JP2007097574A - QUANTITATIVE METHOD FOR mRNA OF OBJECTIVE GENE - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a quantitative method for mRNA of objective gene, imparting a compatible data in detecting various conditions by normalizing detected data in using micro-array, etc., without using a quantitative PCR and a quantitative RT-PCR. <P>SOLUTION: The invention relates to the determination method for mRNA of the objective gene by correcting the amount of mRNA of the target gene comprising hybridization of a probe which is a nucleic acid-relating substance and immobilized on a carrier, with a target which is the object to be detected and is a nucleic acid-relating substance, and measuring intensity of a signal based on the hybridization reaction, wherein a known amount of an oligonucleotide corresponding to a portion of the objective gene and comprising a sequence hybridizing with the probe is added as the target and measuring the intensity of the signals. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a method for quantifying mRNA of a target gene expressed in a test sample using hybridization between a probe and a target.

  Individuals / organs / organisms that have been developed from genome research to describe all genes to elucidate the mechanisms of biological development and diseases, diagnose them, and utilize them for drug discovery. Expression profile analysis that analyzes the types and expression levels of genes expressed in tissues and cells at the mRNA level has been performed. Expression profile analysis is an effective means to examine and compare different samples in time series, under different conditions or between different organisms. When there are few types of target mRNA, quantitative RT-PCR, when there are many types of mRNA A microarray is mainly used for (exhaustive analysis). A microarray is a plate in which a flat plate is used as a carrier, and a nucleic acid or oligonucleotide is sequenced and immobilized on the plate, and RNA having a complementary sequence, ie, aRNA or cDNA, is hybridized. The amount of binding is quantitatively measured with a dye or the like, but there are also cases where a thread-like object is used as a carrier instead of a flat plate or a group of identifiable beads (particles) is used.

  In this case, the data obtained in the microarray or the like is qualitative or relative, and depends on the equipment and technique used. Therefore, the amount of mRNA cannot be obtained as an absolute value, and a different microarray or the like was used. It is also impossible to compare expression levels between experiments. For example, when oligonucleotides designed by selecting different regions from the same gene are used as probes, mRNA of the gene or a derivative thereof shows different hybridization efficiencies for different probes. In addition, the mRNA exhibits different hybridization efficiencies depending on the sample processing method and hybridization conditions, and the possibility of cross-hybridizing with a heterologous mRNA or the like is different. This is extremely inconvenient for measurement of gene expression by a microarray or the like. Therefore, in order to obtain quantitative data on the gene expression level, it is general to select a gene for which a change in the expression level is to be detected and perform quantitative RT-PCR one by one.

  In order to increase the accuracy of standardization in quantitative PCR and quantitative RT-PCR, a method has been adopted in which a standard substance is prepared for each gene and the measurement accuracy is increased using this. However, in a microarray or the like used for the purpose of obtaining a large number of gene expression information, it is not practical to perform quantitative RT-PCR after analysis by microarray or the like for each gene.

  In analysis using a conventional microarray, for example, to see the effect of medication, a set of mRNA obtained from a reference (untreated sample) is compared with a set of mRNA obtained from a treated sample, and the expression level for each gene It was usual to obtain a relative increase / decrease. At this time, it is not a practical problem to know exactly how much mRNA is actually contained in the sample, and data using microarrays or the like by different manufacturers is not compatible.

  This is because (1) the manufacturer selects a completely different probe such as cDNA or oligonucleotide, (2) the design is different when using the oligonucleotide as a probe, (3) (4) The efficiency of hybridization exhibited by aRNA or cDNA, which is a derivative of mRNA used as a target to be reacted with the probe, varies depending on the probe or technique (5) ) Different techniques used by different experimenters, resulting in different hybridization efficiencies; (6) Furthermore, the possibility that some probes cross-hybridize with transcripts of different genes is sufficiently eliminated. Not because of that.

  Therefore, an object of the present invention is to provide a method for obtaining compatible data even when detection is performed under different conditions by standardizing detection values in a microarray or the like without using quantitative PCR or quantitative RT-PCR. is there. In other words, an object of the present invention is to provide a method for quantifying mRNA and a method for comparing values measured using different microarrays.

  The present inventors have intensively studied to solve the above problems. As a result, the probe immobilized on the carrier is hybridized with an oligonucleotide containing a sequence corresponding to a part of the target gene, the amount of which is known as a standard substance, and the signal intensity based on the hybridization is measured. The amount of mRNA of the target gene expressed in the test sample is determined by comparing the measured signal intensity based on the hybridization reaction for the test sample with the signal intensity measured using the standard substance. The inventors have found that the amount can be corrected and quantified, and have completed the present invention.

That is, the present invention is as follows.
(1) A test sample by hybridizing a probe, which is a nucleic acid-related substance immobilized on a carrier, with a target, which is a detection target and a nucleic acid-related substance, and measuring the signal intensity based on the hybridization reaction In quantifying the mRNA of the target gene expressed in the probe, in addition to measuring the signal intensity based on the hybridization reaction for the test sample, the probe corresponds to a part of the target gene and the probe. An object of the present invention is to correct and quantify the amount of mRNA of a target gene in the test sample by adding a known amount of an oligonucleotide containing a sequence that hybridizes to the reaction and measuring the signal intensity. A method for quantifying gene mRNA.

(2) The method according to (1), wherein the oligonucleotide is a fragment of full-length aRNA corresponding to the target gene, and the amount of the full-length aRNA is known.
(3) A standard sample containing a full-length aRNA, the standard sample for which the content of the full-length aRNA is known, and the aRNA test sample containing aRNA prepared from the test sample are the same. Step (a) for fragmenting aRNA by treatment with the method, step (b) for hybridizing the fragment obtained in step (a) with the probe for each of both samples, fragment for each of both samples Step (c) of measuring the signal intensity based on the hybridization between the probe and the probe, and comparing the signal intensities obtained for both samples, thereby calculating the absolute amount of aRNA in the aRNA test sample The method according to (2), comprising step (d).
(4) The method according to (1), wherein the oligonucleotide is a synthetic oligonucleotide.

(5) Step (Ai) of preparing a standard sample containing the oligonucleotide and having a known content of the oligonucleotide, aRNA test sample containing aRNA prepared from the test sample The fragment in a standard sample prepared in the step (A-ii) and the step (Ai) for fragmenting aRNA by treating the fragment and the fragment obtained in the step (A-ii), respectively, A step of hybridizing with a probe (B), a step of measuring a signal intensity (i) based on hybridization between the oligonucleotide and the probe, and a signal intensity (ii) based on hybridization between the fragment and the probe (C) and by comparing signal intensity (i) and signal intensity (ii), aRNA in the aRNA test sample Absolute amount calculating a containing (D), the method described in (4).
(6) The method according to any one of (1) to (5), wherein the probe is a probe on a microarray.
(7) The method according to any one of (1) to (6), wherein the probe is a cross-hybridization measurement using a gene other than a gene that is originally a measurement target as a target gene.

