JP2007010540A - METHOD OF DETECTING IgA NEPHROPATHY-RELATED ANTIBODY - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a means for obtaining information useful for diagnosing IgA nephropathy, a diagnostic method for the IgA nephropathy using the method, a reagent kit useful for diagnosis and research of the IgA nephropathy, and a method of screening a substance useful for a medical measure for the IgA nephropathy. <P>SOLUTION: One or more of step(s) selected from the following group comprising (1) and (2) is(are) executed to detect an IgA nephropathy-related antibody in a sample. (1) the step for detecting an IgA nephropathy antibody coupled specifically to an outer membrane protein of a Haemophilus species bacterium, and (2) the step for detecting an IgA nephropathy antibody coupled specifically to an outer membrane protein of a Phaemophilus parainfluenzae. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to means useful in the field of diagnosis, treatment or research of IgA nephropathy.

  IgA nephropathy is a common primary glomerulonephritis in Japan, and its prognosis is generally poor. In IgA nephropathy, histological features include IgA deposition in the glomerular mesangial region, proliferation of mesangial cells, and an increase in extracellular matrix. The cause of IgA nephropathy is still unknown, but the presence of a pathogenic antigen is important for its onset, and IgA nephropathy is caused by repeated glomerular deposition of the immune complex between the pathogenic antigen and the corresponding IgA antibody. It is believed that So far, self antigens, food antigens, viral antigens, bacterial antigens and the like have been reported as pathogenic antigen candidates. In particular, regarding bacteria, involvement of Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli and the like has been pointed out (Non-Patent Documents 1 to 3). In 1994, it was reported that the outer membrane protein of Haemophilus parainfluenzae, a bacterium resident in the upper respiratory tract and oral cavity, was involved in the development of IgA nephropathy ( Non-patent document 4). In response to this, genes such as hpnA of Haemophilus parainfluenza were reported as the cause of IgA nephropathy (Torii et al. 75th Bacteriological Society of Yokohama, Japan, April 2002).

Davin, J.C., Malaise, M., Foidart, J., and Mahieu, P. 1987. Anti-alpha-galactosyl antibodies and immune complexes in children with Henoch-Schonlein purpura or IgA nephropathy.Kidney Int 31: 1132-1139. Endo, Y., Kanbayashi, H., and Hara, M. 1993. Experimental immunoglobulin A nephropathy induced by gram-negative bacteria. Nephron 65: 196-205. Koyama, A., Sharmin, S., Sakurai, H., Shimizu, Y., Hirayama, K., Usui, J., Nagata, M., Yoh, K., Yamagata, K., Muro, K., et al. 2004. Staphylococcus aureus cell envelope antigen is a new candidate for the induction of IgA nephropathy.Kidney Int 66: 121-132. Suzuki, S., Nakatomi, Y., Sato, H., Tsukada, H., and Arakawa, M. 1994. Haemophilus parainfluenzae antigen and antibody in renal biopsy samples and serum of patients with IgA nephropathy. Lancet 343: 12-16 .

  Under the above background, an object of the present invention is to identify a causative antigen of IgA nephropathy and to provide a useful means in the diagnostic, therapeutic or research fields of IgA nephropathy. Specifically, for means for obtaining information useful for diagnosis of IgA nephropathy, diagnostic methods for IgA nephropathy using the information, reagents and kits useful for diagnosis and research of IgA nephropathy, medical measures for IgA nephropathy The object is to provide a screening method for useful substances.

