JP2007001881A - Composition for treating proteasome inhibitor-resistant cancer, kit for treatment, and screening method of compound for treating proteasome inhibitor-resistant cancer - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a composition for treating a proteasome inhibitor-resistant cancer, a screening method thereof, or the like by way of precaution against appearance of a proteasome inhibitor-resistant cancer cell. <P>SOLUTION: The composition for treating the proteasome inhibitor-resistant cancer comprises as an effective ingredient fluorouracil, a prodrug thereof, or a salt thereof, or a topoisomerase inhibitor or a salt thereof. The screening method of the compound for treating the proteasome inhibitor-resistant cancer utilizes a cell caused to have acquired resistance to a proteasome inhibitor. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a therapeutic composition for cancer cells that have acquired resistance to proteasome inhibitors.

  In recent years, proteasome inhibitors have attracted attention as a new kind of anticancer agent. In 2003, Bortezomib (Bortezomib; chemical name: [(1R) -3-methyl-1-[[(2S) -1-oxo-3-phenyl-2-[(pyrazinylcarbonyl) amino] was the first proteasome inhibitor. ] propyl] amino] butyl] boronic acid was approved by the US FDA for the treatment of refractory multiple myeloma. Bortezomib is known to inhibit the chymotrypsin-like activity of the 26S proteasome in mammalian cells.

  The proteasome is an ATP-dependent protease that recognizes and selectively degrades proteins with multiple ubiquitin chains attached by ubiquitination, and the ubiquitin / proteasome system is used for various biological phenomena such as signal transduction, especially in the cell cycle and tumor growth. It also plays an important role in the degradation of the proteins involved. For this reason, proteasome is regarded as an important therapeutic target for diseases involving cell proliferation, especially cancer. The 26S proteasome plays a central role in the mechanism of proteolytic degradation by the proteasome. A phenomenon in which apoptosis is induced in cancer cells exposed to a proteasome inhibitor has already been reported (see, for example, Non-Patent Documents 1 and 2).

  Although the effect of bortezomib on solid tumors is not yet clear, clinical trials in the United States for patients with multiple myeloma have shown high response rates, and some cases have been markedly effective. The trial has been started and is expected as a new kind of anticancer agent.

On the other hand, for many anticancer agents, it is known that cancer cells acquire resistance to the anticancer agent by long-term administration, and the phenomenon that the effect seen at the initial stage of treatment decreases or the effect is not obtained at the time of recurrence. Has been observed. Therefore, it is expected that resistant cells will appear with respect to proteasome inhibitors as they become widely used in the future.
Adams J. et al .: Current Opinion in Oncology 14 (6): 628-634, 2002 Adams J. et al .: Cancer Research 59: 2615-2622, 1999

  Therefore, an object of the present invention is to provide a therapeutic composition for proteasome inhibitor resistant cancer, a screening method thereof, and the like in preparation for the appearance of proteasome inhibitor resistant cancer cells.

  In order to solve the above problems, the present inventors produced a mutant cell having resistance to the proteasome inhibitor epoxomicin (EXM) using A431, a cell line of human squamous cell carcinoma cells, and A431EXM2 (Ohkawa et al., International Journal of Oncology 24: 425-433, 2004). A431EXM2 showed resistance not only to EXM but also to five other proteasome inhibitors.

  As a result of further earnest studies, the present inventors have found that the mutant cell A431EXM2 can be used for screening therapeutic compositions that also have anticancer effects on cancer cells that have acquired resistance to proteasome inhibitors. As a result, the topoisomerase inhibitor and the fluorouracil-based anticancer agent were found to show an antitumor effect on proteasome inhibitor-resistant cancer cells, and the present invention was completed.

