perform shaking culture (100 rpm) at 37 ° C.
3) Recovery of VL-displayed phage library (i) Add 5 mL of 20% PEG / 500 mM NaCl to the above culture and leave it on ice for 1 hour or longer.
(Ii) The supernatant is carefully removed by centrifugation (6500 rpm × 35 minutes).
(Iii) The precipitate is suspended in 500 μL of PBS buffer to obtain a VL display phage solution.
4) Titer evaluation of VL-displayed phage library (i) 10 μL of JM109 glycerol stock is added to LB and cultured with shaking at 37 ° C.
(Ii) A serially diluted solution of the VL-displayed phage solution prepared in 3) above is prepared using LB medium.
(Iii) The OD ₆₀₀ was ˜0.5 (a) A series of 750 μL of culture broth (× 10 ⁻⁶ to 10 ⁻¹⁰
) Add 10 μL of the diluted solution and incubate with shaking at 37 ° C. for 1 hour.
(Iv) Centrifuge (6000 rpm × 5 min) to remove 700 μL of culture supernatant.
(V) The remaining medium supernatant and precipitate are suspended by pipetting, and LB / amp. Spread on a plate and let stand at 37 ° C. overnight.
(Vi) Count colonies generated on a diluted concentration plate with a colony of 100 or less, and use it as the titer value of the VL-displayed phage library solution.

Obtained VL-displayed phage library: 5 × 10 ⁹ cfu / μL (3) VL panning using gold microparticles Using the phage library solution prepared above and gold microparticles (1.5 μmφ: manufactured by Aldrich) The panning operation by the above method was repeated 5 rounds, and the purpose was to select phage groups displaying gold-binding VL.

1) Binding experiment (i) The above-mentioned gold microparticle solution (50 mg / PBS 1 mL) against the above-mentioned phage solution (the amount in which the total number of phage in the solution is 1010 cfu) in a sterilized Eppendorf tube (1.5 mL)
10 μL, and further PBS + 0.1% Tween 20 (PBST) were added to a total volume of 1000 μL to obtain a binding reaction solution.
(Ii) The binding reaction solution was held for 30 minutes while gently rotating at room temperature.
(Iii) The above (ii) is centrifuged (10,000 rpm × 5 min), and the solution supernatant is carefully discarded.
2) Washing (washing of non-specifically adsorbed materials)
(I) Add 500 μL of PBST to the gold fine particles in the Eppendorf tube and hold for 10 minutes while gently rotating at room temperature.
(Ii) Centrifuge (10,000 rpm × 5 min) and carefully discard the washing supernatant.
(Iii) Repeat (i) and (ii) above 10 times.
3) Acid elution and titer evaluation of the acid elution fraction The evaluation of the phage titer adsorbed on the gold fine particles obtained in 2) above is confirmed by the following procedure.
3) -1 Acid elution (i) 115 μL of 0.2MGly-HCl (pH 2.2) was added to the pre-cleaned gold fine particles. Hold gently rotating up and down for 1 minute.
(Ii) The supernatant is collected as an acid elution fraction by centrifugation (10,000 rpm × 5 min).
(Iii) Add 15 μL of 1M Tris-HCl to neutralize the collected acid elution fraction.
(Iv) 1 μL of the neutralized acid eluate is serially diluted, and the titer value is determined by the titer evaluation method.
(V) The remaining acid-eluting fraction is quickly combined with the gold fine particle fraction and suspended again.
3) -2 Titer evaluation (2) -3) Perform titer evaluation in the same manner as 4), and obtain the following results.
1 round: 9.8 × 10 ² cfu
2 rounds: 1.0 × 10 ³ cfu
3 rounds: 7.8 × 10 ² cfu
4 rounds: 1.3 × 10 ³ cfu
5 rounds: 1.1 × 10 ⁴ cfu
4) Reinfection and phage amplification Until the 4th round, the phage group adsorbed to the gold fine particles obtained in 3) is subjected to a reinfection process in E. coli to amplify the number of phages, and a phage solution for the next panning is obtained. prepare.
(I) E. coli JM109 is cultured with shaking (140 rpm) at 37 ° C. in 20 mL of LB medium for reinfection and phage amplification.
(Ii) The gold fine particle suspension of 3) above is added to the E. coli culture solution of (a) where OD ₆₀₀ = 0.3 to 0.5, and shaking culture (140 rpm) is performed at 37 ° C. for 1 hour.
(Iii) Add ampicillin to a final concentration of 100 μg / mL and shake culture at 37 ° C.
For 2 hours.
(Iv) 40 μL of helper phage M13KO7 is added, the shaking speed is lowered to 100 rpm, and the culture is performed at 37 ° C. for 1 hour.
(V) Kanamycin is added so that the final concentration is 50 μg / mL, and shaking culture is performed at 37 ° C. overnight.
(Vi) The phage in the culture supernatant is collected by the same operation as in (2) -3) and 4) to prepare a phage solution. Furthermore, the titer value is evaluated to confirm that it is amplified.
The titer values obtained after amplification are shown below.
1 round: 2.4 × 10 ⁹ cfu
2 rounds: 8.1 × 10 ⁸ cfu
3 rounds: 1.8 × 10 ⁹ cfu
4 rounds: 1.1 × 10 ¹⁰ cfu
(Iv) Phage ELISA
1) Production of gold-deposited substrate for ELISA 96-well titer plate (BD,
Polystyrene) is used as a substrate for phage ELISA.
2) Preparation of VL-displayed phage single clone Phagemids are recovered from 11 colonies expressed on a dilution plate of 10 ^{4 in} the titer evaluation in the fifth round of (3) -4) by the following procedure.
(I) Each colony was LB / amp. Incubate in 20 mL at 37 ° C.
(Ii) 40 μL of helper phage M13KO7 is added, the shaking speed is lowered to 100 rpm, and the culture is performed at 37 ° C. for 1 hour.
(Iii) Kanamycin is added so that the final concentration is 50 μg / mL, and shaking culture is performed at 37 ° C. overnight.
(Iv) (2) -3) The phage in the culture supernatant is recovered by the same operation as in 4) to prepare a phage solution. Furthermore, the titer value is evaluated to confirm that it is amplified.
No. indicating the titer value obtained after amplification below. 1: 3.8 × 10 ⁹ cfu
No. 2: 9.0 × 10 ⁸ cfu
No. 3: 2.4 × 10 ⁹ cfu
No. 4: 1.0 × 10 ⁹ cfu
No. 5: 9.7 × 10 ⁷ cfu
No. 6: 4.4 × 10 ⁸ cfu
No. 7: 6.2 × 10 ⁹ cfu
No. 8: 8.9 × 10 ⁷ cfu
No. 9: 1.4 × 10 ⁹ cfu
No. 10: 1.1 × 10 ¹⁰ cfu
No. 11: 4.9 × 10 ⁹ cfu
2) Preparation of phage solution Prepare 200 μL of each dilution series with the following composition so that each phage solution obtained in 1) has a titer value of 1/10 sequentially from 10 ⁹ cfu.
VL display phage solution: x μL
Super blocking buffer (PIERCE): 20 μL
0.5% Tween20 / PBS: x / 5 μL
PBS: 180- (6x / 5) μL
3) ELISA
(I) 80 μL of each VL-displayed phage solution serially diluted in a gold-deposited titer plate
Dispense and gently stir for 1 hour on a shaker.
(Ii) Remove the phage solution, dispense 90 μL of PBST to each well, stir for 10 minutes, and discard the washing supernatant. Repeat this operation three times.
(Iii) HRP-Anti M13 immunoglobulin / SBB / PBS (1/1000:
1:10) After 75 μl of the solution is dispensed into each well, gently stir with a shaker for 1 hour.
(Iv) Discard the supernatant of the immunoglobulin solution. Next, PBST 90μL / wel
Dispense l, stir for 10 minutes and discard the wash supernatant. This washing operation is repeated three times.
(V) detection reagent 1, 2 (Amasham BIOSIEEN
CE) is dispensed at 35 μL / well and allowed to react with gentle stirring for 1 minute.
(Vi) Luminol emission intensity was measured. No. with high emission intensity. 1, no. 2, no. 3
Is a gold-binding VL-displaying phage clone.

Phagemids were isolated from the above four phage clones, and the base and amino acid sequence of gold-binding VL were clarified. Next, an expression vector is prepared, the protein is expressed, and the binding property is confirmed on a surface plasmon resonance (SPR) gold substrate.

