JP2007121282A - Method for detecting bacteria and identifying gram-positive/negative bacteria - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a bacteria detecting method, whose detection speed and sensitivity are equal to or higher than those of conventional bacteria detecting methods, and which can accurately detect bacteria, even in a sample that contains a material having the potential of affecting the detection and can identify the Gram staining properties of the detected bacteria. <P>SOLUTION: The method uses a fusion protein that is of a reporter protein and a protein which bonds to the cell wall of the bacteria, and can conduct depending on the presence of the processing for increased permeability of the outer membrane of a Gram-negative bacteria, thereby detecting a Gram-positive bacteria and the Gram-negative bacteria, or detecting only the Gram-negative bacteria. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a method for performing bacterial detection and discriminating whether a detected bacterium is a gram positive bacterium or a gram negative bacterium.

  Microorganisms such as bacteria are tested in many situations such as food manufacturing sites, pharmaceutical manufacturing sites, environmental microbiological tests in hospitals, pools, baths, etc., microbiological contamination testing in foods and pharmaceuticals, and infectious diseases in medical settings. Necessary inspection. In particular, it is a very important test in the field of environmental sanitation, food sanitation and medical care.

  Conventionally, microbiological tests have been performed by growing live cells using a nutrient medium and detecting them, but this method requires a certain number of days before the microbes can grow and become detectable. There was a problem.

ATP (adenosine triphosphate) is an energy substance present in all living things such as animals, plants, and microorganisms. Currently, ATP is measured by a method of measuring light emitted by reacting ATP with luciferin which is a luminescent substrate in the presence of luciferase (see Non-Patent Document 1). Luminescence is generated by the following reaction in the presence of luciferase and a divalent metal ion (Mg ²⁺ , Mn ^2+, etc.).
Luciferin + ATP + O ₂ + H ₂ O → oxyluciferin + AMP + PPi + CO ₂ + light ).
DeLuca, M., and McElroy, WD, Kinetics of the firefly luciferase catalyzed reactions.Biochemistry, 26, 921-925 (1974). Bautista, DA, Vaillancourt, JP, Clarke, RA, Renwick, S., and Griffiths, MW, Adenosine triphosphate bioluminescence as a method to determine microbial levels in scald and chill tanks at a poultry abattoir.Poult.Sci., 73, 1673 -1678 (1994).

  However, although the above-described bacterial detection method using the bioluminescence method using luciferin / luciferase is a very rapid and sensitive method, there is a problem that ATP other than bacteria is also detected. That is, when ATP not derived from bacteria (for example, extracellular ATP or ATP derived from cells other than bacteria) is present in the sample, it is problematic that an accurate result cannot be obtained as the number of bacteria. It was.

  Bacteria are classified into Gram-positive bacteria and Gram-negative bacteria, which is the first item indispensable for bacterial identification. This classification is also an index for selecting antibacterial agents. Gram positive / negative discrimination can actually be performed by applying Gram staining to bacteria, but it requires more than 12 steps and three special reagents. Required. Naturally, the bacteria detection method using the above-mentioned luciferin / luciferase bioluminescence method cannot distinguish between gram-positive bacteria and gram-negative bacteria.

  Therefore, development of a bacteria detection method that can simultaneously solve the above two problems is desired.

  The present invention has been made in view of the above-mentioned problems, and its purpose is to have a speed and sensitivity equivalent to or better than those of conventional bacterial detection methods using a bioluminescence method using luciferin / luciferase, and for detection. It is an object of the present invention to provide a bacteria detection method that can accurately detect bacteria even in a sample containing a substance that may have an effect and that can identify the Gram stainability of the detected bacteria.

  As a result of intensive studies to solve the above problems, the present inventor has found that a fusion protein of an autolytic enzyme derived from Staphylococcus aureus and a green fluorescent protein (GFP) or luciferase functions as a reporter protein. And found that the fusion protein can also bind to the cell wall of Gram-negative bacteria that have been treated to enhance permeability of the outer membrane. The invention has been completed.

  That is, the method according to the present invention is a method for detecting bacteria in a sample and discriminating whether the detected bacteria are gram-positive or gram-negative, and comprises a protein and a reporter that bind to the bacterial cell wall. It is characterized by using a fusion protein with a protein.

  In addition, the method according to the present invention includes a contact step of bringing a bacterium in a sample into contact with the fusion protein; and a counting step of measuring the number of bacteria using a reporter protein in the fusion protein as an index. In addition, when the permeation enhancement process step of the outer membrane of gram-negative bacteria in the sample is performed, all bacteria in the sample are detected, and when the permeation enhancement process step is not performed, gram positive in the sample is detected. It is characterized by detecting only bacteria.

  In the method according to the present invention, it is preferable to further include a recovery step of recovering bacteria to which the fusion protein is bound before the counting step.

  In the method of the present invention, the dissociation constant Kd between the fusion protein and the bacterial cell wall is preferably 100 nM or less, and more preferably 10 nM or less.

  In the method according to the present invention, the protein that binds to the bacterial cell wall is preferably derived from a bacterial autolytic enzyme, and more preferably from a Staphylococcus aureus autolytic enzyme.

  The cell wall-binding protein derived from Staphylococcus aureus autolytic enzyme includes a protein consisting of the amino acid sequence shown in SEQ ID NOs: 1 to 3 and the amino acid sequence shown in SEQ ID NOs: 1 to 3 It is preferable that at least one selected from proteins consisting of amino acid sequences in which one amino acid is deleted, substituted or added, a protein consisting of the amino acid sequence shown in SEQ ID NO: 4, and a sequence shown in SEQ ID NO: 4 More preferably, the amino acid sequence is selected from proteins consisting of amino acid sequences in which one or several amino acids are deleted, substituted or added.

  In the method according to the present invention, the reporter protein is preferably selected from fluorescent protein, luciferase, beta galactosidase, diaphorase, alkaline phosphatase, and peroxidase.

