WO2019039390A1 - Juvenile myelomonocytic leukemia therapeutic agent - Google Patents

Abstract

The problem addressed by the present invention is to provide a new molecularly-targeted therapeutic agent for juvenile myelomonocytic leukemia and the use thereof. Provided is a juvenile myelomonocytic leukemia therapeutic agent containing an ALK tyrosine kinase inhibitor or a JAK2 tyrosine kinase inhibitor. Also disclosed is a new fusion gene that regulates juvenile myelomonocytic leukemia.

Description

Juvenile myelomonocytic leukemia therapeutic drug

The present invention relates to means useful for the treatment, diagnosis and the like of juvenile myelomonocytic leukemia (JMML). More specifically, it relates to a JMML therapeutic agent, a novel fusion gene involved in JMML, and its use. This application claims priority based on Japanese Patent Application No. 2017-162389 filed on Aug. 25, 2017, the entire contents of which are incorporated by reference.

Juvenile myelomonocytic leukemia (JMML) is a rare myelodysplasia of the infancy and childhood characterized by proliferation of myelomonocytic cells and hypersensitivity to granulocyte-macrophage colony stimulating factor (GM-CSF). / Myeloproliferative disease (MDS / MPD) (Non-patent Document 1). More than 80% of JMML cases are characterized as having mutually exclusive somatic / germline mutations in classical RAS pathway related genes such as PTPN11, NF1, NRAS, KRAS, CBL (non-patent literature) 2, 3). Second hit mutations of SETBP 1 (Non-patent documents 4 and 5) and other genes (Non-patent documents 6 and 7), gene expression profiles (Non-patent documents 8 and 9), and methylation profiles of promoter regions of several genes (Non-patent documents 10 and 11) are identified as prognostic factors. However, the interrelationship between these biomarkers has not yet been clarified.

JMML cases are generally resistant to conventional chemotherapy, and allogeneic hematopoietic stem cell transplantation is the only definitive treatment, but overall survival at 5 years is poor at around 50%, and new molecules Targeted treatment is required.

In order to solve the above-mentioned problems, the present inventors collect samples of 150 cases (the number of samples of JMML which is very rare disease is extremely large in the world), and complete exome sequencing, methylation array analysis Conducted comprehensive gene analysis using RNA sequences, and aimed to identify gene mutations that would be new therapeutic targets for JMML. As a result, they succeeded in identifying three types of fusion genes. JMML is known to have somatic or germline gene mutations (formation of fusion genes) of RAS pathway related genes such as PTPN11, NF1, NRAS, KRAS, CBL in 70% or more cases of JMML. The three types of fusion genes identified are those with mutations in receptor tyrosine kinase genes and are extremely characteristic. In this regard, the three types of fusion genes are new therapeutic targets for JMML, and their utility or significance is great. In addition, the existence of a fusion gene accompanied by a mutation in receptor tyrosine kinase gene can be evaluated as an extremely important finding in developing a future therapeutic strategy for JMML.

On the other hand, crizotinib, which is an ALK tyrosine kinase inhibitor and is used for the treatment of non-small cell lung cancer, suppressed the growth of newly identified fusion gene positive cells in vitro. Moreover, crizotinib also improved the patient prognosis clinically. Intriguingly, crizotinib also showed antiproliferative effects in fusion gene negative JMML as well. As a result of further examination, tumor growth inhibitory effect was also recognized by ALK tyrosine kinase inhibitors other than crizotinib. These experimental results show that an agent called ALK tyrosine kinase inhibitor, which is a line with a known therapeutic agent for JMML, can be an effective molecular-targeted therapeutic agent for JMML.

During further study, it was noted that crizotinib also exhibited inhibitory activity against JAK2 tyrosine kinase, and the effect of the JAK2 tyrosine kinase inhibitor, luxoritinib, was investigated. As a result, it was found that luxoritinib has a tumor growth inhibitory effect. This fact indicates that, in addition to ALK tyrosine kinase inhibitors, JAK2 tyrosine kinase inhibitors can also be molecular targeted therapeutic agents for JMML, and have important implications for therapeutic strategies.