That is, the present invention
[1] A composition for treating proteasome inhibitor-resistant cancer comprising fluorouracil, a prodrug thereof, or a salt thereof as an active ingredient; [2] The prodrug is fluorodeoxyuridine, The composition for treating a proteasome inhibitor-resistant cancer according to the above; [3] a composition for treating a proteasome inhibitor-resistant cancer comprising a topoisomerase inhibitor, or a salt thereof as an active ingredient; [4] the topoisomerase inhibitor, The composition for treating a proteasome inhibitor-resistant cancer according to the above [3], which is a topoisomerase I inhibitor or a topoisomerase IIβ inhibitor; [5] a test sample in a medium of A431 cells that have acquired resistance to a proteasome inhibitor; A step of adding a compound and culturing, and after a certain period of time, the proteasome inhibitor The screening method of the proteasome inhibitor-resistant therapeutic compounds for cancer comprising the step of measuring the viability of A431 cells resistant were won, the. [6] the screening method according to [5] above, wherein the A431 cells that have acquired resistance to the proteasome inhibitor are A431EXM2 cells (Accession No. FERM P-20527); [7] acquired proteasome inhibitor resistance; A kit for screening a compound for treating proteasome inhibitor-resistant cancer comprising the A431 cells prepared; [8] The A431 cells that have acquired the resistance to proteasome inhibitors are A431 EXM2 cells (Accession No. FERM P-20527) 7]. The screening kit according to [7].

  According to the therapeutic composition of the present invention, the anti-tumor effect of a proteasome inhibitor can be obtained even in cancer cells that have acquired resistance to a proteasome inhibitor by administration in a small amount not exceeding the dose conventionally used in clinical settings. Can be maintained or improved. Moreover, the screening method according to the present invention can be used for searching for a novel or combination therapeutic compound for such proteasome inhibitor-resistant cancer.

  Hereinafter, the meanings of symbols, terms and the like used in the present specification will be shown, and the present invention will be described in detail.

  The first aspect of the composition for treating proteasome inhibitor-resistant cancer according to the present invention contains fluorouracil, a prodrug thereof, or a salt thereof as an active ingredient. 5-Fluorouracil has a structure in which H at the 5-position of uracil is substituted with F, and is known as an effective anticancer agent.

  5-FU undergoes ribosylation and phosphorylation in vivo to form 5-fluoro-2'-deoxyuridine 5'-phosphate, which inhibits DNA synthesis by inhibiting thymidylate synthase (TS). Incorporation into RNA instead of uracil also promotes the synthesis of abnormal proteins and causes cells to die. 5-Fluorouracil is rapidly metabolized in the liver and rapidly disappears from the blood, so its prodrug is often administered. 5-Fluorouracil (5-FU) is thought to lead to cell death of cancer cells having resistance to proteasome inhibitors by the following mechanism.

The proteasome controls the degradation of both thymidylate synthase (TS) and dihydrofolate reductase (DHFR) molecules. TS is an enzyme that catalyzes the reaction of receiving 1 carbon unit from tetrahydrofolic acid (THF) and methylating 5'-deoxyuridylic acid (dUMP) to thymidylic acid (dTMP). In normal cells, TS is known to regulate the translation of TS mRNA by binding to TS mRNA, and to self-regulate the total amount of TS.
When a proteasome inhibitor is administered to cells that do not have proteasome inhibitor resistance, degradation is suppressed and TS and DHFR molecules increase. When 5-fluorouracil (5-FU) or its prodrug is administered to such cells, the amount of TS in which activity is maintained is transiently formed by the formation of an irreversible ternary complex of FU-TS-THF. Decrease. As a result, in addition to abnormal RNA synthesis, inhibition of DNA synthesis due to thymine deficiency in the DNA material is caused, which may cause cell death. This is one of the mechanisms by which 5-FU and its prodrugs exhibit anticancer effects. However, self-regulation due to TS-TS mRNA binding ceases to function, resulting in an increase in TS mRNA translation. In many cells, it tends to increase in TS molecules, which also serves as a mechanism for expressing resistance of cells to 5-FU.
On the other hand, in proteasome inhibitor-resistant cells, TS and DHFR are decreased due to the enhancement of proteasome activity based on the analysis of cell characteristics. When 5-FU or a prodrug thereof is administered to such cells, the amount of TS is further reduced by forming an irreversible ternary complex of FU-TS-THF. On the other hand, TSmRNA translation increases due to the failure of TS-TSmRNA binding self-regulation, but proteasome activity is enhanced in proteasome inhibitor-resistant cells, so TS produced by translation of TSmRNA is efficiently transferred to the proteasome. Metabolic degradation. Thus, when 5-FU or its prodrug is loaded on a proteasome-resistant strain, even if the TS molecule is overexpressed due to the breakdown of the TS self-regulation mechanism due to the formation of an irreversible ternary complex, As a result, the increase in TS is suppressed, so the total amount of TS is surely reduced and 5-FU resistance is difficult to develop. At the same time, the amount of DHFR also decreases due to the increased proteasome activity, leading to a strong decrease in THF, resulting in thymine deficiency, inhibiting DNA synthesis, and inducing cell death.