Example 6 (Acquisition of gold affinity VL protein)
(1) Recovery of phagemid The above-mentioned No. 5 expressed on the × 10 ⁴ dilution plate in the titer evaluation in the fifth round of Example 5 (3) -4). Phagemid was recovered from the colony corresponding to 7 by the following procedure.
(I) Each colony was LB / amp. Incubate overnight at 37 ° C in 1.6 mL.
(Ii) Minipreps SV plus DNA Purification sy
Using a stem (promega), the phagemid is recovered by a method recommended by the manufacturer.
(2) Preparation of expression vector Expression vectors expressing the above three types of VL proteins are constructed with the following constitution. The pRA-XX shown in FIG. 11 of Example 1 and the phagemid obtained in (1) above were converted into NcoI and N
Cleave by restriction enzyme reaction using otI. The obtained VL fragment is inserted into pRA-XX, and the plasmid pRA-VLNo, n (n
: Clone number). (Fig. 13)
(3) Protein expression and purification Hereinafter, VL protein is expressed using the three VL protein expression vectors obtained above.
1) Transformation 40 μL of BL21 (DE3) competent cells are transformed with the above expression vector. Transformation is performed under conditions of heat shock in ice → 42 ° C. × 90 sec → ice.
750 μL of LB medium is added to the BL21 solution transformed by heat shock, and shaking culture is performed at 37 ° C. for 1 hour. Thereafter, centrifugation was performed at 6000 rpm for 5 minutes, 650 μL of the culture supernatant was discarded, the remaining culture supernatant and the precipitated cell fraction were stirred, and LB / amp.
Spread on a plate and let stand at 37 ° C overnight.
2) A colony on the preculture plate was randomly selected and 3.0 mL LB / amp. Shake culture overnight at 28 ° C. in the medium.
3) Main culture The above-mentioned preculture solution is transferred to 750 mL of 2 × YT medium, and the culture is further continued at 28 ° C. When OD600 exceeds 0.8, add IPTG so that the final concentration is 1 mM,
The culture is further performed overnight at 28 ° C.
4) Purification (i) Ammonium sulfate precipitation The culture solution obtained in 3) was centrifuged at 6000 rpm for 30 minutes to obtain a culture supernatant.
The obtained culture supernatant weight is measured, and ammonium sulfate of 60% of the culture supernatant weight is gradually added. Stir overnight at 4 ° C.
(Ii) Desalination (i) The solution is centrifuged at 8000 rpm × 20 min, and the supernatant is discarded. The resulting precipitate is 2
Add 15 mL of 0 mM Tris / 500 mM NaCl (hereinafter referred to as Tris solution) and add 4 ° C.
Soak overnight to dissolve. Next, the obtained solution is put into a dialysis cellulose tube (manufactured by Sanko Junyaku Co., Ltd.), and the external solution is dialyzed at 4 ° C. as a Tris solution to perform desalting. (External liquid was changed every 6 hours)
(Iii) Metal chelate column As a metal chelate column carrier, His-Bind (manufactured by Novagen) is used.
The column adjustment, sample loading, and washing step were performed at 4 ° C. in accordance with the recommended method of the supplier. The target His tag fusion VL protein elution is 500 mM imidazole / Tri.
s Solution is used.
As a result of SDS-PAGE (acrylamide 15%) of the eluate, it is confirmed that it is a single band and is purified. The eluate is dialyzed again using the external solution as a Tris solution to remove imidazole in the eluate. Furthermore, the external solution is added to phosphate buffer (hereinafter referred to as P
Instead of BS), buffer substitution is performed to obtain a VL protein solution for SPR.

Example 7 (SPR measurement)
The binding of VL protein obtained in Example 6 to gold was measured by SPR. SPR
BIAcore 2000 (manufactured by BIAcore) is used as a measuring device, and a gold-deposited glass substrate of SIA-kit Au of the same company is used as the gold substrate of the object to be bonded.
Measurement is performed under the following conditions.
Running buffer: PBST
Temperature: 25 ° C
Flow rate: 20 μL / min
Sample: VL protein / PBST
Injection volume: 20μL
A binding curve in which binding properties are confirmed is obtained (FIG. 9).

Example 8 (Determination of base and amino acid sequence of VL protein)
The DNA sequence of VL No. 7 obtained above was determined by the following method.
The sequencing primer was set in the pelB sequence part located upstream of the VL coding gene. The sequencers are as follows. Similar to Example 2,
pelB-back
(SEQ ID NO: 88)
5'-ccgct ggatt gttat tactc gc-3 '
Of Primer, and the Big by the sequence reaction kit and reaction solution composition recommended by the manufacturer
Dye-PCR reaction was performed. The temperature cycle is 96 ° C. × 3 min → (94 ° C. × 1 min →
50 ° C. × 1 min → 68 ° C. × 4 min) × 30 cycle → 4 ° C. Next, the base sequence of the PCR product purified by ethanol precipitation is determined with a sequencer (ABI 377). The following results are obtained. No. 7 is the same base sequence as SEQ ID NO: 76 of Example 12.

Example 9 (Screening of gold-affinity VH display phage group)
According to the following procedure, a VH-displayed phage library is prepared, and a group of phages that bind to gold is selected.
(1) Phagemid for VH display As in Example 1, human adult peripheral blood B lymphocyte-derived Fab library is used as a template, and primers are SEQ ID NO: 80 to SEQ ID NO: 89 as in Example 1. The VH encoding gene was replicated. Furthermore, N of PIII protein which is coat protein of M13 phage
VH prepared so that a part of the terminal is deleted and the VH protein is fused and expressed.
A library of display phagemids (Figure 12a) is used.
(2) Preparation of VH-displayed phage library Hereinafter, a VH-displayed phage library is prepared in the same manner as in Example 5 (2) except that (1) is used. Obtained VH-displayed phage library solution: 1 × 10 ⁹
cfu / μL
(3) VH panning using gold fine particles Except for using the phage library solution prepared in (2) above, panning to select a phage group displaying gold-binding VH is performed in the same manner as in Example 5 (3). Do.
1) Binding experiment 2) Washing, 3) Acid elution and titer evaluation were performed in the same manner as in Example 5.
1 round: 9.8 × 10 ² cfu
2 rounds: 1.0 × 10 ³ cfu
3 rounds: 7.8 × 10 ² cfu
4) Reinfection and phage amplification The procedure was the same as in Example 5. 1 round showing titer values obtained after amplification: 2.4 × 10 ⁹ cfu
2 rounds: 8.1 × 10 ⁸ cfu
(4) Phage ELISA
(1) Preparation of gold-deposited substrate for EISA As in Example 5, a substrate for phage ELISA was used.
2) Preparation of VL-displayed phage single clones Phagemids were recovered in the same manner as in Example 1 from 20 colonies expressed on x10 ⁴ dilution plates in the third round titer evaluation of the VH panning operation. The titer value of the obtained VH-displayed phage monoclonal solution is shown below.
No. 1: 3.8 × 10 ⁹ cfu
No. 2: 9.0 × 10 ⁸ cfu
No. 3: 2.4 × 10 ⁹ cfu
No. 4: 1.0 × 10 ⁹ cfu
No. 5: 9.7 × 10 ⁷ cfu
No. 6: 4.4 × 10 ⁸ cfu
No. 7: 6.2 × 10 ⁹ cfu
No. 8: 8.9 × 10 ⁷ cfu
No. 9: 1.4 × 10 ⁹ cfu
No. 10: 1.1 × 10 ¹⁰ cfu
No. 11: 4.9 × 10 ⁹ cfu
No. 12: 9.0 × 10 ⁸ cfu
No. 13: 2.4 × 10 ⁹ cfu
No. 14: 1.0 × 10 ⁹ cfu
No. 15: 9.7 × 10 ⁷ cfu
No. 16: 4.4 × 10 ⁸ cfu
No. 17: 6.2 × 10 ⁹ cfu
No. 18: 8.9 × 10 ⁷ cfu
No. 19: 1.4 × 10 ⁹ cfu
No. 20: 1.1 × 10 ¹⁰ cfu
2) Preparation of phage solution 200 μL each of dilution series was prepared with the following composition so that each phage solution obtained in 1) was sequentially reduced to 1/10 from 10 ⁹ cfu.
VH display phage solution: x μL
Solubilized VL solution (50 ng): 1 μL
Super blocking buffer (PIERCE): 20 μL
0.5% Tween20 / PBS: x / 5 μL
PBS: 179- (6x / 5) μL
3) Phage ELISA
Phage ELISA was performed in the same manner as in Example 1.
Three clones with higher emission intensity than the VH library solution for comparison were used as gold-binding VH-displayed phage clones. (No.2, 4, 6)
Example 10 (Acquisition of gold affinity VH protein)
Phagemids are isolated from the above three phage clones, their expression vectors are prepared, and then proteins are expressed to confirm the binding on a surface plasmon resonance (SPR) gold substrate.
Furthermore, the base and amino acid sequence of their gold-binding VH will be clarified.
(1) Recovery of phagemid Phagemid was recovered from colonies corresponding to 15 clones expressed on a dilution plate of 10 ^{4 in} the third round titer evaluation by the following procedure.
(A) Each colony was LB / amp. The cells were cultured overnight at 37 ° C in 1.6 mL.
(B) Minipreps SV plus DNA Purification sy
Using a stem (promega), the phagemid was recovered by a method recommended by the manufacturer.
(2) Preparation of expression vector Expression vectors expressing the above three types of VH proteins are constructed with the following constitution.
The multicloning site of PET-15b (Novagen) was changed and pUT-X
Let X be. The pUT-XX and the phagemid obtained in the above (1) are cleaved by restriction enzyme reaction using the respective NcoI and NheI. The obtained VH fragment was inserted into pUT-XX, and the plasmid pRA-7sn (n:
The above phage clone number) is prepared. (Fig. 14)
(3) Protein expression and purification The above (expression vectors are processed in the protein expression and purification steps described below in individual systems, and obtained as three types (7s2, 7s4, 7s6) of VH.
1) Transformation The above two expression vectors are transformed with 40 μL of different BL21 (DE3) competent cell solutions. For transformation, heat shock in ice → 42 ℃ × 90sec →
Perform under ice conditions. 750 μL of LB medium was added to the BL21 solution transformed by heat shock, followed by shaking culture at 37 ° C. for 1 hour. Thereafter, centrifugation was performed at 6000 rpm for 5 minutes, 650 μL of the culture supernatant was discarded, the remaining culture supernatant and the precipitated cell fraction were stirred, and LB / amp. Spread on a plate and let stand at 37 ° C overnight.
2) Preculture A colony on the plate was randomly selected and 3.0 mL LB / amp. 28 ° C in medium
Shake overnight at
3) Main culture The above preculture solution was inoculated into 750 ML of 2 × YT medium, and the culture was further continued at 28 ° C. When the OD600 exceeds 0.8, IPTG is added so that the final concentration is 1 mM, and the culture is further performed overnight at 28 ° C.
4) Purification The desired polypeptide chain is purified from the insoluble granule fraction by the following steps.
(I) Recovery of insoluble granules The culture solution obtained in 3) above is centrifuged at 6000 rpm x 30 min to obtain a precipitate as a cell fraction. The obtained bacterial cells were tris solution (20 mM Tris / 500 mM NaCl) 1
Suspend in 5 ml in ice. The obtained suspension is crushed with a French press to obtain a bacterial crushing solution.
Next, the bacterial disruption solution is centrifuged at 12,000 rpm × 15 min, the supernatant is removed, and the precipitate is obtained as an insoluble granule fraction.
(Ii) Solubilization of insoluble granule fraction Add 10 mL of 6M guanidine hydrochloride / Tris solution to the insoluble fraction obtained in (a) and soak overnight. Next, it is centrifuged at 12,000 rpm × 10 min to obtain a supernatant as a solubilized solution.
(Iii) Metal chelate column As a metal chelate column carrier, His-Bind (manufactured by Novagen) is used.
The column adjustment, sample loading, and washing steps are in accordance with the recommended method of the above-mentioned supplier, and the room temperature (20
° C). The target His tag fusion polypeptide is eluted with a 60 mM imidazole / Tris solution. As a result of SDS-PAGE (acrylamide 15%) of the eluate,
Make sure it is a single band and purified.
(Iv) Dialysis The eluate is dialyzed at 4 ° C. using an external solution as a 6M guanidine hydrochloride / Tris solution to remove imidazole in the eluate to obtain the respective polypeptide chain solutions.
(V) Refolding In the same manner as described above, the protein chain refolding was carried out while each of the polypeptide chain solutions of VHg-VLh and VHh-VLg was separately treated by dialysis (4 ° C) with guanidine hydrochloride by the following steps. I do.
a) Using 6M guanidine hydrochloride / Tris solution, the express coefficient and ΔO. D. A sample with a concentration of 7.5 μM (volume after dilution: 10 ml) is prepared from the (280 nm-320 nm) value. Next, β-mercaptoethanol (reducing agent) is added at a final concentration of 375.
Add to μM (protein concentration 50 times) and reduce at room temperature in the dark for 4 hours. This sample solution is put into a dialysis bag (MWCO: 14,000) to obtain a sample for dialysis.
b) The dialysis sample is immersed in 6M guanidine hydrochloride / Tris solution as an external dialysis solution and dialyzed for 6 hours with gentle stirring.
c) Decrease the concentration of guanidine hydrochloride in the external solution stepwise to 3M and 2M. Dialyse for 6 hours at each external concentration.
d) Oxidized glutathione (GSSG) at a final concentration of 375 μM, L-Arg at a final concentration of 0.4
M) was added to the Tris solution, and the 2M dialysis solution of 3) above was added to adjust the guanidine hydrochloride concentration to 1M, and the pH was adjusted to pH 8.0 (4 ° C.) with NaOH. Dialyze with gentle agitation for hours.
e) Prepare an L-Arg tris solution containing 0.5M guanidine hydrochloride in the same manner as d), and dialyze for 12 hours.
f) Finally, dialyze against Tris solution for 12 hours. 7) After dialysis, about 2 at 10,000 rpm
Centrifugation for 0 minutes separates aggregates and supernatant.