The following invention is mainly based on the above knowledge and consideration.
[1] A therapeutic agent for juvenile myelomonocytic leukemia, which comprises an ALK tyrosine kinase inhibitor or a JAK2 tyrosine kinase inhibitor.
[2] The juvenile myelomonocytic leukemia therapeutic drug according to [1], wherein the ALK tyrosine kinase inhibitor is a tyrosine kinase inhibitor for ALK and ROS1.
[3] The juvenile myelomonocytic leukemia therapeutic drug according to [1], wherein the ALK tyrosine kinase inhibitor is crizotinib, alectinib, seritinib or TAE684.
[4] The juvenile myelomonocytic leukemia therapeutic drug according to [1], wherein the JAK2 tyrosine kinase inhibitor is luxolitinib.
[5] The juvenile myelomonocytic leukemia therapeutic drug according to any one of [1] to [4], which is administered to a patient who is positive for a fusion gene of ALK or ROS1.
[6] The juvenile myelomonocytic leukemia therapeutic drug according to any one of [1] to [5], which is used in combination with another drug.
[7] The juvenile myelomonocytic leukemia therapeutic drug according to [6], wherein the other drug is an anticancer drug.
[8] A test method for juvenile myelomonocytic leukemia, which comprises the following steps (1) to (3):
(1) preparing a sample containing leukemia cells isolated from a patient with juvenile myelomonocytic leukemia;
(2) detecting the presence or absence of a fusion gene of ALK or ROS1 or a fusion protein encoded by the fusion gene in the sample;
(3) determining that the fusion gene or the fusion protein is detected to be compatible with treatment with an ALK tyrosine kinase inhibitor.
[9] A fusion gene of ALK or ROS1 as a cause of juvenile myelomonocytic leukemia.
[10] A method of screening a substance effective for the treatment of juvenile myelomonocytic leukemia, which comprises the following steps (i) to (iii):
(i) preparing a cell that expresses a fusion gene of ALK or ROS1;
(ii) culturing the cells in the presence of a test substance;
(iii) measuring the number of viable cells or the number of colonies to determine the efficacy of the test substance.
[11] A method for treating juvenile myelomonocytic leukemia, comprising administering a therapeutically effective amount of an ALK tyrosine kinase inhibitor or a JAK2 tyrosine kinase inhibitor to a patient with juvenile myelomonocytic leukemia.

Clinical and genetic profiles of 150 patients. Each row represents one patient, and methylation analysis was performed in 106 out of 150 (71%). JMML; juvenile myelomonocytic leukemia, NS / MPD; Noonan syndrome-related myeloproliferative disorder, LOH; loss of heterozygosity. Tyrosine kinase fusion gene in juvenile myelomonocytic leukemia (JMML). (A-c) Structure of the detected fusion protein. (A) DCTN1-ALK identified by UPN5, (b) RANBP2-ALK identified by UPN168, (c) TBL1XR1-ROS1 identified by UPN106. MAM: MAM domain, LDL-R: low density lipoprotein receptor class A domain, TM: transmembrane domain, TPR: tetratricopeptide repeat domain, RanBD1: Ran binding domain, LisH: lis homologous domain, F-box like: F-box like domain, FN Type III: Fibronectin type III domain. Effect of crizotinib (ALK / ROS1 / MET inhibitor) on RANBP2-ALK ⁺ CD34 ⁺ cell colony formation. 1 × 10 ³ CD34 ⁺ cells from patients with RANBP2-ALK were cultured for 2 weeks with 0, 20, 80, 200, 500 nM of crizotinib added to the medium of cytokine (+) or (−). (A) Microscopic findings of CFU-GM colonies. (B, c) The number of colonies in the medium (b) with or without the cytokine (c). CFU-GM: granulocyte macrophage colony forming unit, BFU-E: erythroblast burst forming unit. Clinical course and crizotinib administration to RANBP2-ALK positive patients. Effect of crizotinib on colony formation. (a) KRAS, p. G12A mutation, (b) PTP N11, p. E76 K mutation, (c) CBL splice site mutation, (d) CBL, p. Y 371 H. mutation. Using CD34 ⁺ cells (1 × 10 ³ per culture) from each mutation positive patient, ⁰ , 200, 500 nM crizotinib was added to the medium of cytokine (+) or (−) and cultured for 2 weeks. CFU-GM: Granulocyte macrophage colony forming unit. *, p <0.05; ,, p <0.01. Correlation between established risk factors in JMML. Co-occurrence and exclusivity between clinical features, genetic changes, expression and methylation profiles, and outcomes. Gray lines indicate each factor associated with JMML, and circles indicate that the two crossed factors occur statistically simultaneously or exclusively. Effects of various ALK tyrosine kinase inhibitors and JAK2 tyrosine kinase inhibitors on colony formation of PTPN11 p.D61V mutation-positive and CD34-positive cells. PTPN11 p.D61V mutation-positive and CD34-positive cells (1 × 10 ³ ) in the cytokine (+) or (-) medium, various ALK tyrosine kinase inhibitors (Alectinib, seritinib or TAE684) or JAK2 tyrosine kinase inhibitors ( Luxoritinib) was added at a predetermined concentration and cultured for 2 weeks. (A) colony number in crizotinib-supplemented medium, (b) colony number in alectinib-supplemented medium, (c) colony number in ceritinib-supplemented medium, (d) colony number in TAE684-supplemented medium, (e) lucsolitinib-supplemented medium Number of colonies at. *, p <0.05; ,, p <0.01

