JP2007020526A - Method for highly sensitively detecting target molecule by utilization of specific bond, and kit therefor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a label which can highly sensitively, regularly and stably be measured in excellent operability; to provide a labeling method using the same; and to provide an analysis method using the same. <P>SOLUTION: This method for detecting, identifying or determining a target molecule in a specimen comprises using a chemical substance-bound oligonucleotide as a label, and then cleaving a nucleic acid with a nuclease to detect the oligonucleotide, in detail, cleaving the nucleic acid with a flap end nuclease, in more detail, by an invader method. Preferably, the method for detecting, identifying or determining the target molecule in the specimen comprises bringing a chemical substance (hereinafter referred to as a labeled chemical substance) bound to an oligonucleotide as a label into contact with a specimen which contains or may contain a target molecule, to form a complex of the labeled chemical substance with a target molecule in the specimen, and then measuring the oligonucleotide in the complex by the invader method. The labeled chemical substance, the oligonucleotide for labeling and the measurement kit therefor are provided for the above method. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a measurement method using an oligonucleotide as a novel label, a labeling chemical substance, a labeling oligonucleotide, and a measurement kit therefor. More particularly, the present invention relates to a method of cleaving a nucleic acid using a oligonucleotide bound to a chemical substance as a label and cleaving the oligonucleotide using a nuclease, and more particularly using a flap endonuclease. More particularly, the present invention relates to a method for detection, identification or quantification by an invader method. More specifically, in the present invention, a chemical substance to which an oligonucleotide as a label is bound (hereinafter referred to as a labeled chemical substance) is brought into contact with a sample containing or possibly containing a target molecule. A method for detecting, identifying or quantifying a target molecule in a sample, comprising forming a complex between the labeled chemical substance and a target molecule in the sample, and measuring an oligonucleotide in the complex by an invader method, The present invention relates to a labeling chemical substance, a labeling oligonucleotide, and a measurement kit therefor.

Many chemical substances are involved in the activity and maintenance of individuals. Especially in living organisms, many chemical substances are involved in the growth, maintenance and activities of life. The physical or chemical behavior of these chemicals has been elucidated little by little. In particular, elucidation of specific interrelationships such as antigens and antibodies and ligands and receptors has been carried out, and these specific interactions are not only for maintaining health but also for diagnosing and treating diseases. Relevance has been gaining attention.
In particular, the antigen-antibody reaction is not only a highly specific reaction in which only the corresponding antigen and antibody selectively react, but also the antigen-antibody reaction occurring in vivo can be reproduced as it is in a test tube. It has been widely used for diagnosing and treating diseases.
However, it is impossible to directly detect the behavior of chemical substances, particularly the behavior of chemical substances in living organisms, and labeling has been performed to observe the behavior of these chemical substances.

Labeling is the modification of a part of the chemical substance to provide a measurable mark in order to obtain information on the chemical substance, such as detection, identification or quantification of the target chemical substance. . The first example in the biochemical field of labeled chemicals is said to be the 1904 F. Knoop experiment. In this method, a fatty acid in which the methyl group at the terminal of the fatty acid is replaced with a phenyl group is administered to a rabbit, and phenylacetic acid in urine is analyzed to propose a β-oxidation theory of fatty acids in vivo.
At present, isotopes such as deuterium, ¹³ C, ¹⁴ C, and ³² P, particularly radioactive isotopes are used as labels. A radioisotope can trace a chemical substance without greatly changing the chemical characteristics of the chemical substance, and is easy to detect. However, it is a big problem that it is radioactive.
In addition to isotope labeling, labeling for introducing a functional group is also performed. As the functional group, a group having absorption in the ultraviolet or visible region, a fluorescent group, or the like is used. However, these functional groups change the physical or chemical properties of chemical substances, and many of them are non-biological systems, which causes problems for in vivo applications.
Thus, labels are extremely important for measuring various behaviors of chemical substances, and a wide variety of labels have been developed. For example, in an immunoassay using an antigen-antibody reaction, a labeled immunoassay such as a radioimmunoassay (RIA) using a radioisotope, an enzyme immunoassay (EIA) using an enzyme, or a fluorescent immunoassay (FIA) using a fluorescent substance is generally used. It is becoming.

In recent years, a method using a nucleic acid such as DNA as a label has been developed, and attempts have been made to increase the sensitivity by amplifying the DNA by a PCR method. This method is an application of antibody-binding DNA (see Patent Document 1), which was originally used for detecting DNA by binding an antibody to the 5 ′ end of DNA, in an immunoassay. This is an attempt to increase the detection sensitivity of the antibody by binding DNA and amplifying it by PCR (see Patent Document 2 and Non-Patent Document 1). This method is currently used in the field of immunoassay as an immuno-PCR method (see Patent Documents 3 and 4).
The immuno-PCR method can infinitely amplify in principle and is an advantageous method in terms of sensitivity. However, the operation is complicated, quantification is difficult, and the variation in measured values is large. Compared with the ELISA method, the practicality is not sufficient.

  On the other hand, with the analysis of the human genome, gene polymorphism has attracted attention. RFLP (restriction enzyme fragment length polymorphism) method, direct sequencing method, ASO (Allele Specific Oligonucleotide) hybridization method, RNase A cleavage method, DOL (Dye-labeled) Various methods such as Oligonucleotide Ligation) method, TaqMan PCR method, MALDI-TOF / MS method (Matrix Assisted Laser Desorption-time of Flight / Mass Spectrometry) method, DNA chip method, and invader method have been developed. Many of the methods required amplification by PCR. Of these, the invader method does not require labeling of the analyte DNA as well as the signal probe and the invader oligo, and only the fret probe requires labeling. And the said fret probe is concerned only with the base sequence of the flap part, and is irrelevant to the base of the flap part in particular, is not influenced by the base sequence of the subject DNA at all, and can be arbitrarily determined regardless of the subject. Since it is based on a base, there was an advantage that mass production was possible and the cost for probe preparation could be greatly reduced.

JP-A-3-231151 US Pat. No. 5,665,539 Japanese translation of PCT publication No. 8-502413 JP 2003-504073 A Lab. Clin. Pract., 20: 110-114; 2002

  The present invention provides a label with higher sensitivity, no variation in measurement, capable of stable measurement and excellent operability, a labeling method using the same, and an analysis method.

The present inventors have developed high sensitivity of the invader method, which is a detection method of gene polymorphism, and found that various substances can be labeled by applying this invader method. The invader method is a method developed to detect single nucleotide polymorphisms in the genome, and exclusively detects single nucleotide polymorphisms in the sample DNA using invader oligos. deep. The invader method is widely known as one of the SNP typing methods. For example, the “SNP gene polymorphism strategy” edited by Yusuke Nakamura (Nakayama Shoten Co., Ltd., 2000) has details of the method. Are listed. FIG. 1 shows a schematic diagram of the nucleic acid single nucleotide polymorphism analysis method by the invader method.
This method is a method for determining that a base that is an SNP at the position “N” exists in the target DNA as shown in FIG. For this purpose, a signal probe (primary probe), an invader probe (secondary probe), and a fret probe (FRET probe) (fluorescence resonance energy transfer (FRET) probe) for detection are used. The signal probe has a complementary base sequence on the 5 ′ side from the SNP position of the sample DNA, and further has a base sequence portion called “flap”. The base sequence of the flap portion is a base sequence complementary to the base sequence on the 3 ′ side of the fret probe. The invader oligo has a complementary base sequence on the 3 ′ side of the sample DNA. The base “N” of the sample DNA at the position of the SNP (the position indicated by “N” in FIG. 1) is one of the bases A, T, G, and C of the single nucleotide polymorphism site, and the signal The base “N ₁ ” of the probe is a base capable of forming a normal base pair with N, and the base “N ₂ ” of the invader probe is an arbitrary base. The fret probe is a probe having a single-stranded portion for binding a flap portion on the 3 ′ side, and the 5 ′ side of the fret probe is formed so that all or a part thereof forms a double strand. In FIG. 1, the entire 5 ′ side is shown to form a double strand, but it is not always necessary to form a double strand. A luminescent dye “Ln” and a quenching substance “Q” are bound to the 5 ′ end portion of the fret probe. When the quenching substance “Q” is present within a certain distance of the luminescent dye “Ln”, the luminescence of the luminescent dye is quenched and the luminescence cannot be observed.

In the invader method, first, the signal probe and the invader oligo are bound to the sample DNA. At this time, the invader oligo is inserted between the base pair of the base “N ₁ ” of the signal probe and the base “N” of the sample DNA. The base “N ₂ ” comes in like an invader. Such a state is shown in the uppermost stage of FIG. When a cleaving enzyme (structure-specific 5 'nuclease) that specifically acts on the state in which these three bases are involved, this cleaving enzyme cleaves the signal probe at the position of the base “N ₁ ”. Thus, only the flap portion is formed. And this flap part couple | bonds with the 3 'side of a fret probe. This state is shown in the middle part of FIG. At this time, the tip portion including the base “N ₁ ” of the flap portion enters a state where it interrupts the double-stranded portion of the fret probe. This state is the same as the previous invader state, and becomes a specific cleavage position by the cleavage enzyme. Then, the 5 ′ end side of the fret probe is cleaved from the portion interrupted by the flap portion by the cleavage enzyme. The luminescent dye “Ln” is bonded to the 5 ′ side of the cleaved fret probe, and the luminescent dye “Ln” is separated from the quenching substance “Q” by this cleavage, and as a result, the luminescent dye “Ln”. It becomes possible to observe the light emission. Such a state is shown in the lowermost stage of FIG. The luminescent dye “Ln” is released from the quenching substance “Q” and exhibits original light emission. When the base “N ₁ ” of the signal probe cannot form a normal base pair with the base “N” of the sample DNA, the invader-like state does not occur, so that cleavage by the cleavage enzyme does not occur. Therefore, it can be determined by luminescence whether or not the base “N” of the analyte DNA is a base capable of forming a normal base pair with the base “N ₁ ” of the signal probe.
Unlike the conventional invader method, the invader method in the present invention is not intended to detect a single nucleotide polymorphism (SNP) of a sample DNA. The term “target DNA” is used in place of “analyte DNA”.

  As described above, the conventional invader method uses genomic DNA as an analyte and detects a single nucleotide polymorphism in the genomic DNA. By using a nucleic acid (oligonucleotide) such as DNA bonded to a substance, the nucleic acid can be detected and identified with high sensitivity without performing a complicated PCR method, and can be used as a labeling compound for a chemical substance. I found out that I can do it.

That is, the first feature of the present invention is to use an oligonucleotide as a label for a chemical substance. Further, the oligonucleotide is detected, identified or quantified by a method of cleaving a nucleic acid using a nuclease, preferably an invader method. This is a second feature.
The first feature of the present invention is to use a short oligonucleotide as a label to which the PCR method cannot be applied. In US Pat. No. 5,665,539 relating to immuno-PCR, a 2.67 kb DNA is used as a label and a 261 bp fragment is amplified using a primer of about 30 mer, but the oligonucleotide of the present invention is a signal probe in the invader method. When used as a (primary probe), about 10 to 100 mer, preferably about 20 to 60 mer is sufficient, and is distinct from the oligonucleotide as a label in the conventional immuno-PCR method in its length. It can be done. The oligonucleotide may be any of a signal probe (primary probe), an invader oligo (secondary probe), or a target DNA of the invader method in the above description. Preferably, the oligonucleotide is a target in the invader method described above. It is used as a DNA or signal probe (primary probe).
The second feature of the present invention is that the oligonucleotide is detected by a method of cleaving a nucleic acid using a nuclease, preferably a method of cleaving a nucleic acid using a flap endonuclease, more preferably an invader method, To identify or quantify. The method of cleaving nucleic acid using a nuclease in the method of the present invention will be described using the invader method as an example. The method is the same as the conventional invader method, but the subject is the same as in the conventional invader method. It is not for detecting the complementarity of one base in DNA (target DNA), but is different in that it is a method for assaying the presence or absence of an oligonucleotide as a label and its abundance.
Any one or both of these two features of the present invention are included in the scope of the present invention regardless of the means.