  The reagent composition according to the present invention is a reagent composition that detects bacteria in a sample and discriminates whether the detected bacteria are gram positive or gram negative, and binds to the bacterial cell wall. It includes a fusion protein of a protein and a reporter protein.

  In the reagent composition according to the present invention, the dissociation constant Kd between the fusion protein and the bacterial cell wall is preferably 100 nM or less, more preferably 10 nM or less.

  In the reagent composition according to the present invention, the protein that binds to the bacterial cell wall is preferably derived from a bacterial autolytic enzyme, and more preferably from a Staphylococcus aureus autolytic enzyme. preferable.

  The cell wall-binding protein derived from Staphylococcus aureus autolytic enzyme includes a protein consisting of the amino acid sequence shown in SEQ ID NOs: 1 to 3 and the amino acid sequence shown in SEQ ID NOs: 1 to 3 It is preferable that at least one selected from proteins consisting of amino acid sequences in which one amino acid is deleted, substituted or added, a protein consisting of the amino acid sequence shown in SEQ ID NO: 4, and a sequence shown in SEQ ID NO: 4 More preferably, the amino acid sequence is selected from proteins consisting of amino acid sequences in which one or several amino acids are deleted, substituted or added.

  In the reagent composition according to the present invention, the reporter protein is preferably selected from fluorescent protein, luciferase, beta galactosidase, diaphorase, alkaline phosphatase, and peroxidase.

  The Gram-positive / negative bacteria identification / detection kit according to the present invention is characterized by comprising the reagent composition according to the present invention.

  If the method, reagent composition, and kit according to the present invention are used, there is an effect that bacteria can be detected in a short time without requiring complicated operations and Gram positive / negative of the detected bacteria can be identified.

  In addition, the conventional method has an effect that the target bacteria can be detected with high sensitivity and accuracy even when a sample containing a factor that causes a decrease in detection sensitivity is used.

  The method according to the present invention is a method for detecting bacteria in a sample and discriminating whether the detected bacteria are gram-positive or gram-negative, comprising a protein that binds to the bacterial cell wall and a reporter protein Any fusion protein may be used.

  The reagent composition according to the present invention is a reagent composition for detecting bacteria in a sample and identifying whether the detected bacteria are gram positive or gram negative. What is necessary is just to contain the fusion protein of the protein and reporter protein to couple | bond.

  Gram-positive bacteria is a general term for bacteria that are not decolorized by acetone treatment in Gram staining reaction, and typical gram-positive bacteria include lactic acid bacteria, actinomycetes, Bacillus subtilis, Staphylococcus genus, Streptococcus genus and the like. Gram-negative bacteria are a general term for bacteria that are not stained with Gram staining but stain with counterstaining, and typical Gram-negative bacteria include Escherichia coli, Salmonella, Pseudomonas genus, and the like.

  First, a fusion protein of a protein that binds to the bacterial cell wall and a reporter protein will be described.

[Fusion protein of protein that binds to bacterial cell wall and reporter protein]
As used herein, the term “protein” is used interchangeably with “polypeptide” or “peptide”. “Proteins” include partial fragments of proteins. The “protein” includes a fusion protein. A “fusion protein” is a protein in which some or all of two or more heterologous proteins are combined.

  Any protein that binds to the bacterial cell wall (hereinafter referred to as “cell wall-binding protein”) can be used as long as it can bind to the bacterial cell wall. Proteins that can be (attached) are not included. In addition, it is not necessary to be able to bind to the cell walls of all bacteria, and it may be possible to bind to the cell walls of some bacteria.

  The cell wall-binding protein is obtained by, for example, treating a protein eluted from the cell wall by treating a bacterium with a high-concentration salt solution (such as 5M LiCl), and separating the protein derived from each band obtained by polyacrylamide gel electrophoresis. It can be obtained by analyzing cell wall binding ability (Reference: Molecular cloning and sequencing of a major Bacillus subtilis autolysin gene, Kuroda A, Sekiguchi J, J Bacteriol. 173, 7304-7312, 1991.) .

  The obtained cell wall binding protein can be identified and amino acid sequenced using a known method. For example, tryptic digests can be analyzed by matrix-assisted laser ionization time-of-flight mass spectrometer (MALDI-TOFMS), identified by peptide mass fingerprint analysis, and amino acid sequences can be obtained from known protein databases . For example, an amino acid sequence can be determined using an automatic peptide sequencer.

  If the amino acid sequence is determined, the base sequence of the gene encoding the cell wall binding protein can be obtained from, for example, a known gene database. In addition, based on the amino acid sequence of the cell wall-binding protein, a primer or probe can be designed, a DNA fragment encoding the cell wall-binding protein can be cloned, and the base sequence can be determined using a DNA sequencer.

  Any reporter protein may be used as long as it can maintain the reporter function even when it forms a fusion protein with the cell wall binding protein. Especially, it is preferable that it can detect a reporter function easily. For example, fluorescent protein, enzyme, etc. can be mentioned. More specifically, green fluorescent protein, luciferase, beta galactosidase, diaphorase, alkaline phosphatase, peroxidase and the like can be mentioned.

  As the fusion protein, for example, a fusion gene (hybrid gene) in which a gene encoding a cell wall binding protein and a gene encoding a reporter protein are artificially linked is prepared, and the fusion gene is inserted downstream of the promoter of the expression vector. It can be obtained by introducing it into a host cell such as Escherichia coli and expressing it. Specific examples of the construction of the fusion protein expression vector and the expression and purification of the fusion protein include the methods described in the Examples below.

  Here, the cell wall-binding protein is preferably derived from a bacterial autolytic enzyme. Autolytic enzymes are also called autolytic enzymes and autolytic enzymes, and are a general term for peptidoglycan hydrolases that can bind to and degrade the cell walls of the cells.