(8) A method of comparing measured values measured using microarrays between microarray lots to which probes, which are nucleic acid-related substances, are fixed, or between commodities. And a target that is a nucleic acid-related substance is hybridized, and a signal intensity based on the hybridization reaction is measured, wherein the target corresponds to a part of the gene that is the object of measurement and hybridizes to the probe. The signal intensity is measured using a sample containing a known amount of an oligonucleotide containing the sequence to be used as the target, and the measured values are compared between lots of microarrays or between products, Method.
(9) The method according to (8), wherein the oligonucleotide is a fragment of full-length aRNA corresponding to the target gene, and the amount of the full-length aRNA is known.
(10) The method according to (8), wherein the oligonucleotide is a synthetic oligonucleotide.

The present invention includes the following inventions.
(I) a method for measuring the amount of mRNA due to expression of a target gene in a test sample by detecting hybridization between a probe and a target,
The method described above, wherein the detection value of the signal intensity based on hybridization is standardized by using a full-length aRNA corresponding to the target gene as a standard substance.

(Ii) a step of fragmenting aRNA by treating a standard sample containing a known amount of full-length aRNA and an aRNA test sample prepared from the test sample in the same manner,
The step of hybridizing the fragmented aRNA contained in each sample with the probe, and detecting and comparing the signal intensity based on the hybridization obtained for both samples, the absolute amount of aRNA contained in the test sample is determined. The method according to (i), comprising a step of calculating.

(Iii) The method according to (i) or (ii), wherein the probe is immobilized on a carrier.
(Iv) The method according to (iii), wherein the probe is a probe on a microarray.
(V) A method for detecting cross-hybridization between a probe and a nucleic acid derived from a test gene other than the gene targeted by the probe, wherein a full-length aRNA corresponding to the test gene is used. And said method.

  According to the present invention, mRNA of a target gene expressed in a test sample can be quantified by a simple method such as microarray without using a technique such as quantitative PCR or quantitative RT-PCR.

  When using full-length aRNA as a standard substance, if the type of target gene that can be measured is known, the mRNA of the target gene can be quantified even if the base sequence of the probe is unknown.

  If the base sequence of the probe is clear, a synthetic oligonucleotide can be used as a standard substance. In that case, obtain a more reliable and simpler oligonucleotide than using full-length aRNA. There is an advantage that you can.

  According to the present invention, it is possible to compare measured values of lots and products of products such as microarrays. However, when a synthetic oligonucleotide is used as a standard substance and comparison is made between products, it is necessary that the base sequences of the probes include a common part in those products.

  The present invention hybridizes a probe, which is a nucleic acid-related substance immobilized on a carrier, with a target, which is a detection target and a nucleic acid-related substance, and measures the signal intensity based on the hybridization reaction. When quantifying mRNA of a target gene expressed in a sample, in addition to measurement of signal intensity based on the hybridization reaction for the test sample, the target corresponds to a part of the target gene and the A known amount of an oligonucleotide containing a sequence that hybridizes to the probe is added and reacted, and the signal intensity is measured, thereby correcting and quantifying the amount of mRNA of the target gene in the test sample. The present invention relates to a method for quantifying mRNA of a target gene.

  As a target, adding a known amount of an oligonucleotide containing a sequence corresponding to a part of a target gene and hybridizing to a probe means that a sample containing the known amount of the oligonucleotide is used as a standard sample. Sure. In the present invention, the oligonucleotide containing a sequence corresponding to a part of the target gene and hybridizing to the probe is preferably a full-length aRNA fragment corresponding to the target gene or a synthetic oligonucleotide. That is, in the present invention, preferably, a full-length aRNA corresponding to the target gene or a synthetic oligonucleotide containing a sequence corresponding to a part of the target gene and hybridizing to the probe is used as the standard substance.

  A standard substance is usually a quantitative measurement of a test substance in a test sample based on a measured value for the standard substance. More specifically, a standard substance contains a known amount of a standard substance and is included in the test sample. A substance for quantifying the test substance contained in the test sample by determining the relative amount of the test substance to be measured. Preferably, it refers to a substance for quantifying a test substance contained in a test sample by preparing a calibration curve using a sample containing a known amount of a standard substance.

  In one aspect, the present invention relates to a method for measuring the expression level of a target gene in a test sample, more specifically, the amount of mRNA contained in the test sample by detecting hybridization between the probe and the target. The present invention relates to a method characterized in that a detection value of signal intensity based on hybridization is standardized by using a full-length aRNA corresponding to a gene as a standard substance.

  In one embodiment of the present invention, a full-length aRNA prepared from a full-length cDNA corresponding to a target gene is used as a standard substance. Since this reference material covers the entire length of the coding region of the target gene and includes non-coding regions upstream (5 ′) and downstream (3 ′) thereof, oligonucleotides representing any part of the gene or modified And a portion that hybridizes with a probe comprising a cDNA fragment. The efficiency of hybridization with the target varies depending on the nature and configuration of the probe, but as long as the standard sample containing the standard substance and the test sample are operated according to the same protocol, the probe contains a known amount of the standard substance corresponding to each probe. Regardless of the production method, properties, and usage of the microarray, the standard sample provides a correction curve for standardizing the detection value of the signal intensity based on the hybridization. Based on this, the absolute value of mRNA in the test sample is given. The amount can be determined.

  When the base sequence of the probe is known, a synthetic oligonucleotide containing a complementary sequence corresponding to a part of the target gene and hybridizing to the probe can be used as a standard substance. In this case, compared with the case where full-length aRNA is used as a standard substance, aRNA test sample containing aRNA prepared from the test sample is subjected to aRNA fragmentation treatment. The difference is that the included standard sample is not subjected to the fragmentation process.

  A synthetic oligonucleotide as a standard substance contains a sequence that corresponds to a part of a target gene and hybridizes to a probe. When an aRNA test sample containing aRNA prepared from a test sample is subjected to aRNA fragmentation treatment It is preferable to design so that it may have the same sequence as the aRNA fragment obtained. The base length of the synthetic oligonucleotide is appropriately determined according to the probe sequence and the base length, but is usually 70 mer or less, preferably 25 to 50 mer.