1. Treatment of Juvenile Myelomonocytic Leukemia (JMML) The first aspect of the present invention relates to a therapeutic agent for juvenile myelomonocytic leukemia (JMML) and its use. "Therapeutic agent" refers to a drug that exhibits a therapeutic or prophylactic effect on a target disease or condition (ie, JMML). Therapeutic effects include alleviation of symptoms or concomitant symptoms characteristic of the target disease / pathology (reduction of symptoms), prevention or delay of deterioration of symptoms, and the like. The latter can be regarded as one of the preventive effects in terms of preventing the aggravation. Thus, therapeutic effects and preventive effects are partially overlapping concepts, so it is difficult to distinguish them clearly, and there are few benefits to doing so. A typical preventive effect is to prevent or delay the recurrence of symptoms characteristic of the target disease / pathology. As long as it exhibits some therapeutic effect or preventive effect or both for the target disease / pathology, it is a therapeutic agent for the target disease / pathology.

The present invention is based on the surprising fact that ALK tyrosine kinase inhibitors have shown efficacy against JMML in vitro and in vivo. ALK (Anaplastic Lymphoma Kinase) is a receptor-type tyrosine kinase, also called CD246. An ALK fusion gene (EML4-ALK, TFG-ALK, KIF5B-ALK, etc.) in which the ALK gene and other genes are fused is found in some cases of non-small cell lung cancer, etc. In the ALK fusion gene, ALK tyrosine kinase is constitutively aberrantly activated to cause canceration. Several therapeutic agents (ALK tyrosine kinase inhibitors) that target the ALK fusion gene have been developed and are clinically applied (for example, application of crizotinib to treatment of non-small cell lung cancer).

Examples of ALK tyrosine kinase inhibitors include crizotinib (Crizotinib), alectinib (Alectinib), ceritinib (Ceritinib), and TAE684. It is preferable based on the fact that a ROS1 (c-ros on cogene 1) fusion gene (TBL1XR1-ROS1) positive was found in cases of JMML and the fact that crizotinib, which is an inhibitor for ALK and ROS1, showed efficacy for JMML. Uses an ALK tyrosine kinase inhibitor that also exhibits an inhibitory effect on ROS1. That is, in a preferred embodiment, tyrosine kinase inhibitors against ALK and ROS1 are employed as ALK tyrosine kinase inhibitors. The “tyrosine kinase inhibitors against ALK and ROS1” show at least an inhibitory activity against ALK and ROS1, and the presence or absence of the inhibitory activity against other tyrosine kinases is not particularly limited. Examples of ALK tyrosine kinase inhibitors falling under “tyrosine kinase inhibitors against ALK and ROS1” include crizotinib, seritinib and lolatinib.

ROS1 is a type of receptor tyrosine kinase and, like ALK, belongs to the insulin receptor family. ROS1 fusion genes (CD74-ROS1, SLC34A2-ROS1, etc.) have been identified and targeted as therapeutic targets in cases of non-small cell lung cancer. The tyrosine kinase domain of ROS1 shows high homology to the tyrosine kinase domain of ALK.

As shown in Examples described later, crizotinib, which is an ALK tyrosine kinase inhibitor, exhibited a growth inhibitory action, ie, a drug effect not only on novel fusion gene-positive JMML cells, but also on novel fusion gene-negative JMML cells. In light of this fact, the subject (JMML patient) of the therapeutic agent of the present invention is not particularly limited, and the therapeutic agent of the present invention can be widely used for the treatment of JMML. However, as an example of a preferable treatment subject, a case that is positive for ALK fusion gene (for example, DCTN1-ALK fusion gene, RANBP2-ALK fusion gene) or ROS1 fusion gene (for example, TBL1XR1-ROS1 fusion gene) can be mentioned.

