JP2007197433A - Gold-binding protein - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To obtain a gold-binding protein that can be used for binding gold to a target substance in a microstructure and can specifically bond to the gold, to provide a complex protein containing the protein, and to provide a technique for utilizing the complex protein for detecting the target substance. <P>SOLUTION: As a protein having the bonding property to gold metal, the protein having following properties can be provided: the β-sandwich structure comprising two or more layers of the β-sheets arranged in the anti-parallel in which these interlayer spacings are not cross-linked with the disulfide bonds; in addition, the dissociation constant Kd of the protein to gold satisfies Kd≤1×10<SP>-5</SP>M. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a gold-binding protein, gold and a target substance-binding protein.

  Biomolecules typified by nucleic acids and proteins are known to construct precise structures controlled at the atomic level in order to perform their functions, and by utilizing the characteristics of such biomolecules, It has been studied to arrange the material on various materials. Japanese Patent Application Laid-Open No. 2005-31446 discloses a gold-binding protein that can be specifically bound to gold and can be used for binding gold to a target substance (target substance). The protein disclosed in the patent document has a binding property to gold and includes at least a part of an antibody. This protein has an antibody structure as a scaffold and is an antibody fragment that directly recognizes gold by taking advantage of the antigen recognition ability of the antibody, and it can be immobilized on a gold substrate by securing a space by the scaffold structure. It is what.

  However, the protein disclosed in JP-A-2005-31446 has an antibody-based structure. For this reason, in production using microorganisms such as Escherichia coli, there is a possibility that the target protein molecule cannot be stably produced due to a difference in intramolecular or intermolecular disulfide bond. In addition, since a part of the antibody is used, there is a possibility that the stability of the protein itself can be improved.

  On the other hand, J. Mol. Biol. (1998) 284, 1141-1151 discloses that a fibronectin type III domain having a β sandwich structure is used as a scaffold for a binding protein. Here, fibronectin type III domain is selected as a scaffold structure using ubiquitin protein as a new target substance, and the binding property between the two is examined. However, what is disclosed in J. Mol. Biol. (1998) 284, 1141-1151 is only a binding property to ubiquitin protein, and is a protein having a binding property to metal materials such as gold. There is no disclosure.

  Protein Science (2002), 11: 1917-1925 discloses a protein having binding property to a gold surface using an extracellular protein (OmpF) having a β-barrel structure as a scaffold. In this case, protein and gold are bonded to each other by an Au-S bond generated between the cysteine residue of the amino acid introduced into the bent portion between the β sheets of the β barrel structure and the gold surface.

  The protein described in JP-A-2005-31446 obtains binding property with gold by an antibody-based structure, and does not disclose a gold-binding protein based on a protein other than an antibody. J. Mol. Biol. (1998) 284, 1141-1151 discloses a protein using a scaffold having a β sandwich structure, but does not disclose a protein having binding property to gold. Protein Science (2002), 11: 1917-1925 discloses that a protein can be fixed at a high density by using an outer membrane protein (OmpF) having a β barrel structure as a scaffold. However, in Protein Science (2002), 11: 1917-1925, the cysteine residue of the amino acid used for binding tends to form a multimer such as a dimer between molecules, and efficient binding to the gold surface is impaired. There is a fear. Furthermore, the protein disclosed in Protein Science (2002), 11: 1917-1925 does not cause binding to gold by a sequence consisting of a plurality of different amino acids.

On the other hand, considering the manufacturing process and cost of various instruments such as biosensors and diagnostic devices using gold-binding proteins, functions such as the desired sensitivity can be obtained by using smaller amounts of gold-binding proteins. It is desirable. Furthermore, reduction in the number of manufacturing processes of these devices and reduction in manufacturing time are required. In other words, it is important that a lower concentration of molecules can be efficiently immobilized on a substrate containing gold in a short time, and that the number of processes is small. In addition, when such a gold-binding protein is mounted on a biosensor or diagnostic agent / diagnostic device and commercialized as a medical device, the gold-binding protein is oriented more precisely in terms of reproducibility and accuracy. It is important to fix them.
JP 2005-31446 A J. Mol. Biol. (1998) 284, 1141-1151 Protein Science (2002), 11: 1917-1925

  An object of the present invention is to expand the possibility of providing a technique for satisfying the demand for the gold-binding protein. Another object of the present invention is to provide a gold-binding protein that can be stably produced in microorganism production using genetic engineering and can be immobilized on the gold surface with good orientation.

The protein provided by the present invention is a protein having a binding property to gold, wherein the protein has a β sandwich structure in which a β sheet layer composed of at least an antiparallel β sheet forms two or more layers, and the interlayer Is not cross-linked by a disulfide bond, and the dissociation constant Kd of the protein with respect to gold satisfies Kd ≦ 1 × 10 ⁻⁵ M.

  In the gold-binding protein according to the present invention, a β sandwich structure, which is a stable structure that naturally exists even in the absence of a disulfide bond between two or more antiparallel β sheet layers, is selected as the basic structure of the scaffold structure. is doing. As a result, inactivation process caused by cross-linking of disulfide bonds, which is very important for the maintenance and function of the scaffold structure, is reduced in the production process of recombinant proteins by microorganisms, etc., and functional activities such as gold binding are maintained. Protein molecules can be produced efficiently. In addition, once the disulfide bond is broken, it may be difficult for the antibody or the like to return to the original structure. However, the gold-binding protein of the present invention has no disulfide bond between the β sheet layers, and there is an equilibrium between them. Therefore, the storage stability is good.

  Since the gold-binding protein according to the present invention has a gold-binding site and a scaffold structure part, the target substance-binding site is immobilized when the target substance-binding site that binds and binds thereto is immobilized on the surface of the gold substrate. The immobilization effect on the original function can be eliminated as much as possible. In addition, since no reagent is used for immobilization, the target substance binding site is not exposed to a chemical reaction that may affect its function. Furthermore, by maintaining the distance between the target substance binding site and the gold substrate, the influence of the gold substrate on the target substance binding site can be eliminated as much as possible.

  When cysteine residues are used to stabilize the structure of protein molecules or bind to gold substrates, multimers may be formed by disulfide bonds between cysteine residues for immobilization by Au-S bonds. . On the other hand, the gold-binding protein according to the present invention does not have a cysteine residue responsible for a disulfide bond in the β sheet structure, and binds to the gold substrate surface without using a cysteine residue at the gold-binding site. Can also be possible. Therefore, formation of the multimer as described above can be avoided in the gold-binding protein of the present invention. As a result, there is no influence of steric hindrance resulting from multimer formation, and the gold-binding protein according to the present invention can be efficiently bound to the gold surface. Furthermore, because of the molecular recognition function, it is possible to fix the desired number of molecules with a small amount of molecules for immobilization. In addition, since the number of immobilization processes is very small, the time required for immobilization can be shortened. As a result, cost merit is increased. Further, the gold-binding protein according to the present invention can be immobilized without being affected by the use environment such as a redox state.

  Furthermore, the gold-binding protein of the present invention can have a structure having at least gold and a binding site for a target substance. At this time, since the gold-binding protein according to the present invention has a three-dimensionally very stable structure of the β sandwich structure composed of the antiparallel β-sheet, a spatial position is set between the binding sites of the gold base material and the target substance. It is possible to keep. In addition, the gold-binding protein domain (for example, the second domain) that binds gold or a substance other than gold (for example, the target substance) binds without receiving any interaction from the substrate containing gold. Performance can be maintained.

  Furthermore, in addition to the sterically stable structure of the β sandwich structure, the molecule does not have a disulfide bond between the β sheet layers. Therefore, reproducibility and accuracy can be greatly improved from the viewpoint of the production and function of devices at the commercial level and the immobilization process. Moreover, it is possible to form a very thin dense multilayer structure.

  By utilizing these characteristics of the gold-binding protein of the present invention, various detection devices can be constructed. For example, a sensing element for a desired substance can be obtained by providing the gold-binding protein of the present invention capable of binding to a desired substance on a gold thin film. This sensing element can be suitably used for a detection method or a detection device using optical means, for example, a detection method or a detection device using, for example, surface plasmon resonance.