  Synthetic oligonucleotides can be produced by methods commonly used in the art. Examples of such production methods include, for example, the diester method, triester method, phosphite method, amidite method, H-phosphonate method (SL Beaucage et al., Tetrahedron, 48, 2223 (1992); H. Koster et al. , Tetrahedron Lett., 40, 103 (1984); J. Stawinski et al., Acta Biochim. Pol., 45, 907 (1998)). It can also be synthesized using a commercially available automatic nucleic acid synthesizer.

  In the present invention, the probe has the meaning usually used in the art. That is, it refers to a nucleic acid-related substance used for detecting a target gene, preferably a nucleic acid, which specifically hybridizes with a nucleic acid corresponding to the gene or a fragment thereof. As the probe, a synthetic oligonucleotide immobilized on a carrier such as a microarray, a denatured cDNA fragment or a genomic DNA fragment is usually used. In the case of an oligonucleotide probe, it usually has a length of several tens of bases (20 to 70 mer).

  In the present invention, nucleic acid-related substances include nucleic acids, fragments thereof, synthetic oligonucleotides, denatured cDNAs, genomic DNA fragments, and derivatives thereof, and those having a label added thereto. Moreover, the nucleic acid etc. to which the reactive functional group was added in order to fix | immobilize to a support | carrier are also included.

  In the present invention, the nucleic acid includes DNA and RNA. Also includes oligonucleotides. A nucleic acid corresponding to a gene corresponds to at least a nucleic acid corresponding to the entire coding region of the gene, usually a nucleic acid corresponding to the entire coding region of the gene and its upstream (5 ′) and downstream (3 ′) non-coding regions essential as mRNA. Including full-length cDNA, full-length mRNA, full-length aRNA, genomic DNA and fragments thereof. cDNA refers to a molecule obtained by enzymatically synthesizing DNA having a sequence complementary to messenger (m) RNA and further synthesizing its complementary strand into a double strand. DNA consists of two polynucleotide strands with opposite polarities and complementary sequences, but the strand with the same polarity as mRNA is called the sense strand, whereas it has the opposite polarity to mRNA Is called the antisense strand. And aRNA (antisense RNA) refers to RNA having the opposite polarity to mRNA. When using an oligonucleotide as a probe in the current method, an oligonucleotide having a sense sequence is used for immobilization as a probe, and a nucleic acid having an antisense sequence, such as aRNA, is used as a target, or mRNA is synthesized as a template. In many cases, the resulting cDNA is denatured and hybridized. However, denatured cDNA may be used as a probe. In addition, mRNA including a region from the transcription start point at the 5 ′ end of each gene to the 3 ′ poly A end due to the termination of transcription is referred to as a full-length mRNA, and a cDNA prepared based on the mRNA is referred to as a full-length cDNA. The aRNA prepared based on the full-length cDNA is referred to as full-length aRNA.

  An oligonucleotide containing a sequence corresponding to a part of a gene includes a full-length cDNA fragment, a full-length mRNA fragment, a full-length aRNA fragment, a genomic DNA having a sequence corresponding to a part of the base sequence of the gene. Synthetic oligonucleotides having fragments and their corresponding sequences are included.

  Examples of nucleic acid derivatives include artificial nucleic acids modified with phosphodiester sites; artificial nucleic acids modified with glycosyl bonds and hydroxyl groups at furanose sites; artificial nucleic acids modified with nucleobase sites; and structures other than sugar / phosphate skeletons And more specifically, phosphorothioate-type, phosphorodithioate-type, phosphorodiamidate-type, methylphosphonate-type, or methylphosphonothio, in which the oxygen atom of the phosphate moiety is replaced with a sulfur atom. Artificial nucleic acid of ate type; Substituent modified type on furanose ring, pyranose type of sugar ring skeleton increased by 1 carbon, or polycyclic sugar skeleton type artificial nucleic acid; pyrimidine C-5 modified base type, purine C- Examples thereof include artificial nucleic acids of the 7-position modified base type or ring extended modified base type.

  The shape and material of the carrier for immobilizing the probe are not particularly limited. Examples thereof include a flat plate such as a microarray, a particle such as a bead, and a yarn. In the present invention, a probe on a microarray is preferably used as the probe. As microarrays, probes that are spotted two-dimensionally on a flat plate are widely used. Usually, oligonucleotides chemically synthesized to represent a specific gene or one extracted by denaturation from a biological sample are denatured. Stranded cDNA is immobilized as a spot on the substrate as a probe. Using a microarray, cDNA synthesized enzymatically based on mRNA extracted from a test sample, separated into single strands by denaturation treatment, or aRNA (including fragments thereof) synthesized using cDNA as a template Hybridize a probe with a label such as a dye, and use it to determine the molecular species and amount of the gene transcript present in the test sample from the type and amount of the spot where specific binding occurs. Can be measured. The amount of mRNA contained in the test sample is taken as the expression level of the target gene.

  In the present invention, the target has a meaning usually used in the art, and refers to a nucleic acid-related substance to be detected. A target may be referred to as a target. Usually, it refers to a nucleic acid derived from a test sample to be hybridized to a probe and a nucleic acid enzymatically synthesized based on the nucleic acid, specifically, mRNA, denatured cDNA, aRNA, and fragments thereof. The target as a standard substance includes aRNA, a fragment thereof, and a synthetic oligonucleotide. As the target, the nucleic acid-related substance itself may be used, or a target in which a label molecule and a nucleic acid-related substance are bound in advance may be used.

  Hybridization or hybridization has the meaning normally used in the art, and single-stranded DNAs having complementary sequences, single-stranded RNAs, or single-stranded DNA and single-stranded DNA. It means that RNA forms a double strand under appropriate conditions.

  In one embodiment of the present invention, full-length aRNA corresponding to the target gene is used as a standard substance. The full-length aRNA corresponding to the target gene is produced based on the genome sequence or by utilizing the full-length cDNA collection results (for example, Suzuki, Y. et al., Nucleic Acids Res. 30: 328, 2002). The aRNA corresponding to the entire coding region of the gene (the region of the gene translated into protein) and the upstream (5 ′) and downstream (3 ′) non-coding regions. As a standard substance, a full-length aRNA corresponding to a specific gene may be used alone, or a full-length aRNA corresponding to a plurality of genes may be used in combination. A sample containing a standard substance full-length aRNA in a known amount is referred to as a standard sample. A sample containing a known amount of full-length aRNA corresponding to a plurality of genes is referred to as a pool standard sample.