The present invention will be described more specifically.
The present invention uses an oligonucleotide bound to a chemical substance as a label, and uses the oligonucleotide to cleave nucleic acid using a nuclease, and more specifically to a method of cleaving nucleic acid using a flap endonuclease. More specifically, the present invention relates to a method for detecting, identifying or quantifying the presence of one base in the oligonucleotide by an invader method. More specifically, in the present invention, a chemical substance to which an oligonucleotide as a label is bound (hereinafter referred to as a labeled chemical substance) is brought into contact with a sample containing or possibly containing a target molecule. , By forming a complex between the labeled chemical substance and the target molecule in the sample, and cleaving the nucleic acid using a nuclease with the oligonucleotide in the complex, more specifically using a flap endonuclease More particularly, the present invention relates to a method for detecting, identifying or quantifying a target molecule in a sample, which comprises measuring the presence of one base in the oligonucleotide by an invader method.
The present invention also relates to an immunoassay using an oligonucleotide as a label and a method of cleaving the nucleic acid using a nuclease, and more specifically a method of cleaving a nucleic acid using a flap endonuclease. More specifically, the present invention relates to a method for detecting, identifying or quantifying the presence of one base in the oligonucleotide by an invader method. That is, the present invention provides use of a novel label in an immunoassay and a method for analyzing the same.
Furthermore, the present invention relates to a method for assaying (analyzing) various target molecules such as a binding assay and a competition assay, by using an oligonucleotide as a label, and cleaving the nucleic acid using a nuclease. More specifically, a target molecule consisting of detecting, identifying or quantifying the presence of one base in the oligonucleotide by an invader method is assayed by a method of cleaving a nucleic acid using a flap endonuclease (more specifically, an invader method). Analysis). That is, the present invention provides use of a novel label in various assays and a method for analyzing the same.

The present invention also relates to a chemical labeling agent comprising an oligonucleotide of 10 to 100 mer, preferably 10 to 60 mer, 10 to 40 mer, more preferably 20 to 60 mer, and 10 to 100 mer, preferably 10 to 60 mer, 10 It relates to the use of oligonucleotides of ˜40 mer, more preferably of 20-60 mer, as labels. Furthermore, when an oligonucleotide is used as the target DNA in the invader method, one having an integral multiple of this length can be used.
Furthermore, the present invention relates to a labeled chemical substance in which an oligonucleotide of 10 to 100 mer, preferably 10 to 60 mer, 10 to 40 mer, more preferably 20 to 60 mer is bound to the chemical substance as a label.
The present invention also includes at least one kind of labeled chemical substance in which an oligonucleotide of 10 to 100 mer, preferably 10 to 60 mer, 10 to 40 mer, more preferably 20 to 60 mer is bonded to the chemical substance as a label. The present invention relates to a method for cleaving a nucleic acid using a nuclease using an oligonucleotide as a label, preferably a method for cleaving a nucleic acid using a flap endonuclease, and more preferably a measurement kit by an invader method.
Furthermore, the present invention comprises at least one oligonucleotide selected from the group consisting of a signal probe (primary probe), an invader oligo (secondary probe), a target DNA, and a fret probe in the invader method. The present invention relates to a measurement kit by an invader method using an oligonucleotide as a label.

The aspect of the present invention will be described in detail as follows.
(1)
A method of detecting, identifying or quantifying a target molecule in a sample by using a oligonucleotide bound to a chemical substance as a label and cleaving a nucleic acid using a nuclease using the oligonucleotide.
(2)
A chemical substance to which an oligonucleotide as a label is bound (hereinafter referred to as a labeled chemical substance) is brought into contact with a sample containing or possibly containing a target molecule, and the labeling chemistry is performed. The target in the sample according to (1) above, which comprises forming a complex of a substance and a target molecule in the sample, and measuring the oligonucleotide in the complex by a method of cleaving a nucleic acid using a nuclease A method for detecting, identifying or quantifying molecules.
(3)
In the method for detecting, identifying or quantifying a target molecule in a sample, the method comprises using an oligonucleotide as a label and measuring the presence of the oligonucleotide by a method of cleaving a nucleic acid using a nuclease, (1) or A method for detecting, identifying or quantifying a target molecule in a sample according to (2).
(4)
The method according to any one of (1) to (3), wherein the oligonucleotide is a single-stranded DNA.
(5)
The method according to any one of (1) to (4) above, wherein the oligonucleotide is 10 to 1000 mer of DNA.
(6)
The method according to (5) above, wherein the oligonucleotide is 10 to 100-mer DNA.
(7)
The method according to (5) above, wherein the oligonucleotide is 10 to 60-mer DNA.
(8)
The method according to (5) above, wherein the oligonucleotide is 10 to 40-mer DNA.
(9)
The method according to any one of (1) to (8), wherein the chemical substance is protein, biotin, avidin, or nucleic acid.
(10)
The method according to (9) above, wherein the chemical substance is biotin.
(11)
The method according to any one of (1) to (10), wherein the labeled oligonucleotide is directly bound to the chemical substance.

(12)
The method according to any one of (1) to (11), wherein the nucleic acid cleaved by the nuclease is a labeled oligonucleotide.
(13)
The method according to any one of (1) to (11), wherein the nucleic acid cleaved by the nuclease is a nucleic acid produced based on a labeled oligonucleotide.
(14)
The method according to any one of (1) to (13), wherein the nucleic acid cleaved by the nuclease is a nucleic acid bound to a luminescent substance and a quenching substance.
(15)
The method according to (14), wherein the luminescent material has a rare earth fluorescent complex labeling agent.
(16)
The method according to (15), wherein the rare earth fluorescent complex labeling agent is a labeling agent comprising an Eu complex, a Tb complex, an Sm complex, or a Dy complex.
(17)
The method according to any one of (1) to (16), wherein the nuclease is a flap endonuclease.
(18)
The method according to any one of (1) to (17), wherein the method for cleaving a nucleic acid using a nuclease is an invader method.
(19)
The method according to (18), wherein the labeled oligonucleotide is a target DNA in an invader method.
(20)
The method according to (19) above, wherein the target DNA has one or two or more base sequences with which the signal probe can hybridize.
(21)
The method according to (19) or (20) above, wherein the signal probe has a base sequence capable of generating two flaps.
(22)
The method according to (19) or (20) above, wherein the signal probe has a base sequence that can function as an invader oligo of an adjacent signal probe.
(23)
The method according to any one of (1) to (22), wherein the method for detecting, identifying or quantifying a target molecule in a sample is an immunoassay.
(24)
The method according to (23), wherein the immunoassay is a sandwich assay.
(25)
The method according to (1) to (22) above, wherein the method for detecting, identifying or quantifying the target molecule in the sample is a binding assay.
(26)
The method according to any one of (23) to (25), wherein the chemical substance to which the oligonucleotide as a label is bound is biotinylated DNA.

(27)
A chemical labeling agent comprising 10 to 100 mer oligonucleotides.
(28)
The labeling agent according to (27), wherein the oligonucleotide is a 10 to 60-mer oligonucleotide.
(29)
The labeling agent according to (27), wherein the oligonucleotide is a 10 to 40-mer oligonucleotide.
(30)
The labeling agent according to any one of (27) to (29), wherein the oligonucleotide is a single-stranded DNA.
(31)
A labeling agent for a chemical substance comprising an oligonucleotide, wherein the base sequence of the oligonucleotide according to any one of (27) to (29) is repeated twice or more.
(32)
The labeling agent according to (31), wherein the base sequence is repeated twice to ten times.
(33)
Use as a 10-100mer oligonucleotide label.
(34)
The use according to (33) above, wherein the oligonucleotide is a 10-60mer oligonucleotide.
(35)
The use according to (33) above, wherein the oligonucleotide is a 10-40mer oligonucleotide.
(36)
The use according to any one of (33) to (35), wherein the oligonucleotide is single-stranded DNA.
(37)
Use of the oligonucleotide according to any one of (33) to (35) as a label for an oligonucleotide, wherein the oligonucleotide has the base sequence repeated twice or more.
(38)
The use according to (37) above, wherein the base sequence is repeated 2 to 10 times.
(39)
A labeled chemical with 10 to 100 mer oligonucleotides attached to the chemical as a label.
(40)
The labeled chemical substance according to (39), wherein the oligonucleotide is a 10-60mer oligonucleotide.
(41)
The labeled chemical substance according to (39), wherein the oligonucleotide is a 10 to 40 mer oligonucleotide.
(42)
The labeled chemical substance according to any one of (39) to (41), wherein the oligonucleotide is a single-stranded DNA.
(43)
The oligonucleotide characterized by having the base sequence of the oligonucleotide according to any one of (39) to (41) repeated twice or more, and labeled with a chemical substance as a label Chemical substance.
(44)
The labeled chemical substance according to (43), wherein the nucleotide sequence is repeated 2 to 10 times.
(45)
The labeled chemical substance according to any one of (39) to (44), wherein the chemical substance is biotin.

(46)
Measurement by a method of cleaving a nucleic acid using a nuclease using an oligonucleotide as a label, comprising at least one labeled chemical substance in which a 10 to 100-mer oligonucleotide is bound to the chemical substance as a label For kit.
(47)
The measurement kit according to (46), wherein the oligonucleotide is a 10 to 60-mer oligonucleotide.
(48)
The measurement kit according to (46), wherein the oligonucleotide is a 10 to 40-mer oligonucleotide.
(49)
The measurement kit according to any one of (46) to (48), wherein the oligonucleotide is a single-stranded DNA.
(50)
The oligonucleotide having a base sequence of 10 to 100 mer oligonucleotide is repeated at least twice and contains at least one kind of labeled chemical substance bonded to the chemical substance as a label. A measurement kit by a method of cleaving a nucleic acid using a nuclease using an oligonucleotide as a label.
(51)
The measurement kit according to (50), wherein the base sequence is repeated twice to ten times.
(52)
The method according to any one of (46) to (51), wherein the method for cleaving a nucleic acid using a nuclease using an oligonucleotide as a label is the method according to any one of (1) to (26) above. Measurement kit.
(53)
The measurement kit according to any one of (46) to (52), wherein the labeled chemical substance is biotin.
(54)
An oligonucleotide comprising at least one oligonucleotide selected from the group consisting of a signal probe (primary probe), an invader oligo (secondary probe), a target DNA, and a fret probe in the invader method is used as a label. Kit for measurement by the invader method.
(55)
The measurement kit according to (54), wherein the labeled chemical substance is biotin.

The “method of cleaving nucleic acid using nuclease” in the present invention (hereinafter sometimes referred to as “nucleic acid cleavage method” of the present invention) includes nucleic acids such as DNA, RNA, PNA and the like by nucleases. Any method can be used as long as it can be cleaved at a specific position. More specifically, a nucleic acid is cleaved by a nuclease to quench a luminescent substance such as a fluorescent substance bound to the nucleic acid and light emission from the luminescent substance. In this method, the quenching substance (quencher) to be separated can be separated, and as a result of the separation, light emission by the luminescent substance can be observed or measured from the outside. Nucleic acids that can be observed or measured from the outside by light-emitting substances such as fluorescent substances by cleaving nucleic acids with nucleases include, for example, fret probes by the invader method and tackman probes by the Tuckman PCR method. Such probes can be used in the method of the present invention, but the method of the present invention is not limited to the use of such probes.
The nuclease in this method of the present invention is not particularly limited as long as it can cleave a nucleic acid, but may be either an endonuclease or an exonuclease, and is an enzyme that acts on a double-stranded nucleic acid. Even an enzyme that acts on a triple strand or an enzyme that acts on a single-stranded nucleic acid may be used. Moreover, the enzyme which recognizes the higher order structure of a nucleic acid may be sufficient. The nuclease in this method of the present invention is capable of cleaving nucleic acids, and as a result, the luminescent substance and the quencher are separated (the distance between the luminescent substance and the luminescent substance is extinguished by the quencher). However, it is preferable that the nucleic acid to which the luminescent substance and the quencher are bound is selected without cleaving the oligonucleotide used as the label of the present invention. Nucleases that can be cleaved.
As a nuclease in this method of the present invention, for example, various restriction enzymes can be used. For example, by using a probe in which a luminescent substance and a quenching substance at both ends are bound, such as a Taqman probe, the luminescent substance and the quenching substance in the Taqman probe are removed by cleaving the intermediate site with a restriction enzyme or the like. As a result, light emission from the measurement system can be observed. However, in such a simple method, only one luminescent substance is released from an oligonucleotide as one label, and sufficient sensitivity may not be obtained. A method capable of selectively cleaving a nucleic acid bound to a luminescent substance and a quenching substance without cleaving the oligonucleotide used as the label of the present invention in order to perform high-speed and high-sensitivity measurement. Is preferred. In such a method, a large number of luminescent substances can be released from an oligonucleotide as one label, and highly sensitive measurement is possible.
Therefore, a particularly preferred embodiment of the “method of cleaving nucleic acid using nuclease” of the present invention includes a method capable of generating a large number of flaps from one target DNA, such as the invader method. Become. By such a method, quantitative measurement can be performed at high speed and with high sensitivity. Moreover, it does not require a complicated operation as in the PCR method and does not require a long nucleic acid as in the PCR method. For example, even if a relatively short nucleic acid of about 10 to 100 mer, preferably about 10 to 40 mer or 10 to 30 mer is used as a label, this method of the present invention makes it possible to obtain sufficient sensitivity.
In the following description, the “method of cleaving a nucleic acid using a nuclease” of the present invention will be described by taking an invader method as an example, but the method of the present invention is not limited to such a method. Absent.