The protein of the present invention is a protein having a binding property to gold, wherein the protein has a β sandwich structure in which at least a β sheet layer composed of antiparallel β sheets forms two or more layers, and the interlayer is a disulfide bond. And the dissociation constant Kd of the protein with respect to gold satisfies Kd ≦ 1 × 10 ⁻⁵ M.

  The present invention includes those in which the β sandwich structure has a gold binding site. The present invention includes those in which the gold binding site has at least one loop motif constituting an antiparallel β sheet having a β sandwich structure. The protein of the present invention comprises a single domain, and the domain has a binding site with gold and a binding site with a target substance. The protein of the present invention includes a complex protein having a domain having a β sandwich structure having a binding site with gold and a domain having a binding site with a target substance. Furthermore, the present invention provides a target substance capturing structure in which a protein having binding ability to a target substance is immobilized on a substrate, wherein the base includes gold on at least a part of the surface, and the protein is bound to the target substance. A structure for capturing a target substance as a protein of the present invention having a binding site is included.

Hereinafter, the gold-binding protein according to the present invention and its use for capturing a target substance will be described.
(1) Gold-binding protein / protein structure Proteins form an acid amide bond (-CO-NH-) by dehydration condensation of the amino acid carboxyl group (-COOH) with the α-amino group (-NH2) of another amino acid. The polymerized product is shown. The acid amide bond found in the amino acid linkage of this protein is particularly called a peptide bond. This amino acid sequence is called the primary structure of the protein. The unit amino acid moiety (-NH-CH (-R) -CO-), which is a protein component by peptide bonding, is called an amino acid residue, but the nature of each R varies. This residue interaction (hydrogen bonding) folds the peptide that was just a straight chain (this folding is called folding) to form a secondary structure. And it will take the tertiary structure as the whole protein. In some proteins, a plurality of (in some cases, multiple types) polypeptide chains form a complex, and such a relationship is called a quaternary structure.

  Typically, the secondary structure is roughly divided into three types, α-helix, β-sheet, and random structure, in the manner of interaction (hydrogen bonding) between residues. In addition, secondary structures appear as a certain combination in the cores of various proteins, which are called structural motifs. Protein structural motifs can be regular geometrical spatial arrangements of secondary structures (supersecondary structures) or domains that are functionally and structurally organized. A structural motif refers to a repeating unit or a unit with common features. The super-secondary structure includes the following when the loop of the polypeptide chain at the seam of the anti-parallel β sheet consisting of two β strands makes a turn. That is, it includes a hairpin β motif (in the present invention, a loop motif (bent portion)) and a βαβ motif (a motif in which a parallel β sheet composed of two β strands is connected by an α helix). Domains that are larger units include an α bundle structure, an α solenoid structure, a β sandwich structure, a β barrel structure, a Rothman fold, a trefoil structure, and a roll structure. The β sandwich structure described in the present invention refers to an antiparallel β sheet layer composed of two or more β strands forming two or more layers.

  Tertiary structure refers to a single domain monomer protein consisting of only a single domain, or a multi-domain monomer protein consisting of units (subunits) consisting of a plurality of domains regularly. . Further, the quaternary structure refers to a multimer formed by the tertiary structure proteins interacting with each other in a non-covalent bond. For example, antibody fragments VH and VL are heterodimers, and dimers composed of the same monomers are homodimers, and are included in multimers. The complex protein shown in the present invention refers to a multi-domain monomer protein and a multimer. The β sandwich structure, which is a super secondary structure, is structurally stable as represented by antibodies. Further, it is expected that the loop motif (bent portion) between antiparallel β sheets can modify amino acids like the CDR regions of antibodies having diversity, and the β sandwich structure can be maintained. In the present invention, a β sandwich structure is selected as the scaffold structure of the protein having gold binding property, and the orientation is highly oriented with respect to the gold substrate. A certain space can be secured.

• β sandwich structure protein The β sandwich structure is a kind of structural motif, and is a sandwich structure in which at least two of the β sheet layers composed of antiparallel β sheets form a multilayer. A loop motif (bent portion) is formed between the antiparallel β sheets, and the structure is also stable in three dimensions.

  FIG. 1 shows the concept and part name of the β sandwich structure. In FIG. 1, a first β sheet layer composed of antiparallel β sheets composed of three β strands and a second β sheet layer composed of antiparallel β sheets composed of four β strands are divided into two layers. The resulting β sandwich structure is shown. In this sandwich structure, one or more loop motifs (bent) on the same side of the first and second β sheet layers are conformed to the first loop group and the other side, and one or more loop motifs (bent) Part) is a second loop group. The β sandwich structural protein is a protein having at least a part of the above structure. For example, the most typical molecule is an immunoglobulin structure (antibody). The antibody is a β sandwich structure protein having a disulfide bond composed of an antiparallel β sheet composed of seven β strands. A β sandwich structure is formed in such a manner that an antiparallel β sheet layer composed of three β strands and an antiparallel sheet layer composed of four β strands overlap each other. In addition, the overlapping β sheet layers are cross-linked by disulfide bonds. In an antibody, a disulfide bond is very important in performing a specific reaction with a three-dimensionally complex antigen such as a protein.

In addition, the protein according to the present invention may include a β sandwich structure classified by a database that can be classified in order by structure such as sequence or structural motif. Examples of such a database include CATH (Protein Structure Classification Site) [http // www.biochem.ucl.ac.uk / latest / index.html]. And this includes a protein or domain containing a β-sandwich structure to be classified, its family or structurally similar protein or domain. For example, when expressed in terms of the T level (topology level) of the CATH site, Neurophysin II; Chain A, Cytochrome C Oxidase; Chain F, ATP Synthase; domain 1, Gamma-B Crystallin; domain 1, Electron Transport Ethylamine Dehydrogenase, Substrate Binding Domain Of DNAk; Chain A, domain 1, Immunoglobulin-like, Lipoxygenase-1, Adenovirus Type 5 Fiber Protein (Receptor Binding Domain), Tick-borne Encephalitis virus Glycoprotein; domain 1, Thaumatin, Jelly Rolls, Protocatechuate 3,4-Dioxygenase, subunit A, Bacteriophage G4 Capsid Proteins Gpf, Gpg, Gpj, subunit 1, Polyomavirus Vp1 ; Chain A, Tumor Suppressor Smad4, Apoptosis, Tumor Necrosis Factor Receptor Associated Protein 2; Chain A, Chondroitinase Ac; Chain A, domain 3, Viral Chemokine Inh Examples include ibitor; Chain A, Baculovirus p35, and the like.

-Β sandwich structure protein having no disulfide bond In the gold-binding protein of the present invention, a protein in which the antiparallel β sheet layers constituting the β sandwich structure are not cross-linked by a disulfide bond is used for the scaffold structure. That is, in the present invention, a β sandwich structure protein that does not naturally have a disulfide bond and exists stably in nature is selected as a material for obtaining a scaffold structure. On the other hand, when a disulfide bond is used in the scaffold structure to maintain the structure, a protein that maintains functional activity can be efficiently obtained by, for example, a mistake in the disulfide bond during the recombinant protein production process in microorganisms. May be difficult. This leads to higher cost than low productivity when attempting to mass-produce functionally active proteins such as sensor devices. In particular, it is remarkable when it consists of a plurality of domains and each domain has a disulfide bond that contributes to maintaining the structure. For example, bispecific antibody fragments (Diabodies) and the like may have very low productivity due to disulfide mistakes. In the present invention, since a β sandwich structure having no disulfide bond between at least β sheet layers is used for the scaffold structure, the reduction in production efficiency as described above can be prevented. That is, in the present invention, stability of protein molecules can be ensured, and further, the use of disulfide bonds is suppressed as much as possible, so that recombinant proteins having functional activity can be produced efficiently.