  Among them, a cell wall binding protein derived from autolysin of Staphylococcus aureus (hereinafter sometimes abbreviated as “SA”) can be preferably used. This SA autolytic enzyme has a structure in which an N-terminal amidase domain and a C-terminal glucosaminidase domain are linked via three repeating sequences. The amino acid sequence (1256 amino acids) of the SA autolytic enzyme (autolysin) is registered in GenPept as ACCESSION: BAA04185, and the base sequence (6140 bases) is registered in GenBank as ACCESSION: D17366.

  The inventor, as will be described in detail in the Examples below, shows that a fusion protein of three repetitive sequence parts of the SA autolytic enzyme and a green fluorescent protein (hereinafter abbreviated as “GFP”) is attached to the bacterial cell wall. It has been found that it can bind and does not impair the function of GFP. It has also been confirmed that the fusion protein can bind strongly to the cell wall of SA.

  Of the three repetitive sequences of the autolytic enzyme of SA, the first repetitive sequence is the amino acid sequence shown in SEQ ID NO: 1. Specifically, it is an amino acid sequence corresponding to positions 441 to 584 in the amino acid sequence of SA autolysin. The second repetitive sequence is the amino acid sequence shown in SEQ ID NO: 2. Specifically, it is an amino acid sequence corresponding to positions 610 to 753 of the amino acid sequence of SA autolysin. The third repetitive sequence is the amino acid sequence shown in SEQ ID NO: 3. Specifically, it is an amino acid sequence corresponding to positions 784 to 927 of the amino acid sequence of SA autolysin. Further, SEQ ID NO: 4 shows an amino acid sequence containing all three repetitive sequence portions of the SA autolytic enzyme. Specifically, it is an amino acid sequence corresponding to positions 441 to 932 of the amino acid sequence of SA autolysin.

  The cell wall-binding protein is a protein comprising the amino acid sequence shown in SEQ ID NOs: 1 to 3, and an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NOs: 1 to 3 It is preferable that it contains at least one selected from proteins consisting of It is sufficient if it contains at least one kind, and it may contain a plurality of the same kind. Further, the combination, the order of connection, the number of bonds, etc. are not limited.

  Further, the cell wall binding protein consists of a protein consisting of the amino acid sequence shown in SEQ ID NO: 4 and an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4. Preferably it is selected from proteins.

  Here, “one or several amino acids have been deleted, substituted or added” means that the number can be deleted, substituted or added by a known mutant peptide production method such as site-directed mutagenesis ( Preferably 10 or less, more preferably 7 or less, and still more preferably 5 or less amino acids are deleted, substituted or added. Such a mutant protein is not limited to a protein having a mutation artificially introduced by a known mutant polypeptide production method, and may be a protein obtained by isolating and purifying a naturally occurring protein.

  It is well known in the art that some amino acids in the amino acid sequence of a protein can be easily modified without significantly affecting the structure or function of the protein. Furthermore, it is also well known that there are variants that not only artificially modify, but also do not significantly alter the structure or function of the protein in the native protein.

  Preferred variants have conservative or non-conservative amino acid substitutions, deletions, or additions. Silent substitution, addition, and deletion are preferred, and conservative substitution is particularly preferred. These do not alter the polypeptide activity according to the invention.

  Typically seen as conservative substitutions are substitutions of one amino acid for another in the aliphatic amino acids Ala, Val, Leu, and Ile, exchange of hydroxyl residues Ser and Thr, acidic residues Asp and Glu exchange, substitution between amide residues Asn and Gln, exchange of basic residues Lys and Arg, and substitution between aromatic residues Phe, Tyr.

  The fusion protein of the cell wall binding protein and the reporter protein is preferably one that can bind firmly to the bacterial cell wall. Specifically, when the bond strength is expressed by the dissociation constant Kd, Kd = 100 nM or less is preferable, and Kd = 10 nM or less is more preferable. If Kd = 100 nM or less, the fusion protein and the cell wall can be firmly bound, and can be prevented from peeling off from the bacterial surface layer even in the washing operation described below.

The dissociation constant (Kd) is expressed as dissociation reaction rate constant (Koff) / binding reaction rate constant (Kon). In general, assuming that the binding reaction rate constant (Kon) is about 10 ⁵ M ⁻¹ S ⁻¹ , and the Kd is 100 nM (10 ⁻⁷ ), the dissociation reaction rate constant (Koff) is 10 ⁻² S ^−1. It becomes. The meaning of this number (Koff is 10 ⁻² S ⁻¹ ) means that it takes 100 seconds for the coupled state to decrease to a natural logarithm (1 / e, about 0.37). In this experiment, since it takes 60 seconds to precipitate the bound material by centrifugation, it is necessary to maintain the bound state for at least 100 seconds. Therefore, it is necessary that Kd = 100 nM or less. Desirably, when Kd = 10 nM, since the conjugate is stable for about 1000 seconds, the time required for the centrifugal operation is not a problem.

  The strength of the fusion protein of GFP with the SA autolysin cell wall-binding domain (three repetitive sequences) used by the present inventor is Kd = about 6 nM.

  The dissociation constant (Kd) can be determined by, for example, the Scatchard plot described in the examples.

  Here, Oshida et al. (Oshida, T., M. Sugai, H. Komatsuzawa, YM Hong, H. Suginaka, and A. Tomasz. 1995. A Staphylococcus aureus autolysin that has an N-acetylmuramoyl-L-alanine amidase Proc. Natl. Acad. Sci. USA 92: 285-289.) includes the nucleotide sequence and amino acid of SA autolysin (domain) and an endo-bN-acetylglucosaminidase domain: Cloning, sequence analysis, and characterization. Sequences have been disclosed, suggesting that three repetitive sequence parts may be involved in cell wall binding. However, in this paper, it is not demonstrated that the three repetitive sequence portions are cell wall binding domains. In addition, when only the three repetitive sequence portions are taken out to form a fusion protein with another protein, the fusion protein can bind strongly to the cell wall (Kd = 6 nM binding force), and the fusion protein Based on this paper, it cannot be easily predicted by those skilled in the art that it can bind to cell walls of Gram-positive bacteria and Gram-negative bacteria other than SA.