In the case of the invader method, the oligonucleotide in the present invention can be used for any of a signal probe (primary probe), an invader oligo (secondary probe), or a target DNA. There is no particular restriction on DNA, and DNA or RNA may be used as long as hybridization is possible in a complementary sequence, but DNA is preferred. The oligonucleotide of the present invention is preferably a target DNA or signal probe (primary probe) in the invader method, particularly preferably a target DNA, and its length is not particularly limited, but nucleic acids used in the conventional immuno-PCR method For the distinction, 10 to 100 mer, preferably 10 to 60 mer, 10 to 40 mer, more preferably 20 to 40 mer oligonucleotide is preferable. For example, the oligonucleotide of the present invention will be described using the target DNA in the invader method as an example, but the present invention is not limited to this. The nucleotide sequence of the oligonucleotide of the present invention is not particularly limited. When the oligonucleotide of the present invention is used as a signal probe, the flap portion is 5 to 50 mer, preferably 10 to 40 mer, more preferably about 10 to 20 mer. And the rest is designed to be complementary to the target DNA. In this case, the invader oligo (secondary probe) is a sequence complementary to the remaining portion of the target DNA, and further has one base as an invader.
The relationship between such a signal probe (primary probe), invader oligo (secondary probe), target DNA, and fret probe in the present invention will be described with reference to a more specific base sequence as FIG. In this example, the oligonucleotide as a label of the present invention hybridizes to the 5 ′ end side of the target DNA as a signal probe (primary probe), and the flap portion is left unhybridized. Then, an invader oligo (secondary probe) hybridizes to the 3 ′ side of the target DNA, and one base enters the cleavage site, which is cleaved to generate a flap. This flap hybridizes to the fret probe, and similarly, one base enters, and the labeling site of the fret probe (in this example, the BPTA-Tb ³⁺ binding site) is cleaved, and fluorescence is observed. .
Moreover, although the case where the oligonucleotide of this invention is used as target DNA in an invader method is demonstrated to an example, this invention is not limited to this. In this case as well, the nucleotide sequence of the oligonucleotide of the present invention is not particularly limited, but the oligonucleotide of the present invention is 10 to 200 mer, preferably 10 to 60 mer, more preferably 20 to 60 mer, or the same sequence. It is also possible to use oligonucleotides having an integer multiple having a length of, for example, 2 times, 3 times, or even longer. In such a case, an oligonucleotide of 10 to 1000 mer, preferably 10 to 500 mer can be used as the oligonucleotide of the present invention. The oligonucleotide having such a length is about the same length as the oligonucleotide used in the conventional immuno-PCR method, but the oligonucleotide of the present invention has a clearly repetitive nucleotide sequence or its complementary sequence. It is different in that it has a simple arrangement. Longer oligonucleotides such as long nucleotides of 1 kb or more derived from living organisms can also be used.

The characteristics of the base sequence of the target DNA in the present invention are as follows (1) to (5).
(1) A part of the structure itself does not form a double strand. Moreover, target DNA does not form a dimer. There is no complementary sequence inside or between target DNAs.
(2) A sequence consisting of 10 to 100 bases, preferably 10 to 40 bases, has a repeated sequence with an appropriate space of 0 to 50 bases. The number of repeating sequences is preferably 1-10.
(3) One unit consists of sequences of two adjacent blocks, each sequence is 10 to 100 bases, preferably 10 to 40 bases, and this unit is repeated with an appropriate space of 0 to 50 bases Has an array. The number of repeating sequences is preferably 1-10.
(4) A base sequence in which the above two blocks hybridize with an invader oligo and a signal probe so that each region has a Tm value of about 50 to 65 ° C. is not limited to this range. , Tm can be adjusted to the optimum temperature of the enzyme used.
(5) Invader oligos or signal probes can be correctly overlapped to form a triplex. It is preferred that the invader oligo or signal probe does not misanneal on the target DNA.
If it has such a feature, an arbitrary base sequence can be set, and the oligonucleotide of the present invention is not limited to one having a specific base sequence.
Examples of the base sequence of the oligonucleotide of the present invention are shown below, but are not limited thereto.
In the case of one target area,
(1) 5'- AATCAAATCCAGTACCTGTGAATCAGGCT CCGGATTTGCTGAAGTGCAG-3 '
Invader oligo complementary region Signal probe complementary region
(Tm: 60 ° C) (Tm: 58 ° C)
(2) 5'- CAAGCAATGGATGATTTGATGCTGTCCC CCGGACGATATTGAACAATGGTTCACTGAA-3 '
Invader oligo complementary region Signal probe complementary region
(Tm: 61 ° C) (Tm: 61 ° C)
(3) 5'- GAATCGCACTATTGCCCATGATGACAATCG GTCCAGTAAGCGACTTGCAGGC-3 '
Invader oligo complementary region Signal probe complementary region
(Tm: 63 ° C) (Tm: 62 ° C)

If there are two or more target areas,
(4) As an example where the space between target units is 0 mer,
5'-GTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTGGTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG-3 '(86mer)
(5) As an example where the space between target units is 5 mer,
5'-GTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTGATCGTGTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG-3 '(91mer)
(6) As an example where the space between target units is 10 mer,
5'-GTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTGATCGTACGATGTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG-3 '(96mer)
(7) As an example of a 34-mer space between target units,
5'-GTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTGAATCAAATCCAGTACCTGTGAATCAGGCTCCGGAGTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG-3 '(120mer)
Etc. In addition, as an example of using a signal probe that has an invader oligo function,
(8) As an example of having 5 repetitions in the target sequence:
5'-GTGTCTGCGGGAGTGTGTCTGCGGGAGTGTGTCTGCGGGAGTGTGTCTGCGGGAGTGTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG-3 '(99mer)
Can be mentioned.

Examples of fret probes for exonuclease (Exonuclease)
5 '-(FAM) -ACTCCCGCAGACAC- (Dabcyl) -3'
As an example of the target DNA sequence corresponding to this,
5'- GTGTCTGCGGGAGT CGATTTCATCATCACGCAGCTTTTCTTTG-3 '
(The underlined portion indicates a complementary region with the fret probe.)
Is mentioned. Moreover, what repeated said complementary sequence 2-5 times can also be used.

In the method of the present invention, an oligonucleotide having two or more target regions can be used. By using an oligonucleotide having such a repeat, a plurality of flaps can be formed from one oligonucleotide as a label. It can be obtained in a short time, and high-speed and high-sensitivity measurement is possible. Oligonucleotides having such repetitions can be produced by various known methods.
For example, a method for producing a multi-target DNA having 6 to 10 repetitive sequences will be specifically described based on an example.
First, the following three types of oligonucleotides (1) to (3) are produced by an automatic synthesizer.
(1) It has a restriction enzyme NdeI recognition sequence at the 5 ′ end and a BamHI recognition sequence at the 3 ′ end.
5'-GGAATTCCATATG GTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG ATCGTATGCA GTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG GGATCCCG-3 '(117mer)
The underlined portion is a complementary region with the invader oligo and signal probe, has two repeats, and the space between the targets is 10 mer.
(2) It has a restriction enzyme BamHI recognition sequence at the 5 ′ end and an XhoI recognition sequence at the 3 ′ end.
5'-CGGGATCC GTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG ATCGTATGCA GTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG CTCGAGCGG-3 '(113mer)
The underlined portion is a complementary region with the invader oligo and the signal probe, has two repeats, and the space between the targets is 10 mer.
(3) BamHI recognition sequence at both ends.
5'-CGGGATCC GTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG ATCGTATGCA GTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG GGATCCCG-3 '(112mer)
The underlined portion is a complementary region with the invader oligo and the signal probe, has two repeats, and the space between the targets is 10 mer.

Next, the synthetic oligonucleotide (1) and the expression vector pET 22b (Merck) are cleaved with NdeI and BamHI, and the synthetic oligonucleotide (1) is ligated into the vector to obtain the synthetic oligonucleotide (1) as a vector. Incorporate inside. The vector incorporating the synthetic oligonucleotide (1) and the synthetic oligonucleotide (2) are cleaved with BamHI and XhoI, the synthetic oligonucleotide (2) is ligated, and the synthetic oligonucleotide (2) is incorporated into the vector. Further, this is cleaved with BamHI, and the synthetic oligonucleotide (3) is ligated at the cleavage site, and the synthetic oligonucleotide (3) is incorporated into the vector. By this operation, an oligonucleotide having 6 target regions can be produced. However, the synthetic oligonucleotide (3) has the same restriction enzyme site at both ends, and therefore there is a possibility that a plurality of oligonucleotides may enter at the same time. Yes, oligonucleotides with 6 or more target regions can be simultaneously produced by this method. Since the number of repetitions of the target sequence contained in the vector can be estimated from the length by direct PCR, an oligonucleotide having a desired length can be obtained from several clones.
Then, a primer is designed for the sequence on the vector, PCR of the target region is performed, and then PCR using only one primer is performed to obtain single-stranded DNA. At this time, a biotin-labeled target can be produced by using a biotin-labeled primer.

  In the invader method of the present invention, the light emitting material of the fret probe is preferably a fluorescent material, such as a fluorescent dye such as FAM (mono-5 (or 6) -carboxyfluorescein). In order to improve the detection sensitivity, a rare earth fluorescent complex labeling agent as a luminescent dye in a fret probe, for example, the following general formulas (1) to (6) as a ligand may be used.

(In the formulas (1) to (6), n represents an integer of 1 to 4, R represents an aryl group having a substituent, and R ′ represents an amino group, a hydroxyl group, a carboxyl group, a sulfonic acid group, or an isothiocyanate. A rare earth fluorescent complex of rare earth elements comprising samarium (Sm), europium (Eu), terbium (Tb), dysprosium (Dy), or the like, which contains any one of the ligands represented by: A labeling agent is preferable (see Japanese Patent Application Laid-Open No. 2003-325200 and Japanese Patent Application No. 2005-106860). Moreover, as a quencher in a fret probe, a fluorescence quencher labeling agent is preferable, for example, the following general formulas (7) to (9)

(In the formulas (7) to (9), m represents an integer of 1 to 4, _one of R ₁ and R ₂ represents a linker group for fixing to a carrier or nucleic acid, and the other represents a hydrogen atom or alkyl. R ₃ represents a linker group for fixing to a carrier or a nucleic acid.) (See JP 2003-325200 A and Japanese Patent Application No. 2005-106860). . Here, the description of Japanese Patent Application Laid-Open No. 2003-325200 and Japanese Patent Application No. 2005-106860 is incorporated herein by reference.

The chemical substance to be labeled in the present invention is not particularly limited, and includes various chemical substances that can be labeled. Examples of the chemical substance of the present invention include, for example, proteins such as antigens, antibodies, biotin and avidin, nucleic acids such as vitamins, hormones, lipids, carbohydrates, sugar chains, aromatic compounds, enzymes and aptamers, low molecular ligands or ligand receptors. A group consisting of (excluding antibodies). The low molecular ligand herein refers to an organic compound such as a sugar chain, aromatic compound, ganglioside, oligosaccharide, peptide having 2 to 10 amino acids, such as myc peptide, thyroxine, triiodothyronine, ganglioside. Examples include G _M2 , cellobiose, and sugar chains having sialic acid at the terminal. The ligand receptor refers to a substance that specifically binds to a specific ligand present in a cell, a cell, or between cells, and examples thereof include a cellulose-binding protein, a sialic acid-binding lectin, and an albumin receptor. Further examples of small molecule ligands or receptors include, for example, hormones or hormone receptors such as insulin, insulin receptor, EGF, EGF receptor, HGF, HGF receptor, TSH, TSH receptor, cytokines such as IL-8 or receptors for chemokines And receptors for small molecule ligands such as acetylcholine receptor and histamine receptor.
In addition, enzymes such as protein kinase C, cAMP-dependent protein kinase, cGMP-dependent protein kinase, calmodulin-dependent phosphorylase, and tyrosine phosphorylase can also be measured by the ligand-receptor reaction and can be used as the chemical substance of the present invention. Furthermore, various lectins for various sugar chains and gangliosides can also be used as the chemical substance of the present invention. Examples of lectins include concanavalin A for D-mannose bound to various proteins on cells, wheat germ agglutinin for di-N-acetylchitobiose, horseshoe crab-derived sialic acid-binding lectin for sialic acid, and the like.
As the nucleic acid, DNA in which various deoxyribonucleic acids (dATP, dGTP, dTTP, dCTP, dUTP) are continuous, RNA in which various ribonucleic acids (rATP, rGTP, rTTP, rCTP, rUTP) are continuous, PNA, LNA, and also these chimeras can be used as the chemical substance of the present invention. When a nucleic acid is used as the chemical substance of the present invention, the sequence may be a continuous sequence with the oligonucleotide as the label of the present invention, and the entire labeled chemical substance may be a nucleic acid.
Further, the chemical substance of the present invention may be immobilized on a carrier or fine particles.