  A sample obtained by fragmenting the full-length aRNA contained in the standard sample is referred to as a fragmented aRNA standard sample. A fragmented aRNA standard will contain fragmented aRNA in an amount corresponding to a known amount of full-length aRNA. A sample obtained by subjecting a mixture of fragmented aRNA standard samples to a plurality of genes or a pool standard sample containing known amounts of full-length aRNA corresponding to a plurality of genes to a fragmentation treatment is used as a fragmented aRNA pool standard sample Called.

  In general, a probe consists of an oligonucleotide selected from a full length of a gene or a denatured cDNA fragment, but a sample obtained by fragmenting a full-length aRNA represents the full length of the gene. Even if it is used, it is characterized in that it always contains a fragment that hybridizes with a specific probe on the microarray.

  In another embodiment of the present invention, a synthetic oligonucleotide containing a sequence corresponding to a part of a target gene and hybridizing to the probe is used as a standard substance. In this case, a sample containing a synthetic oligonucleotide as a standard substance in a known amount is referred to as a standard sample. The synthetic oligonucleotide used may be one kind or plural kinds. That is, the standard sample may contain a mixture of synthetic oligonucleotides for a plurality of genes. A sample containing a mixture of such synthetic oligonucleotides is referred to as a pool standard sample.

  Normalization means that a detection value measured under a specific condition can be compared with a detection value measured under a different condition, more specifically, for a test sample measured under a specific condition. The absolute value in the test sample is calculated by comparing the detection value with the detection value for a standard sample measured under the same conditions.

  Normalization means that when full-length aRNA is used as a standard substance, for example, the detection value in an aRNA test sample containing aRNA derived from mRNA of a specific gene prepared from the test sample is converted into the full-length aRNA of the same gene. It means calculating the absolute amount (for example, mol concentration or number of molecules) of aRNA contained in the aRNA test sample prepared from the test sample by comparison with the detection value in a standard sample containing a known amount. In addition, the absolute amount of aRNA contained in the aRNA test sample prepared from the test sample can be compared with the amount of cDNA derived from it, and hence the amount of mRNA derived from it, when measured under different conditions. Preferably calculating the amount of mRNA as an absolute amount.

  Standardization means that when a synthetic oligonucleotide is used as a standard substance, for example, a detection value in an aRNA test sample containing aRNA derived from mRNA of a specific gene prepared from the test sample corresponds to a part of the same gene. Calculating the absolute amount of aRNA contained in the aRNA test sample prepared from the test sample (for example, the mol concentration or the number of molecules) by comparing the detected value with a standard sample containing a known amount of the synthetic oligonucleotide Say. In addition, the absolute amount of aRNA contained in the aRNA test sample prepared from the test sample can be compared with the amount of cDNA derived from it, and hence the amount of mRNA derived from it, when measured under different conditions. Preferably calculating the amount of mRNA as an absolute amount.

  Specific conditions include, for example, the type of probe used, the design of the probe, the type of microarray, the amount of immobilized probe, the hybridization efficiency between the probe and the target, the detection / measurement method, the labeling method, and other temperatures. Measurement conditions such as pH and pH, and different conditions mean that one or more of the above conditions are different.

  The detection value refers to a detection value for the intensity of a signal indicating hybridization between the probe and the target, and the obtained signal and its intensity vary depending on the detection method of hybridization, the labeling method, and the type of label.

  The labeling method and the type of label are not particularly limited as long as hybridization between the probe and the target can be detected. For example, when aRNA is synthesized, a substrate (mainly UTP) to which a label such as biotin or an aminoallyl group is covalently bound is incorporated, and a dye is later bound to the labeling site of the reaction product. Hybridization with the target can be detected. In the present invention, such a labeling method is referred to as a uniform label. Alternatively, after aRNA is fragmented, the same label may be attached to the ends of each fragment by an organic chemical method or an enzymatic method, followed by binding of a dye or the like. Such a labeling method is referred to as a terminal labeling method (Cole, K. et al., Nucleic Acids Res. 32, e86, 2004, Liang, R-Q., Et al., Nucleic Acids Res. 33, e17, 2005). With respect to a synthetic oligonucleotide as a standard substance, a label can be incorporated during the synthesis. When the dye is bound to the label, this may be performed before hybridization or after hybridization. As a label, in addition to a pigment, those commonly used in the art, for example, radioisotopes, fluorophores, dyes, chemiluminescent, luminescent and photosensitizers can also be used. Furthermore, an enzyme, an enzyme fragment, an enzyme inhibitor, an antibody, a catalyst or the like may be bound. Using these labels, detection and quantification can be carried out according to radioimmunoassay methods and enzyme immunoassay methods.

  The test sample usually refers to a sample in which the target gene may be expressed, and is preferably a biological sample derived from a living object or a living object. For example, blood, serum, urine, tears, cells, organs, tissues, bone, bone marrow, lymph, lymph nodes, synovial tissue, chondrocytes, synovial macrophages, endothelial cells, skin, extracts and debris thereof, and Examples thereof include cultured cells, embryonic cells, stem cells, animal cell extracts, plant extracts, prokaryotic cell extracts, and eukaryotic single cell extracts. The test sample includes a sample derived from the above biological sample, for example, a sample in which a specific nucleic acid is amplified.

One embodiment of the present invention is a method comprising the following steps (a) to (d):
A standard sample containing a full-length aRNA, the standard sample having a known content of the full-length aRNA, and an aRNA test sample containing aRNA prepared from the test sample are each treated in the same manner. Step (a) of fragmenting aRNA,
For each of both samples, the step (b) of hybridizing the fragment obtained in step (a) with the probe,
Measuring the signal intensity based on the hybridization between the fragment and the probe for each of both samples (c), and
A step (d) of calculating the absolute amount of aRNA in the aRNA test sample by comparing the signal intensities obtained for both samples;

In other words, this embodiment can also be described as follows.
A step of fragmenting aRNA by treating a standard sample containing a known amount of full-length aRNA and an aRNA test sample prepared from the test sample in the same manner,
The step of hybridizing the fragmented aRNA contained in each sample with the probe, and detecting and comparing the signal intensity based on the hybridization obtained for both samples, the absolute amount of aRNA contained in the test sample is determined. A method comprising the step of calculating.

Another embodiment of the present invention is a method comprising the following steps (A) to (D):
A step of preparing a standard sample containing a synthetic oligonucleotide corresponding to a part of a target gene and containing a sequence that hybridizes to the probe, wherein the content of the synthetic oligonucleotide is known (A-i) ), A process of treating an aRNA test sample containing aRNA prepared from the test sample to fragment aRNA (A-ii),
A step (B) of hybridizing the oligonucleotide in the standard sample prepared in the step (A-i) and the fragment obtained in the step (A-ii) with the probe,
Measuring signal intensity (i) based on hybridization of the oligonucleotide and the probe, and signal intensity (ii) based on hybridization of the fragment and the probe (C), and
A step (D) of calculating an absolute amount of aRNA in the aRNA test sample by comparing the signal intensity (i) and the signal intensity (ii).