  JP-T-2002-514181 (publication date: May 21, 2002) discloses a proteinaceous substance having an amino acid sequence capable of adhering to a cell wall of a microorganism. However, this publication only discloses a partial sequence of protein A as the amino acid sequence of SA, and does not describe the amino acid sequence of SA autolysin.

[Method according to the present invention]
The method according to the present invention uses the above-mentioned fusion protein of a cell wall-binding protein and a reporter protein to detect bacteria in a sample and discriminate whether the detected bacteria are gram-positive or gram-negative. It is a method to do. In addition, the spore is contained in the bacteria which are the detection targets of the method according to the present invention.

  The method according to the present invention includes a contact step of bringing a bacterium in a sample into contact with the fusion protein; and a counting step of measuring the number of bacteria using a reporter protein in the fusion protein as an index. When the permeabilization process of the outer membrane of Gram-negative bacteria in the sample is performed, all bacteria in the sample are detected. When the permeation process is not performed, only the Gram-positive bacteria in the sample Any method can be used. It is preferable to include a recovery step for recovering bacteria to which the fusion protein is bound before the counting step. In addition, the process other than the above may be provided in this method, and the content of the process other than the above is not limited.

  Hereinafter, each step of the method according to the present invention will be described.

<Permeability enhancement treatment process>
The permeation enhancing treatment step is an essential step when detecting gram-negative bacteria, but is not necessary when detecting only gram-positive bacteria.

  Gram-negative bacteria, unlike Gram-positive bacteria, have a membrane (outer membrane) outside the cell wall (peptidoglycan layer). In the permeability enhancement treatment step, a treatment for enhancing the permeability of the outer membrane and allowing the fusion protein to reach the cell wall in the outer membrane is performed.

  Examples of the treatment method include a treatment method using a surfactant or an organic solvent, an enzyme treatment method, a heat treatment method, a protein denaturation treatment method, and the like. However, it is not limited to these. In the examples described later, the present inventor increases the permeability of the outer membrane by heat treatment at 100 ° C. for 3 minutes, surfactant treatment, and protein denaturation treatment. The surfactant is preferably benzalkonium chloride, and the protein denaturant is preferably trichloroacetic acid.

<Contact process>
In the contacting step, a sample containing or possibly containing a detection control bacterium is allowed to contact a cell wall-binding protein-reporter protein fusion protein (hereinafter simply referred to as “fusion protein”) with the bacterial cell wall. What is necessary is just to add.

  The form of the sample is not particularly limited, and forms such as liquids, solids, granules, powders, fluids, and tissue sections that may contain bacteria can be suitably used as the sample. For example, when inspecting for contamination of bacteria in food, medicine, etc., the test object itself (liquid, individual, etc.) can be used as a sample. In addition, the sample can be prepared by suspending the test object in an appropriate buffer or the like. Samples can be similarly prepared in inspections in other fields such as the environmental health field.

  For example, if the sample is a bacterial suspension, the purified fusion protein may be added to the suspension. Moreover, it is preferable to mix by shaking after addition. After the addition, the time until the next recovery step is not particularly limited and may proceed to the recovery step immediately, but it is preferable to provide a contact time of about 1 to 5 minutes. The contact time may be long, but 1 to 5 minutes is sufficient in consideration of rapidity. Also, the temperature need not be particularly controlled, and the bacteria and the fusion protein may be brought into contact at room temperature.

<Recovery process>
The recovery step is aimed primarily at removing fusion proteins that are not bound to the bacterial cell wall. The recovery step is not an essential step, and may be provided as necessary depending on the form of the sample and the type of reporter protein used for the fusion protein. For example, when GFP is used as a reporter protein and a cell suspension is used as a sample, it is possible to detect bacteria by dark field observation with a fluorescence microscope without providing a recovery step.

  In the recovery step, bacteria in the sample may be recovered. For example, if the sample is a bacterial suspension, the bacteria can be easily recovered by centrifugation. By recovering the bacteria, the fusion protein not bound to the bacterial cell wall can be easily removed. Bacteria can also be easily recovered by filter filtration. Also in this method, the fusion protein not bound to the bacterial cell wall can be easily removed.

  Furthermore, it is preferable to perform a washing operation after collecting the bacteria. For washing, for example, an appropriate buffer (for example, PBS: phosphate buffered saline) may be added to the collected bacteria, mixed, and centrifuged again. Alternatively, an appropriate washing buffer may be passed through the filter from which the bacteria have been collected. By performing the washing, it is possible to almost completely remove the fusion protein not bound to the bacterial cell wall.

  For example, when luciferase is used as a reporter protein, excess luciferase not bound to bacteria is removed by this recovery step, and only luciferase bound to bacteria in the next counting step is replaced with sufficient ATP and luciferin. If added and detected by luminescence, only bacteria can be detected. In the case of this method, since the detection target is not ATP but luciferase, the problem in the conventional bacterial detection method using the bioluminescence method by luciferin / luciferase that measures ATP not derived from bacteria is solved. Can do. Furthermore, since bacteria do not have luciferase that emits light using luciferin as a substrate, it is not necessary to consider the background, which is very advantageous.

<Counting process>
In the counting step, the number of bacteria may be measured by detecting the function of the reporter protein portion of the fusion protein bound to the bacteria recovered in the recovery step.

  For example, when GFP is used for the reporter protein portion of the fusion protein, the number of bacteria emitting green fluorescence can be counted using a fluorescence microscope. In addition, when luciferase is used, sufficient ATP and luciferin can be added to the bacteria collected on the filter, and the luminescence point can be counted as one bacterium.