In the present invention, the “bonding” between the oligonucleotide as the label and the chemical substance may be a direct bond between the chemical substance and the oligonucleotide as the label, or the linker and the like are bound together. It may be indirectly bonded through a group for the purpose. Such “bond” is preferably a chemical bond such as a covalent bond, but is not limited thereto, and may be a physical bond such as adsorption, which is not separated in the measurement system. I just need it.
The invader method in the present invention is not limited to the basic method exemplified above, but a method in which a flap is generated due to the presence of an invader base and a state that can be measured by this flap can be formed. If it is. That is, a triple chain part is formed in one part, preferably one base part in the base sequence, and this part is designated as a specific cleavage enzyme (structure-specific 5 'nuclease) (hereinafter referred to as FEN as a specific enzyme). The method includes a method in which an oligonucleotide that can be recognized by a fret probe (partially hybridizable) can be released by the cleavage. By this method, it becomes possible to handle the oligonucleotide for labeling such as target DNA and the fret probe to be observed in the observation system completely, and the measurement sensitivity and S / N ratio are separated from the label. Can be considered.
The complex in the present invention is a substance that is chemically or physically combined with a chemical substance (labeled chemical substance) to which the oligonucleotide of the present invention as a label is bound, for example, an antigen and an antibody. And a multimer of a protein such as an enzyme.
The immunoassay in the present invention is not particularly limited as long as it is an analysis method based on an antigen-antibody reaction using a label, and any method such as a sandwich assay may be used. In addition, a streptavidin-biotin system may be used or may not be used, but in order to have versatility, those bound to biotin are preferable.
The assay of the present invention is not limited to the above-described immunoassay, and includes various assays such as a binding assay such as a ligand and a receptor, and a competitive assay.
Therefore, the sample in the present invention contains or may contain a substance that can be chemically or physically combined with the labeled chemical substance of the present invention to form a complex. All are included.
Furthermore, the label of the present invention is not limited to those used in the assay, but includes cases where it is used as a tracer. Therefore, the labeled chemical substance of the present invention includes a case where no complex is formed.

The method of the present invention can be used in the same manner as the conventional method by using the oligonucleotide of the present invention instead of the conventional label in a method using a conventional label such as an isotope or a fluorescent substance. . Specific examples of these will be described in more detail in examples described later.
As a method of binding a chemical substance such as biotin and the oligonucleotide label of the present invention, a technique such as a conventional DNA labeling method can be used as it is. In particular, a conjugate of biotin and the oligonucleotide of the present invention is useful as a versatile labeling reagent and can be used in the same manner as an assay system using a conventional avidin-biotin system.
In the examples described later, examples of using the target DNA in the invader method as the oligonucleotide of the present invention are shown, but the method of the present invention is not limited to this, and a signal probe is used as the oligonucleotide of the present invention. It is also possible to use an invader oligo as a label.

Moreover, the triple chain part by an invader oligo will be cut | disconnected by FEN and a flap will be produced, but it can also be designed to provide not only one such triple chain part but two or more places. For example, in the basic invader method, as shown in FIG. 3, one point is cut by FEN, and one flap is generated. In FIG. 3, N ₁ to the 3 ′ end, which is a complementary sequence portion between the target DNA and the signal probe, hybridize with the target DNA, and further, a complementary sequence portion between the invader oligo and the target DNA. From the 5 ′ end to the base before N2 hybridizes with the target DNA. Then, the base N _{2 at} the end of the invader oligo forms a triple chain portion, and as a result, one flap is generated by FEN from one oligonucleotide of the present invention (see the lower side of FIG. 3). In such a method of use, in principle, one flap is generated from one labeled oligonucleotide.
More specifically, for example, as a target DNA,
5'-GTGTCTGCGGGAG-T-CGATTTCATCATCACGCAGCTTTTCTTTG-3 '
As a signal probe,
5'- AACGAGGCGCAC -ACTCCCGCAGACAC-3 '
As an invader oligo,
5'-CAAAGAAAAGCTGCGTGATGATGAAATCG-C-3 '
By using, a flap (underlined portion) can be generated.
Many more flaps can be generated from a single labeled oligonucleotide. For example, it is not impossible to amplify the labeled oligonucleotide by the PCR method or the like. However, not only is the operation complicated, but also quantification becomes difficult when the amplification by the PCR method does not ensure the quantification. Furthermore, when amplifying by the PCR method, a length of at least about 100 bp is necessary, and there is a problem that a longer oligonucleotide must be used as a label.

A simpler method for generating a large number of flaps from one labeled oligonucleotide is to use a signal probe that generates two flaps. For example, as shown in FIG. 4, from one signal probe and target DNA, FEN is used as a cleavage enzyme for cleaving the 5′-side flap of the signal probe, and Hef is used as a cleavage enzyme for cleaving the 3′-flap. By using (Helicase-associated Endonuclease for Fork-structured DNA, derived from Pyrococcus furiosus (Komori et al. (2002) Genes Genet. Syst. 77: 227-241)), two flaps can be generated. For this purpose, as target DNA, for example,
5'-GTTTCTTTTCGACGCACTACTACTT-TGAGGGCGTCTGTG-TTCATCATCACGCAGCTTTTCTTTG-3 '
As a signal probe,
5'- AACGAGGCGCAC -ACTCCCGCAGACAC- AACGAGGCGCAC -3 '
By using, two flaps (underlined portions) can be generated. That is, a doubled labeled product can be obtained from one labeled oligonucleotide, and the sensitivity of the label increases.

In the method described above, Hef is used as a cleavage enzyme for cleaving the 3 ′ flap, but it is also possible to simply bind two or more signal probes. For example, as shown in FIG. 5, it can be designed so that a plurality of signal probe binding sites are repeated so that a plurality of signal probes can bind to the target DNA. This is a simple repetition of the conventional invader method that produces a single flap as described above. In this method, the length of the oligonucleotide used as a label is increased by the number of repeats, but multiple flaps at a time using only FEN as the cleavage enzyme to cleave the 5 'flap. And the sensitivity as a label can be remarkably increased.
Similarly, the above-described method of simultaneously generating two flaps using FEN as a cleavage enzyme for cleaving the 5 ′ flap and Hef as a cleavage enzyme for cleaving the 3 ′ flap is repeated. The oligonucleotides of the invention can be designed so that they can be used. For example, the method shown in FIG. 4 can be simply repeated to design as shown in FIG.

Furthermore, in the simple repetition method shown in FIG. 5, invader oligos are required for the number of repetitions, but the invader oligos can be omitted. For example, an oligonucleotide synthesized by repeating a sequence complementary to a signal probe is used as a target DNA, and a site to which a signal probe binds and a site to which an invader oligo binds are provided (see FIG. 5). However, at this time, one more base is added to the 3 ′ end side of the signal probe so that this part forms a triple chain with the adjacent complementary sequence. That is, the binding site of the signal probe is directly used as the binding site of the invader oligo. This is conceptually illustrated in FIG. In this technique, the invader oligo is not used, and the binding portion of the signal probe with the target DNA also serves as the invader oligo. For example, as target DNA,
5 '-(GTGTCTGCGGGAGT) × n-CGATTTCATCATCACGCAGCTTTTCTTTG-3'
(N represents an integer of 2 or more.)
As a signal probe,
5'-AACGAGGCGCAC-ACTCCCGCAGACAC-C-3 '
The signal probe is used as an invader oligo for the adjacent signal probe. In this case, since the invader oligo is not present in the first signal probe, a flap cannot be generated, but a flap is generated from the subsequent signal probe.
Of course, invader oligos can also be used in this method. By using such an invader oligo, a flap can be generated from the first signal probe.

The oligonucleotide base sequence as a label of the present invention may be of any length as long as it is long enough to generate a triple-stranded portion by invader oligo or the like, and the sequence can be designed arbitrarily. The oligonucleotide may be artificially produced by synthesis or may be natural. When natural oligonucleotides derived from living organisms are used as the labeled oligonucleotides of the present invention, the base sequences of signal probes and invader oligos may be designed so as to correspond to them. When a relatively long oligonucleotide derived from a living body is used as a label of the present invention, there are many sites for designing corresponding signal probes and invader oligos, and therefore one or more of these appropriate sites are arbitrarily selected. be able to. The above-described application examples can be used in appropriate combination.
Furthermore, in the method of the present invention, the method of using an oligonucleotide itself bound to a chemical substance as an oligonucleotide in a direct invader method, for example, as a signal probe or target DNA has been described. is not. For example, by hybridizing with a DNA having a base sequence complementary to the oligonucleotide as a label of the present invention bound to a chemical substance, only the DNA hybridized with the labeled oligonucleotide is separated, and this is used in the invader method. It can also be used as a signal probe, target DNA or invader oligo. More specifically, for example, a short DNA of about 10 to 100 mer, preferably about 10 to 50 mer, more preferably about 10 to 20 mer is used as an oligonucleotide as a label of the present invention, and a sequence containing a sequence capable of hybridizing with the oligonucleotide is used. A second oligonucleotide, which is hybridized with a signal probe, target DNA in the invader method, or DNA having a length sufficient for use as an invader oligo, and separates a second oligonucleotide that does not hybridize in the measurement system; Subsequently, the hybridized second DNA can be separated and separated, and the obtained hybridized second oligonucleotide can be analyzed by an invader method.
In addition to these points, improvements can be made in various respects. However, the feature of the present invention is that the oligonucleotide is used as a label, and that “the method of cleaving nucleic acid using nuclease”, The analysis is preferably performed by a method of cleaving nucleic acid using a flap endonuclease, and more preferably by an invader method. Even if improvements are made in other respects, those skilled in the art will readily understand that these methods are all included in the present invention as embodiments of the present invention.

In the first aspect, the measurement kit of the present invention is labeled with an oligonucleotide having a length of 10 to 100 mer, preferably 10 to 60 mer, 10 to 40 mer, more preferably 20 to 40 mer, or an integer multiple of these. The present invention relates to a measurement kit based on an invader method using an oligonucleotide as a label, which contains at least one kind of labeled chemical substance bonded to the chemical substance. Such chemical substances labeled with the oligonucleotide of the present invention include proteins such as antibodies and receptors, various antigens, fluorescent substances, chemical substances containing radioisotopes, and specific substances such as biotin and avidin. And chemical substances having a good affinity. Among these, biotin is a substance that is often used in current assay systems, and since it can be easily applied to currently used assay systems, biotin bound to the oligonucleotide of the present invention is particularly preferred. It is not limited to this. The measurement kit of the present invention contains at least one chemical substance labeled with the oligonucleotide of the present invention, and in addition, substances necessary for measurement, such as antibodies, antigens, buffers A solution, avidin, etc. and various probes required for the analysis of an invader method can be contained.
The second embodiment of the measurement kit of the present invention comprises at least a signal probe in the invader method (primary probe), an invader oligo (secondary probe), and / or a target DNA, and / or a fret probe. A kit for measurement by an invader method using an oligonucleotide as a label. Such a measurement kit can be applied directly to a genomic SNP analysis kit except for the target DNA, but the SNP analysis kit analyzes a large number of types of target DNA in a short time. However, the kit of the present invention is for detecting, identifying or quantifying a target DNA whose base sequence has been determined, and is basically the point that the target DNA is determined. It is different. That is, this measurement kit of the present invention is a kit for detection, identification or quantification of a probe having a known base sequence, and is a measurement kit in which the DNA to be measured is specified. This measurement kit of the present invention may contain all three types of probes: a signal probe (primary probe), an invader oligo (secondary probe), and a target DNA in the invader method. In this case, one of them, preferably the target DNA is used by binding to the target chemical substance. In addition, in the measurement system using the chemical substance to which the oligonucleotide of the present invention is already bound, there is a lack of one of the three types of probes: signal probe (primary probe), invader oligo (secondary probe), and target DNA. For example, a combination of a signal probe (primary probe) and an invader oligo (secondary probe), a combination of an invader oligo (secondary probe), and a target DNA may be used. Furthermore, when there is no need to use an invader oligo as in the application example, a combination without an invader oligo may be used. Among the measurement kits of the present invention, in addition to the oligonucleotides described above, other necessary ones such as a cleavage enzyme such as FEN and Hef for specifically cleaving the triple chain, a fret probe, and a buffer solution May be contained.