  The aRNA test sample is prepared by extracting mRNA from the test sample as described above, and subsequently performing cDNA synthesis and aRNA synthesis. The preparation method is not particularly limited and can be carried out by a conventional method.

A full-length aRNA or an aRNA in an aRNA test sample having a large molecular weight causes various problems when hybridized to the probe, but it can be efficiently hybridized to the probe by fragmenting the aRNA. And detection sensitivity can be increased. Fragmentation of aRNA in a full-length aRNA or near aRNA test sample can be performed by a method commonly used in the art, for example, an enzymatic cleavage method or a chemical cleavage method, eg, Mg A method of cutting in the presence of metal ions such as ²⁺ can be used.

  When a full-length aRNA standard sample is used as the standard sample, the full-length aRNA standard sample and the aRNA test sample are processed by the same fragmentation method. When a standard sample containing a synthetic oligonucleotide is used as the standard sample, the standard sample is not fragmented. Therefore, it can be carried out more easily with fewer steps than when a full-length aRNA standard sample is used.

  A signal based on hybridization refers to a signal indicating that the probe and the target have hybridized, and is usually a signal derived from a reaction product using a dye, an antibody, an enzyme, or the like bound to a label attached to the target. Point. The signal can be detected by a method corresponding to the label used, and the greater the signal intensity, the greater the amount of target contained in the test sample.

  Hereinafter, an example of an embodiment of the method of the present invention will be described. First, an example of an embodiment using full-length aRNA as a standard substance will be described.

Preparation of standard substance and preparation of calibration curve (1) Synthesis and purification of full-length cDNA and aRNA using the same transcription of entire coding region of gene and upstream (5 ') and downstream (3') non-coding region A full-length cDNA clone copied from mRNA is obtained in large quantities together with human genome analysis, its base sequence is determined, and compared with the sequence information of the genome.
When a cDNA clone has already been obtained and a promoter sequence that acts on RNA polymerase such as SP6 is attached to its 5 ′ end (full length cDNA with promoter), RNA polymerase is allowed to act in vitro using this, Full-length aRNA is synthesized from the promoter site.

  A full-length cDNA with a promoter can be obtained from a full-length cDNA clone without a promoter by performing PCR using sequences at both ends, and using a primer with a promoter sequence at that time. In the case of genes such as yeast and bacteria, there are many cases where there is no intron even if there is no cDNA clone, so based on the known genomic sequence, DNA corresponding to the coding region of each gene is synthesized by the PCR method, Primers are designed so that the SP6 promoter is attached to one end, and cDNA clones can be obtained in the same manner as described above. A full-length aRNA is synthesized by RNA polymerase using the full-length cDNA with a promoter as a template.

(2) Concentration measurement of synthesized full-length aRNA After the synthesis is completed, the full-length aRNA is purified with a column or the like, and its purity is examined. Next, an ultraviolet absorption curve of the sample is drawn with a spectroscope, and the concentration of full-length aRNA is measured based on the absorbance at 260 nm.

(3) Synthesis of uniform-labeled full-length aRNA During full-length aRNA synthesis, for example, aminoallyl-oligolated UTP or biotinylated UTP (hereinafter referred to as UTP derivative) is incorporated together with UTP and present in the full-length aRNA sequence. A label can be put on a part of U (uridine). After measuring the concentration of the product, it is defined as a uniform labeled full length aRNA (FIG. 1).

(4) Fragmentation of the synthesized labeled full-length aRNA Fragment by enzymatically cleaving the uniform-labeled full-length aRNA synthesized in (3) above with RNase III or the like or in the presence of a metal ion such as Mg ²⁺ Turn into. After cutting, confirm the cutting by electrophoresis or the like if necessary. This fragment is used as a uniform labeled fragmented aRNA standard sample of known concentration. The uniform labeled fragmented aRNA is allowed to bind to the dye in this state or after hybridization with the probe nucleic acid.

(5) Synthesis of end-labeled full-length aRNA In the above (2), if a non-derivatized UTP is used instead of the UTP derivative, a non-labeled full-length aRNA can be synthesized. The purity of full-length aRNA is assayed and quantified to give unlabeled full-length aRNA. This is cleaved and fragmented in the same manner as in (4) and then dephosphorylated using Shrimp Alkaline Phosphatase (SAP). Purification is performed by column purification or the like, the biotinylated donor is reacted in the presence of T4 RNA ligase (Cole, K. et al., Nucleic Acids Res., 32, e86, 2004), and the end is labeled with biotin or the like. Alternatively, other labels can be inserted according to Liang, RQ et al. (Nucleic Acids. Res. Supra). The obtained product is used as an end-labeled fragmented aRNA standard sample (FIG. 2).

(6) Dye labeling The labeled fragmented aRNA obtained by (4) or (5) is bound to a dye. The binding is performed before the hybridization or after the hybridization.

(7) Concentration adjustment of cleaved and labeled fragmented aRNA standard sample The concentration of the fragmented aRNA standard sample obtained in (4) or (5) is adjusted, and a set which is serially diluted to a plurality of concentrations is prepared (calibration curve ). When using a standard sample containing fragmented aRNA derived from multiple types of full-length aRNA, a full-length aRNA mixed sample having a known concentration is fragmented, or a full-length aRNA having a known concentration is used. A fragmented aRNA pool standard sample is prepared by fragmenting the standard sample and then mixing a certain amount to make a serially diluted set (FIG. 3).

(8) Preparation of calibration curve Each diluted solution of the serially diluted fragmented aRNA standard sample or fragmented aRNA pool standard sample is hybridized with the probe on the microarray, and compared to the full-length aRNA concentration in the standard sample before fragmentation A standard curve is drawn by plotting the signal intensity from the dye label (eg, FIG. 4).

Measurement of test sample mRNA is extracted from a test sample by a method usually used in the art. Subsequent operations (cDNA synthesis, aRNA synthesis, fragmentation thereof, labeling, hybridization, detection of signal intensity) allow the test sample and the standard sample to be processed according to the same protocol.

(1) Hybridization / Washing / Drying Each of the appropriate dilution series members of the fragmented aRNA standard sample or the fragmented aRNA pool standard sample suitable for the microarray to be used is individually separated from the target group of microarrays according to the protocol. Hybridize, and then wash and dry. Use at least one microarray for each dilution series. The binding between the UTP derivative and the dye may be performed before hybridization or may be performed after hybridization. The synthesis, fragmentation, labeling method, dye binding method, etc. of full-length aRNA are matched with the processing method of the test sample.