  In addition, the total amount of the fusion protein bound to the collected bacteria can be measured, for example, as a fluorescence amount, a luminescence amount, and a color development amount. For example, when an enzyme such as beta galactosidase, diaphorase, alkaline phosphatase, or peroxidase is used for the reporter protein portion of the fusion protein, the amount of color development can be measured by adding a substrate to the collected bacteria. In this case, an approximate number of bacteria can be obtained by creating a calibration curve between the number of bacteria and the measured amount.

  Here, the Gram positive / negative discrimination can be performed as follows.

  Two test samples are collected from the sample. At this time, it is preferable to perform an operation such as mixing the samples well so that the number of bacteria in the two test samples is not biased. One sample (sample 1) is subjected to the permeability enhancement treatment step, and the other (sample 2) is omitted from the permeability enhancement treatment step. Subsequent steps are performed in the same manner for both samples.

  From sample 1, the total number of bacteria in the sample (the number of gram-positive bacteria + the number of gram-negative bacteria) can be obtained. From sample 2, the number of gram positive bacteria in the sample is obtained. By analyzing this result, it is possible to obtain information on whether the bacteria present in the material are only gram-positive bacteria, only gram-negative bacteria, or the ratio of both. it can.

  Moreover, as shown in the examples described later, in the case of not performing the permeability enhancement treatment step, it can be completed in a minimum of 1 minute, and even if the permeability enhancement treatment step is carried out, it can be carried out in a minimum of about 5 minutes. It is considered very useful.

[Reagent composition and kit according to the present invention]
The reagent composition according to the present invention only needs to contain a fusion protein of a protein that binds to the bacterial cell wall and a reporter protein. What is contained in a composition other than fusion protein is not specifically limited, What is necessary is just what does not inhibit the cell wall binding function and reporter function of fusion protein. The fusion protein contained in the reagent composition according to the present invention is as described above. Moreover, this reagent composition can be used according to the method which concerns on the above-mentioned this invention.

  The reagent composition according to the present invention can be implemented, for example, in the form of a reagent solution containing a fusion protein of a cell wall binding protein and a reporter protein, a lyophilized product, or the like.

  The kit according to the present invention only needs to include the reagent composition according to the present invention. The specific kit configuration other than the above is not particularly limited, and a necessary reagent or instrument may be appropriately selected to form the kit configuration. For example, washing buffer solution, substrate solution, reaction tube, filter and the like can be mentioned. A kit comprising a fusion protein expression vector of a cell wall binding protein and a reporter protein may be used.

  As used herein, the term “kit” is intended to include a package with a container (eg, bottle, plate, tube, dish, etc.) containing a particular material. Preferably, an instruction manual for using the material is provided. The instructions for use may be written or printed on paper or other media, or may be affixed to electronic media such as magnetic tape, computer readable disk or tape, CD-ROM, and the like.

  The kit according to the present invention can be used according to the above-described method according to the present invention.

  The fusion protein of a cell wall-binding protein and a reporter protein used in the present invention can be applied to a screening method for a substance that enhances the permeability of the outer membrane of Gram-negative bacteria. That is, when a gram-negative bacterium is treated with a test substance in a permeabilization process, and then the bacterium and the fusion protein are contacted, and the fusion protein bound to the cell wall is detected, the test substance is gram-negative bacterium. It can be said that the substance has the ability to enhance the outer membrane permeability.

  It should be noted that the specific embodiments and the following examples made in the section of the best mode for carrying out the invention are intended to clarify the technical contents of the present invention, and to such specific examples. It is not to be construed as limiting in any way whatsoever, and those skilled in the art can implement the invention within the spirit of the invention and the scope of the appended claims.

  Moreover, all the academic literatures and patent literatures described in this specification are incorporated herein by reference.

[Example 1: Construction of a fusion protein expression vector of cell wall bainding domain (hereinafter abbreviated as “CWB”) of SA autolysin (Autolysin) and GFP]
First, a GFP expression vector was constructed. Two oligonucleotide primers P1: AGAAAAGCTTAGTAAAGGAGAAGAACTTTTCACT (HindIII site added, SEQ ID NO: 5) and P2: TCATGCGGCCGCAAGCTCATCCATGCCATGTGTA (NotI site added, SEQ ID NO: 6) were prepared from the known gfp gene sequence, and PCR was performed using pGFPuv (Clontech) as a template. went. The reaction used KOD Plus DNA polymerase (TOYOBO) and followed the company's protocol. The reaction conditions were maintained at 94 ° C. for 3 minutes, followed by 37 cycles of 97 ° C. for 30 seconds, 55 ° C. for 40 seconds and 72 ° C. for 2 minutes, and held at 72 ° C. for 10 minutes.

  The PCR product and expression vector pET21-b (Novagen) were treated with restriction enzymes HindIII and NotI at 37 ° C. for 2 hours, and then subjected to agarose gel electrophoresis. Each DNA fragment excised from the gel was ligated with Ligation High (TOYOBO) at 16 ° C. for 2 hours, and transformed into Escherichia coli MV1184 strain. A plasmid with the desired DNA fragment inserted was extracted from the obtained colonies to construct pET GFP. FIG. 1 shows the structure of pET GFP.

  Next, a CWB-GFP expression vector was constructed. Two oligonucleotide primers P3: CATCGAATTCTAAATTAACAGTTGCTGCAAACAA (EcoRI site added, SEQ ID NO: 7) and P4: AGTTGAGCTCGTTAAATCTTTTGCATTTACCCA (SacI site added, SEQ ID NO :) based on the base sequence (GenBank ACCESSION: D17366) 8) was prepared, and PCR was performed using the chromosomal DNA of Staphylococcus aureus JCM2141 (obtained from RIKEN) as a template. The method is the same as described above, except that pET GFP was used as the vector and EcoRI and SacI were used as the restriction enzymes. The finally extracted plasmid was named pET CWB-GFP. FIG. 2 shows the structure of a CWB-GFP expression vector (pET CWB-GFP).