  The present inventors hypothesized that Haemophilus parainfluenza is involved in the development of IgA nephropathy and attempted to identify the causative antigen of IgA nephropathy. By the way, some results have been reported that suggest some bacterial infection in IgA nephropathy. However, very few have finally reached the determination of the causative antigen. The reason is that it is very difficult to identify the target protein after immunoblotting by the conventional technique that has been frequently used for identification of the target protein. In addition, since it is impossible to analyze samples containing several types of proteins simultaneously by determining the amino acid sequence by the usual Edman degradation method, it is necessary to devise a method for separating the target protein as the causative antigen as a single protein. . In such a case, two-dimensional electrophoresis is generally used. However, two-dimensional electrophoresis is very time consuming and requires considerable skill to obtain highly reproducible data. Furthermore, in the above-described analysis of amino acids by the Edman degradation method, it usually takes about 1 hour to determine one amino acid residue. Therefore, it is appropriate to obtain the minimum amino acid sequence information necessary for collation with the database. Therefore, this technique is not suitable for analyzing many proteins. In view of such circumstances, the present inventors have introduced a new technique completely different from the conventional techniques as means for identifying the causative antigen of IgA nephropathy from Haemophilus parainfluenza. That is, first, the outer membrane protein of Haemophilus parainfluenza was separated by electrophoresis and then transferred to a PVDF membrane. Subsequently, the post-transcriptional PVDF membrane was reacted with the serum of an IgA nephropathy patient and the serum of a healthy person, and a band specifically reacting with the serum of an IgA nephropathy patient was identified and cut out. Thereafter, trypsin digestion and extraction were performed, and the obtained peptide fragment was subjected to mass spectrometry. The amino acid sequence determined as a result was collated with a previously reported database. In this way, the antigen protein recognized by the antibody contained in the serum of IgA nephropathy patients is extracted from the membrane after the immunoblot and identified directly by mass spectrometry to identify the causative antigen of IgA nephropathy Tried. As a result, a protein that is registered as an outer membrane protein (OMP) of the genus Haemophilus as an antigenic protein specifically recognized by the serum of IgA nephropathy patients (outer membrane protein [Haemophilus sp.], ACCESSION: CAA07454, http: //www.ncbi.nlm.nih.gov/), and the outer membrane P6 protein homologue of Haemophilus parainfluenza (OMP P6) [Haemophilus parainfluenzae], ACCESSION: BAA06035, http: //www.ncbi.nlm.nih.gov/). Among these antigenic proteins, a recombinant protein was prepared for OMP whose entire base sequence encoding it was known, and its reactivity with the serum of patients with IgA nephropathy was examined. As a result, it was confirmed that antibodies against OMP are commonly present in the serum of IgA nephropathy patients at a high rate. On the other hand, since only partial amino acids were revealed for OMP P6, we attempted to determine the full-length amino acid sequence and succeeded.

The present invention has been completed based on the above results and provides the following configurations. That is, the first aspect of the present invention relates to a method for detecting an IgA nephropathy-related antibody, and specifically comprises the following constitution.
[1] A method for detecting an IgA nephropathy-related antibody in a sample, comprising one or more steps selected from the group consisting of the following (1) and (2):
(1) detecting an IgA antibody that specifically binds to an outer membrane protein of a Haemophilus sp. Bacterium, and
(2) A step of detecting an IgA antibody that specifically binds to the outer membrane P6 protein of Haemophilus parainfluenzae.
[2] The amino acid sequence of the outer membrane protein of the genus Haemophilus sp. Is the sequence of SEQ ID NO: 1 or a sequence substantially identical thereto,
The amino acid sequence of the outer membrane P6 protein of Haemophilus parainfluenzae is the sequence of SEQ ID NO: 2 or a sequence substantially the same as it.
The detection method according to [1] above, wherein

Another aspect of the present invention relates to the use of an antigen protein that has been successfully identified as a reagent or kit, and specifically comprises the following constitution.
[3] A reagent for diagnosing IgA nephropathy or IgA nephropathy research, comprising one or more proteins selected from the group consisting of the following (1) and (2):
(1) outer membrane proteins of Haemophilus sp.
(2) The outer membrane P6 protein of Haemophilus parainfluenzae.
[4] The amino acid sequence of the outer membrane protein of the genus Haemophilus sp. Is the sequence of SEQ ID NO: 1 or a sequence substantially identical thereto,
The amino acid sequence of the outer membrane P6 protein of Haemophilus parainfluenzae is the sequence of SEQ ID NO: 2 or a sequence substantially the same as it.
The reagent according to [3] above, wherein
[5] A kit for diagnosing IgA nephropathy, comprising the reagent according to [3] or [4] above and an instruction manual.
[6] The IgA nephropathy diagnostic kit according to the above [5], further comprising an anti-IgA antibody.

A further aspect of the present invention relates to a method for screening a compound effective for IgA nephropathy, and specifically comprises the following constitution.
[7] A screening method for a compound effective for IgA nephropathy, comprising the following step (1) or (2):
(1) a protein selected from the group consisting of an outer membrane protein of Haemophilus sp. Bacteria and an outer membrane P6 protein of Haemophilus parainfluenzae, and an IgA antibody that specifically binds to the protein Determining the inhibitory activity of a test compound against the formation of an immune complex with
(2) a protein selected from the group consisting of an outer membrane protein of Haemophilus sp. Bacteria and an outer membrane P6 protein of Haemophilus parainfluenzae, and an IgA antibody that specifically binds to the protein And examining the inhibitory activity of the test substance against binding of the immune complex to the renal glomerulus.
[8] The screening method according to [7] above, comprising the following steps (1-1) and (1-2):
(1-1) selected from the group consisting of Haemophilus sp. Outer membrane protein and Haemophilus parainfluenzae outer membrane P6 protein in the presence and absence of the test compound Contacting the protein with an IgA antibody that specifically binds to the protein in vitro;
(1-2) The amount of immune complex formed between the protein and the IgA antibody was measured when the step (1-1) was performed in the presence of the test compound, and in the absence of the test compound ( The step of comparing with the time when 1-1) was implemented.
[9] The screening method according to [7], comprising the following steps (2-1) to (2-4):
(2-1) A protein selected from the group consisting of Haemophilus sp. Bacterial outer membrane protein and Haemophilus parainfluenzae outer membrane P6 protein, and specifically binds to the protein Providing an immune complex with an IgA antibody;
(2-2) administering a test compound and the immune complex to a non-human animal;
(2-3) detecting the amount of binding of the immune complex to the glomeruli of the non-human animal; and
(2-4) A step of comparing the amount of binding detected in step (2-3) with the amount of binding detected when only the immune complex is administered to a non-human animal.
[10] The amino acid sequence of the outer membrane protein of the genus Haemophilus sp. Is the sequence of SEQ ID NO: 1 or a sequence substantially identical thereto.
The amino acid sequence of the outer membrane P6 protein of Haemophilus parainfluenzae is the sequence of SEQ ID NO: 2 or a sequence substantially the same as it.
The screening method according to [8] or [9] above, wherein