(2) Measurement of signal intensity based on hybridization In the case of a microarray, a scanner is used, and in the case of beads, a dedicated measurement device is used. The intensity of a signal derived from fragmented aRNA bound to the probe by analysis software. Is detected. The equipment to be used and the use conditions are the same for the standard sample and the test sample.

(3) Calculation of the conversion factor For the fragmented aRNA standard sample obtained from the full-length aRNA standard sample at each concentration, the signal intensity is plotted against each concentration of full-length aRNA in the standard sample, A correction coefficient is obtained for each probe. The correction coefficient varies depending on the target gene, and also varies depending on the microarray and method used.

  Further, when the calibration curve does not become a straight line due to use conditions such as a microarray, the absolute amount of aRNA in the test sample may be obtained using the calibration curve itself.

(4) Measurement of mRNA in a test sample mRNA is extracted from a test sample by a method usually used in the art and used as an mRNA test sample. Subsequent operations, ie, cDNA synthesis, aRNA synthesis, fragmentation thereof, labeling, hybridization, washing, drying, and detection of signal intensity are performed according to the same protocol as described above for standard samples. The protocol from the start of the mRNA test sample until obtaining the detection value and the protocol performed using the standard sample are completely the same including the equipment used.

(5) Calculation of the amount of mRNA in the test sample From the detection value of the signal intensity based on the hybridization between the aRNA fragment corresponding to the target gene or a group of aRNA fragments and the probe, using the correction coefficient obtained in (3). The expression level of the target gene can be measured by calculating the absolute value of the aRNA concentration in the test sample, and hence the amount of mRNA.

Absolute amount of mRNA in the test sample (mol)
= Correction coefficient (c) × (signal intensity−background value)

  The above operation is performed for each probe. In addition, when the calibration curve does not become a straight line due to the use conditions of the microarray or the like, the absolute amount of aRNA in the test sample is obtained using the calibration curve itself.

(6) Comparison of microarray data using standard substances When the above operation is performed on different microarrays, the amount of mRNA derived from the target gene contained in the test sample can be standardized under any measurement condition. For example, it is possible to compare data obtained using different experiments and different devices.

  According to the present invention, data such as microarrays can be standardized, and quantitative data relating to gene expression can be obtained more easily than in the past. As a result, even if different microarrays are used or different experimental techniques are used, the data can be compared and examined, so the research can be promoted efficiently.

  With the progress of genome research, almost all gene sequences can be identified, and due to the progress of full-length cDNA collection (Suzuki, Y. et al., Nucleic Acids res. 30: 328, 2002), today, Standard materials can be made. If these standard substances are mixed and used as a pool, in principle, the detection value of the component that hybridizes to all probes mounted on the microarray etc. is standardized, and this is corrected to determine the absolute amount. Is possible.

  Next, an example of an embodiment using a synthetic oligonucleotide as a standard substance will be described.

(1) Synthesis of oligonucleotide An oligonucleotide having a sequence complementary to the base sequence (known) of the probe is synthesized. The synthetic oligonucleotide may contain all of the sequence complementary to the base sequence (known) of the probe, or may contain only part of the complementary sequence as long as it hybridizes to the probe. . The length of the synthetic oligonucleotide is usually 70 mer or less, preferably 25 to 50 mer. The synthesis may be performed by a known method using an amidite reagent.

  The oligonucleotide incorporates a label (for example, isotope label) during synthesis, or after the synthesis is completed, a dye such as Cy5 is directly covalently bonded via a linker, or is labeled via a linker at the end. (ND Sinha, S. Striepeke: in Oligonucleotides and Analogues [F. Eckstein ed., Oxford University Press (1991) pp 185-210]).

(2) Preparation of standard samples A series of standard samples having different oligonucleotide concentrations are prepared. When a pool standard sample containing a plurality of types of oligonucleotides is used, a solution having a known concentration is mixed for each oligonucleotide type at a certain ratio, and then serial dilution is performed.

(3) Preparation of calibration curve Using each of the standard samples with different concentrations, the oligonucleotide is hybridized with the probe on the microarray, the signal is detected, and the signal intensity is plotted against the oligonucleotide concentration. Create

  The following steps: a step of preparing aRNA from a test sample and obtaining an aRNA test sample containing the aRNA, a step of fragmenting aRNA (A-ii), an oligonucleotide in a standard sample, and a step ( The step (B) in which the fragments obtained in A-ii) are each hybridized with the probe, the signal intensity (i) based on the hybridization between the standard oligonucleotide and the probe, and the test sample The step (C) of measuring the signal intensity (ii) based on the hybridization between the fragment and the probe, and comparing the signal intensity (i) with the signal intensity (ii), thereby aRNA in the aRNA test sample The step (D) of calculating the absolute amount of is basically the same as in the embodiment using full-length aRNA as a standard substance.

  The method for quantifying mRNA of a target gene of the present invention can also be applied to measurement of cross-hybridization using a gene other than the gene that is originally the measurement target of the probe as a target gene.

  In other words, the present invention also provides a method for detecting cross-hybridization between a probe and a nucleic acid derived from a test gene other than the gene targeted by the probe, the oligonucleotide comprising, for example, the test gene. The present invention relates to a method comprising using a corresponding full-length aRNA fragment or a synthetic oligonucleotide corresponding to a part of the sequence of the test gene.

  Cross-hybridization is a phenomenon in which when a prepared target is hybridized to a probe, a nucleic acid derived from a gene other than the gene targeted by the probe forms a non-specific double strand with the probe. Say. This is likely to occur when there is a complementary sequence in part of the target and probe sequences, and this is usually avoided by tightening the conditions for hybridization and washing.

  A normal microarray selects a specific site from the sequence of a target gene and carries an oligonucleotide probe designed with a certain length (for example, 25 mer or 50 mer). However, the possibility that this probe cross-hybridizes with mRNA-derived denatured cDNA or aRNA produced by the expression of different genes or a part thereof is not always excluded. This problem is particularly serious when denatured cDNA is used as a probe. Standards can also be used to test this problem. For example, when a fragmented aRNA obtained by fragmenting a full-length aRNA corresponding to a test gene is reacted with a microarray to be used, when there is a probe that hybridizes with the fragmented aRNA in addition to the corresponding probe This can be detected. This method can be applied not only to monitor cross-hybridization but also to the design of an optimal probe that detects only mRNA due to expression of the gene and does not detect mRNA due to expression of other genes. Also, by this method, when data that differs between different experimenters is obtained, it is possible to determine whether or not there is an influence due to the difference in the probe.