In the analysis by the invader method of the present invention, generation of a flap is required, but a fret probe for analyzing this is not necessarily essential, and if there is other means for analyzing the generated flap, the fret probe is particularly necessary. There is no need to use. However, an analysis method using a fret probe has been widely used as an invader method for SNP analysis, and an analysis method using a fret probe has many economical advantages.
In general, a fret probe has a light emitting substance and a quenching substance. As the fret probe of the present invention, any light emitting substance and any quenching substance can be used as long as they can be measured. In the method of using the oligonucleotide of the present invention as a label, since the oligonucleotide is measured with a fret probe, the sensitivity and measurement range of the entire measurement system largely depend on the properties of the fret probe. Selection is important in a sense. It is particularly preferable to use a fret probe with high sensitivity and specificity. As a preferable fret probe, a luminescent substance using a rare earth element rare earth fluorescent complex labeling agent such as samarium (Sm), europium (Eu), terbium (Tb), or dysprosium (Dy) is preferable. Those using a europium (Eu) complex are preferred.

The present invention provides a novel concept of using an oligonucleotide as a labeling substance in a measurement system such as an assay. Although it has been known to use long DNA as a label as in the immuno-PCR method, it requires not only a complicated and skillful operation of the PCR method, but also a measurement range and a base capable of PCR. The label itself has to be a very large molecular species. On the other hand, the label of the present invention uses a shorter oligonucleotide, has a small size as a label, has little influence on the characteristics of the target chemical substance, and has the characteristics of the target chemical substance. Measurements can be made without significant changes, and the measurement range is wide.
Furthermore, in the method of the present invention, the “method of cleaving nucleic acid using nuclease”, preferably by applying the invader method, can be measured with extremely high sensitivity, and the number of generated flaps is increased. As a result, measurement with higher sensitivity becomes possible, and the measurement limit in the conventional measurement method can be further improved.
In addition, the method of the present invention does not require the use of radioactive substances or highly toxic substances, and allows safe measurement.
Furthermore, since the method of the present invention measures the generated flap, there is no need for complicated operations or operations that require skill, and it is possible to stably obtain safe and reliable measurement results with a simple method. it can.
In addition, the method of the present invention can apply the invader method as a conventional SNP analysis method, and can process a large amount of specimens on a plate and a chip.

  EXAMPLES Hereinafter, although an Example demonstrates this invention more concretely, this invention is not limited at all by these Examples.

Sandwich immunoassay using rabbit IgG (Rabbit IgG) as an antigen After anti-rabbit IgG antibody was immobilized, it was blocked with 1% BSA and 0.2% glycine to prevent nonspecific reaction. This was reacted with rabbit IgG at respective concentrations of 0.005 pg / mL to 50000 pg / mL, then sandwiched with biotin-labeled anti-rabbit IgG antibody, and biotinylated DNA (target DNA) was bound via avidin. It was. After washing this 10 times, 50 ml of a probe mix described later was added and reacted at 63 ° C. for 1 hour, and the fluorescence intensity of FAM was measured.
The labeled DNA used here is used as a target DNA in analysis by the invader method, and its sequence is
5'-AAGGA GAAGG TGTCT GCGGG AGTCG ATTTC ATCAT CACGC AGCTT TTCTT TG-3 '
Met.
The sequence of the signal probe (primary probe), invader oligo (secondary probe), and fret probe (FRET probe) in the probe mix is as follows:
Signal probe:
5'-AACGA GGCGC ACACT CCCGC AGACA C-3 '
Invader oligo (secondary probe):
5'-CAAAG AAAAG CTGCG TGATG ATGAA ATCGC-3 '
FRET probe:
5'-GCTTG TCTCG GTTTT TCCGA GACAA GCGTG CGCCT CGTT-3 '
In the fret probe (FRET probe), FAM is bonded to the 5 ′ end, and DABCYL is bonded to the third base from the 5 ′ end as a quencher.
The probe mix used was
PH FEN 10ng / mL
FAM fret probe 125nM
Signal probe 125nM
Invader Oligo 50nM
MgCl ₂ 7.5 mM
tRNA 5ng / mL
Tris-HCl (pH 7.4) 10 mM
Tween 20 0.05%
It consisted of.
The results are shown graphically in FIG. The vertical axis of FIG. 8 shows the fluorescence intensity of FAM, and the horizontal axis shows the concentration (pg / mL) of the added rabbit IgG. The black circles in FIG. 8 show the results of Example 1 of the present invention, and the black squares show the results of the ELISA method described later. As a result, as shown in FIG. 8, the detection limit of rabbit IgG was 5 pg / mL, the detection range was 50000 pg / mL to 5 pg / mL, and the average CV% was 3.
The detection limit was the concentration at which the value obtained by adding 3 times the standard deviation (n = 4) to the fluorescence intensity of the negative control (NC) coincided with the calibration curve.

Comparative Example 1
In the method described in Example 1, instead of using an oligonucleotide as a label, a conventional enzyme labeling method (ELISA method) was used.
The results are shown by black square marks in FIG. 8 in comparison with the method of the present invention in Example 1. As a result, in the enzyme measurement method (ELISA method), the detection limit was 449 pg / mL, the detection range was 50000 pg / mL to 500 pg / mL, and the average CV% was 9.
It was found that the detection sensitivity of the method of the present invention was increased by an order of magnitude compared to the enzyme measurement method, and the slope was large and measurement was possible even at a low concentration.

Direct assay using rabbit IgG as an antigen After immobilizing rabbit IgG at each concentration of 0.05 pg / mL to 500,000 pg / mL, it was blocked with 1% BSA and 0.2% glycine to prevent non-specific reactions. . After reacting with a biotin-labeled anti-rabbit IgG antibody, biotinylated DNA (target DNA) was bound via avidin. Thereafter, in the same manner as in Example 1, after washing 10 times, 50 ml of the probe mix was added, reacted at 63 ° C. for 30 minutes, and the fluorescence intensity of FAM was measured.
The results are shown graphically in FIG. The vertical axis in FIG. 9 shows the fluorescence intensity of FAM, and the horizontal axis shows the concentration (pg / mL) of the added rabbit IgG. As a result, as shown in FIG. 9, the detection limit of rabbit IgG was 6 pg / mL, the detection range was from 500,000 pg / mL to 6 pg / mL, and the average CV% was 1.7.

Sandwich immunoassay using human TNF-α as antigen Antigen-antibody complex by incubating each concentration of TNF-α and biotinylated TNF-α antibody diluted on a microplate immobilized with TNF-α antibody for 2 hours at room temperature Formed. After adding 100 ng / ml streptavidin and incubating at room temperature for 1 hour, the plate was washed 3 times with buffer A (0.05 M Tris-HCl buffer (pH 7.8) containing 0.05% Tween-20), and then buffered. B (0.05 M Tris-HCl buffer (pH 7.8)) was washed once (hereinafter, washing was performed in the same manner). Similarly to Example 1, 0.1 nM biotinylated DNA (target DNA) was bound via avidin. After washing, the plate was further washed three times with water, 50 mL of probe mix was added, and reacted at 63 ° C. for 1 hour. The fluorescence intensity of FAM was measured by Chameleon (manufactured by HIDEX) at an excitation wavelength (Ex.) Of 485 nm and an emission wavelength (Em.) Of 530 nm.
The results are shown graphically in FIG. The vertical axis of FIG. 10 shows the fluorescence intensity of FAM, and the horizontal axis shows the concentration (pg / mL) of added TNF-α. The results of Example 3 are indicated by black circles in FIG. As a result, as shown in FIG. 10, the detection limit of TNF-α was 0.65 pg / mL, the detection range was 1000 pg / mL to 0.65 pg / mL, and the average CV% was 3.2.

Comparative Example 2
In the method described in Example 3, instead of using an oligonucleotide as a label, a conventional enzyme labeling method (ELISA method) was used. In enzyme measurement, streptavidin-HRP was added to the antigen-antibody complex and incubated at room temperature for 30 hours, and then reacted with TMB at room temperature for 30 minutes. After adding Stop solution, OD450nm was measured with Chameleon.
This result is shown by a black square mark in FIG. As a result, in the enzyme measurement method (ELISA method), the detection limit was 26 pg / mL, the detection range was from 1000 pg / mL to 26 pg / mL, and the average CV% was 4.5.
As a result, it was found that the method of the present invention has excellent sensitivity compared to the conventional enzyme measurement method (ELISA method).

Experiment Using Rare Earth Fluorescent Complex as Fluorescent Dye Instead of the FAM fret probe described in Example 1, DTBTA europium complex (Eu-DTBTA) was bound as a fluorescent dye to the 5 ′ end, and the fourth from the 5 ′ end. The assay was performed under the same procedures and conditions as described in Example 3 except that time-resolved fluorescence measurement was performed using a fret probe in which BHQ2 (registered trademark) was bound as a quencher to a base. In the time-resolved fluorescence measurement, the fluorescence intensity of Eu-DTBTA was measured with Chameleon (manufactured by HIDEX) at an excitation wavelength (Ex.) Of 340 nm, an emission wavelength (Em.) Of 616 nm, a delay time of 100 μs, and a window time of 400 μs.
The results are shown by black circles in the graph in FIG. The vertical axis in FIG. 11 indicates the fluorescence intensity of Eu-DTBTA, and the horizontal axis indicates the concentration (pg / mL) of added TNF-α. As a result, as shown in FIG. 11, the detection limit of TNF-α was 1.9 pg / mL, the detection range was 1000 pg / mL to 1.9 pg / mL, and the average CV% was 7.

Comparative Example 3
In the method described in Example 4, instead of using an oligonucleotide as a label, a conventional enzyme labeling method (ELISA method) was used.
This result is shown by a black square mark in FIG. As a result, in the enzyme measurement method (ELISA method), the detection limit was 20 pg / mL, the detection range was 1000 pg / mL to 20 pg / mL, and the average CV% was 4.5.
As a result, it was found that the method of the present invention has excellent sensitivity as compared with the conventional enzyme measurement method (ELISA method).

Glycoprotein sugar chain and lectin binding assay and quantification method Milk-derived lactoferrin was used as a glycoprotein model. Lactoferrin has the following sugar chain structure (Matsumoto et al., Journal of Biochemistry, 91 (1), 143-155, 1982)

This is recognized by lentil lectin (LCA):

Since it was consistent with the sugar chain structure (Taniguchi et al., Biophysical Chemistry, 35 (3), 199-204, 1991), an attempt was made to assay lactoferrin binding by the method of the present invention using LCA.
Each concentration of lactoferrin (manufactured by Wako) diluted with 0.05 M carbonate buffer (pH 9.3) was coated on a 96-well fluoronunk module microplate (manufactured by Nunc) at 100 μl per well at 4 ° C. overnight. After washing 3 times with buffer A (0.05 M Tris-HCl buffer (pH 7.8) containing 0.05% Tween-20), buffer B (0.05 M Tris-HCl buffer (pH 7.8)) was used. Washed once (hereinafter, washing was performed in the same manner). The mixture was incubated with 1% BSA (manufactured by Sigma) at room temperature for 1 hour for blocking, washed, and then incubated with 5 μg / ml biotinylated LCA for 1 hour at room temperature to form a biotinylated LCA-lactoferrin complex. After adding 100 ng / ml streptavidin and incubating at 37 ° C. for 1 hour, it was reacted with 0.01 nM biotinylated DNA (target DNA) at room temperature for 30 minutes in the same manner as in Example 1. After washing, it was further washed 3 times with water. As in Example 1, 50 mL of probe mix was added and reacted at 63 ° C. for 1 hour. The fluorescence intensity of FAM was measured with an excitation wavelength (Ex.) Of 485 nm and an emission wavelength (Em.) Of 530 nm by Chameleon (manufactured by HIDEX).
The results are shown graphically in FIG. The vertical axis in FIG. 12 indicates the fluorescence intensity of FAM, and the horizontal axis indicates the concentration (pg / mL) of the added lactoferrin. Black circles indicate the results of Example 5 of the present invention, and black squares indicate the results of the ELISA method described later. As a result, as shown in FIG. 12, the detection limit was 7.3 pg / mL, the detection range was 10000 pg / mL to 7.3 pg / mL, and the average CV% was 3.3.