  The β sandwich structure is a β sandwich structure classified by CATH (Protein Structure Classification Site) or PDB (Protein Data Base). In addition, it can be a protein or domain that does not have a cysteine residue that forms a disulfide bond between antiparallel β sheet layers, a family or structurally similar protein or domain thereof. Examples include fibronectin type III domain, Trp RNA-Binding Attenuation Protein (Trap), E-Cadherin, Synaptotagmin I, and CBM4-2. The β sandwich structure can be configured by using one appropriately selected from the various proteins described above according to the intended use. For example, to improve the productivity by reducing the size of a domain having a gold binding site to a smaller size, select a β sandwich structure protein that does not have a disulfide bond between β sheet layers consisting of four or more β strands. I can do it. Examples thereof include Trp RNA-Binding Attenuation Protein (Trap). Furthermore, when it is desired to give more orientation on the sensor device, a protein having a plurality of loop motifs in one of the first or second loop group of the β sandwich structure as a gold binding site can be selected. Proteins that can bind to gold in two or more loops are preferred. Examples include fibronectin type III domain, Trp RNA-Binding Attenuation Protein (Trap), E-Cadherin, Synaptotagmin I, CBM, and the like. In addition, when the gold surface has a nanoscale fine shape, a fibronectin type III domain or CBM4-2 having a binding ability comparable to the specificity of the antibody can be selected. In addition, when the target molecule-binding ability is further added to the domain containing the gold-binding site or more stabilized by the second effector molecule, etc., the CBM family that is a non-active part of the sugar hydrolase and binds to the sugar is used. be able to. By using these, it is possible to impart gold-binding property and sugar-binding property to the protein, to stabilize the scaffold by sugar bonding, or to bind the target substance by a loop different from the gold-binding loop. The β sandwich structure may be any structure as long as the gold-binding protein can secure a certain space between the substrate and the target substance binding site, and may be modified by genetic engineering.

Gold-binding protein The gold-binding protein of the present invention is a protein having a β sandwich structure having no disulfide bond between β sheet layers as at least a part of the scaffold structure. Gold binding proteins in which the gold binding site is within the β sandwich structural unit are preferred. Further, a gold-binding protein in which at least a part of a loop motif (bent portion) in the β sandwich structure is a gold-binding site is further preferable. The dissociation constant (K _D ) of the protein of the present invention with respect to gold is 1 × 10 ⁻⁵ M or less, more preferably 1 × 10 ⁻⁷ M or less. In this case, it is preferable to use the buffer conditions in the presence of 0.1% Tween20. The inventors have confirmed in the examination by the present inventor that even a protein material, such as BSA, which is relatively nonspecifically adsorbed to gold by being in this dissociation constant range, cannot be adsorbed to gold. ing. If the _KD value is 1 × 10 ⁻⁵ M or less, it can be sufficiently distinguished from the adsorption behavior of the non-specifically adsorbing protein as described above, and is further 1 × 10 ⁻⁷ M or less. Can sufficiently function as an anchor molecule for immobilization. If the amino acid sequence with gold binding are arranged in a plurality of loops of gold-binding protein, as K _D values of the apparent gold-binding protein may satisfy the above K _D values.

  The β sandwich structure can be analyzed by protein crystal structure analysis or NMR. In addition, as a simple method, it is possible to distinguish the presence of β- and α-structures by the CD (circular dichroism) spectrum, the content of α-helix and β-sheet, and the parallel β-sheet and anti-parallel β-sheet by the Raman spectrum. is there. The presence or absence of disulfide bonds can be analyzed by Edman assay or the like. Furthermore, it is possible to predict the formation of β sandwich structure or disulfide bond from the amino acid sequence.

  It is known that a protein having a β sandwich structure existing in nature binds to a target substance through a plurality of loop motifs or β sheet sites located between antiparallel β sheets. In addition, techniques such as improving the binding force to the target substance by modifying a loop sequence not involved in the structure by genetic engineering have been developed. That is, it is suggested that the β sandwich structure mainly stabilizes the protein structure by the β structure composed of antiparallel β sheets, and that the loop motif is mainly involved in the binding to the target substance. In the gold-binding protein according to the present invention, the gold-binding amino acid sequence can be grafted on the loop motif (folded portion) of the β sandwich structure protein and modified to obtain gold-binding properties. Since an inorganic material such as a gold substrate has a very monotonous crystal structure as compared with a protein or the like, binding ability can be easily obtained by presenting a peptide having gold-binding properties obtained in advance by grafting to a scaffold structure. Grafting refers to substitution or insertion of an amino acid sequence by genetic engineering.

  In order to obtain the protein of the present invention, a loop motif (folded portion) recombinant library of β sandwich structure protein having no disulfide bond between β sheet layers produced using combinatorial chemistry technology can be used. In addition, a peptide display library having a random sequence can be used. That is, they can be used as a supplier for obtaining a β sandwich structure. From these libraries, proteins having gold-binding properties and peptides having gold-binding properties may be obtained by screening and used in the present invention. The number of amino acid sequences, the number of loops, and the loop position of the graft or recombination region are determined as appropriate, but the number and position are not limited as long as the scaffold structure can secure a certain space between the substrate and the target substance binding site. Preferably, it is desirable to provide a gold binding site in a loop motif (bent portion) that grows in one of the first loop groups of the β sandwich structure. More preferably, modification to a plurality of loops is preferable because stable orientation can be secured. The modified sequences may not be the same in a plurality of loops.

The amino acid sequence having gold binding property may be any amino acid sequence that binds specifically to gold and molecularly recognizes, and may have a secondary structure. As an amino acid sequence having gold-binding properties, an amino acid sequence that does not contain a cysteine residue is preferable because a multimer such as a disulfide bond dimer that is easily formed between cysteine residues is not formed. Particularly preferable sequences include the following sequences.
(1) Amino acid sequence of SEQ ID NOs: 1 to 62 described later (2) One or several amino acids in the amino acid sequence of SEQ ID NOs: 1 to 62 as long as the gold binding property of these amino acid sequences is not impaired An amino acid sequence obtained by performing deletion, substitution or addition of.
SEQ ID NO: 1; DYYMD
SEQ ID NO: 2; SIKQD GSETR YGDSV RG
SEQ ID NO: 3; ELDGG FFDF
SEQ ID NO: 4; GHWMH
SEQ ID NO: 5; RIDEH GSSAY YADSV NG
SEQ ID NO: 6; LGFIT PEVVH WSSDI
SEQ ID NO: 7; RFYWN
SEQ ID NO: 8; RIFTN GTTNY NPSLG S
SEQ ID NO: 9; GGDYG PALAW FDP
SEQ ID NO: 10; ESMVR DGMDV
SEQ ID NO: 11; GYYWT
SEQ ID NO: 12; DSSHS GRTNY N PSLK S
SEQ ID NO: 13; AEETV TIVP
SEQ ID NO: 14; SHYIH
SEQ ID NO: 15; GFIPI FGTSN YAEKF KG
SEQ ID NO: 16; PRRSS SSKTF SALDY
SEQ ID NO: 17; DYAMN
SEQ ID NO: 18; FIRSR GFGGT PEYAA
SEQ ID NO: 19; DYRPL QFWPG RQMDA FDI
SEQ ID NO: 20; SYWIN
SEQ ID NO: 21; MIYPA DSDTR YSPSF QG
SEQ ID NO: 22; LGIGG RYMSR
SEQ ID NO: 23; RYYIH
SEQ ID NO: 24; MINPR GGSTT YAQKF QG
SEQ ID NO: 25; ESMPG RDVRD GMDV
SEQ ID NO: 26; DHYIH
SEQ ID NO: 27; PNSGA TKYAQ KFHG
SEQ ID NO: 28; GILLA RLDV
SEQ ID NO: 29; NYAIS
SEQ ID NO: 30: GTLLM LRIIN SAQKF QG
SEQ ID NO: 31; ALPTS LGPIG YLHH
SEQ ID NO: 32; DYYMH
SEQ ID NO: 33; WINPN IGATN HAQRF QG
SEQ ID NO: 34; DLGIS AFEN
SEQ ID NO: 35; DYFMH
SEQ ID NO: 36; WINPN SGVTH YAQKF QG
SEQ ID NO: 37; ELITG RLPTD ND
SEQ ID NO: 38; GYYIH
SEQ ID NO: 39; WINPN TGGTN YAQKF QG
SEQ ID NO: 40; RSGGS GRYWG IKNNW FDP
SEQ ID NO: 41; WINPN SGVTH YAQKF QG
SEQ ID NO: 42; ELIAG RLPTD ND
SEQ ID NO: 43; DYYFH
SEQ ID NO: 44; WINPD SGGTN YAQKF QG
SEQ ID NO: 45; GSRYN SGWYY FDY
SEQ ID NO: 46; ISSPT
SEQ ID NO: 47; EIYHS GTSHH NPSLK N
SEQ ID NO: 48; LDFDS PLGMD A
SEQ ID NO: 49; RASQS ISTYL N
SEQ ID NO: 50; AASSL QS
SEQ ID NO: 51; QQSYS TPRT
SEQ ID NO: 52; RASED VNSWL A
SEQ ID NO: 53; GSTNL QG
SEQ ID NO: 54; KYFDA LPPVT
SEQ ID NO: 55; TSSQS LLYTS NNKNY LT
SEQ ID NO: 56; WASTR EF
SEQ ID NO: 57; QQYSD PPPT
SEQ ID NO: 58; MHGKT QATSG TIQS
SEQ ID NO: 59; LGQSG ASLQG SEKLT NG
SEQ ID NO: 60; EKLVR GMEGA SLHPA
SEQ ID NO: 61; ALVPT AHRLD GNMH
Sequence number: 62; LQATP GMKMR LSGAK EATPG MKMRL SGAKE ATPGM STTVA GL
It is preferable to arrange at least one of the amino acid sequences selected from (1) and (2) in the loop motif.