For the three types of VH solutions obtained above, an external solution was further added to a phosphate buffer (hereinafter PBS).
), And buffer substitution was performed to obtain a VH protein solution for SPR.

Example 11 (SPR measurement)
The binding of the VH protein obtained in Example 10 to gold was determined in the same manner as in Example 15.
Measured with PR. 7s2, 7s4, and 7s6 obtained binding curves in which binding was confirmed.
A representative example is shown in FIG. To give the following K _D of the curve fitting. 7s2: K _D
= 5.0 × 10M ^-8
7s4: K _D = 8.0 × 10M ^-9
7s6: K _D = 3.0 × 10M ⁻⁷
Example 12 (Determination of base and amino acid sequence of VH protein)
The DNA sequences of the three VH-displayed phagemids obtained above were determined in the same manner as in Example 2. The sequencing primer is pel located upstream of the VH coding gene.
Set to B array. Using the same sequencing primer as in Example 2 , analysis was performed in the same procedure to obtain three different sequences. They are obtained in Example 10 SEQ ID NO: 59
Or SEQ ID NO: 61, which is the same sequence.

Example 13 (VH / VL complex and gold binding experiment by SPR)
VL clone obtained in Example 6: 7 and VH clones obtained in Example 10: 7s2 was prepared in a 50 nM PBST solution. Stored at 4 ° C. for 1 day. SPR measurement was performed in the same manner as in Example 7 using the above mixed solution. As a result, the binding property with gold was confirmed at a lower concentration than in Example 7 or Example 11. It was suggested that a complex (Fv) was formed by mixing, and the binding was improved by stabilizing the structure. (Figure 3)
Example 14 (Obtaining gold-binding scFv)
VL clone obtained in Example 6: ScFv consisting of VH clone 7s2 obtained in Example 7 and Example 10 was prepared by the following procedure.
(1) Preparation of expression vector VL (No. 7) coding gene, linker (GGGGGS) × 3, VH (7s4) coding gene, His × 6 (hereinafter “His tag”) are translated and expressed as a fusion protein Such an expression vector was prepared.
A specific manufacturing method is shown in FIG.
The following are used as primers.
scFv-B (SEQ ID NO: 117)
5'-NNNNNCCATGGCCGGGGGCGGGGGCAGCGGGGGCGGG
GGCAGCGGGGGCGGGGGCAGCCCAGGTGCAGTTGGTGGAGT
CT-3 '
scFv-F (SEQ ID NO: 118)
5'-NNNNNCCGCGGAACCATTCAGATCCTCTTCT-3 '
(2) Protein expression and purification The scFv protein was expressed and purified using the scFv protein expression vector obtained above.
1) Protein expression Escherichia coli BL21 (DE3) is transformed with the above expression vector, and the culture is performed at 28 ° C. using 2 × YT medium. O. D. _{When 600} = approximately 0.8, expression is induced with IPTG at a final concentration of 1 mM, followed by overnight shaking culture. The bacterial cells were centrifuged at 6000 rpm × 20 min to obtain a culture supernatant fraction and a bacterial cell fraction. These samples were subjected to SDS-PAGE by known methods.
Electrophoresis was performed to confirm the expression level of the target protein. As a result, it was found that secretion into the culture supernatant fraction was very small. Therefore, in order to purify the target protein from the bacterial cell fraction, a sample was prepared by the following procedure. First, the cells are resuspended in 15 mL of PBS, and then P
25 mL of BS was obtained and the cells were crushed with a French press. The resulting crushed liquid is 120
Centrifugation was performed at 00 rpm × 15 min to obtain a precipitate fraction as insoluble granules. The obtained insoluble granules were soaked overnight in a 6M guanidine hydrochloride / Tris solution, solubilized, and used as a metal chelate column sample.
2) Metal chelate column purification Purification was performed in the same manner as in Example 2 except that the running buffer was 6M guanidine hydrochloride / 5mM imidazole / Tris solution, the imidazole concentration at elution was 100mM, and the development temperature was room temperature (20 ° C). It was.
3) Dialysis The elution fraction obtained in 2) is put in a cellulose tube for dialysis (manufactured by Sanko Junyaku Co., Ltd.)
Dialysis was performed at 4 ° C. as an M guanidine hydrochloride / 1 mM EDTA / Tris solution to remove imidazole. (External liquid was changed every 6 hours)
3) Reconstruction of protein The scFv solution obtained in 2) was adjusted to 7.5 μM with a Tris solution, and used as a sample. By reducing the concentration of glycine hydrochloride in the external solution stepwise from the above solution, the concentration of guanidine hydrochloride in the internal solution was reduced and the scFv structure was reconstructed.
(A) Using a 6M guanidine hydrochloride / Tris solution, the molar extinction coefficient estimated from the amino acid sequence of the target protein and the O.D. D. (280 nm) or 7.5 μM samples were prepared.
(B) Next, β-mercaptoethanol (reducing agent) is added to a final concentration of 375 μM.
It was allowed to stand for 4 hours in the dark at room temperature.
(C) Put the sample in the same dialysis membrane as above, and use external solution (6M guanidine hydrochloride / Tris).
The solution is dialyzed at 4 ° C. for about 6 hours.
(D) Thereafter, the external liquid was changed twice every 6 hours. At that time, dialysis was performed while gradually reducing the concentration of guanidine hydrochloride in the external solution from 3M to 2M.
(E) Next, add oxidized glutathione (GSSG) to the Tris solution to a final concentration of 375 μM and L-Arg to a final concentration of 0.4 M), and then add the dialysis external solution (2M) of (d) above. As a result, the guanidine hydrochloride concentration was adjusted to 1M, pH was adjusted to NaOH, pH 8.0 (at
Dialyze for about 12 hours at 4 ° C. using an external solution adjusted to 4 ° C.).
(F) A 0.5M guanidine hydrochloride / Tris solution was prepared in the same manner as in (e), and 4 ° C.
Dialyze for about 12 hours.
(G) Finally, the external solution is replaced with a Tris solution and dialyzed at 4 ° C. for about 12 hours.
(H) After completion of dialysis, the aggregate fraction and the supernatant fraction are separated by centrifugation at 10,000 rpm for about 20 minutes. When the supernatant fraction was confirmed by SDS-PAGE electrophoresis, it was confirmed that the target protein was solubilized in the supernatant fraction. In VL, the above No. Distribute 7 clones to VH 7
scFv with s2 was obtained.