In one aspect of the present invention, a JAK2 tyrosine kinase inhibitor is used based on the fact that the JAK2 tyrosine kinase inhibitor, Luxolitinib (Ruxolitinib) has shown efficacy against JMML in vitro. Luxoritinib selectively acts on JAK1 and JAK2 subtypes. Specific examples of JAK2 tyrosine kinase inhibitors are luxoritinib, pacritinib (Pacritinib), varisitinib (Baricitinib).

As an active ingredient of the therapeutic agent of the present invention, pharmacologically acceptable salts of ALK tyrosine kinase inhibitors or JAK2 tyrosine kinase inhibitors may be used. "Pharmaceutically acceptable salt" is not particularly limited, and use of various salts, for example, acid addition salts, metal salts, ammonium salts, organic amine addition salts, amino acid addition salts and the like is conceivable. . Examples of acid addition salts include mineral acid salts such as hydrochlorides, sulfates, nitrates, phosphates, hydrobromides, acetates, maleates, fumarates, citrates, benzenesulfonates, Organic acid salts such as benzoate, malate, oxalate, methanesulfonate, tartrate and the like can be mentioned. Examples of metal salts include alkali metal salts such as sodium salts, potassium salts and lithium salts, alkaline earth metal salts such as magnesium salts and calcium salts, aluminum salts and zinc salts. Examples of ammonium salts include salts such as ammonium and tetramethyl ammonium. Examples of organic amine addition salts include morpholine addition salts and piperidine addition salts. Examples of amino acid addition salts include glycine addition salts, phenylalanine addition salts, lysine addition salts, aspartic acid addition salts and glutamic acid addition salts.

Two or more active ingredients (ALK tyrosine kinase inhibitors or pharmacologically acceptable salts thereof, or JAK2 tyrosine kinase inhibitors or pharmaceutically acceptable salts thereof) may be used in combination. In addition to the above-mentioned active ingredients (ALK tyrosine kinase inhibitor or pharmacologically acceptable salt thereof, or JAK2 tyrosine kinase inhibitor or pharmaceutically acceptable salt thereof), other active ingredients are mixed. May be

Depending on the use or dosage form, any component that can usually be used in medicine may be appropriately blended with the therapeutic agent of the present invention, as long as the effects and pharmaceutical stability of the present invention are not impaired. Ingredients which can be compounded are not particularly limited, and include, for example, carrier components or additives, and as carrier components or additives in a solid preparation, for example, excipients, disintegrants, binders, lubricants, antioxidants , Coating agents, coloring agents, flavoring agents, surfactants, plasticizers, sweeteners, flavoring agents, disintegrating aids, foaming agents, adsorbents, preservatives, preservatives, wetting agents, antistatic agents, etc. . Moreover, as a carrier component or additive in the liquid preparation, for example, a solvent, a pH adjuster, a refreshing agent, a suspending agent, an antifoamer, a thickener, a solubilizer, a surfactant, an antioxidant, a coloring agent Agents, sweeteners, flavoring agents, preservatives / antimicrobial agents, chelating agents, solubilizers or solubilizers, stabilizers, fluidizers, emulsifiers, thickeners, buffers, isotonic agents, dispersions Agents and the like.

The dosage form for formulation is also not particularly limited. Examples of dosage forms include tablets (including uncoated tablets, sugar-coated tablets, intraoral fast disintegrating tablets, intraoral fast dissolving tablets, chewable tablets, effervescent tablets, troches, drops, film-coated tablets, etc.), pills, granules, Fine granules, powders, hard capsules, soft capsules, syrups, injections, external preparations and suppositories. It is also possible to shape in a jelly form so as to be easy to swallow (eg, jelly form) or to improve the absorbability in the digestive tract. In addition, it may be any of a solid preparation, a semi-solid preparation, and a liquid preparation (for example, a decoction or a dip). One preferred dosage form is a tablet. Among tablets, dosage forms such as intraoral fast disintegrating tablets, intraoral fast dissolving tablets and chewable tablets, which can be easily taken without water when feeling symptoms of diarrhea, and block off unpleasant taste Dosage forms such as sugar-coated tablets and film-coated tablets may be particularly preferred.