The second aspect of the composition for treating proteasome inhibitor-resistant cancer according to the present invention comprises a topoisomerase inhibitor or a salt thereof as an active ingredient. Topoisomerase (also referred to as DNA topoisomerase; hereinafter referred to as “TOP”) is an enzyme that temporarily cleaves DNA strands that take a solenoid structure or loop structure in cells to eliminate twists and knots in the DNA strands. One that cuts only one strand of double-stranded DNA is called TOPI type, and one that cuts both strands is called TOPII type. TOPII type includes TOPIIα type and TOPIIβ type.
A TOP inhibitor is a substance that inhibits such TOP functions, and it is thought that cancer cells having proteasome inhibitor resistance lead to cell death by the following mechanism.

  The proteasome is involved in the degradation of TOP and the degradation of the cleavable complex consisting of TOP inhibitor-DNA-TOP formed when TOP inhibitor is administered. In cancer cells having resistance to proteasome inhibitors, the function of the proteasome is enhanced, so that TOP is being decomposed. When a TOP inhibitor is administered here, a cleavable complex consisting of TOP inhibitor-DNA-TOP is formed, which is also degraded by the proteasome. If the DNA break ends (DNA scratches) are exposed by this decomposition and the TOP activity is sufficiently maintained, the DNA break can be repaired. However, since the TOP is decreased, the DNA break ends are not repaired. As a result, the total amount of TOP in the cell becomes extremely small. As a result, DNA strand damage (solenoid and loop structure) cannot be eliminated, DNA replication and transcription are inhibited, and the cell is directed to cell death.

  The TOP inhibitor used in the composition for treating proteasome inhibitor-resistant cancer according to the present invention is not particularly limited, and among them, TOPI inhibitor or TOPIIβ inhibitor is preferable because of its high antitumor effect. Examples of TOPI inhibitors include irinotecan, camptotensin, topotecan, nogitecan, or metabolically active substance SN-38. Examples of TOPIIβ inhibitors include amrubicin, idarubicin, mitoxantrone, doxorubicin, etoposide, or sobuzoxan. It is done.

  The “proteasome inhibitor resistant cancer” that is the target of the therapeutic composition according to the present invention is one in which the proteasome inhibitor exhibits an effect for a certain period of time and becomes resistant to the proteasome inhibitor after a certain period of time. As long as it is not particularly limited. Examples of such cancer include brain tumor, head and neck cancer, esophageal cancer, stomach cancer, colon cancer, liver cancer, pancreatic cancer, lung cancer, breast cancer, skin cancer, ovarian cancer, uterine and cervical cancer, prostate cancer, renal cancer, Examples include bladder cancer, lymphoma, leukemia, and the like. The therapeutic composition according to the present invention is effective for cancer diseases of mammals (eg, humans, mice, rats, guinea pigs, rabbits, dogs, horses, monkeys, etc.), and particularly useful for the treatment or prevention of human cancer diseases. It is.