  Moreover, the repeating arrangement | sequence of said each arrangement | sequence can also be used. Furthermore, a repeating arrangement using different repeating units can also be used. Gold binding ability can be improved by repeating the arrangement. A DNA sequence encoding a gold-binding amino acid sequence can be used for producing a gold-binding protein.

  The amino acid sequence can be identified by mass spectrometry (PMF (Peptide Mass Fingerprint), MS / MS Ion Search, denovo sequence) or a protein sequencer.

  Even if the gold-binding protein forms a multimer, it may have different functional sites. In order to further stabilize the scaffold structure (β sandwich structure) of the gold-binding protein, a second effector may be added.

-Substrate A structure that can be used for various applications can be obtained from a gold-binding protein and a substrate on which at least part of the surface is made of gold. This substrate is formed by placing gold on at least a part of its surface, and any material and shape can be used as long as it can form the structure of the present invention. The portion other than the gold of the substrate may be made of any material as long as it can form a structure according to a desired application. For example, use one made of a material selected from one or more selected from metals, metal oxides, inorganic semiconductors, organic semiconductors, glasses, ceramics, natural polymers, synthetic polymers and plastics, or composites thereof. Can do. The shape of the substrate can be selected according to a desired application, and for example, any one or more shapes selected from a plate shape, a particle shape, a porous shape, a protrusion shape, a fiber shape, a cylindrical shape, and a mesh shape can be used. .

  Examples of the organic polymer compound for forming the portion other than gold of the substrate include those obtained by polymerizing a polymerizable monomer selected from the group. Examples of monomers include styrene polymerizable monomers such as styrene; acrylic polymerizable monomers such as methyl acrylate; methacrylic polymerizable monomers such as methyl methacrylate; methylene aliphatic monocarboxylic esters, vinyl esters such as vinyl acetate And vinyl polymerizable monomers such as vinyl ethers such as vinyl methyl ether and vinyl ketones such as vinyl methyl ketone.

Examples of inorganic solids include clay minerals such as kaolinite, bentonite, talc, mica; alumina, titanium dioxide, zinc oxide, magnetite, ferrite, NbTa composite oxide, WO ₃ , In ₂ O ₃ , MoO ₃ , Metal oxides such as V ₂ O ₅ and SnO ₂ ; Insoluble inorganic salts such as silica gel, hydroxyapatite and calcium phosphate gel; Metals such as silver, platinum and copper; Semiconductor compounds such as GaAs, GaP, ZnS, CdS and CdSe , Glass, silicon, or a composite thereof can be used.

  As the base part other than gold, the following can be used. Film made of plastic such as polyethylene terephthalate (PET), diacetate, tricetate, cellophane, celluloid, polycarbonate, polyimide, polyvinyl chloride, polyvinylidene chloride, polyacrylate, polyethylene, polypropylene, polyester, polyvinyl chloride, polyvinyl alcohol, acetyl Porous polymer film made of cellulose, polycarbonate, nylon, polypropylene, polyethylene, Teflon, wood board, glass board, silicon substrate, cotton, rayon, acrylic, silk, polyester, cloth, fine paper, medium paper, art paper Also, a film or sheet using paper such as bond paper, recycled paper, baryta paper, cast coated paper, cardboard paper, or resin coated paper can be used. These film-like and sheet-like materials may be smooth or uneven.

Furthermore, as the base part other than gold, a substrate made of silicon, silica, glass, quartz glass, or the like, and a minute flow path or a hole (hole) made on the substrate by a technique such as photolithography, etching, or sandblasting, or These are applied by a substrate and molding technology such as those with silver or platinum thin films, PDMS (polydimethylsiloxane), PMMA (polymethylmethacrylate), PET (polyethylene terephthalate) PC (polycarbonate) PS (polystyrene). Microchannels, holes (holes), carbon nanotubes, carbon nanohorns, fullerene diamonds or aggregates thereof, nanowhiskers made of alumina, carbon, fullerene, ZnO, etc., SiO ₂ , aluminosilicates, other metallosilicates, TiO 2 _2, S O _2, mesoporous thin film made of Ta ₂ O ₅ or the like, fine particles, and the monolith structures, silver, copper, fine particles such as platinum, magnetite, ferrite, hematite, gamma hematite, iron oxide particles such as maghemite, aluminum silicon mixed Examples thereof include a film and a silicon oxide nanostructure obtained by anodizing it, a porous alumina thin film, an alumina nanohole structure, and a silicon nanowire. Further, the size of the substrate of the present invention can be variously selected according to the intended use.

(2) Gold-binding single-domain monomer protein / gold-binding single-domain monomer protein having a target substance binding site The present invention is a gold-binding protein comprising a single domain and has at least a gold-binding site. And having a binding site for the target substance in the same domain. The gold binding site may be any site in a single domain, but is preferably at least a part of a loop motif (bent portion). In the gold-binding single domain monomer protein, a loop group having at least a gold binding site is referred to as a first loop group. An opposite loop group different from the first loop group is referred to as a second loop group. The order of the first and second loop groups is not specified only when the target substance is Au. Examples of the gold-binding single domain monomer protein include the following structures.
(A) a protein in which one or more loop motifs (bent portions) are gold binding sites, and one or more other loop motifs including the loop motif (bending portions) in the first loop group are target substance binding sites (FIG. 2 (a) configuration).
(B) One or more loop motifs (bent portions) are gold binding sites, and one or more loop motifs different from the first loop group including the gold binding sites having the loop motif are bound to the target substance. A protein as a site (configuration shown in FIG. 2B).
(C) A protein in which one or more loop motifs (bent portions) are gold binding sites and the target substance binding site is a site other than the first or second loop group (configuration shown in FIG. 2C).
Specific examples include sugar-binding proteins such as CBM (having a β sandwich structure), and are known to bind to sugars at β sheet sites. By using CBM as a scaffold structure and imparting gold-binding property to a loop motif, a gold-binding single domain monomer protein using sugar as a target substance is exemplified.

  In order to obtain a more precise orientation, the gold-binding single domain monomer protein shown in (b) is preferred. More preferably, the gold binding site is two or more loops. When binding to the target substance on the β sheet layer surface, for example, when using CBM, the configuration of FIG. 2C is preferable. A desired configuration can be appropriately selected from these configurations depending on the type of the target substance and the use of the gold-binding single domain monomer protein.