The first aspect of the present invention relates to a method for detecting an IgA nephropathy-specific antibody in a sample. The detection method of the present invention includes one or more steps selected from the group consisting of the following (1) and (2).
(1) A step of detecting an IgA antibody that specifically binds to an outer membrane protein of a genus Haemophilus sp.
(2) Step of detecting IgA antibody that specifically binds to the outer membrane P6 protein of Haemophilus parainfluenzae

Information obtained by carrying out the detection method of the present invention is used for diagnosis of IgA nephropathy. For example, information obtained by carrying out the above method for patients with IgA nephropathy can be used for evaluation or grasping of the patient's disease state, evaluation of therapeutic effects, and the like. For example, if the method of the present invention is performed in parallel with the treatment of IgA nephropathy, the therapeutic effect can be evaluated based on the resulting information. Specifically, the therapeutic effect can be determined from the increase or decrease in the amount of antibody against a specific antigen protein by carrying out the method of the present invention after drug administration. Thus, you may utilize the method of this invention for the monitoring of a therapeutic effect. On the other hand, information obtained when a subject other than a patient, that is, a person who is not certified for IgA nephropathy, can be used for determination of the presence or absence of IgA nephropathy, evaluation of morbidity risk, and the like.
In the detection method of the present invention, the process related to the onset is measured, and thus information useful for early diagnosis is given.

In the detection method of the present invention, an IgA antibody having a specific binding property to a protein (antigen protein) determined as an etiology antigen of IgA nephropathy is detected. The antigenic protein here is an outer membrane protein of Haemophilus sp. (Also referred to herein as “OMP”), or an outer membrane P6 protein of Haemophilus parainfluenzae (herein “ OMP P6 ”). As shown below, the full-length amino acid sequence of OMP has been clarified.
OMP: outer membrane protein [Haemophilus sp.], ACCESSION: CAA07454, http://www.ncbi.nlm.nih.gov/ (SEQ ID NO: 1)
On the other hand, for OMP P6, the full-length amino acid sequence (SEQ ID NO: 2) was clarified by the present inventors as shown in the Examples described later. As shown below, OMP P6 is registered on the database and its partial amino acid sequence is shown.
OMP P6: outermembrane P6 protein homologue [Haemophilus parainfluenzae], ACCESSION: BAA06035, http://www.ncbi.nlm.nih.gov/ (SEQ ID NO: 8)

Anti-IgA antibodies in a sample against a particular antigen protein can be detected, for example, by immunological techniques. The immunological detection method enables rapid and sensitive detection. Also, the operation is simple. Examples of immunological detection methods include ELISA, radioimmunoassay, FACS, immunoprecipitation, and immunoblotting.
An example of an immunological detection method is shown below.
(1) First, an antigen protein (for example, OMP) immobilized on an insoluble support is prepared. As the insoluble support, for example, a resin such as polystyrene resin, polycarbonate resin, silicon resin, nylon resin, or a water-insoluble substance such as glass can be used. The antigenic protein can be obtained by extraction and separation from the bacterium carrying it (see Gousset, N et al., Infect. Immun. 67 (1), 8-15 (1999), etc.). Moreover, it can also obtain as a recombinant protein by utilizing the sequence information of each protein. That is, a recombinant protein obtained by expressing a nucleic acid encoding the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 in an appropriate host cell can be used in the detection method of the present invention. According to such a genetic engineering technique, it is relatively easy to obtain a target protein uniformly and in large quantities.
A protein having a sequence substantially identical to the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 can also be used as an antigen protein. The term “substantially identical” as used with respect to amino acid sequences means that the differences in sequence between the two amino acid sequences to be compared are relatively small and the difference in sequence is the function of the antigen protein, that is, the antigen protein is in vivo. It means that it binds to IgA to form an immune complex and has no substantial effect on causing IgA nephropathy. The amino acid sequences that can be considered to contain some modifications with respect to the reference amino acid sequence within a range that does not substantially affect the function of the antigen protein are substantially identical amino acid sequences. As used herein, “partial modification of amino acid sequence” means deletion of one to several amino acids constituting the amino acid sequence, substitution, addition of one to several amino acids, insertion, or a combination thereof. A change occurs in the sequence. The position of the amino acid sequence mutation is not particularly limited, and the mutation may occur at a plurality of positions. The term “plurality” as used herein refers to a number corresponding to, for example, within 10% of all amino acids constituting the amino acid sequence, and preferably a number corresponding to within 5% of all amino acids. More preferably, the number is within 1% of all amino acids.
Whether two amino acids are substantially identical can be determined, for example, by comparing the reactivity of a protein containing each amino acid sequence (the sequence of other regions is the same) with the serum of an IgA nephropathy patient . For example, when the reactivity is examined using two proteins to be compared, if there is no significant difference in reactivity, substantial identity can be identified between the two.