  In this specification, a prodrug is a compound that is converted into a substance that exhibits physiological activity by a reaction with an enzyme, gastric acid, or the like under physiological conditions in vivo, that is, enzymatically causes oxidation, reduction, hydrolysis, or the like. A compound that is converted to FU. Examples of such compounds include flucytosine, capecitabine, doxyfluridine, carmofur, tegafur and the like which are metabolized in the body and converted to FU. Note that irinotecan, which is a TOP inhibitor, is also a prodrug of SN-38.

  The “salt” used in the present specification is not particularly limited, but for example, an addition salt of an inorganic acid such as hydrochloride, sulfate, carbonate, bicarbonate, hydrobromide, hydroiodide; Addition salts of organic carboxylic acids such as acetate, maleate, lactate, tartrate, trifluoroacetate, methanesulfonate, hydroxymethanesulfonate, benzenesulfonate, toluenesulfonate, taurine salt, etc. Organic sulfonic acid addition salts: trimethylamine, pyridine, procaine, picoline, dicyclohexylamine, N, N'-dibenzylethylenediamine, N-methylglucamine, diethanolamine, triethanolamine, tris Addition salts of amines such as (hydroxymethylamino) methane salt and phenethylbenzylamine salt; arginine salt, lysine salt And addition salts of amino acids such as serine salt, glycine salt, aspartate and glutamate.

  In the present specification, the active ingredient means an ingredient for obtaining the original effect of a pharmaceutical product, and the therapeutic composition according to the present invention may contain a combination of two or more active ingredients. .

  When the therapeutic composition according to the present invention is used as a medicine, the dosage form is not particularly limited, and may be oral or parenteral. When administered to mammals, particularly humans, the dosage is the degree of symptoms, patient age, sex, weight, sensitivity difference, administration method, administration timing, administration interval, properties of pharmaceutical preparations, preparations, types, types of active ingredients Although there is no particular limitation depending on the component, 1 mg to 6000 mg, preferably 10 mg to 1000 mg, more preferably 50 mg to 500 mg, can be administered in a single dose or divided into several doses per day for each adult.

  The therapeutic composition according to the present invention can be formulated by a commonly used method using the active ingredient substance as it is or mixing it with a known pharmaceutically acceptable carrier or the like. Preferred dosage forms include tablets, powders, fine granules, granules, coated tablets, capsules, syrups, troches, inhalants, suppositories, injections, ointments, eye ointments, eye drops, nasal drops , Ear drops, poultices, lotions and the like. For formulation, commonly used excipients, binders, disintegrants, lubricants, colorants, flavoring agents, and if necessary stabilizers, emulsifiers, absorption promoters, surfactants, pH adjusters Preservatives, antioxidants, and the like can be used, and it can be formulated by a conventional method by blending components generally used as raw materials for pharmaceutical preparations.

  For example, animal and vegetable oils such as soybean oil, beef tallow and synthetic glycerides; hydrocarbons such as liquid paraffin, squalane and solid paraffin; ester oils such as octyldodecyl myristate and isopropyl myristate; higher alcohols such as cetostearyl alcohol and behenyl alcohol; silicon resin Silicone oil; surfactants such as polyoxyethylene fatty acid ester, sorbitan fatty acid ester, glycerin fatty acid ester, polyoxyethylene sorbitan fatty acid ester, polyoxyethylene hydrogenated castor oil, polyoxyethylene polyoxypropylene block copolymer; hydroxyethyl cellulose, polyacrylic Water-soluble polymers such as acid, carboxyvinyl polymer, polyethylene glycol, polyvinylpyrrolidone, methylcellulose; ethanol, Lower alcohols such as propanol; polyhydric alcohols such as glycerin, propylene glycol, dipropylene glycol and sorbitol; sugars such as glucose and sucrose; inorganic powders such as silicic anhydride, aluminum magnesium silicate and aluminum silicate; purified water Etc.