Comparative Example 4
In the method described in Example 5, instead of using an oligonucleotide as a label, a conventional enzyme labeling method (ELISA method) was used. For enzyme measurement, streptavidin-HRP was added to the biotinylated LCA-lactoferrin complex and incubated at 37 ° C. for 1 hour, and then reacted with TMB at room temperature for 30 minutes. After adding Stop solution, OD450nm was measured with Chameleon.
This result is shown by a black square mark in FIG. As a result, in the enzyme measurement method, the detection limit was 65 pg / mL, the detection range was from 10,000 pg / mL to 100 pg / mL, and the average CV% was 13.2.
It was found that the detection sensitivity of the method of the present invention was increased by one digit and less varied than the enzyme measurement method.

  As an application example of the method described in Example 5, it is known that sugar chain structures such as glycoproteins and glycolipids change in cancerous cells and various diseases. There have already been reports of detecting changes in sugar chains using lectins and using them in the diagnosis of cancer and liver diseases. As a conventional technique, detection by Western blotting or a lectin column is generally used, but as an antibody-lectin enzyme immunoassay (Taniguchi et al., Biophysical Chemistry, 35 (3), 199-204) A method for rapidly detecting a glycoprotein having a specific sugar chain in such a form has also been developed. This time, combining the lectin and the Invader method as a detection method, it is more sensitive than the antibody-lectin enzyme immunization method and easier than the Western blot method (the Western blot requires about 6-7 hours, In this method, it takes about 5 hours (multiple specimens can be handled at the same time and diagnosed quickly). In biochemical experiments and the like, a trace amount of sugar chains can be detected more quickly than in the past.

Cell protein expression assay by the method of the present invention (1) Detection of actin protein expression by HT-1080 cells 0.55 × 10 5 cells / well of HT-1080 cells (human fibrosarcoma) were placed in a 96-well microplate, The cells were coated by incubating in 5% aqueous formalin solution at room temperature for 15 minutes. The cell-coated wells were then washed with PBS buffer and incubated for 5 minutes in PBS buffer containing 0.01% Triton X-100. After washing again with PBS buffer, mouse anti-human actin, smooth muscle antibody (1:10) (UK-Serotec Ltd) and antibody-free negative control were incubated at room temperature for 2 hours.
After washing again with PBS buffer, biotinylated anti-mouse IgG (1: 100) was added and incubated at room temperature for 1 hour to form a biotinylated antigen-antibody complex.
In order to detect the obtained biotinylated antigen-antibody complex by the method of the present invention, 1000 ng / ml of streptavidin was added, incubated at room temperature for 1 hour, and then buffer A (containing 0.05% Tween-20) After washing 3 times with 0.05M Tris-HCl buffer (pH 7.8)), it was washed once with buffer B (0.05M Tris-HCl buffer (pH 7.8)). .)
Next, in the same manner as in Example 1, it was reacted with 0.1 nM biotinylated DNA (target DNA) at room temperature for 30 minutes. This was washed and then washed three times with water.
In the same manner as in Example 1, 50 mL of probe mix was added, and the mixture was reacted at 63 ° C. for 25 minutes. Was used to measure the fluorescence intensity of FAM.
The results are shown graphically in FIG. The vertical axis in FIG. 13 indicates the fluorescence intensity of FAM, and the horizontal axis indicates the case where added biotinylated anti-mouse IgG is added (Positive) and the case where it is not added (Negative). As a result, in the quantification by the method of the present invention, it was confirmed that the fluorescence intensity of the cells containing the actin protein expressed in the positive control HT 1080 cytoplasm was increased as compared with the negative control.

(2) Quantification method of actin protein by HT-1080 cells Cell numbers of 0.55 × 10 ⁵ cells, 0.275 × 10 ⁵ cells, 0.1375 × 10 ⁵ cells, and 0.034 × 10 ⁵ cells / well Cells (HT-1080) were placed in a 96-well microplate, and each was incubated in a 5% formalin aqueous solution at room temperature for 30 minutes to coat the cells, followed by the same procedure as described in (1) above for the protein. Quantification was attempted.
The results are shown in the graph of FIG. The vertical axis of FIG. 14 shows the expression intensity (fluorescence intensity) of the actin protein, and the horizontal axis shows the number of cells (× 10 ⁵ cells / well). As a result, as shown in FIG. 14, in this method of the present invention, the fluorescence intensity was observed almost in proportion to the concentration of actin protein, and it was confirmed that it could be used for quantitative measurement.

Detection of apoptosis by the method of the present invention Apoptosis is a term that combines apo (off) and ptosis (falling), and is contrasted with mitosis, the symbol of "life". . Apoptosis is a biological control mechanism that removes cells that are no longer necessary in the living body, and also has the meaning of biological defense that eliminates cells that have become abnormal due to mutation or injury. In other words, “live renewal” by the self-erase function of normal and abnormal cells is the essence of apoptosis. Not only in the field of morphogenesis but also in the medical field, the pathological mechanism, the biological significance of apoptosis relating to diagnosis and treatment is discussed. In order to conduct research on apoptosis, it is important to establish a technique for accurately and sensitively detecting apoptosis, and the method of the present invention will be described as a method for simply detecting this.
(1) Detection of early apoptosis In the initial stage of apoptosis, the integrity of the cell membrane is maintained, but the asymmetry of the membrane phospholipid is lost. Along with this, the negatively charged phospholipid phosphatidylserine localized inside the cell membrane is exposed on the cell surface. Annexin V, which is a Ca ²⁺ -dependent phospholipid binding protein, selectively binds to phosphatidylserine to detect apoptosis. In the present invention, biotinylated annexin V is used to bind biotinylated synthetic DNA (target DNA) via avidin. In the same manner as in Example 1, early apoptotic cells are detected by the method of the present invention.
Since there is a report (Biol Pharm Bull 2002; 25, 1546-1549 Ikeda K et al) that apoptosis was induced by administering Magnolol to HT-1080 cells used in Example 6, HT- Early apoptosis was detected using 1080 cells by the following procedure.
1 × 10 ⁵ cells / well of HT-1080 cells (human fibrosarcoma) are placed in a 96-well microplate, incubated overnight at 37 ° C. in a carbon dioxide incubator, and 0 μM and 75 μM magnolol (manufactured by Wako) are placed. Furthermore, it incubated at 37 degreeC overnight with the carbon dioxide gas incubator. Next, the culture medium containing magnolol is discarded, 200 μl of 1 × binding buffer (BioVision) is added, and 5 μl of biotinylated annexin V (BioVision) and 5 μl of propidium iodide (BioVision) are added. Incubated for 5 minutes at room temperature in the dark. Next, after washing once with 1 × binding buffer, the cells were coated with a 5% formalin PBS solution at room temperature for 15 minutes and coated. Next, the cell-coated wells were washed with PBS buffer, and then incubated for 1 hour at room temperature in PBS buffer containing 1% BSA for blocking.
In order to detect the immobilized biotinylated annexin V by the method of the present invention, 1000 ng / ml streptavidin was added and incubated at room temperature for 1 hour, and then buffer A (0.05 M containing 0.05% Tween-20 was added) After washing 3 times with Tris-HCl buffer (pH 7.8)), it was washed once with buffer B (0.05 M Tris-HCl buffer (pH 7.8)).
Next, in the same manner as in Example 1, it was reacted with 0.1 nM biotinylated DNA (target DNA) at room temperature for 30 minutes. This was washed three times with buffer A, washed once with buffer B, and then further washed three times with water.
In the same manner as in Example 1, 50 mL of probe mix was added and reacted at 63 ° C. for 60 minutes, and then excitation wavelength (Ex.) 485 nm and emission wavelength (Em.) By a fluorescent plate reader (Chameleon; manufactured by HIDEX, Finland). ) The fluorescence intensity of FAM was measured at 530 nm.
As a result of the fluorescence intensity measurement, it is confirmed that the fluorescence intensity of positive (75 μM) containing magnolol is increased compared to negative (0 μM) not containing magnolol, and early apoptotic cells can be detected. confirmed.

(2) Detection of late-stage apoptosis Apoptosis is performed based on nuclear chromatin condensation when apoptosis proceeds as a cell death different from necrosis and the integrity of the plasma membrane is lost. And, DNA fragmentation of nucleosome (about 180 base pairs) units by endonuclease activity characterizes apoptosis.
In this method, biotin-labeled deoxyuridine triphosphate (dUTP) is added to the double-stranded break of DNA using terminal deoxynucleotidyl transferase (TdT). Then, biotinylated DNA (target DNA) was bound via avidin. In the same manner as in Example 1, late apoptotic cells are detected by the method of the present invention.
6 μm rat thymus (positive control including late apoptosis) slide (manufactured by Trevigen) in xylene for 5 minutes, 2 times: 100% ethanol for 1 minute, 2 times: in 99% ethanol for 1 minute, 3 times: in water for 1 minute, 5 Deparaffinized and hydrophilized in the order of the times. Next, it was immersed in protein K (Protein K) for 20 minutes at room temperature, and then washed twice with water for 2 minutes. Next, after immersing in a quenching solution (manufactured by Trevigen) for 5 minutes, it was immersed in PBS buffer for 1 minute, and then immersed in TdT labeling buffer (manufactured by Trevigen) at room temperature for 5 minutes. Next, 50 μl of TdT enzyme (manufactured by Trevigen) and labeling buffer (positive) or labeling buffer alone (negative, no enzyme) were added, and hybridization was carried out in a humid box at 37 ° C. for 1 hour. Next, it was immersed in a TdT stop solution (manufactured by Trevigen) for 5 minutes and washed once with PBS buffer for 5 minutes. Next, 50 μl of anti-BrdU (anti-BrdU) (manufactured by Trevigen) was added, and hybridization was performed in a humid box at 37 ° C. for 1 hour. Further, the plate was washed 3 times for 5 minutes with PBS buffer containing 0.05% Tween20. After that, the following reaction was performed by surrounding the specimen with dacopen.
In order to detect the obtained fragmented DNA and biotin-labeled deoxyuridine triphosphate complex by the invader method of the present invention, 1000 ng / ml streptavidin was added and incubated at room temperature for 1 hour, and then buffer A (0. After washing three times with 0.05 M Tris-HCl buffer (pH 7.8) containing 05% Tween-20, the resultant was washed once with buffer B (0.05 M Tris-HCl buffer (pH 7.8)). Next, it reacted with 0.1 nM biotinylated synthetic DNA at room temperature for 30 minutes. After washing 3 times with the above buffer A, it was washed once with buffer B, and further washed 3 times with water. Next, the probe mix was added and reacted at 63 ° C. for 90 minutes. Next, 20 μl of the reaction solution was placed in a black microplate with 384 holes, and the fluorescence intensity of FAM was measured at an excitation wavelength (Ex.) Of 485 nm and an emission wavelength (Em.) Of 530 nm using a fluorescence plate reader (Chameleon; manufactured by HIDEX, Finland). Was measured.
As a result of the fluorescence intensity measurement, it was confirmed that the positive fluorescence intensity with TdT increased compared to the negative without terminal deoxynucleotidyl transferase (TdT). It was confirmed that can be detected.

Receptor-Ligand Binding Assay In the method of the present invention, the present invention is carried out using a ligand molecule as a chemical substance. This enables application to cell receptor expression, measurement of its activity, ligand search for receptors (for example, orphan receptors), or receptor search for specific ligands.
For example, laminin is one of cell adhesion factors and is known to exhibit an action via a receptor (laminin receptor) on the cell surface. Previous studies have reported that among the amino acid sequence of laminin, the Tyr-Ile-Gly-Ser-Arg (YIGSR) sequence corresponding to β-chains 929-933 gives conjugation to the laminin receptor. In fact, even a 5-amino acid peptide having only this sequence has been reported to bind to the receptor and inhibit the action of laminin. Therefore, a receptor-ligand binding assay is performed using a ligand having this sequence as a probe.