[Example 2: Construction of fusion protein expression vector of CWB and luciferase]
Two oligonucleotide primers P5: CCGGGTCGACATGGAAGACGCCAAAAAC (SalI site added, SEQ ID NO: 9) and P6: GTTGCGGCCGCCAATTTGGACTTTCCGCC (NotI site added, SEQ ID NO: 10) are prepared from a known luciferase gene sequence, and Luciferase T7 Control DNA (promega) is used as a template As a PCR.

  The PCR product and the vector CWB-GFP expression vector (pET CWB-GFP) were treated with restriction enzymes SalI and NotI at 37 ° C. for 2 hours, and then subjected to agarose gel electrophoresis. Each DNA fragment excised from the gel was ligated with Ligation High (TOYOBO) at 16 ° C. for 2 hours, and transformed into Escherichia coli MV1184 strain. From the obtained colony, a plasmid with the target DNA fragment inserted was extracted and named pET CWB-LUC. FIG. 3 shows the structure of the CWB-Luciferase expression vector (pET CWB-LUC).

[Example 3: Expression and purification of fusion protein (CWB-GFP, CWB-Luciferase)]
BL21 (DE3) (Novagen) transformed with pET CWB-GFP and pET CWB-LUC, respectively, was cultured in LB medium at 37 ° C. until OD600 reached 0.5, and then 0.3 mM IPTG was added and further cultured for 6 hours. went. After collection, the cells were disrupted with lysozyme and ultrasonic waves, and the centrifuged supernatant was purified with a HisTrap HP 1 ml (GE Health Science) column. After washing with 10 ml of buffer A (20 mM sodium phosphate pH 7.4, 0.5 M NaCl, 15% glycerol) containing 10 mM imidazole, elution was performed with buffer A containing 0.5 M imidazole. Finally, 1 ml fraction containing the fusion protein was obtained.

[Example 4: Study on bacterial binding of CWB-GFP fusion protein]
S. aureus 10 ⁸ cell / ml 0.1 ml was collected by centrifugation and suspended in 0.1 ml of pure water. CWB-GFP (about 5.5 μg) was added thereto so that the concentration was 660 nM. After 5 minutes at room temperature, the sample was observed with a fluorescence microscope (Olympus BX-60, excitation light 470-490 nm).

  The results are shown in FIG. As apparent from FIG. 4, it was revealed that CWB-GFP accumulates in S. aureus.

[Example 5: Study on fungal selectivity of CWB-GFP fusion protein (1)]
S. aureus (gram positive), Escherichia coli (E. coli, gram negative), green bacterium (Pseudomonas aeruginosa, gram negative), Bacillus subtilis (gram positive) 10 ⁸ cells A mixed suspension of / ml was prepared with 20 mM phosphate buffer (pH 7), and CWB-GFP was added to a concentration of 660 nM. After 5 minutes at room temperature, the sample was observed with a fluorescence microscope (Olympus BX-60, excitation light 470-490 nm).

  The results are shown in Table 1. As is clear from Table 1, CWB-GFP bound to S. aureus and B. subtilis and did not bind to E. coli and P. aeruginosa.

  FIG. 5 is an image observed with a microscope after adding the CWB-GFP fusion protein to a mixed suspension of S. aureus and E. coli. FIG. 5A is an observation image in a bright field, and both S. aureus and E. coli can be confirmed. On the other hand, FIG. 5B is an image of the same visual field observed with fluorescence, and it can be confirmed that only spherical S. aureus emits green fluorescence.

  From the above results, it was shown that the CWB-GFP fusion protein can detect Gram-positive bacteria.

[Example 6: Examination of binding of CWB-GFP fusion protein to Gram-negative bacteria (1)]
Gram-negative bacteria had the outer membrane of the cell wall (peptidoglycan layer), and therefore the following experiment was conducted for the purpose of confirming that the CWB-GFP fusion protein cannot be bound. That is, whether the gram-negative bacteria could be detected using the CWB-GFP fusion protein was examined by enhancing the permeability of the outer membrane of the gram-negative bacteria and allowing the CWB-GFP fusion protein to permeate. .

  After the E. coli suspension was treated at 100 ° C. for 3 minutes, CWB-GFP was added in the same manner as in Example 5. After 5 minutes at room temperature, it was observed with a fluorescence microscope.

  The results are shown in FIG. As is clear from FIG. 6, it was revealed that CWB-GFP also binds to Escherichia coli, which is a gram-negative bacterium, by performing treatment at 100 ° C. for 3 minutes.

  From the results of this Example and Example 5, the same sample was subjected to the method of performing treatment at 100 ° C. for 3 minutes and the method of not performing it at the same time, so that the total number of bacteria in the sample and Gram-positive and Gram-negative bacteria It was shown that the ratio to can be detected easily and quickly. And this treatment made it possible to detect whole general bacteria.

[Example 7: Examination of bacterial binding ability of CWB-GFP fusion protein]
An SA suspension (10 ⁸ cell / ml) was prepared with 20 mM phosphate buffer (pH 7), CWB-GFP was added to a concentration of 40 nM, 60 nM, and 140 nM. After 5 minutes at room temperature, GFP Fluorescence was measured (total GFP). The fluorescence of the filtrate immediately filtered through a 0.2 μm filter was measured (unbound GFP). The bound GFP can be calculated by (total GFP)-(unbound GFP). A JASCO FP-6500 spectrofluorometer was used for the measurement.

  The results are shown in FIG. The ratio of bound CWB-GFP fusion protein / non-bound CWB-GFP fusion protein is plotted on the vertical axis, and the concentration of CWB-GFP fusion protein is plotted on the horizontal axis (scatchard plot). The dissociation constant Kd was calculated from the plotted slope. The Kd value was 6 nM.