  Examples of excipients include lactose, corn starch, sucrose, glucose, mannitol, sorbitol, crystalline cellulose, silicon dioxide and the like; examples of binders include polyvinyl alcohol, polyvinyl ether, methyl cellulose, ethyl cellulose, gum arabic, tragacanth, gelatin, and shellac. , Hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, polypropylene glycol polyoxyethylene block polymer, meglumine, calcium citrate, dextrin, pectin, etc .; disintegrating agents such as starch, agar, gelatin powder, crystalline cellulose, carbonic acid Calcium, sodium bicarbonate, calcium citrate, dextrin, pectin, carboxymethylcellulose / calcium, etc .; lubricant For example, magnesium stearate, talc, polyethylene glycol, silica, hydrogenated vegetable oil, etc .; any colorant may be used as long as it is permitted to be added to pharmaceuticals; , Cocoa powder, mint brain, fragrance powder, mint oil, dragon brain, cinnamon powder and the like; As the antioxidant, those which are permitted to be added to pharmaceuticals such as ascorbic acid and α-tocopherol are used.

  For oral preparations, add excipients, and if necessary, binders, disintegrants, lubricants, coloring agents, flavoring agents, etc., and then add powders, fine granules, granules, tablets, and coatings by conventional methods. Tablets, capsules, etc.

  In the case of tablets and granules, sugar coating, gelatin coating, and other coatings may be applied as necessary.

  For liquids such as syrups, injectable preparations, eye drops, etc., pH adjusters, solubilizers, tonicity agents, etc., and solubilizers, stabilizers, buffers, suspending agents as necessary Add drug, antioxidant, etc., and formulate by conventional method. In the case of the solution, it can be a lyophilized product, and the injection can be administered intravenously, subcutaneously or intramuscularly. Preferable examples of the suspending agent include methyl cellulose, polysorbate 80, hydroxyethyl cellulose, gum arabic, tragacanth powder, sodium carboxymethyl cellulose, polyoxyethylene sorbitan monolaurate, and the like; Oxyethylene hydrogenated castor oil, polysorbate 80, nicotinic acid amide, polyoxyethylene sorbitan monolaurate, etc .; Examples of suitable stabilizers include sodium sulfite, sodium metasulfite, ether and the like; Examples of suitable preservatives include , Methyl paraoxybenzoate, ethyl paraoxybenzoate, sorbic acid, phenol, cresol, chlorocresol and the like.

  In the case of an external preparation, the production method is not particularly limited, and it can be produced by a conventional method. As a base material to be used, various raw materials usually used for pharmaceuticals, quasi drugs, cosmetics and the like can be used. For example, animal and vegetable oils, mineral oils, ester oils, waxes, higher alcohols, fatty acids , Silicone oils, surfactants, phospholipids, alcohols, polyhydric alcohols, water-soluble polymers, clay minerals, purified water, etc., pH adjusters, antioxidants as necessary Chelating agents, antiseptic / antifungal agents, coloring agents, fragrances and the like can be added. Furthermore, components having differentiation-inducing action, blood flow promoters, bactericides, anti-inflammatory agents, cell activators, vitamins, amino acids, humectants, keratolytic agents, and the like can be blended as necessary.

  The present invention also includes a method for screening a composition for treating proteasome inhibitor-resistant cancer. Such a screening method includes a step of adding a test compound to a culture medium of A431 cells that have acquired resistance to a proteasome inhibitor and culturing, and after a certain period of time, the resistance of the A431 cells that have acquired resistance to the proteasome inhibitor. And measuring the survival rate.