The therapeutic agents of the present invention can be manufactured by or in a manner conventional in the art. For example, if it is a tablet, it can be prepared by mixing the powdery active ingredient with a pharmaceutically acceptable carrier component (excipient etc.) and compression molding (direct compression method), and the drop agent is a mold Can be prepared by Among solid agents, powder granules such as granules, various granulation methods (extrusion granulation method, pulverization granulation method, dry consolidation granulation method, fluidized bed granulation method, rolling granulation method, high speed stirring It can be prepared by granulation method etc.). Tablets can also be prepared by combining the above granulation method and tableting method (wet tableting method etc.) as appropriate (indirect compression method). Furthermore, capsules can be prepared by filling powders (powders, granules, etc.) into capsules (soft or hard capsules) by a conventional method. The tablets may be coated and formed into sugar-coated tablets or film-coated tablets. Furthermore, the tablet may be a single layer tablet or a laminated tablet such as a double layer tablet. The solution is prepared by dissolving or dispersing each component in a carrier component such as an aqueous medium (purified water, purified hot water, purified water containing ethanol, etc.), heating, filtering, clothing or sterilizing as necessary, and placing in a predetermined container It can be prepared by filling and sterilizing. Although the amount of active ingredient in the therapeutic agent of the present invention generally varies depending on the dosage form, the amount of active ingredient is set, for example, within the range of about 0.01% by weight to about 95% by weight so as to achieve the desired dose.

The therapeutic agent of the present invention can be administered orally or parenterally (intravenous, intraarterial, subcutaneous, intradermal, intramuscular, or intraperitoneal injection, transdermal, transnasal, transmucosal, etc.) depending on its dosage form. Applies to Also, systemic and local administration may be employed. These administration routes are not mutually exclusive, and two or more optionally selected can be used in combination (for example, intravenous injection or the like simultaneously with oral administration or after a predetermined time has elapsed). The therapeutic agent of the present invention contains the active ingredient in an amount necessary to obtain the expected therapeutic effect (ie, a therapeutically effective amount). Although the amount of the active ingredient in the therapeutic agent of the present invention generally varies depending on the dosage form, the amount of the active ingredient is set, for example, within the range of about 0.1% by weight to about 99% by weight so as to achieve the desired dose.

The dose of the therapeutic agent of the present invention is set so as to obtain the expected therapeutic effect. In setting a therapeutically effective dose, the condition, age, sex, and weight of the patient, etc. are generally considered. Those skilled in the art can set appropriate dosages in consideration of these matters. As an example of the dosage, for crizotinib, 500 mg per day for adults and 280 mg / m ² per child can be mentioned. As the administration schedule, for example, once to several times a day, once every two days, or once every three days can be adopted. In preparation of the administration schedule, the patient's medical condition, the duration of the effect of the active ingredient and the like can be considered.

The therapeutic agent of the present invention may be used in combination with other agents. For example, the therapeutic agent of the present invention is added to standard chemotherapy for JMML to exert additive or synergistic effects. Various combination modes are assumed, and the type and number of drugs used in combination, the administration schedule and the like are not particularly limited. Although a representative example of the drug used in combination is an anticancer drug, a molecule-targeted therapeutic drug, cell therapy and the like may be used in combination. Examples of anti-cancer agents are alkylating agents (eg cyclophosphamide, ifosfamide, melphalan), anti-metabolites (eg methotrexate, 6-mercaptopurine, cytarabine, fludarabine, clofarabine), anti-cancer antibiotics (eg Daunorubicin, doxorubicin, pirarubicin, idarubicin, mitoxantrone, plant alkaloids (eg vincristine, vinblastine, vindesine, etoposide), demethylating agents (eg azacitidine). In addition, in the case of chemotherapy, it is basic to perform multidrug therapy combining several kinds of therapeutic agents having different action mechanisms and side effects. Examples of molecule-targeted therapeutic agents include MEK inhibitors, JAK inhibitors, GM-CSF inhibitors and the like. As an example of cell therapy, CAR-T therapy and the like can be mentioned.

As apparent from the above description, the present application also provides a method of treating JMML, which comprises administering a therapeutically effective amount of an ALK tyrosine kinase inhibitor or a JAK2 tyrosine kinase inhibitor to a JMML patient.