Example 15 (Evaluation of gold binding property of scFv by SPR)
The binding of the scFv protein obtained in Example 14 to gold was measured by SPR in the same manner as in Example 3. A bond curve showing gold bondability was obtained. (Fig. 17)
Example 16 (Confirmation of Au specificity)
The gold specificity of the scFv protein obtained in Example 15 was confirmed. As a confirmation substrate, circular patterning with a size of 70 μmφ was deposited on a 3 mm × 5 mm silicon substrate by gold vapor deposition (
(Thickness 50 nm). The surface of the substrate is immersed in isopropyl alcohol, acetone, and hydrochloric acid for 10 minutes to clean the surface. (Each time the solution is changed, the substrate is washed with pure water and dried.) The substrate is immersed in a solution prepared by adjusting the scFv solution obtained in Example 6 to 1 μM for 1 hour. Subsequently, the plate is washed with PBST while gently stirring for 10 minutes. Repeat this operation three times and discard the cleaning solution. Next, the substrate is immersed in a 100 nM anti-His tag antibody / PBST solution with gentle stirring for 1 hour. Subsequently, the plate is washed with PBST while gently stirring for 10 minutes. Repeat this operation three times and discard the cleaning solution. Further, the substrate is immersed in a 100 μM rhodopsin-conjugated anti-IGg antibody / PBST solution with gentle stirring for 1 hour. continue,
Wash with PBST for 10 minutes with gentle agitation. Repeat this operation three times and discard the cleaning solution. Thereafter, the substrate was observed with a fluorescence microscope. As a result, fluorescence was observed only in the circular portion where gold was deposited, and no fluorescence was observed in the silicon portion. ScFv obtained in Example 15
The gold specificity was confirmed.

Comparative Example 1
The substrate was treated in the same manner except that the gold deposited silicon substrate was treated with 1 μM scFv in Example 16. As a result of observation with a fluorescence microscope, not only the silicon part,
Fluorescence could not be confirmed even in the gold-deposited circular part.

Example 17 (Production of silicon oxide affinity peptide-fused gold-binding protein)
A protein obtained by fusing the silicon oxide affinity peptide IPHVHHKHPHV to the C-terminus of the above-mentioned scFv of the above Example is prepared by the following steps.
(1) Preparation of expression vector (a) PCR is performed using pUT-scFv (VL # No, 7 × 7s4) obtained in the above (Example 14) as a template and using the following primers.
SiscFv-B (SEQ ID NO: 119)
5′-NNNNNCCATGGCCCCAGGTGCAGTTGGTGGAGT-3 ′
SiscFv-F (SEQ ID NO: 120)
5'-NNNNNCCGCGGCACGGTGGGGGTGCTTGTGGTGCACGT
GCATGGGGATAACCATTCAGATCCCTTCT-3 '
PCR is performed using a commercially available PCR kit (Takara Bio LA-Taq kit) according to the protocol recommended by the manufacturer.
(B) The resulting PCR product is subjected to 2% agarose electrophoresis. Next, using a gel extraction kit (Promega), crude purification is performed from the gel to obtain a PCR fragment of about 400 bp. As a result of sequencing, it is confirmed that it has the target base sequence.
(C) pUT-scFv (7s4) and the PCR fragment obtained in the above (b) were used as NotI /
Cut with SacII. Subsequently, agarose electrophoresis is performed, and the target fragments are purified on the Vector side and the Insert side, respectively.
(D) The purified nucleic acid fragment obtained in (c) above was obtained by using Vector: Insert = 1: 5.
And ligation reaction is carried out in the same manner as in Example 1.
Hereinafter, transformation, plasmid recovery, and confirmation of the inserted fragment are performed in the same manner as in Example 6.

(3) Protein expression and purification Using the expression plasmid obtained above, protein expression and purification are performed in the same manner as in Example 10 to obtain the target protein.

Example 18 (Obtaining gold and HEL binding proteins)
(1) Preparation of gold-binding VH-encoding nucleic acid fragment Gold-binding for vector introduction in which a restriction enzyme NcoI cleavage site is arranged at the 5 terminal side of the gold-binding VH (SEQ ID NO: 61) and a restriction enzyme NheI is arranged at the 3 ′ terminal In order to produce a sex VH (hereinafter referred to as VHg),
gVH-B (SEQ ID NO: 121)
5'-NNNNNN CCATGG CCGAC CAGG TGCAG TTGGT G
GAGT CT-3 '
gVH-F (SEQ ID NO: 122)
5'NNNN GCTAG C GGAGA CGG TGACCAGGGGT-3 '
PCR is performed using a commercially available PCR kit with a formulation recommended by those skilled in the art.
A bp base pair is obtained. Using the VHB-F, a BigDye-PCR reaction was performed using a commercially available sequence reaction kit and the reaction solution composition. Temperature cycle is 96 ° C. × 3 min → (9
4 ° C. × 1 min → 50 ° C. × 1 min → 68 ° C. × 4 min) × 30 cycle → 4 ° C. Confirm that a fragment having the base sequence encoding the target VH was obtained.
(2) Preparation of gold-binding VL-encoding nucleic acid fragment Restriction enzyme NheI site and linker (G
In order to prepare a nucleic acid encoding GGGS) and a gold-binding VL (hereinafter referred to as VLg) (SEQ ID NO: 99) for vector insertion in which a restriction enzyme SacII is arranged on the 3 ′ end side followed by His × 6 As gVL-B (SEQ ID NO: 123)
NNNNN GCTAGC GGTGGCGGGTGCTCT GAAATTGTGTT
GACGCAGTCT and gVL-F (SEQ ID NO: 124)
NNNNN CCGCG GCACG TTTAA TCTCC AGTCG TGT
A nucleic acid fragment is obtained in the same manner as in (1) except that is used, and it is confirmed that it has the target VL base sequence.
(3) Preparation of HEL-binding VH-encoding nucleic acid fragment Restriction enzyme NcoI cleavage site at the 5 terminal side of HEL-binding VH (SEQ ID NO: 125), 3 ′
HEL-binding VH (hereinafter referred to as VHh) for introducing a vector having the restriction enzyme NheI arranged on the terminal side.
) As a primer to make
hVH-B (SEQ ID NO: 126)
5'-NNNNNN CCATGG CCGAC GATATCCCAGCTGCAGGAG
TCGGGCCC-3 and hVH-F (SEQ ID NO: 127)
5'NNNN GCTAG C GGAGA CGG TGACGTCTGT-3
A nucleic acid fragment is obtained in the same manner as in (1) except that is used, and it is confirmed that it has the target VH base sequence.
(4) Preparation of HEL-binding VL-encoding nucleic acid fragment Nucleic acid encoding restriction enzyme NheI cleavage site and linker (GGGGS) on the 5 terminal side of HEL-binding VL (SEQ ID NO: 128), His × 6 on the 3 ′ terminal side In order to produce a HEL binding VL (hereinafter referred to as VLh) for vector insertion in which a restriction enzyme SacII cleavage site is arranged, as a primer,
hVL-B (SEQ ID NO: 129)
NNNNNGCTAGCGGTGGCGGGTGCTCTGATACGTCCTGAC
CCAGAG and hVL-F (SEQ ID NO: 130)
NNNNN CCGCG GCCTT GATCT CCAGC TTGGT GC
A nucleic acid fragment is obtained in the same manner as in (1) except that is used, and it is confirmed that it has the target VL base sequence.