  Furthermore, the present invention is a method for comparing measured values measured using microarrays between lots of microarrays to which probes that are nucleic acid-related substances are immobilized or between commodities. And a step of hybridizing a target that is a detection target and a nucleic acid-related substance, and measuring a signal intensity based on the hybridization reaction, wherein the probe corresponds to a part of a gene that is the object of measurement and the probe The signal intensity is measured using a sample containing a known amount of an oligonucleotide containing a sequence that hybridizes to the target as the target, and the measured values are compared between lots of microarrays or between products. And also to the method.

  When the oligonucleotide is a fragment of full-length aRNA corresponding to the target gene and the amount of the full-length aRNA is known, this method can be used for sensitivity between all products having the same target gene. It can be used to verify differences.

  When the oligonucleotide is a synthetic oligonucleotide, it may be used for verification of differences between lots of the same product, verification of sensitivity differences between products with the same or almost the same fixed probe, etc. I can do it.

  The specific method for carrying out this method is the same as the signal intensity measurement method for the standard substance described above.

  EXAMPLES Hereinafter, although an Example demonstrates this invention, the scope of the present invention is not limited to the range of an Example.

  Eight types of clones were selected from the full-length cDNA library, uniform-labeled full-length aRNAs were prepared for these, and fragmented to prepare a dilution series of the fragmented aRNA, and a calibration curve was prepared (FIGS. 3 to 5). .

1. Preparation of cDNA Template A plasmid clone having a full-length cDNA was prepared by a conventional method (Suzuki, Y. et al., Nucleic Acids res. 30: 328, 2002). A total of 9 types of full-length cDNAs were obtained, 8 types for preparing calibration curves and 1 type for correcting errors between microarrays. For this purpose, each cDNA cloned into the pSPORT1 plasmid was subjected to PCR amplification using a common primer (this plasmid contains the SP6 promoter sequence in the direction of amplification of the antisense strand). The PCR template (in this case, the above plasmid) is diluted so that the amount in the reaction solution is less than 1 μg, and the PCR reaction is performed using DNA polymerase Takara ExTaq (TaKaRa CodePR001A) under the conditions of a total reaction solution amount of 100 μl. did. A PCR reaction solution excluding the PCR template was prepared in advance, and the reaction was started by adding 1 μl of the PCR template solution thereto. In PCR, after heating at 96 ° C for 5 minutes, repeat 35 cycles of 96 ° C for 15 seconds, 53 ° C for 15 seconds, 72 ° C for 2 minutes, and finally incubate at 72 ° C for 2 minutes, then leave at 4 ° C to complete the reaction. I let you.

2. Purification of PCR product The PCR product was purified using a QIAquick PCR Purification Kit (Qiagen) according to the protocol. For purification, centrifugation was performed and eluted with 50 μl of distilled water. This product was used as a full-length cDNA template for subsequent full-length aRNA synthesis by RNA polymerase.

3. Synthesis of full-length aRNA (standard substance) by SP6 RNA polymerase Using purified full-length cDNA as a template, full-length aRNA was synthesized using SP6 RNA Polymerase (TaKaRa Code 2520A) manufactured by Takara Bio Inc. The template DNA was 100 to 300 ng, the SP6 RNA polymerase was 50 U, the total reaction volume was 20 μl, incubated at 37 ° C. for 2 hours, DNase I was added, and the mixture was further incubated for 30 minutes. In this example, aminoallyl UTP was added during the synthesis reaction with RNA polymerase for the purpose of obtaining uniform-labeled full-length aRNA. The reaction product was purified with a column (Ambion aRNA Filter Cartridge). The solution containing this full-length aRNA was subjected to a Beckman Coulter DU Spectrophotometer DU80, an ultraviolet absorption curve was obtained, and the purity of the nucleic acid was assayed from the ratio of absorbance at 230 nm, 260 nm, and 290 nm. The concentration was determined. Further, it was confirmed by electrophoresis (Agilent 2100 Bioanalyzer) that there was no contamination with a low molecular weight nucleic acid synthesis substrate as necessary.

4). Fragmentation of standard substance (full length aRNA) The resulting uniform labeled full length aRNA was cleaved with Mg ²⁺ degradation buffer (40 mM Tris-acetate, pH 8.2, 100 mM KOAc, 30 mM MgOAc), and then Shrimp Alkaline Phosphatase ( It was dephosphorylated using SAP (USB Corp) (Cole, K. et al., Nucleic Acids res. 32, e86 (2004)).

5. The results of the uniform-labeled fragmented aRNA pool after the preparation and dilution of the uniform-labeled fragmented aRNA pool and the uniform-labeled fragmented aRNA pool are described. Eight kinds of fragmented aRNA standard samples obtained from eight kinds of full-length aRNA standard samples were mixed to 10 fmol based on the full-length aRNA, respectively, to obtain uniform-labeled fragmented aRNA pool standard samples. This pool standard sample was serially diluted to prepare dilution series of 1 fmol, 100 amol, 50 amol, and 10 amol.

6). Hybridization and Washing Each of the above-mentioned 5-step diluted pool standard samples was subjected to AceGene Human Oligo Chip 30K one chip version (Hitachi Software Engineering Co., Ltd./DNA chip laboratory), and hybridization and washing were performed according to the protocol. The signal intensity based on the dye was read with ScanArray 4000 and digitized with DNASIS Array (Hitachi Software Engineering Co., Ltd.).

7). Preparation of calibration curve A standard curve was created by plotting the signal intensity against the concentration of the full-length aRNA and plotting it for each standard sample corresponding to each gene (FIG. 4).

8). Standardization of signal intensity based on hybridization Extract mRNA from a test sample, and synthesize cDNA, aRNA, then fragmentation, hybridization, detection of signal intensity, etc. using the same protocol as the protocol for the above standard. Carried out. For each gene, the signal intensity based on the hybridization of the fragmented aRNA to the probe was detected, and the absolute value of the concentration of the aRNA prepared from the test sample was determined from the calibration curve obtained above (Fig. 5 and 6).

  As test samples, the following substances were purchased from Ambion and used. Sample name Liver Carcinoma (HepG2: cultured cell total RNA derived from human liver cancer) catalog number 7848. The obtained measured values were confirmed to be correct by the Sybr Green method using a Qiagen QRT-PCR kit.

For a pool standard sample containing three kinds of synthetic oligonucleotides, a dilution series of concentrations was prepared and a calibration curve was prepared.
(1) Oligonucleotide synthesis For each of the genes of glyceraldehyde-3-phosphate dehydrogenase (GAPD), paraoxonase 2 (PON2), and signal sequence receptor delta (SSR4), oligos corresponding to the partial sequences thereof Nucleotides were synthesized.