  The target substance-binding amino acid sequence of the target substance-binding site can be obtained from a β motif sandwich protein loop motif (folded part) recombinant library prepared using combinatorial chemistry techniques. That is, from this library, a β sandwich structure protein that specifically binds to a target substance is obtained by panning by a conventional technique and used as a gold-binding monomer protein having a target substance binding site. be able to. The number of amino acids, the number of loops, and the loop position in the recombination region can be determined as appropriate. Absent.

As for the gold-binding monomer protein described here, the dissociation constant (K _D ) for gold may be within the above-mentioned range.

-Substrate By combining the gold-binding single domain monomer protein according to the present invention with a substrate, a structure that can be used for various applications can be obtained. As the substrate that can be used for this purpose, those exemplified above for the gold-binding protein can be used.

-Target substance By configuring the gold-binding single domain monomer protein according to the present invention so as to include a part having a binding property to gold and a part having a binding property to the target substance, It can be used as a gold-binding single domain monomer protein for substance detection. As the target substance as the detection target, any molecule can be used as long as it is a substance that specifically binds. For example, target substances are roughly classified into non-biological substances and biological substances.

  Non-biological substances include the following. That is, PCBs having different chlorine substitution numbers / positions as environmental pollutants, dioxins having different chlorine substitution numbers / positions, so-called endocrine disrupting substances called environmental hormones (eg, hexachlorobenzene, pentachlorophenol, 2, 4, 5-trichloroacetic acid, 2,4-dichlorophenoxyacetic acid, amitrol, atrazine, alachlor, hexachlorocyclohexane, ethyl parathion, chlordane, oxychlordane, nonachlor, 1,2-dibromo-3-chloropropane, DDT, quercene, aldrin, endrin , Dieldrin, endosulfan (benzoepin), heptachlor, heptachlor epoxide, malathion, mesomil, methoxychlor, mirex, nitrophene, toxaphene, trifluralin, alkylphen (Carbon number 5-9), nonylphenol, octynonylphenol, 4-octylphenol, bisphenol A, di-2-ethylhexyl phthalate, butylbenzyl phthalate, di-n-butyl phthalate, dicyclohexyl phthalate, diethyl phthalate , Benzo (a) pyrene, 2,4-dichlorophenol, di-2-ethylhexyl adipate, benzophenone, 4-nitrotoluene, octachlorostyrene, aldicarb, benomyl, kipon (chlordecone), manzeb (mancozeb), manneb, methylam , Metribudine, cypermethrin, esfenvalerate, fenvalerate, permethrin, vinclozolin, dineb, diram, dipentyl phthalate, dihexyl phthalate, dipropyl phthalate), as examples of inorganic materials If Au, Pt, Pd, Ag, SiO2, Zeolites, ZnO, CaCO3, Cr2O3, Fe2O3, GaAs, ZnS, and the like.

  Biological materials include biological materials selected from nucleic acids, proteins, sugar chains, lipids, and complexes thereof. More specifically, it comprises a biomolecule selected from nucleic acids, proteins, sugar chains and lipids. Specifically, it contains a substance selected from DNA, RNA, aptamer, gene, chromosome, cell membrane, virus, antigen, antibody, lectin, hapten, hormone, receptor, enzyme, peptide, sphingosaccharide, and sphingolipid. It is a waste. Furthermore, bacteria and cells themselves that produce the above-mentioned “biological substances” can also be target substances as “biological substances” targeted by the present invention.

Specific proteins include so-called disease markers. Examples include the following: That is,
-An alpha-fetoprotein (AFP) that is produced by hepatocytes in the fetal period and is present in fetal blood and serves as a marker for hepatocellular carcinoma (primary liver cancer), hepatoblastoma, metastatic liver cancer, and Yorksack tumor ).
PIVKA-II, which is an abnormal prothrombin that appears at the time of liver parenchymal disorder and is confirmed to appear specifically in hepatocellular carcinoma.
BCA225 is a glycoprotein that is a breast cancer-specific antigen immunohistochemically and serves as a marker for primary advanced breast cancer and recurrent / metastatic breast cancer.
-Basic fetal protein found in human fetal serum, intestinal and brain tissue extracts, ovarian cancer, testicular tumor, prostate cancer, pancreatic cancer, biliary tract cancer, hepatocellular carcinoma, kidney cancer, lung cancer, stomach cancer, bladder cancer Basic fetoprotein (BFP), which is a marker for colon cancer.
CA15-3 which is a sugar chain antigen serving as a marker for advanced breast cancer, recurrent breast cancer, primary breast cancer, ovarian cancer, CA19 which is a sugar chain antigen serving as a marker for pancreatic cancer, biliary tract cancer, stomach cancer, liver cancer, colon cancer, ovarian cancer -9.
・ CA72-4, a carbohydrate antigen that is a marker for ovarian cancer, breast cancer, colorectal cancer, gastric cancer, pancreatic cancer, ovarian cancer (especially serous cystadenocarcinoma), endometrial adenocarcinoma, fallopian tube cancer, cervix CA125, which is a sugar chain antigen that serves as a marker for adenocarcinoma, pancreatic cancer, lung cancer, and colon cancer.
CA130 which is a glycoprotein serving as an epithelial ovarian cancer, fallopian tube cancer, lung cancer, hepatocellular carcinoma, pancreatic cancer marker.
CA602 which is a core protein antigen that serves as a marker for ovarian cancer (especially serous cystadenocarcinoma), endometrial adenocarcinoma, and cervical adenocarcinoma.
CA54 / 61 (CA546), a mother nucleus sugar chain-related antigen that serves as a marker for ovarian cancer (particularly mucinous cystadenocarcinoma), cervical adenocarcinoma, and endometrial adenocarcinoma.
Carcinoembryonic antigen that is currently most widely used to assist cancer diagnosis as a tumor-related marker antigen for colorectal cancer, stomach cancer, rectal cancer, biliary tract cancer, pancreatic cancer, lung cancer, breast cancer, uterine cancer, urinary tract cancer, etc. (CEA).
DUPAN-2, a sugar chain antigen that serves as a marker for pancreatic cancer, biliary tract cancer, hepatocellular carcinoma, gastric cancer, ovarian cancer, and colon cancer.
Elastase 1 is an exocrine pancreatic proteolytic enzyme that exists in the pancreas and specifically hydrolyzes the elastic fiber elastin of the connective tissue (which constitutes arterial walls and tendons), and serves as a marker for pancreatic cancer, pancreatic sac cancer, and biliary tract cancer .
・ Glycoprotein present in high concentrations in ascites and serum of human cancer patients, lung cancer, leukemia, esophageal cancer, pancreatic cancer, ovarian cancer, renal cancer, bile duct cancer, stomach cancer, bladder cancer, colon cancer, thyroid cancer, malignant Immunosuppressive acidic protein (IAP) that serves as a marker for lymphoma.
NCC-ST-439, which is a sugar chain antigen serving as a marker for pancreatic cancer, biliary tract cancer, breast cancer, colon cancer, hepatocellular carcinoma, lung adenocarcinoma, and stomach cancer.
Gamma-seminoprotein (γ-Sm), a glycoprotein that is a marker for prostate cancer, is a glycoprotein extracted from human prostate tissue and is only present in the prostate tissue, and therefore is a prostate cancer marker Specific antigen (PSA).
Prostatic acid phosphatase (PAP), an enzyme that hydrolyzes phosphate esters under acidic pH secreted from the prostate and is used as a tumor marker for prostate cancer.
・ Glycolytic enzyme that exists specifically in nerve tissue and neuroendocrine cells, lung cancer (especially lung small cell carcinoma), neuroblastoma, nervous system tumor, pancreatic islet cancer, esophageal small cell carcinoma, stomach cancer, kidney Nerve specific enolase (NSE), which is a marker for cancer and breast cancer.
・ A protein extracted and purified from liver metastases of cervical squamous cell carcinoma, which is a marker of uterine cancer (cervical squamous cell carcinoma), lung cancer, esophageal cancer, head and neck cancer, and skin cancer. Antigen (SCC antigen).
-Sialyl LeX-i antigen (SLX) which is a sugar chain antigen serving as a marker for lung adenocarcinoma, esophageal cancer, stomach cancer, colon cancer, rectal cancer, pancreatic cancer, ovarian cancer, uterine cancer.
SPan-1, which is a sugar chain antigen that serves as a marker for pancreatic cancer, biliary tract cancer, liver cancer, gastric cancer, and colon cancer.
・ Esophageal cancer, gastric cancer, rectal / colon cancer, breast cancer, hepatocellular carcinoma, biliary tract cancer, pancreatic cancer, lung cancer, uterine cancer marker, especially in combination with other tumor markers to predict advanced cancer, progress of recurrence Tissue polypeptide antigen (TPA), a single-chain polypeptide that is useful as an observation.
-Sialyl Tn antigen (STN), which is a mother sugar sugar antigen that is a marker for ovarian cancer, metastatic ovarian cancer, stomach cancer, colon cancer, biliary tract cancer, pancreatic cancer, and lung cancer.
Cytokeratin (CYFRA) which is an effective tumor marker for detecting non-small cell lung cancer, particularly squamous cell carcinoma of the lung.
・ Inactive precursors of two types of pepsin (PG I and PG II), protein digestive enzymes secreted into the gastric juice, including gastric ulcers (especially lower gastric ulcers), duodenal ulcers (especially relapsed and refractory cases), Brunnell Pepsinogen (PG) is a marker for adenoma, Solinger-Ellison syndrome, and acute gastritis.
C-reactive protein (CRP), which is an acute phase reaction protein that changes in plasma due to tissue damage or infection, and shows a high value when necrosis occurs in the myocardium due to acute myocardial infarction or the like.
Serum amyloid A protein (SAA), an acute phase reaction protein that changes in plasma due to tissue damage or infection.
Myoglobin which is a heme protein having a molecular weight of about 17500 mainly present in the heart muscle and skeletal muscle and serves as a marker for acute myocardial infarction, muscular dystrophy, polymyositis and dermatomyositis.
-An enzyme that exists mainly in the soluble fraction of skeletal muscle and myocardium and is released into the blood by cell damage, and is a marker for acute myocardial infarction, hypothyroidism, progressive muscular dystrophy, and polymyositis Creatine kinase (CK). This includes CK-MM type derived from skeletal muscle, CK-BB type derived from brain and smooth muscle, CK-MB type derived from myocardium, and CK (macro conjugated with mitochondrial isozymes and immunoglobulins). CK).
A protein with a molecular weight of 39,000 that forms a troponin complex with troponins I and C on thin filaments of striated muscle and is involved in the regulation of muscle contraction. Rhabdomyolysis, myocarditis, myocardial infarction Troponin T, a marker of renal failure.
・ Protein contained in both skeletal muscle and myocardial cells, and an increase in measurement results means damage or necrosis of skeletal muscle or myocardium. Therefore, ventricular myosin is a marker for acute myocardial infarction, muscular dystrophy, and renal failure. Light chain I.
In addition, chromogranin A, thioredoxin, 8-OhdG, and the like that have recently been attracting attention as stress markers.