Example 19 (expression vector preparation)
Two expression vectors are constructed with the following constitution using the above four kinds of nucleic acid fragments.
(1) Preparation of VHg-VLh expression vector (pGHEL) (FIG. 15)
(I) Insertion of VHg The plasmid pUT-XX was transformed into restriction enzymes NcoI / NheI (both New Eng).
Land Biolabs) and spin column 400HR (Amersham Science). Next, VHg cleaved with restriction enzymes NcoI / NheI in the same manner is cleaved, and the cleaved fragment is purified with a commercially available gel purification kit (SV Gel and PCR Clean-ups
ysystem: Promega). The above two fragments are commercially available T4.
Ligase kit (Roche) is prepared by the method recommended by the manufacturer and ligated.

The ligation solution is transformed into 40 μL of JM109 competent cell (Promega) by the heat shock method, spread on an LB / ampicillin (amp.) Plate, and allowed to stand at 37 ° C. overnight.

Next, an arbitrary colony from the plate was LB / amp. Planted in 3 mL liquid medium,
Shake culture overnight at 37 ° C. After that, a commercially available MiniPreps kit (Plus
Minipreps DNA Purification System: Promega
The plasmid is recovered using a)) The nucleotide sequence of the obtained plasmid is confirmed by the above sequencing method using gVH-F, and it is confirmed that the target fragment is inserted.
(Ii) Insertion of VLH The plasmid pUT-VHg obtained in 1) above is cleaved with restriction enzymes NheI / SacII, and spin column 400HR (Amersham Science) is used. Next, similarly, restriction enzyme Nh
VLh cleaved with eI / SacII is obtained. Thereafter, in the same manner as (a) above, ligation and confirmation of the target VHg-VLH expression plasmid pGHEL are confirmed. (The confirmation primer is hVL-F)
(2) Preparation of VHh-VLg expression vector (pHGOLD) (FIG. 16)
(Iii) Insertion of VHh VHh is inserted into plasmid pUT by the same method as in (i) above, and it is confirmed that the resulting plasmid is the target plasmid. (The confirmation primer is hVH-F)
(Iv) Insertion of VLg VLg was inserted into the plasmid obtained in (iii) in the same manner as in (b) above, and the obtained plasmid was the target VHH-VLg expression vector pHGOLD. )
Check in the same way. (The confirmation primer is gVL-F)
Example 20 (protein expression and purification)
The expression vectors expressing the VHg-VLh obtained in (ii) of Example 19 and the VHh-VLg polypeptide obtained in (iv) of Example 19 are expressed in the following manner in individual systems. And purified in the purification step to obtain polypeptide chains VHg-VLh and VHh-VLg, respectively.
1) Transformation The above two expression vectors are transformed with 40 μL of different BL21 (DE3) competent cell solutions. For transformation, heat shock in ice → 42 ℃ × 90sec →
Perform under ice conditions. 750 μL of LB medium was added to the BL21 solution transformed by heat shock, followed by shaking culture at 37 ° C. for 1 hour. Thereafter, centrifugation was performed at 6000 rpm for 5 minutes, 650 μL of the culture supernatant was discarded, the remaining culture supernatant and the precipitated cell fraction were stirred, and LB / amp. Spread on a plate and let stand at 37 ° C overnight.
2) Preculture A colony on the plate was randomly selected and 3.0 mL LB / amp. 28 ° C in medium
Shake overnight at
3) Main culture The above preculture solution was inoculated into 750 ML of 2 × YT medium, and the culture was further continued at 28 ° C. When the OD600 exceeds 0.8, IPTG is added so that the final concentration is 1 mM, and the culture is further performed overnight at 28 ° C.
4) Purification The desired polypeptide chain is purified from the insoluble granule fraction by the following steps.
(I) Recovery of insoluble granules The culture solution obtained in 3) above is centrifuged at 6000 rpm x 30 min to obtain a precipitate as a cell fraction. The obtained bacterial cells were tris solution (20 mM Tris / 500 mM NaCl) 1
Suspend in 5 ml in ice. The obtained suspension is crushed with a French press to obtain a bacterial crushing solution.
Next, the bacterial disruption solution is centrifuged at 12,000 rpm × 15 min, the supernatant is removed, and the precipitate is obtained as an insoluble granule fraction.
(Ii) Solubilization of insoluble granule fraction The insoluble fraction obtained in (i) above is soaked overnight by adding 10 mL of 6M guanidine hydrochloride / Tris solution. Next, it is centrifuged at 12,000 rpm × 10 min to obtain a supernatant as a solubilized solution.
(Iii) Metal chelate column As a metal chelate column carrier, His-Bind (manufactured by Novagen) is used.
The column adjustment, sample loading, and washing steps are in accordance with the recommended method of the above-mentioned supplier, and the room temperature (20
° C). The target His tag fusion polypeptide is eluted with a 60 mM imidazole / Tris solution. As a result of SDS-PAGE (acrylamide 15%) of the eluate,
Make sure it is a single band and purified.
(Iv) Dialysis The eluate is dialyzed at 4 ° C. using an external solution as a 6M guanidine hydrochloride / Tris solution to remove imidazole in the eluate to obtain the respective polypeptide chain solutions.
(V) Refolding In the same manner as described above, the protein chain refolding was carried out while each of the polypeptide chain solutions of VHg-VLh and VHh-VLg was separately treated by dialysis (4 ° C) with guanidine hydrochloride by the following steps. I do.
(A) Using 6M guanidine hydrochloride / Tris solution, the express coefficient and ΔO. D. A sample with a concentration of 7.5 μM (volume after dilution: 10 ml) is prepared from the (280 nm-320 nm) value. Next, β-mercaptoethanol (reducing agent) was added at a final concentration of 37.
Add to 5 μM (protein concentration 50 times) and reduce at room temperature in the dark for 4 hours. This sample solution is put into a dialysis bag (MWCO: 14,000) to obtain a sample for dialysis.
(B) The dialysis sample is immersed in 6M guanidine hydrochloride / Tris solution as an external dialysis solution, and dialyzed for 6 hours with gentle stirring.
(C) Decrease the concentration of guanidine hydrochloride in the external solution stepwise to 3M and 2M. Dialyse for 6 hours at each external concentration.
(D) Oxidized glutathione (GSSG) at a final concentration of 375 μM and L-Arg at a final concentration of 0.
4M) to the Tris solution, and the 2M dialysis external solution of (c) above was added, the guanidine hydrochloride concentration was adjusted to 1M, pH was adjusted to pH 8.0 (4 ° C.) with NaOH, 12
Dialyze with gentle agitation for hours.
(E) Prepare an L-Arg Tris solution containing 0.5 M guanidine hydrochloride in the same manner as in (d) above, and dialyze for 12 hours.
(F) Finally, dialyze with Tris solution for 12 hours.
(G) After completion of dialysis, the mixture is centrifuged at 10,000 rpm for about 20 minutes to separate the aggregate and the supernatant.
(Vi) Purification of the dimerization fraction Individual 5 μM polypeptides (VHg-VLh, VHh-VLg) obtained in (v) above.
) Mix the solution and overnight at 4 ° C. Next, a fraction corresponding to 60 kDa (about 18 minutes from injection) dimerized with a Sephadex 75 column (column: buffer 20 mM Tris, 500 mM NaCl, flow rate 1 ml / min) is obtained. This is S
A sample for PR measurement is used.

Example 21 (Evaluation of gold bonding by SPR measurement)
The binding of the dimerized protein fraction obtained in Example 20 to gold is measured by SPR. BIAcore 2000 (manufactured by BIAcore) was used as the SPR measurement device, and a gold-deposited glass substrate of SIA-kit Au was used as the gold substrate of the object to be bonded. Measurement is performed under the following conditions. As a sample, the dimerized protein fraction 500 nM obtained in Example 15 (calculated from the absorbance in the same manner as described above) is used.
Running buffer: 0.1% Tween 20 / Tris solution: TBST
Temperature: 25 ° C
Flow rate: 20 μL / min
Sample injection volume: 40 μL
A bond curve is obtained although the bond to gold is shown (FIG. 18).

Example 22 (HEL binding evaluation by SPR measurement)
Continuing from the sample in which the SPR evaluation of the gold bondability in Example 21 was performed, 1 μM was continuously applied.
The HEL solution is injected, and the binding property to HEL of the dimerized protein fraction bound to gold is measured by SPR. Although the binding to HEL shown in the figure is shown, a binding curve is obtained (FIG. 18).

Example 23 (Confirmation of Au specificity)
The following experiment was continued using the gold substrate of the SPR chip to which the gold binding protein and HEL obtained in Example 22 were bound. The gold substrate is injected with 1 μM anti-HEL antibody / PBST solution. Then, it is washed with PBST. Further, 1 μM rhodopsin-conjugated anti-IGg antibody / PBST solution is injected, and then washed with PBST. Thereafter, the SPR chip is taken out from the SPR device, and the substrate is observed with a fluorescence microscope. As a result, fluorescence is observed on the SPR channel on the gold substrate.