  (2) Next, the sample is brought into contact with the antigen protein (solid phase antigen) immobilized on the insoluble support. As a sample used for the detection method of the present invention, biological fluid such as serum, plasma, urine, spinal fluid, ascites, pleural effusion of the subject (IgA nephropathy patient or healthy subject) is used. Serum is preferably used. If serum is used, simple measurement is possible.

(3) After washing away non-specific binding components, a labeled anti-IgA antibody (or a labeled anti-human IgA antibody when a human-derived sample is used) is reacted. Subsequently, after washing away non-specific binding components, the amount of bound label is detected. For labeling of antibodies, for example, fluorescent dyes such as fluorescein, rhodamine, Texas red, oregon green, enzymes such as horseradish peroxidase, microperoxidase, alkaline phosphatase, β-D-galactosidase, luminol, acridine dye, etc. Compounds, radioisotopes such as ³² P, ¹³¹ I, and ¹²⁵ I, biotin, and the like can be used. The labeled anti-IgA antibody can be obtained from, for example, the Institute of Medical Biology. Of course, a commercially available anti-IgA antibody or a labeled IgA antibody obtained by labeling an IgA antibody separated and purified from a biological sample by a conventional method may be used.

(IgA nephropathy diagnostic or research reagent)
Another aspect of the present invention relates to a reagent for diagnosing IgA nephropathy or researching IgA nephropathy. The reagent of the present invention can be suitably used as an antigen protein in the detection method of the present invention. Alternatively, it can be used as an experimental tool for studying the onset mechanism of IgA nephropathy and the mechanism of symptom progression. The reagent of the present invention can also be used as an antigen protein in the screening method described later or as an antigen for preparing an IgA antibody used in the screening method described later.

The reagent of the present invention comprises a protein determined as an etiological antigen of IgA nephropathy. Specifically, it comprises one or more proteins selected from the group consisting of the following (1) and (2).
(1) Outer membrane protein of Haemophilus sp.
(2) Outer membrane P6 protein of Haemophilus parainfluenzae

  The protein constituting the reagent of the present invention preferably has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence practically identical thereto. The reagent of the present invention may be provided in a state immobilized on an insoluble support (solid phase reagent). Alternatively, it may be provided in a labeled state (fluorescent label, enzyme label, etc.).

(Kit used in the present invention)
Each method of the present invention (a method for detecting an IgA nephropathy-specific antibody and a method for screening a compound effective for IgA nephropathy described later) may be carried out using a kit reagent or the like. Another aspect of the present invention provides kits used for such purposes. For example, the above-described reagent of the present invention (for IgA nephropathy diagnosis or IgA nephropathy research reagent), reaction reagent, diluent, reaction container, and the like can be included in the kit. The kit of the present invention usually includes instructions for use. By using the kit, the method of the present invention can be carried out more easily and in a shorter time.

  A preferred embodiment of a kit (IgA nephropathy-specific antibody detection kit or IgA nephropathy diagnosis kit) for carrying out a method for detecting an IgA nephropathy-specific antibody is a labeled anti-antibody in addition to the reagent of the present invention. IgA antibody (labeled anti-human IgA antibody when a human sample is used as the specimen). The labeled anti-IgA antibody is used to detect the amount of anti-IgA in the sample bound to the reagent of the present invention. Therefore, according to the kit containing the labeled anti-IgA antibody, formation of an immune complex by contact of the reagent (antigen protein) of the present invention with the sample, binding of the labeled anti-IgA antibody to the immune complex, and bound label A series of operations such as measurement of quantity can be performed. Instead of the labeled anti-IgA antibody, an unlabeled anti-IgA antibody and a labeled antibody (labeled secondary antibody) against the anti-IgA antibody may be included in the kit. According to such a kit, formation of an immune complex by contacting the reagent of the present invention (antigen protein) with a sample, binding of an unlabeled anti-IgA antibody to the immune complex, labeling to an unlabeled anti-IgA antibody Through a series of operations such as antibody binding and detection of the amount of bound label, the target IgA antibody present in the sample is detected.