[Example 8: Examination of bacterial detection by CWB-luciferase fusion protein]
An SA suspension (10 ⁵ cell / ml) was prepared with 20 mM phosphate buffer (pH 7), and 5 μg of CWB-LUC was added to 1 ml of this suspension. After 5 minutes at room temperature, the mixture was filtered with a 0.2 μm filter. After washing with 10 ml of phosphate buffer, the filter was taken out and 50 μl of premix (60 mM Tris-HCl, pH 7.4, 8 mM MgCl2, 2 mM ATP, 1 mM luciferin) was applied to the filter surface. The light emission on the filter was exposed for 10 minutes with an ultra-sensitive CCD camera (Spectral Instruments, Cryo Tiger) to obtain an image.

  The results are shown in FIG. As is apparent from FIG. 8, it was shown that one bacterium can be counted as the luminescence point.

[Example 9: Examination of short-time bacteria detection method using CWB-luciferase fusion protein]
0.1 ml of 20 mM phosphate buffer (pH 7) containing SA10 ⁸ cell / ml was added to 0.5 ml of 20 mM phosphate buffer (pH 7) containing 0.3 μg of CWB-LUC. The mixture was immediately centrifuged (15,000 rpm, 30 seconds), and the supernatant was completely removed (for the purpose of removing unbound CWB-LUC). After washing with 0.5 ml of 20 mM phosphate buffer (pH 7), 50 μl of premix (60 mM Tris-HCl, pH 7.4, 8 mM MgCl2, 2 mM ATP, 1 mM luciferin) was added to detect luminescence (detector) Kikkoman Lumitester C-100, about 10 seconds).

  FIG. 9 shows the procedure and results. As is clear from FIG. 9, high luminescence was detected when SA was present. Moreover, it was shown that bacteria can be detected by this method in a minimum of 1 minute.

[Example 10: Examination of fungal selectivity of CWB-GFP fusion protein (2)]
The bacterial selectivity of the CWB-GFP fusion protein was examined in more detail using a number of strains.

It examined using 17 bacteria (8 gram positive bacteria, 9 gram negative bacteria) and 1 yeast strain (see Table 2). Bacteria were collected from the culture solution of each strain by centrifugation, washed with 20 mM Tris HCl (pH 7.4) buffer containing 100 mM NaCl, and then 10 ⁸ cell / ml suspension was prepared with 100 μl of the same buffer. CWB-GFP (about 5.5 μg) was added thereto so that the concentration was 660 nM, and after 5 minutes at room temperature, the sample was observed with a fluorescence microscope (Olympus BX-60, excitation light 470-490 nm).

  The results are shown in Table 2. As described in the “Untreated” column of Table 2, the CWB-GFP fusion protein did not bind to Gram-negative bacteria and yeast. On the other hand, the CWB-GFP fusion protein bound to all 8 strains of Gram-positive bacteria used.

[Example 11: Study on binding of CWB-GFP fusion protein to Gram-negative bacteria (2)]
In Example 6 above, the outer membrane permeability enhancement treatment of Gram-negative bacteria was performed by heat treatment at 100 ° C. for 3 minutes, but in this example, surfactant treatment and protein denaturation treatment were examined.

(1) Surfactant treatment Benzalkonium chloride (hereinafter referred to as “BC”) was used as a surfactant.

After washing the cells with 20 mM Tris HCl (pH 7.4) buffer containing 100 mM NaCl in the same manner as in the above untreated procedure, 10 ⁸ cells / ml of the cells were suspended in 100 μl of the same buffer containing 0.01% benzal zirconium. The solution was prepared and treated for 3 minutes at room temperature. Thereafter, CWB-GFP (about 5.5 μg) was added so that the concentration was 660 nM, and after 5 minutes at room temperature, the sample was observed with a fluorescence microscope (Olympus BX-60, excitation light 470-490 nm). Note that only Bacillus subtilis was used as the Gram-positive bacterium.

  The results are shown in Table 2. As described in the “BC” column of Table 2, all of the Gram-negative bacteria that did not bind to the CWB-GFP fusion protein by the BC treatment did not bind to the CWB-GFP fusion protein. On the other hand, yeast did not bind to the CWB-GFP fusion protein even after the BC treatment. In addition, BC treatment did not affect the binding between B. subtilis, a Gram-positive bacterium, and the CWB-GFP fusion protein.

  FIG. 10 shows a fluorescence microscope image showing that the CWB-GFP fusion protein is bound to the BC-treated gram-negative bacterium. (A) is E. coli, (b) is A. tumefacience, (c) is P. aeruginosa.

(2) Protein denaturation treatment Trichloroacetic acid (hereinafter referred to as “TCA”) was used as a protein denaturant.

After washing the bacteria with 20 mM Tris HCl (pH 7.4) buffer containing 100 mM NaCl in the same manner as in the above untreated operation, 10 ⁸ cells / ml of the bacterial suspension was added with 100 μl of the same buffer containing 0.1% TCA. Prepared and heated at 90 ° C. for 10 minutes. Thereafter, CWB-GFP (about 5.5 μg) was added so that the concentration was 660 nM, and after 5 minutes at room temperature, the sample was observed with a fluorescence microscope (Olympus BX-60, excitation light 470-490 nm). Note that only B. subtilis was used as the Gram-positive bacterium.

  The results are shown in Table 2. As described in the “TCA” column of Table 2, all Gram-negative bacteria that did not bind untreated by TCA treatment became bound to the CWB-GFP fusion protein. On the other hand, yeast did not bind to the CWB-GFP fusion protein even after TCA treatment. In addition, TCA treatment did not affect the binding between B. subtilis, a Gram-positive bacterium, and CWB-GFP fusion protein.

  From the above results, it was shown that the surfactant treatment and the protein denaturation treatment are effective for the outer membrane permeability enhancement treatment of Gram-negative bacteria. Therefore, it was shown that general bacteria can be detected by performing these treatments. Furthermore, it was shown that bacteria and yeast can be distinguished.

[Example 12: Study on spore binding of CWB-GFP fusion protein]
It was examined whether or not the CWB-GFP fusion protein binds to bacterial spore.