Comparative Example 2
The same operation as in Example 23 is performed using an unused gold vapor deposition substrate. As a result, no fluorescence is observed on the gold substrate.

Example 24
A rewinded polypeptide chain VHg-VLh obtained in the same steps as (i) to (v) in Example 20 is prepared to obtain a 5 μM VHg-VLh / Tris solution.

Example 25
The VHg-VLh / Tris solution obtained in Example 24 is diluted to 500 nM with the Tris solution, and the binding property to the gold substrate is evaluated by SPR in the same manner as in Example 20. Further, 1 μM HEL solution was continuously injected, and HEL of the dimerized protein fraction bound to gold.
The binding to is measured by SPR. Shows binding to gold and HEL, but obtains a binding curve.

Example 26
In Example 25, the sample is prepared by allowing it to stand overnight in the presence of 0.5 μM anti-HEL antibody VL / Tris solution.

Example 27
For the sample prepared in Example 26, the bondability to the gold substrate is evaluated by SPR in the same manner as in Example 15. Further, in the same manner as in Example 16, 1 μM HEL was continuously injected, and the binding property to HEL was measured by SPR. A bond curve showing the bondability is obtained.
Example 28 (Preparation of HEL detection immunochromatography apparatus)
As an example of the detection method of the present invention, an immunochromatography apparatus for detecting HEL is prepared.
1) Preparation of a porous carrier for immunochromatography in which an anti-HEL antibody is solid-phased A nitrocellulose sheet (BAS-85, manufactured by Schleicher-Suel) is 5 mm.
Cut to 30 mm, and anti-HEL antibody solution 0.5 mg /
mL (manufactured by Nippon Biotest Co., Ltd.) is applied linearly to produce a detection site. Allow to stand at room temperature for 2 hours, dry the liquid, and fix the antibody in a sheet form. The sheet is shaken with 1% skim milk (Difco) / PBST solution for 2 hours for blocking, and then allowed to stand at room temperature to prepare an immunochromatographic carrier.
2) Preparation of gold-labeled anti-HEL antibody fragment and preparation of support carrier (i) Preparation of gold-labeled anti-HEL antibody fragment Using the gold / HEL bispecific antibody fragment prepared in Example 20, the following steps are used. .
Gold / H produced in Example 20 in a gold fine particle dispersion (particle size: 50 nm, manufactured by Tanaka Kikinzoku Co., Ltd.)
Add the EL bispecific antibody fragment, mix well, and react at room temperature for 3 hours. Unreacted gold / H
In order to remove the EL bispecific antibody fragment, centrifugation was performed at 12,000 rpm for 5 minutes, and the supernatant was removed to obtain a precipitate. The resulting sediment was suspended in 1.0 mL of PBST. Further, centrifugation is performed under the above conditions. The resulting precipitate was added with 1.0 mL of 1% BSA / PBST.
Suspend in
(Ii) Preparation of carrier for holding gold-labeled anti-HEL antibody fragment 5 μL of the above-mentioned gold-labeled anti-HEL antibody fragment solution and 5 μL of 10% aqueous solution of various bases were impregnated into a 5 mm × 5 mm Benlyze nonwoven fabric (manufactured by Asahi Kasei) and air-dried. A labeled anti-HEL antibody fragment holding carrier was prepared.
3) Preparation of test piece type immunochromatography apparatus 2.5 mm from one end of the immunochromatography support prepared in 1) above
The above-mentioned 2) (ii) gold-labeled anti-HEL antibody fragment holding carrier was stacked up to the position of. Further, a liquid sample absorption carrier (filter paper No. 526, manufactured by Advantech Toyo Co., Ltd.) was layered on the antibody fragment holding carrier. Further, an excess sample absorption site carrier (filter paper No. 526) was stacked up to a position of 5 mm from the other end of the support for immunochromatography. Finally, put the tape on the back side
The whole was immobilized to prepare a test piece type immunochromatography apparatus. As a result of the test using the standard HEL solution, it is confirmed that the anti-HEL antibody immobilization part is colored red.

Example 29 (Production of an electrical measuring device)
An example of the protein detection method using a gold electrode is shown.
1) Two gold electrodes are provided on a glass substrate. The distance between the electrodes is 20 μm. Between the gold electrodes of the glass substrate, 20 μL of a 0.1% poly-L-lysine (Sigma) aqueous solution is dropped and allowed to stand for 3 hours.
Next, after washing with water, washing with ethanol is performed three times and dried.
2) Next, anti-HEL polyclonal antibody (ROCKLAND) was purchased from Proteomics,
3. Immobilization to the glass substrate obtained in the above (a) based on pp254 (2003).
3) The gold / HEL bispecific antibody fragment prepared in Example 20 is reacted with PBST solution and 20 nm gold nanoparticles (Tanaka Kikinzoku Co., Ltd.). (For comparison, PBST solution)
4) Add 1 μM HEL / PBS solution to the anti-HEL antibody-immobilized substrate obtained in 1).
5) Then. Add the gold-binding protein solution obtained in 2) to 3).
6) The substrate obtained in 4) is washed 3 times with a PBS solution. Then, it was immersed in a silver amplification solution (Sigma Chemical Co., Silver Enhancer Solution) for 5 minutes and washed with water. It is confirmed that the electrical resistance between the electrodes is lower than that of the comparative sample PBST alone.

Example 30 (Production of yeast expression vector of VHg-VHh protein)
(1) Preparation of NheI-VHh-SacII fragment Similarly, NheI / Sac was terminated with pHGold prepared in Example 19 as a template.
A VHh fragment with II is generated by PCR.
The following are used as primers.
NheI-VHh_f (SEQ ID NO: 131)
NNNNNGCTAGCCAGGTGCAGTTGGTGGAGTCT
VHh-SacII_r (SEQ ID NO: 132)
NNNNNCCCCGCGGATGAGGAGAGGGTGACCAGGGTT
Using the above primers, PCR is performed using pfu-turbo according to methods recommended by those skilled in the art.
The obtained PCR reaction solution is subjected to agarose gel (2%) electrophoresis, and it is confirmed that a fragment of about 350 bp is obtained.
(2) Preparation of VHg-VHh DNA fragment The VHh fragment obtained in (1) above is introduced into the VLh portion of pGHEL prepared in Example 19 above. The PCR fragment and pGHEL obtained in (1) above were converted into NheI / SacII.
(Both manufactured by Takara Bio Inc.) The restriction enzyme reaction is performed by a method recommended by those skilled in the art. Each reaction solution obtained is subjected to gel purification by agarose electrophoresis. (PCR
Fragment: 2% agarose, pGHEL: 1% agarose. ) Gel purification is performed using the gel purification kit described above. After confirming that the PCR fragment after the restriction enzyme obtained above is about 350 bp and the plasmid fragment is 3000 bp, a new plasmid is obtained in the same manner as in Example 19 below. The nucleotide sequence of the obtained plasmid is confirmed with a sequencer to confirm that it is the target nucleotide sequence. (This plasmid is designated as pHgHh.)
(3) Insertion into yeast expression plasmid PCR is performed by the same method recommended by the manufacturer.
As the yeast (Pichia pastris) expression plasmid, pPCIZαA (Invitrogen) is used. Eco at the multiple cloning site of the plasmid
The target gene is introduced using RI and SacII.
The gene to be introduced is prepared by PCR using the pHgHh obtained in (2) as a template.
7s4-fw-EcoR1s (SEQ ID NO: 133) as a primer
AAGCTGAATTCCAGGTGCAGTTGGTGGAGTCT
HELVH-SacII-r (SEQ ID NO: 134)
NNNNNCCGCGGAGACGGTGACGAGGGGT
The obtained PCR fragment and the above pPCIZαA are sequentially cut with EcoRI and SacII,
The target fragments are obtained by gel purification in the same manner as described above. Ligation is performed by the method described above, and the ligation reaction solution is transformed in the same manner as described above and plated on an agar plate. In this case, the agar plate was tryptone 10 g / yeast extract 5 g / NaCl 5 g /
Zeocin is added to agar 15 g / L to 25 μg / L. Colonies selected by this were treated with liquid medium (tryptone 10 g / yeast extract 5 g / NaCl 5 g.
, Zeocin (25 μg / L) overnight at 37 ° C. After recovering the plasmid, the sequence was confirmed with a sequencer, and VHg-VHh: VH_gold-lin which is the object of this example.
A plasmid expressing ker (GGGGGS) -VH_HEL is obtained. (PPCIZ-αH
H)
Example 31 (expression / purification of VHg-VHh protein)
The expression of VHg-VHh is EasySelect Pichia Expression
Kit Ver. G (Invitrogen) is used. Transformant production, protein production and purification (metal chelate column) are carried out by methods recommended by those skilled in the art. 5 mL of 1 M imidazole elution fraction obtained by a metal chelate column was added to Tris buffer (20
Dialysis is performed at 4 ° C. using mM Tris / 200 mM NaCl, 1 mM EGTA: pH 7.9) as an external solution. The external liquid is exchanged 3 times every 6 hours.