2. Inspection of JMML The second aspect of the present invention relates to inspection of JMML. Specifically, a JMML inspection method is provided, which includes the following steps (1) to (3).
(1) preparing a sample containing leukemia cells isolated from a patient with juvenile myelomonocytic leukemia (2) in the sample, the presence or absence of a fusion gene of ALK or ROS1 or a fusion protein encoded by the fusion gene Detecting (3) determining that the fusion gene or the fusion protein is detected as compatible with treatment with an ALK tyrosine kinase inhibitor

In step (1), a sample to be used for the test is prepared. A sample containing leukemia cells isolated from JMML patients is used. The type and origin of the sample are not particularly limited as long as they contain leukemia cells. For example, a cell fraction (bone marrow cells) prepared from bone marrow or a cell fraction (blood cells) prepared from blood such as peripheral blood is used as a sample. Samples are prepared prior to the practice of the present invention. That is, the test method of the present invention does not include the step of isolating (collecting) bone marrow and the like for preparing a sample from a patient.

In step (2), the ALK fusion gene (eg, DCTN1-ALK fusion gene or RANBP2-ALK fusion gene) or ROS1 fusion gene (eg, TBL1XR1-ROS1 fusion gene) in the sample, or the fusion gene (eg, DCTN1-ALK fusion gene) The presence or absence of a fusion protein encoding either TBL1XR1-ROS1 fusion gene or RANBP2-ALK fusion gene) is detected. In the former embodiment (detection of fusion gene), genomic DNA or mRNA is to be detected. When genomic DNA is to be detected, the presence or absence of the formation of a fusion gene is detected. On the other hand, when mRNA is to be detected, the presence or absence of formation of the fusion gene, the presence or absence of expression, or both of them will be detected. The means for detecting the fusion gene is not particularly limited. For example, RT-PCR (reverse transcription-polymerase chain reaction) method, PCR method, PCR-RFLP (restriction fragment length polymorphism) method, PCR-SSCP (single strand conformation polymorphism) method, RNA sequence analysis, target sequence analysis, FISH ( Fluorescence in situ hybridization, whole genome analysis, Invader (registered trademark, Third Wave Technologies) method, LAMP (Loop-Mediated Isothermal Amplification), CGH (Comparative Genomic Hybridization), dot hybridization, Northern hybridization, etc. Means of detection can be used. Extraction and purification of genomic DNA and mRNA can be performed by known methods. A variety of kits for preparation are also commercially available, and they may be used.

The DCTN1-ALK fusion gene, the TBL1XR1-ROS1 fusion gene and the RANBP2-ALK fusion gene are novel fusion genes derived from JMML patients, which were found by the present inventors. The breakpoints and structures of these fusion genes are shown in FIG. Based on the information, primers and probes to be used for detection of each fusion gene can be designed and prepared. In addition, specific examples of primers that can be used for detection means (RT-PCR method and PCR method described above) utilizing nucleic acid amplification reaction will be described later.

In the latter case (fusion protein detection), for example, the fusion protein can be detected by immunoassay. Immunological assays allow for rapid and sensitive detection. Also, the operation is simple. In the immunological assay, an antibody against a fusion protein is used, and the fusion protein is detected with the binding ability (binding amount) of the antibody as an index. Examples of immunoassays include Western blotting, immunohistochemistry, fluorescence immunoassay (FIA), enzyme immunoassay (EIA), radioimmunoassay (RIA), flow cytometry (FCM) Immunoprecipitation, immunochromatography, ELISA, etc.

In step (3), based on the detection results of step (2), the suitability for treatment with ALK tyrosine kinase inhibitor (that is, whether or not it is a patient to be treated) is evaluated. Specifically, when a fusion gene or fusion protein to be detected in step (2) is detected, it is determined as "compatible with treatment with an ALK tyrosine kinase inhibitor". Thus, a genetic abnormality characterized by the formation of the above-mentioned fusion gene (hereinafter referred to as "the genetic abnormality of the present invention" and the like as an index for determining a therapeutic course or obtaining supplementary information or basis therefor. Is sometimes used). The determination here can be performed automatically / mechanically without depending on the judgment of a person having expert knowledge such as a doctor or a laboratory technician, as is clear from the determination criteria.

The examination method of the present invention is carried out before or after the start of treatment. If the test method of the present invention is performed before the start of treatment and the results are used, more appropriate treatment becomes possible. That is, the present invention can be used as a means for formulating and determining a treatment plan. On the other hand, if the test method of the present invention is performed after the start of treatment, for example, the present invention can be used to change the treatment policy. That is, the present invention is also useful as a means to provide a scientific basis for reviewing a treatment plan. The test method of the present invention may be carried out several times sequentially to monitor the treatment effect and revise / revision the treatment policy.