(3) Gold-binding complex protein / gold-binding complex protein having a target substance-binding site The present invention includes two or more domains, and one or more domains having the above-structured gold-binding protein . It is a composite protein having a first domain containing a gold-binding protein having the above structure and a second domain containing a protein having a binding site for a target substance. Examples of the gold-binding complex protein include the following structures (FIG. 3).
(A) A configuration in which the first domain and the second domain form one polypeptide chain (configuration described in FIG. 3 (1)).
(B) A configuration comprising one polypeptide chain including at least a first domain and a second domain. The configuration described in FIG. 3 (the configuration described in FIGS. 3 (3) and (4)).
(C) A configuration in which a part of the first domain and a part of the second domain form a single polypeptide chain, and a part of the other part of the second domain forms a multimer (see FIG. 3 (2)). Description configuration).

  The protein as a component of the gold-binding complex protein includes at least one (poly) peptide chain formed by combining at least two or more amino acids. These polypeptide chains are folded so as to form a specific three-dimensional structure to form a molecule that can exhibit a unique function (conversion, molecular recognition, etc.). The gold-binding complex protein of the present invention has one or more binding sites for gold and one or more binding sites for gold or a substance other than gold as a target substance, and exhibits multivalent or multispecific binding properties. A complex protein, a complexed protein comprising at least:

  The polypeptide chain length linking the first domain and the second domain can be appropriately selected. Any sequence may be used as long as the function of each domain is not lowered.

  The second domain that is the target substance binding site may have any structure. For example, the structure is not limited as long as it can specifically bind to a target substance such as a β structure, an α structure, an α / β structure, or an α + β structure. Examples of the scaffold structure of the second domain include the following. That is, antibody fragments (VH, VL, Fv, scFv, Fab, VHH, etc.), APPI (Alzheimer's amyloid β-protein precursor inhibitor), AR (Ankyrin repeat), BPTI (bovine pancreatic trypsin inhibitor), CBD (cellulose-binding domain) ), CBM4-2 (carbohydrate-binding module 4 of family 2 of xylanase from Rhodothermus marinus), CI2 (chymotorypsin inhibitor 2), CTLA-4 (cytotoxic T-lymphocyte-associated antigen 4), EETI II (Ecballium elaterium trypsin inhibitor II) ), 10FN3 (tenth fibronectin type III domain), hPSTI (human pancreatic secretary trypsin inhibitor), Im9 (immunityprotein 9), LACI-D1 (human lipoprotein-associated coagulation inhibitor domain 1), LDTI (leech-derived trypsin inhibitor), MTI II (mustard trypsin inhibitor 2), PHD finger (plant homeodomain finger), pVIII (protein VIII of filamentous bacteriophage), SH2 (src homology domain 2), SH3 (src homology domain 3), TPR (tetratricopeptide repeat), Tedamistat, Neocarzinostatin, T-cell receptor, Lipocallins, protein A domain, Zinc finger, GCN4, WW domain, PDZ domains, TEM-1 β-l Examples include actamase, GFP, Thioredoxin, Staphylococcal nuclease, Ecotin, Scorpion toxins, Insect defensin A, γ-crystallins, Ubiquitin, transfer, C-type lectin-like domains, and low-density lipoprotein receptor domain A.

Antibody fragments may be used for the target substance binding site, but preferably, the first domain containing the gold binding site interacts with the domain to reduce both binding activities, or the production of the gold-binding complex protein itself. It is desirable that the domain structure does not deteriorate the property. More preferably, the domain having a target substance binding site is also a domain containing a structure having no disulfide bond in the scaffold structure. More preferably, it is a domain including a β sandwich structure having no disulfide bond between β sheet layers. The target substance-binding amino acid sequence used for the target substance-binding site of the second domain can also be obtained from a β motif sandwich protein loop motif (folded part) recombinant library prepared using combinatorial chemistry techniques. That is, a β sandwich structure protein having a binding property to a target substance specifically from this recombinant library can be obtained by panning and used. The number of amino acids, the number of loops, and the loop position in the recombination region can be determined as appropriate. Absent. It can also be produced by grafting the CDR sequence of an antibody to the scaffold structure of the second domain. More preferably, a fibronectin type III domain is grafted as a scaffold in order to exhibit a conformation very close to that of an antibody. In addition, the gold binding complex protein described here can employ a dissociation constant (K _D ) for gold within the above-mentioned range.

  As the substrate and the target substance, those described above can be adopted.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further more concretely, the scope of the present invention is not limited to a following example.