Subsequently, purification by gel filtration using Sephadex 75 (Amersham Biosciences) (buffer conditions: 50 mM Tris-HCl, 200 mM NaCl, 1
mMEDTA, pH 8.0, flow rate: 0.7 mL / min) at 4 ° C. After concentrating the obtained fraction, the same blotting as described above is performed using SDS-PAGE (acrylamide 17.5%) and an HRP-fused anti-His antibody. Thereby, the fraction of the target protein is specified and purified to a single band. Among them, a peak suggesting that it is a monomeric protein of about 25 kDa is collected, and the following evaluation is performed. (Fig. 19)
Example 32 (Evaluation of gold bonding by SPR measurement)
The binding of the protein fraction obtained in Example 31 to gold is measured by SPR. SP
BIAcore 2000 (manufactured by BIAcore) was used as the R measuring device, and a gold-deposited glass substrate of SIA-kit Au of the same company was used as the gold substrate of the object to be bonded. Measurement is performed under the following conditions. As a sample, the protein fraction obtained in Example 20 500
nM (same as above, calculated from absorbance) is used. The implementation conditions are as in Example 21 and Saturday. Shows bondability to gold but obtains a bond curve. (Fig. 20)
Example 33 (VHg-VHh protein mutant preparation-1)
The plasmid pPCIZ-α7 obtained in Example 30 so that it becomes a VHg variant (SEQ ID NO: 135, 136) that becomes V37L, G44E, L45R of the gold-binding VH of Example 30.
Use QC kit (manufactured by STRATAGENE) using s4 as a template. According to the method recommended by a person skilled in the art, the target plasmid is obtained by three operations using the following primers. Introduce mutations one by one for each operation.

PCR primer V37F-f (SEQ ID NO: 137) for mutagenesis at the first site
TTACTGGATCAACTGGTTCCCGCCAGATGCCCGG
V37F-r (SEQ ID NO: 138)
CCGGGGCATCTGGCGGAACCAGTTGATCCCAGTAA
PCR primer G44E-f (SEQ ID NO: 139) for introducing mutation at the second site
CAGATGCCCGGCAAGAACTACTGAAGATGGAGGGG
G44E-r (SEQ ID NO: 140)
CCCCATCCATTCCAGTTCTTTGCCGGGCATCTG
PCR primer L45F-f (SEQ ID NO: 141) for introducing mutation at the third position
GCCCGGCAAAGAAAAGGAGATGGATGGGGATG
L45F-r (SEQ ID NO: 142)
CATCCCCATCCATTCCCTTTCTTTGCCCGGGC
Mutation is confirmed by sequencing. Example 31 from transformation to protein expression
The same means is used. The following evaluation is performed using a peak of monomeric protein of about 25 kDa.

Example 34 (Evaluation of gold bonding by SPR measurement)
The binding of the protein fraction obtained in Example 33 to gold is measured by SPR. SP
BIAcore 2000 (manufactured by BIAcore) was used as the R measuring device, and a gold-deposited glass substrate of SIA-kit Au of the same company was used as the gold substrate of the object to be bonded. Measurement is performed under the following conditions. As a sample, the protein fraction obtained in Example 33 500
nM (same as above, calculated from absorbance) is used. The implementation conditions are as in Example 21 and Saturday. Shows bondability to gold but obtains a bond curve. (Fig. 21)
Example 35 (VHg-HELscFv protein mutant preparation)
Instead of the HEL-binding VH of Example 31, HEL-binding scFv (SEQ ID NO: 143,
144) Replace to a fused protein. HEL-binding scFv
nal of Biological chemistry, 2003, 279, pp8
PC using a plasmid introduced with the HEL-binding scFv coding gene shown in 979 as a template
A DNA fragment encoding HEL-binding scFv is obtained at R. PCR uses the following primers according to the method recommended by those skilled in the art in the same manner as described above.
scFv-f (SEQ ID NO: 145)
NNNNCCATGCCCGATATCGTCCTGACCCAG
scFv-r (SEQ ID NO: 146)
AGCTACCGCGGAGACGGTGACGAGGGGT
After the restriction enzyme reaction, the target plasmid is obtained by the same method as in Example 30. The obtained plasmid is confirmed by sequencing to be the intended gene sequence. Also,
From transformation to protein expression is carried out by the same means as in Example 31. A monomeric protein of about 39 kDa is obtained.

Example 36 (double bond evaluation to gold and HEL by SPR measurement)
The binding of the protein fraction obtained in Example 35 to gold is measured by SPR. SP
BIAcore 2000 (manufactured by BIAcore) was used as the R measuring device, and a gold-deposited glass substrate of SIA-kit Au of the same company was used as the gold substrate of the object to be bonded. Measurement is performed under the following conditions. As a sample, the protein fraction obtained in Example 31 500
nM (same as above, calculated from absorbance) is used. The implementation conditions were Examples 21 and 22.
The same shall apply. Shows bondability to gold but obtains a bond curve. (Fig. 22)
Example 37 (VHg mutant-VLh expression plasmid preparation)
The DNA sequence represented by SEQ ID NO: is inserted into the gold-binding VH coding sequence of the expression plasmid (pGHEL) obtained in Example 19. The insertion method is performed using the above-described QuickChange kit (Stratagene) using the pGHEL as a template. Confirm that the resulting plasmid is the target sequence. Next, using the resulting plasmid, the protein is expressed and purified in the same manner as in Example 20, and dimerized with VHh-VLg.
A protein fraction having a molecular weight of about 50 kDa is fractionated using Sephadex G75. (
(Fig. 23)
A14P-f (SEQ ID NO: 147)
GAGCAGAGGTGAAAAAGCCCAGGGGAGTCTCTGAAG
A14P-r (SEQ ID NO: 148)
CTTCAGAGACTCCCCTGGCTTTTCACCTCTCGCTC
Example 38 (Evaluation of double bondability of gold and HEL by SPR)
The binding of the protein fraction obtained in Example 37 to gold is measured by SPR. SP
BIAcore 2000 (manufactured by BIAcore) was used as the R measuring device, and a gold-deposited glass substrate of SIA-kit Au of the same company was used as the gold substrate of the object to be bonded. Measurement is performed under the following conditions. As a sample, the protein fraction obtained in Example 37 500
nM (same as above, calculated from absorbance) is used. The implementation conditions are the same as in Example 21. Shows bondability to gold but obtains a bond curve. (Fig. 24)
Example 39 (Preparation of VHg-VHg protein expression plasmid)
PPCIZ-αVHg ² is prepared in the same manner as in Example 30 except that a DNA fragment encoding VHg is used instead of VHh in Example 30. As a template for producing a DNA fragment encoding VHg used above, p obtained in Example 10 is used.
RA2-7s4 was used, and VHg-f (SEQ ID NO: 149) was used as a primer.
NNNNNGCTAGC GGCGGGGGGCGGTAGC CAGGTGCAGTTG
GTGGAGTCT
VHg-r (SEQ ID NO: 150)
NNNNNCCGCGGATGAGGAGAGGGTGACCAGGGTT
Is used. Confirm that it is the target plasmid by sequencing.

Example 40 (Production of VHg-VLg protein)
The target protein is purified by the same method as in Example 31. VH with a molecular weight of about 25 kDa
A protein consisting of a dimer of g-VHg is purified. (Fig. 25)
Example 41 (Preparation of VHg-VLg tetramer protein expression plasmid)
PPCIZ-αVHg ⁴ is prepared in the same manner as in Example 30 except that the linker GGGGS connecting VHg-VHg in Example 39 is changed to GS. PRA2-7s4 obtained in Example 10 is used as a template for preparing a DNA fragment encoding VHg used above, and VHg4-f (SEQ ID NO: 151) is used as a primer.
NNNNNGCTAGC GGCAGC CAGGTGCAGGTTGGTGGAGTCT
VHg4-r (SEQ ID NO: 152)
NNNNNCCGCGGATGAGGAGAGGGTGACCAGGGTT
Is used. Confirm that it is the target plasmid by sequencing.

Example 42 (Gold fine particle aggregation reaction)
Each of the proteins obtained in Examples 40 and 44 is incubated with gold microparticles (20 nmφ: Tanaka Kikinzoku Co., Ltd.) at room temperature. It is observed that the gold fine particles are aggregated when any protein is used. In addition, it was observed that the spectrum (λmax) of the gold fine particle / protein mixed solution changed with time and the half-value width was expanded, and the result suggesting that the distance between the gold fine particles is close is obtained (FIG. 26). ).