1 × 10 ⁵ cells / well of HT-1080 cells (human fibrosarcoma) were placed in a 96-well microplate and cultured overnight, each containing 0, 5 μg / well of biotinylated YIGSR peptide and incubated at 37 ° C. for 1 hour. After washing three times with PBS buffer, the cells were incubated in a 5% formalin PBS solution at room temperature for 15 minutes to coat cells. Next, the cell-coated wells were washed with PBS buffer, and blocked by incubation in PBS buffer containing 1% BSA for 1 hour at room temperature.
In order to detect the receptor-ligand complex by the method of the present invention, 1000 ng / ml of streptavidin was added and incubated at room temperature for 1 hour, and then buffer A (0.05 M Tris-HCl containing 0.05% Tween-20) was used. After washing 3 times with buffer (pH 7.8)), it was washed once with buffer B (0.05 M Tris-HCl buffer (pH 7.8)). Next, it reacted with 0.1 nM biotinylated synthetic DNA at room temperature for 30 minutes. After washing the buffer A three times and the buffer B, it was further washed three times with water.
In the same manner as in Example 1, 50 mL of probe mix was added and reacted at 63 ° C. for 60 minutes, and then excitation wavelength (Ex.) 485 nm and emission wavelength (Em.) By a fluorescent plate reader (Chameleon; manufactured by HIDEX, Finland). ) The fluorescence intensity of FAM was measured at 530 nm.
The result is shown in FIG. The vertical axis in FIG. 15 indicates the fluorescence intensity of FAM, and the horizontal axis indicates the presence or absence of the prepared biotinylated YIGSR peptide. As shown in FIG. 15, it was observed that the fluorescence intensity increased when 5 μg of biotinylated YIGSR peptide was added compared to the negative control without biotinylated YIGSR peptide, confirming that the receptor could be detected. It was.

mRNA assay In the method of the present invention, DNA (or RNA) having a sequence complementary to all or part of mRNA is disposed as a chemical substance. Thereby, the measurement of the gene expression pattern and expression level in a cell can be performed by the method of the present invention.
For example, matrix metalloproteinases (MMPs) are enzymes that decompose extracellular matrix such as collagen. These enzymes are related to cancer cell invasion and metastasis and are known to be highly expressed in cancer cells. In particular, MMP-2 (or gelatinase A, 72-kDa gelatinase, or 72-kDa type IV collagenase) has been reported to be constitutively expressed in fibrosarcoma cells such as HT-1080 cells. Therefore, an mRNA assay is performed targeting MMP-2 mRNA.
Cell coating was performed by taking 1.1 × 10 ⁵ cells of HT-1080 in each well of a 96-well plate and incubating in 5% formalin aqueous solution for 15 minutes. Next, after washing with PBS buffer, the target gene is activated by soaking in Target Retrieval Solution (manufactured by Dako) for 40 minutes, and then treated with 0.2N HCl for 20 minutes. did. This was washed 3 times with DEPC water for 1 minute, then treated with 95% ethanol for 1 minute, 100% ethanol for 1 minute for dehydration, and air-dried with cold air.
Biotinylated MMP2 and endogenous control GAPDH (Glyceraldehyde Phosphate Dehydrogenase) probe (sense and antisense, each 2 μg / mL) were diluted with RNA in-situ hybridization solution to add 10 μL, and hybridized. It was covered with a slip hybridization cover (Hybrislip Hybridization cover) and allowed to hybridize overnight at 37 ° C. The cover was then removed in a 50-fold diluted Stringent wash solution warmed to 40 ° C. and incubated for 20 minutes at 40 ° C. Thereafter, it was again incubated in fresh wash solution for 20 minutes at 40 ° C.
Subsequently, it was immersed in TBS buffer (50 mM Tris-HCl, 159 mM NaCl, PH 7.6) for 5 minutes at room temperature. After adding 1000 ng / mL streptavidin and incubating at room temperature for 1 hour, the cells were washed 3 times with buffer A (0.05 M Tris-HCl buffer (pH 7.8) containing 0.05% Tween-20). Washing was performed once with buffer B (0.05 M Tris-HCl buffer (pH 7.8)) (hereinafter, washing was performed in the same manner).
Next, it was reacted with 0.1 nM biotinylated DNA (target DNA) at room temperature for 30 minutes, washed, and further washed three times with water.
Subsequently, 50 mL of probe mix was added like Example 1, and it was made to react at 63 degreeC for 60 minutes. Next, the fluorescence intensity of FAM was measured with a chameleon (Chameleon (manufactured by HIDEX)) at an excitation wavelength (Ex.) Of 485 nm and an emission wavelength (Em.) Of 530 nm.
The result of MMP2 is shown in FIG. 16, and the result of GAPDH is shown in FIG. The vertical axis in FIGS. 16 and 17 indicates the fluorescence intensity, and the left side of each figure shows the case of the sense strand and the right side shows the case of the antisense strand. As a result, as shown in FIGS. 16 and 17, in the quantification of the method of the present invention, the fluorescence intensity of the cell to which the antisense (complementary to mRNA) probe was added is 1.5 times or 2 as compared with the sense. It was shown that it was rising twice.

Detection of specific DNA in the cell without extracting the intracellular DNA by the method of the present invention The expression of the specific DNA in the cell can be detected using the biotinylated probe of the present invention without extracting the DNA of the cell. Attempted detection and identification. In the following experimental examples, detection and identification of intracellular single-copy virus DNA were performed as specific DNA.
A slide (manufactured by Dako) on which 1 to 2 copies of papilloma 16 virus were infected was attached to xylene for 5 minutes, 2 times, 100% ethanol for 1 minute, 2 times, 99% ethanol for 1 minute, 3 times, water For 1 minute for 5 minutes in order, deparaffinized and hydrophilized.
Next, after immersing in Target Retrieval Solution (manufactured by Dako) at 95 ° C. for 40 minutes, the target gene was activated by leaving it at room temperature for 20 minutes. After washing with water for 5 minutes for 1 minute, it was air-dried to room temperature, and the sample was surrounded with dacopen.
A positive probe (manufactured by Dako) having a biotin-labeled human HPV16 sequence and a negative probe (manufactured by Dako) not containing the HPV16 sequence were put, covered with a cover glass, and hybridized overnight at 37 ° C. in a humidified box.
Next, soak in TBST (Dako) for 10 minutes, remove the cover glass, warm to 55 ° C, and incubate at 50 ° C for 30 minutes in a 50-fold diluted Stringent wash solution (Dako). did.
Immerse in TBST at room temperature for 5 minutes. After adding 1000 ng / mL streptavidin and incubating at room temperature for 1 hour, the plate was washed 3 times with buffer A (0.05 M Tris-HCl buffer (pH 7.8) containing 0.05% Tween 20), and then buffered. Washed once with B (0.05 M Tris-HCl buffer (pH 7.8)) (hereinafter, washing was performed in the same manner). This was reacted with 0.1 nM biotinylated synthetic DNA for 30 minutes at room temperature. After washing, it was further washed 3 times with water. As shown in FIG. 19, the probe mix reagent was put in the same manner as in Example 1 and reacted at 63 ° C. for 90 minutes. Next, 20 mL of the reaction solution was placed in a 384-well black microplate, and the fluorescence intensity of FAM was measured at an excitation wavelength (Ex.) Of 485 nm and an emission wavelength (Em.) Of 530 nm using a fluorescence plate reader (Chameleon; manufactured by HIDEX, Finland). Was measured.
The results are shown in FIG. The vertical axis in FIG. 18 shows the fluorescence intensity, the left side in FIG. 18 shows the negative case, and the right side shows the positive case. As a result, as shown in FIG. 18, quantification by the method of the present invention showed that the positive fluorescence intensity increased about three times or more compared to the negative (negative). Therefore, according to the method of the present invention, detection with higher sensitivity is possible than in the conventional method, and less copy virus DNA can be detected in the slide smear.

Measurement with an aptamer An aptamer is an antibody-like molecule composed of a nucleic acid (single-stranded DNA or RNA) and specifically binds to a target molecule through a three-dimensional structure. Since it is a nucleic acid of about 15 to 30 mer, once the sequence is determined, it can be artificially synthesized with high reproducibility. In other words, it is an “artificial antibody that can be produced in a test tube”.
In the above-described method of the present invention, it is possible to speed up detection and improve reproducibility by replacing chemical substances with aptamers.
In this experiment, a thrombin aptamer was used as an aptamer model. The thrombin aptamer is a 15-mer long single-stranded DNA aptamer that specifically binds to α-thrombin. Its sequence is known (Bock et al. (1992), Nature 355: 564-566), and data from enzyme-labeled ELISA measurements have already been reported (Paborsky et al. (1993), J Biol Chem. 268: 20808-20811). Two types of aptamers, (1) one labeled with biotin at the 5 ′ end and (2) one bound with the target sequence of the invader method of the present invention on the 3 ′ end, were prepared. Measurements were made.

(1) Detection of thrombin with thrombin aptamer (5'-Biotin-GGTTGGTGTGGTTGG-3 ') conjugated with biotin Selection buffer (20 mM Tris-acetate (pH 7.4), 140 mM NaCl, 5 mM KCl, 1 mM CaCl on a 96-well microplate ₂ , 1 mM MgCl ₂ ) coated with α-thrombin at concentrations of 0.25, 2.5, 25, 250, and 2500 nM, blocked with 1% BSA, and then labeled with 500 nM biotin. Incubated with aptamer at 37 ° C. for 1 hour. The plate was washed 3 times with a selection buffer containing 0.05% Tween 20, and then incubated with 30 μg / ml streptavidin for 1 hour at room temperature. After three washes, the reaction was performed with 50 nM biotin-conjugated target DNA for 30 minutes at room temperature. Further, washing was performed three times, 50 μl of probe mix containing PH FEN was poured, an invader reaction was performed at 63 ° C. for 1 hour, and then FAM fluorescence was measured.
The results are shown graphically in FIG. As a result, when the α-thrombin concentration was 2.5 nM or more, the FAM fluorescence intensity increased in proportion to the concentration, and it was shown that the target substance can be correctly detected even when an aptamer is used instead of the antibody.

(2) Detection of thrombin with an aptamer in which the target sequence of the invader method of the present invention is bound to the 3 ′ end.
5'-GGTTGGTGTGGTTGG GTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG -3 '
Thrombin aptamer target sequence (The underlined portion indicates a target sequence in the invader method of the present invention.)
A 96-well microplate was coated with α-thrombin dissolved in selection buffer at concentrations of 0.25, 2.5, 25, 250, and 2500 nM, respectively, blocked with 1% BSA, and then 500 nM of target. Incubated with the sequence fusion aptamer at 37 ° C. for 1 hour. After washing three times with a selection buffer containing 0.05% Tween 20, 50 μl of a probe mix containing PH FEN was poured and reacted at 63 ° C. for 1 hour, and then FAM fluorescence was measured.
The results are shown graphically in FIG. As a result, the α thrombin concentration was 2.5 nM or more, and an increase in FAM fluorescence intensity was seen in proportion to the concentration, indicating that the target substance can be detected correctly even when an aptamer is used instead of the antibody. Since this method uses a single-stranded DNA in which the aptamer sequence is directly fused to the target sequence, the measurement can be performed more rapidly and simply than the method using biotin-avidin. In addition, the synthesis of an aptamer fusion target is easier than biotin-conjugated antibodies or biotin-conjugated aptamers.

Sensitivity test using multi-target DNA The detection sensitivity was compared using target DNA having multiple target regions (multi-target DNA).
(1) Test with target DNA having two target regions As an example in which the space between target units is 5 mer, target DNA having the following 91-mer base sequence was used.
5'-GTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTGATCGTGTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG-3 '(91mer)
As a signal probe,
5'-AACGA GGCGC ACACT CCCGC AGACA C-3 '
As an invader oligo,
5'-CAAAG AAAAG CTGCG TGATG ATGAA ATCGC-3 '
It was used.
For comparison, fluorescence sensitivity by the invader method was compared using conventional target DNA having one target region. The experimental conditions were as follows.
Target DNA concentration: 10 pM
tRNA: 50 ng
Fret probe (FAM): 125 nM
Signal probe: 250 nM
Invader Oligo: 50 nM
FEN (PHFEN): 40 ng
Reaction conditions: 63 ° C., 60 minutes Number of trials: 3 times The results are shown in FIG. In FIG. 21, the vertical axis indicates the fluorescence intensity, and the horizontal axis indicates, from the left side, control (No Target), in the case of a conventional target DNA having one target region (Mono), the target DNA having two target regions. Each case (Multi) is shown.
As a result, by using two target regions, the fluorescence sensitivity of FAM was increased about 1.55 times in the invader assay.