Their sequences are as follows:
GAPD oligonucleotide (AS-GAPDH): CACCACCTGGAGTACCGGGTGTACCGGAGG (SEQ ID NO: 1)
PON2 oligonucleotide (AS-PON2): GTAAGATATACGGTGTTTACTGGTGATGAAG (SEQ ID NO: 2)
SSR4 oligonucleotide (AS-SSR4): TAGCCGGAACACTAGATGATGGAACCGGAAG (SEQ ID NO: 3)
Specifically, oligonucleotides were synthesized and purified according to the protocol using Abacas (automatic synthesizer) developed by Sigma Genosys.

  Cy3 was bound to the synthesized oligonucleotide according to the method described in N.D. Sinha, S. Striepeke: in Oligonucleotides and Analogues [F. Eckstein ed., Oxford University Press (1991) p.p. 185-210].

(2) Preparation of dilution series A mixture (sodium chloride-sodium citrate buffer) containing the above three kinds of oligonucleotides at a concentration of 500 pM was prepared. It was diluted to prepare a mixture containing the three oligonucleotides at a concentration of 50 pM, 5 pM and 0.5 pM, respectively. To each of the prepared oligonucleotide mixtures, as an interchip standardization control, an oligonucleotide corresponding to a part of the gene for lactate dehydrogenase B (LDHB) was added to a concentration of 50 pM. The sequence of the LDHB oligonucleotide is as follows.
LDHB oligonucleotide (AS-LDHB): CTTCGATTTCTACACTACTCACAGAGGTCGA (SEQ ID NO: 4)

(3) Measurement Each of the mixtures prepared in (2) was subjected to AceGene Human Oligo Chip 30K one chip version (Hitachi Software Engineering Co., Ltd./DNA Chip Research Laboratories), and hybridization and washing were performed according to the protocol. . Next, the amount of Cy3 remaining on the substrate after washing by binding to the probe was measured.
The outline of the above operation is shown in FIG.

(4) Creation of calibration curve A calibration curve was created by plotting signal intensity against concentration for each oligonucleotide. The results are shown in FIG.

  As described above, when the base sequence of the probe fixed to the microarray is known, a calibration curve can be created using a synthetic oligonucleotide having a sequence complementary to that sequence as a standard substance, Based on the calibration curve, the mRNA of the target gene in the test sample can be quantified.

  The total number of microarrays currently in practical use is assumed to be close to 1 million / year. The majority of the data obtained using these microarrays can be corrected to absolute values by monitoring using full-length aRNA as a labeling substance after confirming the use conditions. The corrected value (absolute value) can be used for mutual comparison.

  In recent years, the base sequences of probes on a microarray are often published. Thus, when the base sequence of the probe is known, the measured value can be easily corrected to an absolute value by using a synthetic oligonucleotide having a sequence complementary to the base sequence.

A method for synthesizing uniform-labeled full-length aRNA and fragmented aRNA is shown. A method for synthesizing full-length aRNA and end-labeled fragmented aRNA is shown. The procedure for creating a calibration curve using a standard substance is shown. A calibration curve using the standard substance prepared in Example 1 is shown for each gene. 5 shows a standardization method of signal intensity based on hybridization using the calibration curve of FIG. The absolute value of the aRNA concentration in the aRNA test sample obtained based on the calibration curve is shown. An outline of a measurement method when a synthetic oligonucleotide is used as a standard substance is shown. A calibration curve when each synthetic oligonucleotide is used as a standard substance is shown.

Claims (10)

  It is expressed in a test sample by hybridizing a probe, which is a nucleic acid-related substance immobilized on a carrier, with a target, which is a detection target and a nucleic acid-related substance, and measuring the signal intensity based on the hybridization reaction. In quantifying the mRNA of the target gene being used, in addition to measuring the signal intensity based on the hybridization reaction for the test sample, the target corresponds to a part of the target gene and hybridizes to the probe. A target gene mRNA characterized by correcting and quantifying the mRNA amount of the target gene in the test sample by adding a known amount of an oligonucleotide containing the sequence to be reacted and measuring the signal intensity Quantification method.   The method according to claim 1, wherein the oligonucleotide is a fragment of full-length aRNA corresponding to the target gene, and the amount of the full-length aRNA is known.   A standard sample containing a full-length aRNA, the standard sample having a known content of the full-length aRNA, and an aRNA test sample containing aRNA prepared from the test sample are each treated in the same manner. Step (a) for fragmenting aRNA, for each of both samples, step (b) for hybridizing the fragment obtained in step (a) with the probe, for both samples, the fragment and the probe A step (c) of measuring a signal intensity based on hybridization with, and a step of calculating an absolute amount of aRNA in the aRNA test sample by comparing the signal intensities obtained for both samples (d) 3. The method of claim 2, comprising:   The method of claim 1, wherein the oligonucleotide is a synthetic oligonucleotide.   A step of preparing a standard sample containing the oligonucleotide and having a known content of the oligonucleotide (A-i), and processing an aRNA test sample containing aRNA prepared from the test sample The aRNA fragmentation step (A-ii) and the oligonucleotide in the standard sample prepared in step (Ai) and the fragment obtained in step (A-ii) are each hybridized with the probe. Step (B) for making soybean, step (C) for measuring signal intensity (i) based on hybridization between the oligonucleotide and the probe, and signal intensity (ii) based on hybridization between the fragment and the probe (C) And by comparing the signal intensity (i) and the signal intensity (ii), the absolute value of aRNA in the aRNA test sample Calculating a containing (D), The method of claim 4.   The method according to claim 1, wherein the probe is a probe on a microarray.   The method according to any one of claims 1 to 6, wherein the probe is a cross-hybridization measurement using a gene other than a gene originally intended for measurement as a target gene.   A method of comparing measured values measured using microarrays between microarray lots to which probes, which are nucleic acid-related substances, are immobilized, or between commodities, wherein the probe is a detection target and A step of hybridizing a target, which is a nucleic acid-related substance, and measuring a signal intensity based on the hybridization reaction, wherein a sequence corresponding to a part of a gene to be measured and hybridized to the probe The method, wherein the signal intensity is measured using a sample containing a known amount of an oligonucleotide containing the target as the target, and the measured values are compared between lots of microarrays or between commodities.   The method according to claim 8, wherein the oligonucleotide is a fragment of full-length aRNA corresponding to the target gene, and the amount of the full-length aRNA is known.   9. The method of claim 8, wherein the oligonucleotide is a synthetic oligonucleotide.

Images