  The present disclosure demonstrates binding activity retention on a gold substrate by obtaining a gold-binding protein and imparting a fine orientation. In the following examples, a fibronectin type III 10th β sandwich structure is used as a scaffold structure having a gold binding site. Further, a HyHEL10scFv antibody fragment is used as a target substance binding site, and soluble chicken egg white lysozyme (HEL; Seikagaku Corporation code No. 100940) is used as a target substance. The recombinant DNA method described below is performed based on Molecular Cloning: Experimental Manual Second Edition Cold Spring Harbor Laboratory, New York (1989), written by Sambrook et al. For constructing the expression vector, construct a construct using the signal sequence pelB for E. coli secretion expression and the vector pET-20b (+) Vector (Novagen Cat. No. 69739-3) with His tag sequence for purification. it can. The above vector is also used as a subcloning vector for construct production.

  The chemicals used in the examples are analytical grade or higher unless otherwise specified, and can be purchased from Sigma and Nacalai Tesque. Custom oligo DNA can be purchased from Sigma Genosys, Ltd., and restriction enzymes and modification enzymes can be purchased from Takara Bio Inc.

Example 1
"Design and construction of a construct for secretory expression by E. coli to obtain a protein with caking properties"
Fibronectin TypeIII 10th β-sandwich structure is used for the scaffold structure of gold-binding protein, and the gold-binding amino acid sequence is graft modified to the BC loop and FG loop (J. Mol. Biol. (1998) 284, 1141). And build. The primer shown in FIG. 8 is used. Finally, a DNA fragment for expressing the target protein can be reintroduced into a vector that can be secreted in E. coli and has a purification tag sequence, and the target protein can be designed and constructed.

The DNA sequence of Fibronectin Type III 10th is known (accession number BX640803 (DNA sequence number 4870-5160)). Thus, for example, a synthetic oligonucleotide can be designed and a DNA sequence encoding Fibronectin Type III 10 ^th can be obtained by PCR and ligation (Sambrook et al., 1989, supra). The DNA and amino acid sequences are shown in FIG. The underlined region in FIG. 4 is a region that forms a β sheet, and is named A, B, C, D, E, F, and G from the N terminal. Moreover, the loop site | part grafted especially by the loop between each (beta) sheet | seat is shown (BC loop, FG loop). Finally, PCR is performed using primers (primer sequences 1 and 2) for introducing an EcoRV site at the 5 ′ end and a BamHI site at the 3 ′ end to obtain a terminal EcoRV / BamHI fragment of Fibronectin TypeIII 10 ^th .

First, the pET-20b (+) vector is cleaved with EcoRV and BamHI and ligated for subcloning a protein gene having gold-binding properties. Fibronection Type III 10 ^th in the above pET-20b (+) vector is used as a wild-type expression construct not grafted with a gold-binding amino acid in a later example in a control experiment. Next, a gold-binding amino acid sequence (gold-binding sequence 20) having the following sequence is grafted into the BC loop of the fibronectin gene in the vector, and a gold-binding amino acid sequence (gold-binding sequence 22) is grafted into the FG loop.
Gold bonding array 20:
DNA sequence: TCTTACTGGATCAAC
Amino acid sequence: SYWIN
Gold bonding arrangement 22:
DNA sequence: CTCGGTATTGGCGGTCGCTACATGAGCAGA
Amino acid sequence: LGIGGRYMSR
The method of introduction is as follows. First, a primer (primer sequence 1, 2) for amplifying a fragment containing the 5 'side of the BC loop to be grafted and introducing an EcoRV site into the 5' end of the fibronectin gene, a fragment between the BC loop and the FG loop A primer for amplifying a fragment (primer sequence 3, 4) and a fragment containing the 5 'side of the FG loop to be grafted and a primer for introducing a BamHI site at the 3' end of the fibronectin gene (primer sequence 5, Perform each first PCR using 6) as each set. Next, a synthetic oligonucleotide (primer sequence 7) containing DNA encoding the gold-binding amino acid sequence (sequence 20 supra) and containing the 5 'and 3' sequences of the BC loop and the gold-binding amino acid sequence (sequence 22 A second time using a synthetic oligonucleotide (primer sequence 8), a primer (primer sequence 1) and a primer (primer sequence 6) containing DNA encoding FG loop and containing sequences on the 5 'and 3' sides of the FG loop Perform PCR. Thereafter, it is cleaved with EcoRV and BamHI restriction enzymes (FIG. 7).

On the other hand, pET-20b (+) keep vector was cleaved similarly with EcoRV and BamHI, and the Fibronectin TypeIII 10 ^th EcoRV / BamHI fragment and the connection to the gold-binding protein expression constructs Plasmid grafted with the gold binding sequence get.

  In order to confirm the DNA sequence of the constructed construct and to amplify the plasmid, the prepared plasmid is transformed into E. coli JM109, and then cultured in ampicillin (100 μg / ml) selective LB medium at 37 ° C. for one day, and the plasmid can be recovered from E. coli. A part of the DNA sequence can be confirmed by a DNA sequencer.

(Example 2)
"Protein expression and purification"
The construct encoding the protein having gold-binding property prepared in Example 1 was transformed into E. coli BL21 (DE) strain (Cat No. 69450-4 Novagen), and 30 in ampicillin (100 μg / ml) selective LB medium. Incubate at ℃ 16 hours. The final concentration of 1 mM IPTG is added and further cultured for 16 hours to induce protein expression. The cells recovered by centrifugation are treated with osmotic pressure (mixed with 0.5M sucrose solution and added with 5 times the amount of pure water). And it crushes with a French press and the target protein which exists in the periplasm of E. coli is obtained as a solubilized fraction. The expression of about several tens mg / l can be confirmed. For purification, the following two purifications are performed. First, the target protein is purified using a His column (His Bind Purification Kit Cat. No. 70239-3 (Novagen): the purification procedure conforms to the attached protocol). Finally, using a column for gel filtration chromatography (Superose12 10 / 300GL (Amersham)) and using a gel filtration device (AKTA explorer 10S (Amersham)) to obtain a protein with a gold-binding property of 95% purity. it can.

  Western analysis using His-tag detection antibody (Anti-His (C-term) -HRP Antibody anti-His (C-term) -HRP antibody Cat.No. R931-25 Invitrogen) (ECL Plus Western Blotting Starter Kit Full II Cat. No. 72-AS00-47 Amersham).

(Example 3)
"Binding assay by molecular recognition on gold substrate"
Evaluation of the binding ability of the gold-binding protein obtained in Example 2 to the gold substrate can be performed using BIAcoreX (SPR measuring device). First, a gold surface sensor chip (SIA kit Au Cat. No. BR-1004-05) manufactured by BIAcore is washed by the following procedure. First, after being immersed in concentrated hydrochloric acid all day and night, the hydrochloric acid is thoroughly washed away with ultrapure water, and then immersed in acetone, IPA (isopropanol), and ultrapure water for 15 minutes each while applying ultrasonic waves. Finally, transfer the sensor chip to new ultrapure water and dry it with N2 gas before starting SPR measurement. The protein having gold-binding properties obtained in Example 2 is adjusted with PBS-T (0.1% Tween20) buffer so that the final molar concentration is 50 nM, 200 nM, or 500 nM. Nonspecific adsorption to the gold surface is suppressed by adding 0.1% of the surfactant Tween20. That is, binding (adsorption) to a gold substrate other than gold-binding amino acids can be suppressed, and binding by molecular recognition can be evaluated. A gold surface sensor chip is set in BIAcoreX (SPR measuring device), PBS-T buffer is allowed to flow, and proteins having gold-binding properties at various concentrations are sequentially bound. By this operation, the dissociation constant for the gold surface (Kd = dissociation rate (koff) / binding rate (kon)) is calculated (Table 1). As a result, a very fast binding rate and a very small dissociation constant can be obtained. The coverage on the gold surface is as high as 90%. As a control experiment, a protein not grafted with a gold-binding sequence (fibronectin Type III 10 ^th ) is similarly evaluated, and the dissociation constant is three orders of magnitude lower. That is, according to the above examples, it can be demonstrated that the gold surface specifically binds to the gold surface through the gold-bonded amino acid and the orientation is very good. In addition, since kon is very large and koff is small, it is possible to efficiently place a protein on a gold substrate in a short time with a protein having a low concentration of gold binding.