A standard sample may be included in the kit of the present invention. The standard sample here is a standard for evaluating the results obtained by performing detection or the like using the kit of the present invention, and contains a predetermined amount of IgA antibody against a specific antigen protein. For example, a standard sample can be prepared using an IgA antibody isolated from the serum of an IgA nephropathy patient. A standard sample may be prepared using an IgA antibody prepared by a genetic engineering technique.
The kit of the present invention further includes one or more reagents necessary for performing immunostaining such as antigen-antibody reaction and staining (for example, BSA and buffer for inhibiting non-specific binding) and instruments. Also good.

(Screening method of effective compounds for IgA nephropathy)
As a further aspect, the present invention provides a method for screening a compound effective for IgA nephropathy. The compound selected by the screening method of the present invention is expected to be effective for medical measures relating to anti-IgA nephropathy. That is, the compound selected by the screening method of the present invention is a potential drug candidate for IgA nephropathy or a useful material for developing such a drug. When the selected compound has a sufficient medicinal effect on IgA nephropathy, it can be used as it is as an active ingredient of the drug. On the other hand, when it does not have a sufficient medicinal effect, it can be used as an active ingredient of a drug after it has been modified by chemical modification to enhance its medicinal effect. Of course, even if it has a sufficient medicinal effect, the same modification may be applied for the purpose of further increasing the medicinal effect.

The screening method of the present invention includes the following steps (1) or (2).
(1) a protein selected from the group consisting of an outer membrane protein of Haemophilus sp. Bacteria and an outer membrane P6 protein of Haemophilus parainfluenzae, and an IgA antibody that specifically binds to the protein The inhibitory activity of a test compound against the formation of an immune complex
(2) a protein selected from the group consisting of an outer membrane protein of Haemophilus sp. Bacteria and an outer membrane P6 protein of Haemophilus parainfluenzae, and an IgA antibody that specifically binds to the protein To examine the inhibitory activity of a test substance against the binding (deposition) of the immune complex to and to the glomerular mesangial region

  Here, it is thought that IgA nephropathy is caused by the pathogenic antigen and IgA antibody against it forming an immune complex, and the immune complex repeatedly deposits on the glomeruli (especially the mesangial region). Yes. Therefore, in order to inhibit or suppress the onset and progression of IgA nephropathy, it is necessary to inhibit the formation of immune complexes between pathogenic antigens and IgA antibodies, and to inhibit the binding of immune complexes to the glomeruli. Is effective. According to step (1), it is possible to select a compound that can exert a medicinal effect by inhibiting the formation of an immune complex between a pathogenic antigen and an IgA antibody. On the other hand, according to step (2), a compound capable of exerting a medicinal effect by inhibiting the immune complex from binding (deposition) to the kidney glomerulus can be selected. Thus, both the compound selected by step (1) and the compound selected by step (2) treat IgA nephropathy in that it inhibits part of the process important for the development and progression of IgA nephropathy. Or it is effective for prevention.

  Test compounds used in the screening method of the present invention include organic compounds of various molecular sizes (nucleic acids, peptides, proteins, lipids (simple lipids, complex lipids (phosphoglycerides, sphingolipids, glycosylglycerides, cerebrosides, etc.), prostaglandins) , Isoprenoids, terpenes, steroids, etc.)) or inorganic compounds. The test compound may be derived from natural products or may be synthetic. In the latter case, an efficient screening system can be constructed using, for example, a combinatorial synthesis technique. Cell extracts, culture supernatants, and the like may be used as test compounds.

  In the screening method of the present invention, the antigenic protein is selected from the group consisting of Haemophilus sp. Bacterial outer membrane protein (OMP) and Haemophilus parainfluenzae outer membrane P6 protein (OMP P6). Use the protein. As described above, these proteins can be obtained by extraction from bacteria that possess them, separation, or genetic engineering techniques using the amino acid sequence information (SEQ ID NO: 1 and SEQ ID NO: 2).