(Comparative Example 2)
In Example 36, it is the same except that 500 nM BSA is used instead of 500 nM HEL. BSA binding cannot be confirmed. The protein that binds to the gold substrate obtained in Example 35 is HEL.
Are shown to bind specifically. (Fig. 27)
(Comparative Example 3)
The binding ability of the antibody directly immobilized on the gold substrate using an anti-HEL antibody (manufactured by Rockland) is evaluated by SPR measurement.
(1) A 10 μM anti-HEL antibody / PBS solution is prepared.
(2) The antibody solution obtained in (1) is injected at 100 μL at 1 μL / min. The signal of the adsorbed antibody molecule is 1907R. U.
(3) Subsequently, a 1% casein / PBS solution is injected under the same conditions as in (2).
(4) Further, 40 μL of 1% casein / PBS solution is injected at 20 μL / min to confirm that the gold substrate is blocked.
(5) Next, 40 μL of 1 μM HEL is injected at 20 μL / min, and the result of FIG. 28 is obtained.

As a result, the antibody molecule immobilized on the gold substrate was 1907R. The HEL molecule bound to U is 11R. U. Considering the spatial arrangement at the time of fixation, if it is assumed that one antibody molecule has one antigen immobilized on the substrate, it is calculated that about 6% of the antibody captures the target substance.
On the other hand, the present invention shown in the above examples is about 20% of the protein of the present invention immobilized on a substrate.
It is shown that ˜40% or more captures the target substance.
Furthermore, the embodiment of the present invention does not perform any special chemical substance or process under the conditions for immobilizing the protein that becomes the capture molecule of the sensor or the solution concentration / fixation time. The results suggested to be an excellent substrate fixing method are obtained.

The present invention provides a gold-binding protein having one or more binding sites for gold and a binding site for a specific substance, a structure including a gold substrate on which the gold-binding protein is immobilized, and detection using the same Providing equipment. In the detection apparatus comprising a structure to which a gold-binding protein obtained by applying the present invention is immobilized, the protein is immobilized by a binding site that specifically recognizes gold as a substrate. The binding site recognizing the other specific substance (target substance) is not immobilized on the substrate, but is oriented with a space from the substrate. Thereby, the target substance binding site is fixed on the substrate surface in an efficient and highly oriented manner while minimizing the influence on the binding ability from the substrate.

In other words, the present invention applies the functions of various biological materials such as biosensors and bioreactors that immobilize organic materials such as biological materials on the substrate surface and use various physiological functions of the organic materials. This suggests that it can be used to improve the performance of products.

On the other hand, the present invention is a connecting member for labeling a target substance, and has at least one site for binding the target substance and one site for binding the labeling substance. Provided is a connection member that is bonded to a binding substance. The target protein can be labeled without performing the conventional chemical cross-linking method obtained by applying the present invention. Thereby, it is possible to minimize the influence on the binding ability of various proteins to the target substance, which has been a problem in labeling, and to improve the production efficiency. In other words, the present invention is a high-performance product that applies various biomaterial functions, such as biosensors, by immobilizing a connection member such as a biological material to the surface of the substrate and using various physiological functions of the connection member. It is suggested that it can be used for performance improvement.

It is a figure which shows typically the structure of the structure in an example of the composite protein concerning this invention. It is a figure which shows typically the structure of the structure in an example of the composite protein concerning this invention. It is a figure which shows typically the structure of the structure in an example of the composite protein concerning this invention. It is a figure which shows typically the structure of the structure in an example of the composite protein concerning this invention. It is a figure which shows typically the structure of the structure in an example of the composite protein concerning this invention. It is a figure which shows typically the structure of the structure in an example of the composite protein concerning this invention. It is a figure which shows typically the structure of the structure in an example of the composite protein concerning this invention. It is a figure which shows typically the structure of the structure in an example of the composite protein concerning this invention. It is a figure which shows an example of SPR evaluation of VL obtained by this invention. It is a figure which shows an example of SPR evaluation of VH obtained by this invention. It is a vector schematic diagram for demonstrating the Example of this invention. It is a vector schematic diagram for demonstrating the Example of this invention. It is a vector schematic diagram for demonstrating the Example of this invention. It is a vector schematic diagram for demonstrating the Example of this invention. It is a vector schematic diagram for demonstrating the Example of this invention. It is a vector schematic diagram for demonstrating the Example of this invention. It is a figure which shows an example of SPR evaluation of scFv obtained by this invention. 22 is an SPR chart in Example 21. FIG. 22 is a GPC chart in Example 31. 36 is an SPR chart in Example 32. FIG. 42 is an SPR chart in Example 34. FIG. 42 is an SPR chart in Example 36. FIG. 42 is a GPC chart in Example 37. FIG. 42 is an SPR chart in Example 38. FIG. 42 is a GPC chart in Example 40. FIG. 4 is a light absorption curve of a metal-containing fine particle solution in Example 42. FIG. 10 is an SPR chart in Comparative Example 2. 10 is an SPR chart in Comparative Example 3.

Claims (25)

A protein having a binding property to gold, wherein the protein comprises at least a part of an antibody.   The protein according to claim 1, which has a gold binding site containing at least a part of the antibody. The protein according to claim 2, wherein the gold binding site comprises at least one selected from F (ab ') 2, Fab', Fab and a part thereof. The protein according to claim 2, wherein the gold binding site comprises at least one selected from an antibody variable region (Fv) and a part thereof. The gold binding site is
(1) an antibody heavy chain variable region (VH), a variant thereof and a part thereof; and (2) an antibody light chain variable region (VL), a variant thereof and at least one selected from them. 5. A protein according to claim 4 comprising. The protein according to claim 5, wherein the antibody heavy chain variable region (VH) comprises at least one of the amino acid sequences of SEQ ID NOs: 1 to 48. The antibody heavy chain variable region (VH) variant comprises one or more amino acid sequences in which one or several amino acids of the amino acid sequence of SEQ ID NOs: 1 to 48 are deleted, substituted or added,
The protein according to claim 4, which has gold binding properties. The protein according to claim 5, wherein the antibody light chain variable region (VL) comprises at least one of the amino sequences of SEQ ID NOs: 49 to 57. The antibody light chain variable region (VL) variant comprises one or more amino acid sequences wherein one or several amino acids of SEQ ID NO: 49-57 are deleted, substituted or added, 6. The protein according to claim 5, which has sex. The protein according to any one of claims 1 to 5, which has a dissociation constant of 10 ^-6 M or less. A gold-binding complex protein,
(1) a first domain comprising a protein having binding properties to gold according to any one of claims 1 to 10;
(2) a second domain containing a protein having a binding site for a specific substance;
A gold-binding complex protein characterized by comprising: The gold-binding complex protein according to claim 11, further comprising at least one of a third domain forming a complex with the first domain and a fourth domain forming a complex with the second domain. The gold-binding complex protein according to claim 12, wherein the third domain has gold-binding property and includes the protein according to any one of claims 1 to 10. The gold-binding complex protein according to claim 13 or 14, comprising any of the following structures (1) to (7).
(1) The first domain and the second domain form a single polypeptide chain.
(2) The first domain and the second domain are bonded via one or more amino acids. (3) The third domain and the fourth domain form a single polypeptide chain. Yes.
(4) The third domain and the fourth domain are bound via one or more amino acids.
(5) At least the first domain, the second domain, and the third domain form one polypeptide chain.
(6) At least the first domain, the second domain, and the fourth domain form one polypeptide chain.
(7) All of the first to fourth domains form one polypeptide chain. A structure having a substrate and a protein, wherein the substrate contains gold on at least a part of a surface thereof, and the protein is a gold-binding complex protein according to any one of claims 11 to 14. Structure. The structure according to claim 15, wherein at least one of the second and fourth has a binding property to a target substance.   A nucleic acid encoding the gold-binding complex protein according to any one of claims 11 to 14.   A vector comprising the nucleic acid according to claim 17. In the manufacturing method of the structure according to claim 15 or 16,
(1) a step of preparing the substrate;
(2) A method for producing a structure, comprising the step of producing the gold-binding complex protein, and (3) the step of arranging the gold-binding complex protein on the substrate. The production of the structure according to claim 19, wherein the production of the gold binding protein is performed by expressing a polypeptide chain containing the gold binding protein by introducing the vector according to claim 18 into a host cell. Method. A detection kit for detecting a target substance, comprising: a substrate for forming the structure according to claim 15; a gold-binding complex protein; and detection of binding of the target substance to the structure. A kit for detecting a target substance, comprising: a detection means. A connecting member for labeling a target substance with a labeling substance,
Each having one or more sites for binding the target substance and sites for binding the labeling substance;
These sites bind to the bound substance independently of each other,
12. The connection member, wherein at least one of a site that binds the labeling substance or a site that binds the target substance contains the protein according to any one of claims 1 to 11. The connection member according to claim 22, wherein the labeling substance or the target substance includes at least one of a metal containing gold, a metal oxide, and a semiconductor compound. In a method for detecting a target substance by binding a target substance to a labeling substance and labeling the target substance, and detecting the target substance bound to the labeling substance,
A method for detecting a target substance, comprising the step of binding the labeling substance to the target substance via a connecting member according to claim 22. A kit for detecting a target substance,
23. A kit comprising: a labeling substance containing gold; a connection member according to claim 22; and a detection means for detecting a state in which the labeling substance is bound to the target substance via the connection member. .

Images