Example 4
"Design and construction of a secretory expression construct by E. coli to obtain a gold-binding complex protein"
First, a gold-binding complex protein is designed as follows. Fibronectin Type III 10 ^th protein is used for the first domain having a gold binding site of the gold binding complex protein. Then, HyHEL10scFv (Biophysical Journal Vol. 83, 2946-2968 (2002)), which is a fragment of an anti-HEL antibody, is used for the second domain having a target substance binding site. Both domains are linked by a (G4S) 3 linker (G; glycine, S: serine) shown in FIG. The linker sequence can be synthesized. Since the DNA sequence of HyHEL10 scFv is known, for example, a synthetic oligonucleotide can be designed and a DNA sequence encoding HyHEL10 scFv can be obtained by PCR and ligation (Sambrook et al., 1989, supra). DNA and amino acid sequences are shown in FIG. First, a synthetic oligonucleotide is prepared in which a SacI site is introduced at the 5 ′ end of a DNA sequence encoding a (G4S) 3 linker and a HindIII site is introduced at the 3 ′ end (linker sequence 1 FIG. 6 above). Also, a synthetic oligonucleotide is prepared in which a HindIII site is introduced at the 5 ′ end of the DNA sequence encoding HyHEL10scFv and a NotI site is introduced at the 3 ′ end (see FIG. 7).

  The E. coli expression construct plasmid constructed in Example 1 is cleaved with SacI and HindIII, and ligated with a (G4S) 3 linker (linker sequence 1 shown in FIG. 6 above). Next, after digestion with HindIII and NotI, it is ligated with the HyHEL10scFv antibody fragment having HindIII and NotI ends to obtain an E. coli expression construct plasmid of the gold-binding complex protein. In order to confirm the DNA sequence of the constructed construct and to amplify the plasmid, the prepared plasmid is transformed into Escherichia coli JM109, and then cultured in ampicillin (100 μg / ml) selective LB medium at 37 ° C. for one day to extract the plasmid from Escherichia coli. A part of the DNA sequence can be confirmed by a DNA sequencer. For protein expression and purification, affinity purification by HEL column can be added between His purification and gel filtration in Example 2. As a result, an expression level of several mg / l is obtained. The HEL column is obtained by adsorbing and fixing HEL to CNBr-activated Sepharose 4B Code No. 17-0430-01 (Amersham) (fixation and purification comply with the attached protocol).

(Example 5)
"Target substance binding assay with gold-binding complex protein on gold substrate"
The target substance binding ability of the gold-binding complex protein obtained in Example 4 on the gold substrate can be evaluated using BIAcoreX (SPR measuring device). First, a gold surface sensor chip (SIA kit Au Cat. No. BR-1004-05) manufactured by BIAcore is washed by the following procedure. First, after being immersed in concentrated hydrochloric acid all day and night, the hydrochloric acid is thoroughly washed away with ultrapure water, and then immersed in acetone, IPA (isopropanol), and ultrapure water for 15 minutes each while applying ultrasonic waves. Finally, transfer the sensor chip to new ultrapure water and dry it with N2 gas before starting SPR measurement. The gold-binding complex protein obtained in Example 4 is adjusted with PBS-T (0.1% Tween 20) buffer so that the final molar concentration is 500 nM. Nonspecific adsorption to the gold surface is suppressed by adding 0.1% of the surfactant Tween20. That is, binding (adsorption) to a gold substrate other than gold-binding amino acids can be suppressed, and binding by molecular recognition can be evaluated. The gold surface sensor chip is set in BIAcoreX (SPR measuring device), PBS-T buffer is flowed, and gold-binding complex protein is bound. Next, after blocking with a casein solution, a target substance HEL solution adjusted with a PBS-T (0.1% Tween 20) buffer so as to have final molar concentrations of 50 nM, 200 nM, and 500 nM is allowed to act. Then, the dissociation constant of the target substance for the gold-binding complex protein is calculated (Table 2). As a result, the dissociation constant is very small, and the residual binding rate of the complex protein on the gold substrate is as high as 80%. The binding residual ratio indicates the ratio of the number of bound target substances to the number of immobilized protein molecules. It can be proved that the target substance binding site has a very small influence on the gold surface due to the scaffold structure of the complex protein that is densely oriented on the gold substrate and has binding activity. Furthermore, since it has a high orientation with respect to the substrate, the reproducibility is good (Table 2). Furthermore, since the binding speed kon of the complex protein to the gold substrate is very large and the koff is small as in Example 3, the protein is efficiently placed on the gold substrate in a short time with a low concentration of the gold-binding complex protein. Can do. Therefore, it is possible to simplify the manufacturing process without requiring conventional protein modification or immobilization treatment on a gold substrate for immobilization, and it is possible to reduce the production cost compared to immobilization in a low concentration and in a short time. Expected to be used for biosensors with good reproducibility.

(Example 6)
"Target substance binding assay 2 with gold-binding complex protein on a gold substrate"
It demonstrates that a gold-binding complex protein having a Kd ≦ 1 × 10 ⁻⁵ M binding property to gold is useful as a sensor. As the protein, the gold-binding complex protein produced in Example 4 in which the binding property to gold is Kd ≦ 1 × 10 ⁻⁵ M and the wild-type fibronectin complex protein having Kd> 1 × 10e-5M are used. The wild-type fibronectin complex protein is obtained by linking HyHEL10scFv protein to the wild-type fibronectin protein as a target substance binding site, and can be obtained by the method described in Example 4. Act on gold surface as described in Example 5. Then, it reacts with the target substance HEL adjusted to several kinds of concentrations, and the correlation between each target substance concentration and SPR signal intensity is evaluated. As a result, the gold-binding complex protein has a good positive correlation with the concentration of the target substance, functions sufficiently as a sensor, and the effect of the present invention can be expected. On the other hand, the wild type fibronectin complex protein cannot obtain a good correlation. As a reason why such a good correlation cannot be obtained, it is expected that the binding to the target substance cannot be detected correctly because there are many proteins that dissociate from the gold surface with a large Kd value.

It is a conceptual diagram of a β sandwich structure. It is a figure which shows the structure of a gold bond single domain monomer protein. It is a figure which shows the structure of a gold-binding complex protein. It is a figure which shows the amino acid sequence and DNA sequence of a fibronectin type III domain. It is a figure which shows the DNA sequence of HyHEL10scFv. It is a figure which shows a linker sequence. It is a figure which shows the graft introduction method of the gold bond amino acid to a fibronectin type III domain gene. It is a figure which shows a primer arrangement | sequence.

Claims (7)

A protein having a binding property to gold, wherein the protein has a β sandwich structure in which at least a β sheet layer formed of antiparallel β sheets forms two or more layers, and the layers are not cross-linked by a disulfide bond. And a dissociation constant Kd of the protein for gold satisfies Kd ≦ 1 × 10 ⁻⁵ M.   The protein according to claim 1, wherein the β sandwich structure has a gold binding site.   The protein according to claim 2, wherein the gold binding site has at least one loop motif constituting the anti-parallel β sheet of the β sandwich structure. The loop motif is
(1) the amino acid sequence of SEQ ID NOs: 1 to 62, and (2) one or several amino acids to the amino acid sequence of SEQ ID NOs: 1 to 62 as long as the gold binding properties of these amino acid sequences are not impaired An amino acid sequence obtained by performing deletion, substitution or addition of
4. The protein of claim 3, comprising at least one amino acid sequence selected from.   The protein according to claim 1, wherein the protein is composed of a single domain, and the domain has a binding site with gold and a binding site with a target substance.   The protein according to claim 1, wherein the protein is a complex protein having a domain having a β sandwich structure having a binding site with gold and a domain having a binding site with a target substance.   A structure for capturing a target substance, wherein a protein having a binding property to a target substance is immobilized on a substrate, wherein the substrate includes gold on at least a part of a surface, and the protein is any one of claims 5 and 6. A structure for capturing a target substance, which is the protein described in 1.

Images