Step (1) can be performed, for example, by the following procedure. First, in the presence and absence of a test compound, an antigen protein and an IgA antibody against it are contacted in vitro (step (1-1)). An IgA antibody against a specific antigen protein can be isolated and purified from the serum of a patient with IgA nephropathy, for example. The contact between the antigen protein and the IgA antibody is performed, for example, as follows. That is, the IgA antibody is brought into contact with the antigen protein immobilized on an insoluble support such as a plate, membrane, or bead in the reaction solution. After a predetermined time has elapsed, the nonspecific binding component is removed by washing with an appropriate solution.
Next, the amount of the immune complex formed of the antigen protein and the IgA antibody is determined by performing step (1-1) in the presence of the test compound and in the absence of the test compound (1-1). Compared with the time when (Step (1-2)). As a result, if the amount of immune complex formation is smaller under the conditions in the presence of the test compound, it is determined that the test compound has an activity to inhibit immune complex formation, and the test compound is regarded as a promising drug candidate. Select.
The amount of immune complex formed can be determined by detecting an IgA antibody bound to an antigen protein. For example, a labeled anti-IgA antibody can be used to detect an IgA antibody bound to an antigen protein. That is, by reacting a labeled anti-IgA antibody and measuring the amount of specifically bound label, the amount of IgA antibody bound to the antigen protein (ie, the amount of immune complex formation) can be calculated indirectly. .

On the other hand, step (2) can be performed, for example, by the following procedure. First, an immune complex of an antigen protein and an IgA antibody against it is prepared (step (2-1)). An immune complex of an antigen protein and an IgA antibody can be prepared by contacting the antigen protein and an IgA antibody under conditions that allow both to bind.
Next, the test compound and the immune complex are administered to the non-human animal (step (2-2)). Examples of non-human animals include non-human primates (such as monkeys and chimpanzees), mice, rats, rabbits, cows, horses, sheep, dogs, cats, and the like. Among these, a mouse or a rat can be preferably used. The administration route is not particularly limited, and an appropriate route can be selected from oral administration, intravenous administration (injection), intradermal administration (injection), subcutaneous administration (injection), transdermal administration, intraoral administration, and the like.
The dose of the test compound and the dose of the immune complex can be arbitrarily set. For example, the maximum possible dose can be used as long as it does not cause lethal effects on non-human animals.
The number of administrations can also be set arbitrarily. For example, the number of administrations is in the range of 1 to 20 times.

  After the administration, the binding amount (deposition amount) of the immune complex to the kidney glomerulus (especially mesangial region) of the non-human animal is detected (step (2-3)). For example, the binding amount of the immune complex can be detected by an immunological method using a labeled anti-IgA antibody.

  Next, the amount of binding detected in step (2-3) is compared with the amount of binding detected when only the immune complex is administered to a non-human animal (step (2-4)). For example, first, an animal individual (administration group) to which a test compound and an immune complex are administered and an animal individual (non-administration group) to which only the immune complex is administered are prepared. The amount of binding of the immune complex is detected. Subsequently, the binding amount of the administration group is compared with the binding amount of the non-administration group. As a result, if the binding amount of the immune complex is smaller under the condition where the test compound is administered, it is judged that the test compound has an activity to inhibit the binding of the immune complex to the renal glomerulus, and the test compound is promising. Selected as a potential drug candidate.

1. Identification of antigenic proteins involved in IgA nephropathy
(1) Preparation of outer membrane protein of Haemophilus parainfluenza and Western blotting Follow the procedure below to prepare outer membrane protein from H. parainfluenzae 6 strain isolated and cultured from the pharynx of IgA nephropathy patients, and use a gradient gel. (Haemophilus parainfluenzae: 108-62, 108-63, 108-64, 108-66, 111-106, 111-107). First, H. parainfluenzae cultured overnight was collected and subjected to ultrasonic treatment to disrupt the cells. Subsequently, the cell disruption solution was centrifuged (12000 rpm, 20 minutes). The obtained supernatant was separated and subjected to centrifugation (38000 rpm, 60 minutes). The obtained sediment (pellet) was used as outer membrane protein. Next, the outer membrane protein was subjected to SDS-PAGE using a gradient gel (10% to 20%).
Subsequently, the protein was transferred from the gel after SDS-PAGE to a PVDF membrane according to a conventional method, and then blocked with 0.5% polyvinylpyrrolidone 40 (PVP40). Assuming that the sample extracted from the PVDF membrane is directly subjected to ESI-MS / MS, blocking conditions using amino acids such as polyvinylpyrrolidone 40 and glycine were examined. It turned out to be optimal.
The blocked PVDF membrane was reacted with 5 IgA nephropathy patient sera as a primary antibody and healthy human serum as a control (using 1000-fold diluted serum, room temperature, overnight). Subsequently, the non-specific binding component was washed away (washed with 1 × PBS, 3 times in total), and then reacted with an HRP-labeled goat anti-human IgA (HRP) antibody as a secondary antibody. (Room temperature, 60 minutes). When coloring was performed by adding a chromogenic substrate (H ₂ O ₂ ), IgA patient-specific bands were observed at molecular weights of about 38 kD and about 15 kD (FIG. 1). These IgA nephropathy patient specific bands were cut out from the PVDF membrane and transferred to a tube, and then trypsin was allowed to act (on membrane digestion, room temperature, overnight). The peptide fragment obtained by trypsin digestion was subjected to the following mass spectrometry.