(2) The signal probe also serves as an invader oligo, and the target region is tested 5 times by the target DNA. The space between the target units is 0mer. As an example of repeating this 5 times, the following 99mer base is used. Target DNA with sequence was used.
5'-GTGTCTGCGGGAGTGTGTCTGCGGGAGTGTGTCTGCGGGAGTGTGTCTGCGGGAGTGTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTG-3 '(99mer)
As a signal probe,
5'-AACGA GGCGC ACACT CCCGC AGACA CC-3 '
It was used. This signal probe also serves as an invader oligo, but for the creation of the first flap, the next invader oligo,
5'-CAAAG AAAAG CTGCG TGATG ATGAA ATCGC-3 '
It was used.
For comparison, fluorescence sensitivity by the invader method was compared using conventional target DNA having one target region. The experimental conditions were as follows.
Target DNA concentration: 10 pM
tRNA: 50 ng
Fret probe (FAM): 125 nM
Signal probe: 250 nM
Invader Oligo: 50 nM
FEN (PHFEN): 40 ng
Reaction conditions: 63 ° C., 60 minutes Number of trials: 3 times The results are shown in FIG. The vertical axis in FIG. 22 shows the fluorescence intensity, and the horizontal axis shows from the left side the control (No Target), in the case of a conventional target DNA having one target region (Mono), the target DNA having two target regions. Each case (Multi) is shown.
As a result, by using two target regions, the fluorescence sensitivity of FAM was increased by about 1.5 times in the invader assay.

Production of biotinylated DNA (target DNA) Using an automatic synthesizer (ABI394), synthesis was performed by a solid phase method.
First, a dimethoxytrityl derivative (DMTr-dT-CPG) starting material in which deoxythymidine was bound to a solid support of CPG (controlled pore glass) porous glass beads was used. The DMTr group was removed by performing a cycle of flowing 3% trichloroacetic acid (TCA) for 6 seconds and waiting for 5 seconds 5 times. Subsequently, cytosine phosphoramidite was reacted, and then oxidized with I ₂ to obtain a phosphoric acid triester (DMTr-dT- (O = P-OR) -dC-CPG). The above cycle was repeated to extend one base at a time in the 3 ′ → 5 ′ direction (5 ′) to obtain a DNA having a DMTr-AGAAG GTGTC TGCGG GAGTC GATTT CATCA TCACG CAGCT TTTCT TTGAG GCT-CPG (3 ′) base sequence .
In addition, biotin phosphoramidite (1-Dimethoxytrityloxy-2- (N-biotinyl-4-aminobutyl) -propyl-3-O- (2-cyanoethyl)-(N, N-diisopropyl) -phosphoramidite) The mixture was reacted for 2 minutes, then reacted with 28% aqueous ammonia at 55 ° C. for 5 hours and desorbed from the CPG. Finally, it was confirmed that the peak was a single peak at a retention time of 7.41 minutes. Manufactured.

  The present invention provides a method using a novel label that is safe, simple, highly sensitive, reliable, and has a wide measurement range, and is a novel method for measuring the behavior of physiologically active substances and the like. Is to provide. By the method of the present invention, for example, the presence or quantification of physiologically active substances such as various antibodies and antigens can be performed, which is not only useful for diagnosis and treatment of diseases, It is extremely useful as a novel label in various screening methods, and the present invention has industrial applicability.

FIG. 1 schematically shows an overview of the invader method. FIG. 2 illustrates an outline of the invader method based on a more specific base sequence. FIG. 3 schematically illustrates the generation of flaps in the method of the present invention. FIG. 4 schematically shows a method for generating two flaps in the method of the present invention. FIG. 5 schematically shows an example of an invader method using a target in which complementary sequences of an invader oligo and a signal probe are repeated in the method of the present invention. FIG. 6 schematically shows an example of an invader method using a signal probe in which flaps are added to both ends in the method of the present invention. FIG. 7 schematically shows an example of an invader method in which a complementary sequence with a signal probe is repeated when the signal probe itself also serves as an invader oligo in the method of the present invention. FIG. 8 is a graph comparing the calibration curves of rabbit IgG by the method of the present invention (black circles in FIG. 8) and the conventional ELISA method (black squares in FIG. 8). FIG. 9 is a graph showing a calibration curve in the direct assay method using rabbit IgG as an antigen according to the method of the present invention. FIG. 10 is a graph showing a calibration curve in the sandwich immunoassay method using human TNF-α as an antigen by the method of the present invention (black circle in FIG. 10) and the conventional ELISA method (black square in FIG. 10). It is a thing. FIG. 11 shows a sandwich immunoassay method using human TNF-α as an antigen by the method of the present invention using a rare earth fluorescent complex (black circle in FIG. 11) and a conventional enzyme measurement method (black square in FIG. 11). Is a graph showing the calibration curve at. FIG. 12 is a graph comparing the calibration curves of the affinity of lectin for lactoferrin saccharides according to the method of the present invention (black circle in FIG. 12) and the conventional enzyme measurement method (black square in FIG. 12). It is a thing. FIG. 13 is a graph showing the results of analyzing the expression level of actin protein in HT1080 cells by the method of the present invention. FIG. 14 is a graph showing a calibration curve for the expression level of actin protein in HT1080 cells according to the method of the present invention. FIG. 15 is a graph showing the results of a receptor-ligand binding assay using laminin according to the method of the present invention. FIG. 16 is a graph showing the results of measuring the expression level of matrix metalloproteinase 2 (MMP2) in cells by the method of the present invention. FIG. 17 is a graph showing the results of measuring the expression level of GAPDH (Glyceraldehyde Phosphate Dehydrogenase) in cells by the method of the present invention. FIG. 18 is a graph showing the results of detection and identification of papillomavirus in cells by the method of the present invention. FIG. 19 is a graph showing the results of detection and quantification of thrombin using a thrombin aptamer conjugated with biotin. FIG. 20 is a graph showing the results of detection and quantification of thrombin using an aptamer having the target sequence of the present invention bound to the 3 ′ end. FIG. 21 is a graph showing the results of a detection sensitivity test using a target DNA having two target regions of the present invention. FIG. 22 is a graph showing the results of a detection sensitivity test using a target DNA in which the signal probe of the present invention also serves as an invader oligo and the target region is repeated five times.

SEQ ID NO: 1 is an example of an oligonucleotide as a label of the present invention.
SEQ ID NO: 2 is an example of a signal probe in the method of the present invention.
SEQ ID NO: 3 is an example of an invader oligo in the method of the present invention.
SEQ ID NO: 4 is an example of a fret probe in the method of the present invention.

Claims (55)

  A method of detecting, identifying or quantifying a target molecule in a sample by using a oligonucleotide bound to a chemical substance as a label and cleaving a nucleic acid using a nuclease using the oligonucleotide.   A chemical substance to which an oligonucleotide as a label is bound (hereinafter referred to as a labeled chemical substance) is brought into contact with a sample containing or possibly containing a target molecule, and the labeling chemistry is performed. The target molecule in the sample according to claim 1, which comprises forming a complex of a substance and a target molecule in the sample, and measuring an oligonucleotide in the complex by a method of cleaving a nucleic acid using a nuclease. To detect, identify or quantify.   The method for detecting, identifying or quantifying a target molecule in a sample, comprising using an oligonucleotide as a label and measuring the presence of the oligonucleotide by a method of cleaving a nucleic acid using a nuclease. A method for detecting, identifying or quantifying a target molecule in a sample according to 1.   The method according to claim 1, wherein the oligonucleotide is single-stranded DNA.   The method according to any one of claims 1 to 4, wherein the oligonucleotide is 10 to 1000 mer of DNA.   The method according to claim 5, wherein the oligonucleotide is 10 to 100 mer of DNA.   The method according to claim 5, wherein the oligonucleotide is 10 to 60 mer of DNA.   The method according to claim 5, wherein the oligonucleotide is 10 to 40-mer DNA.   The method according to any one of claims 1 to 8, wherein the chemical substance is a protein, biotin, avidin, or a nucleic acid.   The method according to claim 9, wherein the chemical substance is biotin.   The method according to any one of claims 1 to 10, wherein the labeled oligonucleotide is directly bound to the chemical substance.   The method according to any one of claims 1 to 11, wherein the nucleic acid cleaved by the nuclease is a labeled oligonucleotide.   The method according to any one of claims 1 to 11, wherein the nucleic acid cleaved by the nuclease is a nucleic acid produced based on a labeled oligonucleotide.   The method according to any one of claims 1 to 13, wherein the nucleic acid cleaved by the nuclease is a nucleic acid bound to a luminescent substance and a quenching substance.   The method according to claim 14, wherein the luminescent material has a rare earth fluorescent complex labeling agent.   The method according to claim 15, wherein the rare earth fluorescent complex labeling agent is a labeling agent comprising an Eu complex, a Tb complex, an Sm complex, or a Dy complex.   The method according to any one of claims 1 to 16, wherein the nuclease is a flap endonuclease.   The method according to any one of claims 1 to 17, wherein the method of cleaving a nucleic acid using a nuclease is an invader method.   The method according to claim 18, wherein the labeled oligonucleotide is a target DNA in an invader method.   The method according to claim 19, wherein the target DNA has one or more base sequences to which the signal probe can hybridize.   The method according to claim 19 or 20, wherein the signal probe has a base sequence capable of generating two flaps.   The method according to claim 19 or 20, wherein the signal probe has a base sequence that can function as an invader oligo of an adjacent signal probe.   The method according to any one of claims 1 to 22, wherein the method for detecting, identifying or quantifying a target molecule in a sample is an immunoassay.   24. The method of claim 23, wherein the immunoassay is a sandwich assay.   The method according to claim 1, wherein the method for detecting, identifying or quantifying a target molecule in a sample is a binding assay.   The method according to any one of claims 23 to 25, wherein the chemical substance to which the oligonucleotide as a label is bound is biotinylated DNA.   A chemical labeling agent comprising 10 to 100 mer oligonucleotides.   28. The labeling agent according to claim 27, wherein the oligonucleotide is a 10-60mer oligonucleotide.   The labeling agent according to claim 27, wherein the oligonucleotide is a 10-40mer oligonucleotide.   The labeling agent according to any one of claims 27 to 29, wherein the oligonucleotide is a single-stranded DNA.   30. A labeling agent for a chemical substance comprising an oligonucleotide, wherein the base sequence of the oligonucleotide according to any one of claims 27 to 29 is repeated twice or more.   32. The labeling agent according to claim 31, wherein the base sequence is repeated 2 to 10 times.   Use as a 10-100mer oligonucleotide label.   34. Use according to claim 33, wherein the oligonucleotide is a 10-60mer oligonucleotide.   34. Use according to claim 33, wherein the oligonucleotide is a 10-40mer oligonucleotide.   36. Use according to any of claims 33 to 35, wherein the oligonucleotide is single stranded DNA.   Use of the oligonucleotide according to any one of claims 33 to 35 as a label of an oligonucleotide, wherein the oligonucleotide has the base sequence repeated twice or more.   The use according to claim 37, wherein the base sequence is repeated 2 to 10 times.   A labeled chemical with 10 to 100 mer oligonucleotides attached to the chemical as a label.   40. The labeled chemical substance of claim 39, wherein the oligonucleotide is a 10-60mer oligonucleotide.   40. The labeled chemical substance of claim 39, wherein the oligonucleotide is a 10-40mer oligonucleotide.   The labeled chemical substance according to any one of claims 39 to 41, wherein the oligonucleotide is a single-stranded DNA.   A labeled chemical substance, wherein the oligonucleotide has the base sequence of the oligonucleotide according to any one of claims 39 to 41 repeated twice or more, and is bound to the chemical substance as a label.   44. The labeled chemical substance according to claim 43, wherein the base sequence is repeated 2 to 10 times.   45. The labeled chemical substance according to any one of claims 39 to 44, wherein the chemical substance is biotin.   Measurement by a method of cleaving a nucleic acid using a nuclease using an oligonucleotide as a label, comprising at least one labeled chemical substance in which a 10 to 100-mer oligonucleotide is bound to the chemical substance as a label For kit.   The measurement kit according to claim 46, wherein the oligonucleotide is a 10 to 60-mer oligonucleotide.   The measurement kit according to claim 46, wherein the oligonucleotide is a 10 to 40-mer oligonucleotide.   49. The measurement kit according to any one of claims 46 to 48, wherein the oligonucleotide is a single-stranded DNA.   The oligonucleotide having a base sequence of 10 to 100 mer oligonucleotide is repeated at least twice and contains at least one kind of labeled chemical substance bonded to the chemical substance as a label. A measurement kit by a method of cleaving a nucleic acid using a nuclease using an oligonucleotide as a label.   The measurement kit according to claim 50, wherein the base sequence is repeated twice to ten times.   The measurement kit according to any one of claims 46 to 51, wherein the method for cleaving a nucleic acid using a nuclease using an oligonucleotide as a label is the method according to any one of claims 1 to 26.   53. The measurement kit according to claim 46, wherein the labeled chemical substance is biotin.   An oligonucleotide comprising at least one oligonucleotide selected from the group consisting of a signal probe (primary probe), an invader oligo (secondary probe), a target DNA, and a fret probe in the invader method is used as a label. Kit for measurement by the invader method. 55. The measurement kit according to claim 54, wherein the labeled chemical substance is biotin.

Images