  A431 cells that have acquired resistance to proteasome inhibitors are obtained by adding proteasome inhibitors to the medium and culturing until the A431 cells have acquired resistance to proteasome inhibitors and the antitumor effect of the proteasome inhibitors cannot be obtained. be able to. The proteasome inhibitor to be added is not particularly limited, and examples thereof include PS341, MG132, ALLN, NLVS, PSI, and EXM. By adding candidate compounds to the proteasome inhibitor-resistant A431 cell culture medium thus obtained and incubating, and measuring the survival rate of A431 cells after a certain period of time, it is also possible for cancer cells with proteasome inhibitor resistance It is possible to identify compounds that exhibit anti-tumor effects. A person skilled in the art can appropriately select the cell culture method, the amount of proteasome inhibitor or the amount of candidate compound added, and the like. Such a screening method can identify a compound that can be used for treatment in the future when a proteasome inhibitor-resistant cancer is observed in a cancer patient.

  The following reference examples, examples and test examples of the present invention are illustrative, and the present invention is not limited to the following specific examples. Those skilled in the art can make various modifications to the embodiments shown below to fully implement the present invention, and such modifications are included in the scope of the claims of the present application.

<Production of protease inhibitor resistant cancer cells>
Protease inhibitor resistant cancer cells can be obtained by exposing A431 cells to EXM as a proteasome inhibitor according to the procedure described in the literature mentioned above (Ohkawa et al., International Journal of Oncology 24: 425-433, 2004). Produced. Hereinafter, the produced cell is referred to as “A431EXM2.”

<Expression of TOPIIβ in A431EXM2>
The expression at the mRNA level and the expression at the protein level of TOPIIβ in the A431EXM2 cells obtained in Example 1 were analyzed by RT-PCR method and SDSPAGE-Western Bolt method, respectively.

RNA was extracted by RT-PCR using Trizol reagent (GIBCO-BRAL, Tokyo Japan). Single-stranded cDNA was synthesized from 1 μg of RNA using TrueScript II, and the reaction was carried out at 25 ° C. for 10 minutes and 55 ° C. for 1 hour, and finally heated at 95 ° C. for 5 minutes to stop the reaction. PCR was performed in a 20 μl reaction solution containing 1 μl of the obtained cDNA, Taq polymerase 0.5 unit (Takara, Tokyo Japan), 200 μM dNTP 1 μM sense primer and antisense primer. The reaction time was 94 ° C for 1 minute after the denaturation reaction, 98 ° C for 10 seconds, 55 ° C for 30 seconds, 72 ° C for 1 minute, and the number of cycles was 30 times. Β-actin was used as an internal standard. The primers used are shown below.
TS sense, 5'-AAGAATCATCATGTGCGCTT-3 '(SEQ ID NO: 1)
TS antisense, 5'- TTAATAGTTGGATGCGGATTGT-3 '(SEQ ID NO: 2) (399 bp as PCR product),
DHFR sense, 5'- TGGTTCGCTAAACTGCATCG-3 '(SEQ ID NO: 3)
DHFR antisense, 5'-TCAATTTCTGGAAAAAACGTGTC-3 '(SEQ ID NO: 4) (453 bp as PCR product),
TOP I sense, 5'- AAGTTTGAAACAGCTCGACG-3 '(SEQ ID NO: 5)
TOP I antisense, 5'-AGAGTGATGGAGGCGTTGTA-3 '(SEQ ID NO: 6) (467 bp as PCR product),
TOP IIα sense, 5'-GTTTACTTGCTTCAAACGGA-3 '(SEQ ID NO: 7)
TOP IIα antisense, 5′-CAGGACCACCCAGTACCGAT-3 ′ (SEQ ID NO: 8) (396 bp as PCR product),
TOP IIβ sense, 5'- AACAATGTCAGACGAATGCT -3 '(SEQ ID NO: 9)
TOP IIβ antisense, 5′-CCCACAAGCCACTCCTTACG-3 ′ (SEQ ID NO: 10) (497 bp as PCR product),
β-actin sense, 5'- AACACCCCAGCCATGTAC-3 '(SEQ ID NO: 11)
β-actin antisense, 5′-ATGTCACGCACGATTTCC-3 ′ (SEQ ID NO: 12) (254 bp as PCR product).
SDSPAGE-Western Bolt method was performed as follows.