(2) Mass spectrometry and database search ESI-MS / MS (electrospray ionization tandem mass spectrometry) was used for mass spectrometry. Specifically, the peptide fragment obtained by the above operation was analyzed with an LCQ Advantge apparatus (manufactured by Themo Finigan), and MS / MS Ion Search (manufactured by Matrix Science) was performed using the obtained results. The amino acid sequence of the peptide fragment determined in this way was collated with a previously reported database (NCBInr). As a result, two types of proteins (OMP and OMP P6) considered to be the causative antigen of IgA nephropathy were identified (FIG. 2). OMP (Hemophilus outer membrane protein (SEQ ID NO: 1): outer membrane protein [Haemophilus sp.], ACCESSION: CAA07454, http://www.ncbi.nlm.nih.gov/) is a patient with IgA nephropathy It was a protein contained in a band of about 38 kD detected specifically in serum. Similarly, outer membrane P6 protein homologue, Haemophilus parainfluenzae: outermembrane P6 protein homologue [Haemophilus parainfluenzae], ACCESSION: BAA06035, http: / /www.ncbi.nlm.nih.gov/) is a protein contained in a band of about 15 kD.
Among the identified antigenic proteins (OMPs) whose entire base sequence encoding them was known (OMP), recombinant proteins were prepared and used for the following tests. On the other hand, those with unknown base sequences (OMP P6) were first compared with the sequence of H. influenzae, which is a related bacterium, to prepare a PCR primer.
Forward primer: ATGAACAAATTTGTTAAATC (SEQ ID NO: 4)
Reverse primer: GTACGCTAACACTGCACGAC (SEQ ID NO: 5)
Using these primers, PCR was performed using H. parainfluenzae genomic DNA as a template, the product was cloned into a vector, and the full-length amino acid sequence and full-length base sequence of H. parainfluenzae OMP P6 were determined. As a result, these sequences were successfully determined. The full-length amino acid sequence and full-length base sequence of H. parainfluenzae OMP P6 are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

2. Reactivity of the identified antigen protein and IgA nephropathy patient serum OMP detected from a band of about 38 kDa was known to be the antigen in other IgA nephropathy patients because the nucleotide sequence was known. The following tests were conducted for the purpose.
(1) Production of recombinant protein
The following primers capable of specifically amplifying OMP were prepared.
Forward primer: ATGAAAAAAACTGCAATC (SEQ ID NO: 6)
Reverse primer: TTTAGTACCGTTTACTGC (SEQ ID NO: 7)

  Using H.parainfluenzae genomic DNA as a template, PCR using the above primers (reaction at 95 ° C for 2 minutes, 94 ° C for 30 seconds, 50 ° C for 30 seconds, 72 ° C for 3 minutes, total 30 times, (Reaction at 72 ° C. for 10 minutes). Recombinant OMP was obtained by the above operation and then cloned into a pQE vector.

(2) Immunoblot using a recombinant protein Using a recombinant OMP, an immunoblot using patient serum and healthy human serum as primary antibodies was performed. The immunoblotting procedure was the same as the immunoblotting procedure for identification of the antigen protein.
The result of immunoblotting is shown in FIG. There was a clearly marked response to all patient sera. That is, it was confirmed that an antibody recognizing OMP was present at a high rate in the serum of all patients.

3. Summary As described above, a specific band for IgA nephropathy patients is cut out from the membrane after immunoblotting, and analyzed directly by ESI MS / MS, so that the protein (antigen protein) that is considered to be the etiological antigen of IgA nephropathy Two types were successfully identified. In other words, it was revealed that antibodies against these antigen proteins exist in the serum of patients with IgA nephropathy. From this result, it was considered that detection of an IgA antibody against an antigen protein that was successfully identified (that is, examining the presence or amount of the IgA antibody) provides useful information for diagnosis of IgA nephropathy.
On the other hand, among the proteins that were successfully identified, the recombinant protein of OMP was produced and its reactivity with patient sera was verified. As a result, antibodies that recognize OMP in the serum of all patients tested showed a high rate. It was confirmed to exist. This result strongly supports that OMP, an outer membrane protein of H. parainfluenzae, is involved in the development of IgA nephropathy, and the presence or absence of an antibody against OMP is an effective diagnostic marker for IgA nephropathy. It became clear that.

  According to the detection method of the present invention, information useful for diagnosis of IgA nephropathy can be obtained. That is, the detection method of the present invention has high utility value in the diagnostic field of IgA nephropathy. The information obtained by the detection method of the present invention is also useful for determining the treatment policy for patients with IgA nephropathy.