3. Method of Screening for Drug The present invention further provides a method of screening for a substance effective for the treatment of JMML, based on the results of identification of a fusion gene as a new therapeutic target in JMML. The substance identified by the screening method of the present invention is particularly a therapeutic agent for patients who are positive for ALK fusion gene (eg, DCTN-ALK fusion gene, RANBP2-ALK fusion gene) or ROS1 fusion gene (eg, TBL1XR1-ROS1 fusion gene) or It is promising as a therapeutic drug candidate.

In the screening method of the present invention, the following steps (i) to (iii) are performed.
(i) preparing a cell expressing a fusion gene of ALK or ROS1 (ii) culturing the cell in the presence of a test substance;
(iii) measuring the number of viable cells or the number of colonies to determine the efficacy of the test substance.

In the screening method of the present invention, first, cells expressing an ALK fusion gene (for example, DCTN1-ALK fusion gene, RANBP2-ALK fusion gene) or a ROS1 fusion gene (for example, TBL1XR1-ROS1 fusion gene) are prepared (Step (i) ). In other words, new fusion gene positive cells are prepared. For example, those obtained by introducing a novel fusion gene into an established blood cell line (specifically, NALM6, HEK293T, etc.) and forcibly expressing them can be used as the cells here. It is also possible to use cells isolated from a patient who is positive for the novel fusion gene, passage cells of the cells, or cell lines established from the cells.

In step (ii), the prepared cells are cultured in the presence of the test substance. The number of cells to be used is not particularly limited, and can be determined in consideration of detection sensitivity, experimental equipment, and the like. For example, 1 × 10 ² to 1 × 10 ⁶ cells can be used in one screening operation.

The amount (addition amount) of the test substance in the culture solution can be set arbitrarily, but the addition amount may be set within a range that does not have a fatal effect when normal cells are cultured under the same conditions. Those skilled in the art can set appropriate addition amounts by preliminary experiments.

The culture time is set so that the action and effect of the test substance can be sufficiently evaluated, but is not particularly limited. For example, the culture time can be set in the range of 10 minutes to January. When a substance exhibiting a desired action / effect is found, the culture time in the subsequent screening can be set based on the time required for the substance to exhibit the action / effect.

As the test substance, organic compounds or inorganic compounds of various molecular sizes can be used. Examples of organic compounds include nucleic acids, peptides, proteins, lipids (simple lipids, complex lipids (phosphoglycerides, sphingolipids, glycosylglycerides, cerebrosides, etc.), prostaglandins, isoprenoids, terpenes, steroids, polyphenols, catechins, vitamins The test substance may be derived from natural products or synthetically, In the latter case, an efficient screening system can be constructed using, for example, a combinatorial synthesis technique. Extracts, culture supernatants, etc. may be used as a test substance, and existing drugs, nutritional foods, food additives, etc. may be used as test substances etc. Testing by simultaneously adding two or more types of test substances Interactions between substances, synergy, etc. may be examined.

In step (iii) following step (ii), the number of viable cells or the number of colonies after culture is measured to determine the cell growth inhibitory activity (cytotoxic activity) of the test substance, that is, the effectiveness. For example, cells cultured in the presence of the test substance (test group) and cells cultured in the absence of the test substance (control group) are prepared, and the number of surviving cells or the number of colonies is measured for each group and compared. Do. From the comparison results, the extent to which the cell viability / number of colonies has changed as a result of the presence of the test substance is determined. The test substance is effective against JMML when the number of living cells / colony number in the test group is small (cell viability is low) as compared to the control group, ie, when the test substance shows cell growth inhibitory activity. It can be determined that there is. In one aspect, in this case, it is determined that the test substance is effective against a novel fusion gene positive case. If a significant decrease in the survival rate is observed in the test group, it can be determined that the efficacy of the test substance is particularly high. It is also possible to determine the efficacy of the test substance by comparing the number of cells before and after culture in the test group, instead of setting a control group. However, setting the control group as described above can give more reliable results.