  Resistant cell lines and parent cells are washed with cold PBS, and cell extracts are prepared with 10 mM Tris HCl, pH 7.4, 1% TritonX 100, protease inhibitor cocktail, and sodium dodecylsulfate (SDS) polyacrylamide gel electrophoresis (SDS- After PAGE), the separated protein was transferred to a nitrocellulose membrane. The nitrocellulose membrane was blocked with Bovine serum albumin (BSA), reacted with each primary antibody, and colored with a secondary antibody labeled with alkaline phosphatase. Primary antibodies used were mouse anti-human thymidylate synthase (TS) monoclonal antibody (CHEMICON, International, Temecula, CA), rabbit anti-human dihydrofolate reductase (DHFR) polyclonal antibody (Sigma, Tokyo, Japan), mouse anti-human topoisomerase II. Antibody (Transduction Lab., Lexington, KY, USA) and mouse anti-human actin monoclonal antibody (Sigma).

  FIG. 1A shows the results of mRNA expression analysis. TOPIIβ mRNA expression was enhanced in A431EXM2 cells. This is understood to be a compensatory overexpression in A431EXM2 cells to maintain a normal amount of TOPIIβ due to increased proteasome activity due to acquisition of proteasome inhibitor resistance and downregulation of TOPIIβ.

  FIG. 5 (B) shows the protein level expression results of TOPIIβ. The A431EXM2 cell group that has acquired resistance to proteasome inhibitors (lanes 5 and 6) has an increased expression of TOPIIβ mRNA compared to the cell group that has not acquired resistance (lanes 1 to 4). The small number suggests that proteasome activity is enhanced in A431EXM2 cells.

  In both A431 and A431EXM2 cells, administration of etoposide (VP16) as a TOPIIβ inhibitor induced downregulation of TOPIIβ by VP16, and formation of a cleavable complex consisting of VP16-DNA-TOPIIβ. (Lane 2 and lane 5), but this tendency was confirmed to be more prominent in A431EXM2 cells (lane 5) in which proteasome activity was enhanced.

<Expression of TS and DHFR in A431EXM2>
Expression of TS and DHFR at the mRNA level and expression at the protein level in the A431EXM2 cells obtained in Example 1 were measured. Since the measurement method is the same as that of the above-described second embodiment, description thereof is omitted.

  FIG. 2 (A) shows the results of mRNA expression analysis. The expression of TS and DHFR mRNA was decreased in both A431EXM2 cells that acquired proteasome inhibitor resistance compared to A431 cells.

  FIG. 4B shows the expression results of protein levels of TS and DHFR when A431 cells and A431EXM2 cells were exposed to 0.1 μg / ml or 1.0 μg / ml 5-FU, respectively. First, as can be seen from lanes 1 to 3, overexpression of TS was observed in A431 cells by exposure to 5-FU. This is thought to be due to the fact that FU-TS-THF ternary complex was formed by exposure to FU, the auto-regulation of TS expression due to TS-TS mRNA binding stopped functioning, and the translation of TS mRNA was promoted. In A431 cells, proteasome activity is also not enhanced, and an amount of TS that cannot be processed with normal proteasome expression level is produced, thereby creating a substrate that establishes 5-FU resistance.

  On the other hand, as can be seen from lanes 4 to 6, in A431EXM2, the TS expression level is small (lane 4), and it is considered that the proteasome activity is enhanced. By administering 5-FU to this, although the TS amount is less than that of A431 cells, FU-TS-THF ternary complex is also formed, and as a result, auto-regulation of TS expression by TS-TS mRNA binding However, the function fails. However, even if TS is expressed as a result, since proteasome activity is enhanced, it is efficiently decomposed, and as a result, intracellular TS is extremely reduced.

  In addition, as can be seen from lanes 4 to 6, in A431EXM2 cells, a decrease in DHFR due to an increase in proteasome activity was also observed, which is considered to strongly cause a decrease in coenzyme THF together with a decrease in TS.