The present invention is not limited to the description of the embodiments and examples of the invention described above. Various modifications may be included in the present invention as long as those skilled in the art can easily conceive without departing from the description of the scope of claims.
The contents of papers, published patent gazettes, patent gazettes, and the like specified in this specification are incorporated by reference in their entirety.

It is the result of the immunoblot which made IgA nephropathy patient serum react with the serum (control) of a healthy subject with the outer membrane protein of Haemophilus parainfluenza. The strains used are A: 108-62, B: 111-106, C: 111-107, D: 108-66. Bands specific to IgA nephropathy patients are observed at positions of about 38 kD and about 15 kD. It is the analysis result by ESI MS / MS. A protein contained in an approximately 38 kD band specific to IgA nephropathy patients was identified as OMP (ACCESSION: CAA07454). Similarly, the protein contained in the band of about 15 kD was identified as OMP P6 (ACCESSION: BAA06035). It is the result of the immunoblot using recombinant protein (OMP). There is a clear reaction to the serum of patients with IgA nephropathy.

Claims (10)

A method for detecting an IgA nephropathy-related antibody in a sample, comprising one or more steps selected from the group consisting of the following (1) and (2):
(1) detecting an IgA antibody that specifically binds to an outer membrane protein of a Haemophilus sp. Bacterium, and
(2) A step of detecting an IgA antibody that specifically binds to the outer membrane P6 protein of Haemophilus parainfluenzae. The amino acid sequence of the outer membrane protein of the genus Haemophilus sp. Is the sequence of SEQ ID NO: 1 or a sequence substantially identical thereto;
The amino acid sequence of the outer membrane P6 protein of Haemophilus parainfluenzae is the sequence of SEQ ID NO: 2 or a sequence substantially the same as it.
The detection method according to claim 1, wherein: A reagent for diagnosing IgA nephropathy or IgA nephropathy research, comprising one or more proteins selected from the group consisting of the following (1) and (2):
(1) outer membrane proteins of Haemophilus sp.
(2) The outer membrane P6 protein of Haemophilus parainfluenzae. The amino acid sequence of the outer membrane protein of the genus Haemophilus sp. Is the sequence of SEQ ID NO: 1 or a sequence substantially identical thereto;
The amino acid sequence of the outer membrane P6 protein of Haemophilus parainfluenzae is the sequence of SEQ ID NO: 2 or a sequence substantially the same as it.
The reagent according to claim 3, wherein   A kit for diagnosing IgA nephropathy, comprising the reagent according to claim 3 or 4 and instructions for use.   The kit for diagnosing IgA nephropathy according to claim 5, further comprising an anti-IgA antibody. A method for screening a compound effective for IgA nephropathy, comprising the following step (1) or (2):
(1) a protein selected from the group consisting of an outer membrane protein of Haemophilus sp. Bacteria and an outer membrane P6 protein of Haemophilus parainfluenzae, and an IgA antibody that specifically binds to the protein Determining the inhibitory activity of a test compound against the formation of an immune complex with
(2) a protein selected from the group consisting of an outer membrane protein of Haemophilus sp. Bacteria and an outer membrane P6 protein of Haemophilus parainfluenzae, and an IgA antibody that specifically binds to the protein And examining the inhibitory activity of the test substance against binding of the immune complex to the renal glomerulus. The screening method according to claim 7, comprising the following steps (1-1) and (1-2):
(1-1) selected from the group consisting of Haemophilus sp. Outer membrane protein and Haemophilus parainfluenzae outer membrane P6 protein in the presence and absence of the test compound Contacting the protein with an IgA antibody that specifically binds to the protein in vitro;
(1-2) The amount of immune complex formed between the protein and the IgA antibody was measured when the step (1-1) was performed in the presence of the test compound, and in the absence of the test compound ( The step of comparing with the time when 1-1) was implemented. The screening method according to claim 7, comprising the following steps (2-1) to (2-4):
(2-1) A protein selected from the group consisting of Haemophilus sp. Bacterial outer membrane protein and Haemophilus parainfluenzae outer membrane P6 protein, and specifically binds to the protein Providing an immune complex with an IgA antibody;
(2-2) administering a test compound and the immune complex to a non-human animal;
(2-3) detecting the amount of binding of the immune complex to the glomeruli of the non-human animal; and
(2-4) A step of comparing the amount of binding detected in step (2-3) with the amount of binding detected when only the immune complex is administered to a non-human animal. The amino acid sequence of the outer membrane protein of the genus Haemophilus sp. Is the sequence of SEQ ID NO: 1 or a sequence substantially identical thereto;
The amino acid sequence of the outer membrane P6 protein of Haemophilus parainfluenzae is the sequence of SEQ ID NO: 2 or a sequence substantially the same as it.
The screening method according to claim 8 or 9, wherein