Bacillus thuringiensis (gram-positive bacteria) was cultured for 2 days at 37 ° C. using Schaeffer medium to form spores. Spores were collected by centrifugation, washed with 20 mM Tris HCl (pH 7.4) buffer containing 100 mM NaCl, and a 10 ⁸ cell / ml bacterial suspension was prepared with 100 μl of the same buffer. CWB-GFP (about 5.5 μg) was added thereto so that the concentration was 660 nM, and after 5 minutes at room temperature, the sample was observed with a fluorescence microscope (Olympus BX-60, excitation light 470-490 nm). In addition, BC processing and TCA processing were performed in the same procedure as in Example 11 above.

  The results are shown in Table 3 and FIG. It was confirmed that the CWB-GFP fusion protein binds to untreated Bacillus thuringiensis spores. In addition, BC treatment and TCA treatment did not affect the binding between the CWB-GFP fusion protein and the spores.

  From the above results, it was shown that the CWB-GFP fusion protein can be used for detection of spores. Therefore, the CWB-GFP fusion protein is closely related to Bacillus thuringiensis and can be used for detection of Bacillus anthracis used for bioterrorism. Therefore, the present invention can contribute to the prevention of bioterrorism.

  The present invention can be used in various fields that require testing for bacteria. In particular, it is suitable for use in the food industry, pharmaceutical industry, clinical examination field, environmental hygiene field, etc., and can provide a quick, simple and highly sensitive bacteria test.

It is the figure which showed the structure of the GFP expression vector (pET GFP). It is the figure which showed the structure of the CWB-GFP expression vector (pET CWB-GFP). It is the figure which showed the structure of the CWB-Luciferase expression vector (pET CWB-LUC). It is an image showing that CWB-GFP is accumulated in S. aureus. It is an image showing that CWB-GFP binds only to S. aureus. It is an image which shows that CWB-GFP couple | bonds with colon_bacillus | E._coli by heat processing. It is a graph which shows the result of having measured the bacteria binding power (Scatcherd plot) of CWB-GFP. It is an image which shows having detected S. aureus on a filter by CWB-Luciferase. It is a figure which shows the procedure and result which detect bacteria for a short time using the method of this invention. It is an image which shows that CWB-GFP couple | bonds with Gram-negative bacteria by BC process, (a) is colon_bacillus | E._coli, (b) is Agrobacterium, (c) Pseudomonas aeruginosa. It is an image which shows that CWB-GFP couple | bonds with the spore of Bacillus thuringiensis.

Claims (19)

A method for detecting bacteria in a sample and identifying whether the detected bacteria are gram positive or gram negative,
A method comprising using a fusion protein of a protein that binds to a bacterial cell wall and a reporter protein. A contacting step of bringing the bacterium in the sample into contact with the fusion protein; and a counting step of measuring the number of bacteria using the reporter protein in the fusion protein as an indicator,
When performing the permeabilization process of the outer membrane of gram negative bacteria in the sample before the contact step, all bacteria in the sample are detected,
2. The method according to claim 1, wherein only the Gram-positive bacteria in the sample is detected when the permeability enhancement treatment step is not performed.   The method according to claim 2, further comprising a recovery step of recovering bacteria to which the fusion protein is bound before the counting step.   The method according to claim 1, wherein the dissociation constant Kd between the fusion protein and the bacterial cell wall is 100 nM or less.   The method according to claim 1, wherein the dissociation constant Kd between the fusion protein and the bacterial cell wall is 10 nM or less.   The method according to claim 1, wherein the protein that binds to the bacterial cell wall is derived from a bacterial autolytic enzyme.   The method according to claim 6, wherein the protein that binds to the cell wall of the bacterium is derived from an autolytic enzyme of Staphylococcus aureus. Proteins that bind to the bacterial cell wall
Selected from the protein consisting of the amino acid sequence shown in SEQ ID NO: 1 to 3 and the protein consisting of the amino acid sequence shown in SEQ ID NO: 1 to 3 wherein one or several amino acids are deleted, substituted or added 8. The method of claim 7, comprising at least one of the following: Proteins that bind to the bacterial cell wall
A protein consisting of the amino acid sequence shown in SEQ ID NO: 4 and a protein consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4 8. A method according to claim 7, characterized in that   The method according to claim 1, wherein the reporter protein is selected from fluorescent protein, luciferase, beta galactosidase, diaphorase, alkaline phosphatase and peroxidase. A reagent composition for detecting bacteria in a sample and identifying whether the detected bacteria are gram positive or gram negative,
A reagent composition comprising a fusion protein of a protein that binds to a bacterial cell wall and a reporter protein.   The reagent composition according to claim 11, wherein the dissociation constant Kd between the fusion protein and the bacterial cell wall is 100 nM or less.   The reagent composition according to claim 11, wherein the dissociation constant Kd between the fusion protein and the bacterial cell wall is 10 nM or less.   12. The reagent composition according to claim 11, wherein the protein that binds to the bacterial cell wall is derived from a bacterial autolytic enzyme.   The reagent composition according to claim 14, wherein the protein that binds to the cell wall of the bacterium is derived from an autolytic enzyme of Staphylococcus aureus. Proteins that bind to the bacterial cell wall
Selected from the protein consisting of the amino acid sequence shown in SEQ ID NO: 1 to 3 and the protein consisting of the amino acid sequence shown in SEQ ID NO: 1 to 3 wherein one or several amino acids are deleted, substituted or added The reagent composition according to claim 15, comprising at least one selected from the group consisting of: Proteins that bind to the bacterial cell wall
A protein consisting of the amino acid sequence shown in SEQ ID NO: 4 and a protein consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4 The reagent composition according to claim 15, which is characterized by:   12. The reagent composition according to claim 11, wherein the reporter protein is selected from fluorescent protein, luciferase, beta galactosidase, diaphorase, alkaline phosphatase and peroxidase.   A gram-positive / negative bacteria identification / detection kit comprising the reagent composition according to claim 11.