<Search for therapeutic composition for protease inhibitor resistant cancer>
Subsequently, a composition containing 5-FU and doxorubicin (DXR) and etoposide (VP16), which are topoisomerase IIβ inhibitors, was added to the A431EXM2 cell and A431 cell culture media according to the present invention, respectively. .

  On the other hand, as a comparative example, cisplatin (Dichlorodiamine cis-platinum, CDDP) was added to the media of A431EXM2 cells and A431 cells. Cisplatin is an anticancer drug that exhibits antitumor effects by intercalating into DNA and functioning like an alkylating agent.

  Cells are cultured for 17 hours in an EXM-free environment, added with various concentrations of anticancer drugs, and cultured for 72 hours, followed by the MTT (3- [4,5-dimethylthiazol-2-yl] -2,5-diphenyltetrazolium bromide) method. The survival rate was measured by The survival rate was calculated by the following formula: cell survival rate (%) = 100 × (absorbance at 570 nm for drug-treated cells) / (absorbance at 570 nm for untreated cells).

  The results of administering the therapeutic composition according to the present invention are shown in FIG. In the group administered with the therapeutic composition according to the present invention (5-FU, DXR, VP16), cell death was observed at a lower concentration in A431EXM2 cells than in A431. In other words, cells that have acquired resistance to a proteasome inhibitor exhibit a stronger antitumor effect, and it has been confirmed that the therapeutic composition according to the present invention is also effective in treating proteasome inhibitor-resistant cancer. It was.

  FIG. 4 shows a comparative example. In the group administered with CDDP, there was no difference between A431 and A431EXM2, and it was confirmed that the antitumor effect of CDDP on cells that have acquired resistance to proteasome inhibitors cannot be expected.

The result of having measured the expression in the mRNA level and the protein level of topoisomerase in the cell (A431) which has not acquired proteasome inhibitor resistance, and the acquired cell (A431EXM2) is shown. The result of having measured the expression in the mRNA level of TS and DHFR in the cell which has not acquired proteasome inhibitor resistance (A431) and the acquired cell (A431EXM2) and the expression in the protein level is shown. The result of having measured the cell viability when the cell which has not acquired proteasome inhibitor resistance (A431) and the acquired cell (A431EXM2) is exposed to the therapeutic composition concerning this invention is shown. The result of having measured the survival rate of the cell at the time of exposing the cell (A431) which has not acquired proteasome inhibitor resistance, and the acquired cell (A431EXM2) to cisplatin is shown.

Claims (8)

  A composition for treating proteasome inhibitor-resistant cancer, comprising fluorouracil, a prodrug thereof, or a salt thereof as an active ingredient.   The composition for treating proteasome inhibitor-resistant cancer according to claim 1, wherein the prodrug is fluorodeoxyuridine.   A composition for treating proteasome inhibitor-resistant cancer comprising a topoisomerase inhibitor or a salt thereof as an active ingredient.   The composition for treating proteasome inhibitor-resistant cancer according to claim 3, wherein the topoisomerase inhibitor is a topoisomerase I inhibitor or a topoisomerase IIβ inhibitor. Adding a test compound to the medium of A431 cells that have acquired resistance to a proteasome inhibitor, and culturing;
Measuring the survival rate of A431 cells that have acquired resistance to the proteasome inhibitor after a certain period of time, and a method for screening a therapeutic compound for proteasome inhibitor-resistant cancer.   The screening method according to claim 5, wherein the A431 cells that have acquired resistance to the proteasome inhibitor are A431EXM2 cells (Accession No. FERM P-20527).   A kit for screening a compound for treating proteasome inhibitor-resistant cancer, comprising A431 cells that have acquired resistance to proteasome inhibitor. The screening kit according to claim 7, wherein the A431 cells that have acquired resistance to proteasome inhibitors are A431EXM2 cells (Accession No. FERM P-20527).

Images