In a preferred embodiment, a test group (cultured with cytokine) in which cells are cultured in the presence of a cytokine (for example, GM-CSF can be used) and a test (cultured with no cytokine) group in which cells are cultured in the absence And determine based on the number of viable cells / number of colonies in both test groups. In this way, it is possible to evaluate in an environment close to in vivo where cytokines are abundant. Also in this embodiment, it is preferable to provide a control group (in which the cells are cultured in the absence of the test substance) for each, and to make a judgment after comparing and evaluating the test group and the control group.

The substance (screening product) selected by the screening method of the present invention is a strong candidate (lead compound) as an active ingredient of a medicine for JMML (particularly, a case where a novel fusion gene is positive). When the selected substance has sufficient medicinal effects, it can be used as it is as an active ingredient of a medicine. On the other hand, even if the drug does not have sufficient medicinal effects, it can be used as an active ingredient of a medicine after being modified such as chemical modification to enhance its medicinal effects. Of course, even in the case of having sufficient efficacy, similar modifications may be made for the purpose of further enhancing the efficacy.

4. Fusion Gene, Fusion Protein The present invention further provides three novel fusion genes responsible for the onset of JMML, ie, a DCTN1-ALK fusion gene, a TBL1XR1-ROS1 fusion gene, and a RANBP2-ALK fusion gene. The DCTN1-ALK fusion gene is   A breakpoint is present in exon 28, a breakpoint is present in intron 19 in the ALK gene, and has a structure in which up to exon 26 of the DCTN gene and exon 20 or later of the ALK gene are linked. Similarly, the TBL1XR1-ROS1 fusion gene has a breakpoint in intron 12 in the TBL1XR1 gene, a breakpoint in exon 36 in the ROS1 gene, and a portion of the intron 12 of the TBL1XR1 gene and the ROS1 gene It has a structure in which exons 36 and beyond are linked. The RANBP2-ALK fusion gene has a breakpoint at intron 18 in the RANBP2 gene, a breakpoint at intron 19 in the ALK gene, and the exon 18 of the RANBP2 gene is linked to the exon 20 and beyond of the ALK gene It has the following structure.

A typical genomic nucleotide sequence of a DCTN1-ALK fusion gene is a cDNA nucleotide sequence as SEQ ID NO: 1, a typical genomic nucleotide sequence of a TBL1XR1-ROS1 fusion gene as SEQ ID NO: 2, and a cDNA nucleotide sequence as SEQ ID NO: 3. The typical genomic nucleotide sequence of the RANBP2-ALK fusion gene is shown in SEQ ID NO: 5, and the cDNA nucleotide sequence is shown in SEQ ID NO: 6, respectively.

The present invention also provides a fusion protein which is the expression product of a novel fusion gene. Specifically, a DCTN-ALK fusion protein encoded by a DCTN1-ALK fusion gene, a TBL1XR1-ROS1 fusion protein encoded by a TBL1XR1-ROS1 fusion gene, and a RANBP2-ALK fusion protein encoded by a RANBP2-ALK fusion gene Provided. The DCTN1-ALK fusion protein comprises a coiled coil domain from RANBP2, a kinase domain from ALK. Similarly, the TBL1XR1-ROS1 fusion protein contains an FN type III domain from TBL1XR1, a kinase domain from ROS1. In addition, the RANBP2-ALK fusion protein contains a TRP domain derived from RANBP2, a kinase domain derived from ALK. A typical amino acid sequence of a DCTN1-ALK fusion protein is shown in SEQ ID NO: 7, a typical amino acid sequence of a TBL1XR1-ROS1 fusion protein is shown in SEQ ID NO: 8, and a typical amino acid sequence of a RANBP2-ALK fusion protein is shown in SEQ ID NO: 9 It shows each.

The fusion gene and fusion protein of the present invention are useful, for example, as a therapeutic target or a diagnostic marker, or as an indicator for judging the suitability of a therapeutic agent.

The fusion gene and fusion protein of the present invention can be prepared in an isolated state, for example, by separating and purifying from a patient who is positive for the corresponding fusion gene. Alternatively, they may be prepared by chemical synthesis, genetic engineering techniques, etc. based on the sequence information disclosed herein.

Incidentally, matters not specifically mentioned in the present specification (conditions, operation methods, etc.) may be in accordance with ordinary methods, for example, Molecular Cloning (Third Edition, Cold Spring Harbor Laboratory Press, New York), Current protocols in molecular biology (edited) by Frederick M. Ausubel et al., 1987), Current protocols in Immunology, John Wiley & Sons Inc, etc. can be referred to.

In order to create a new molecular targeted therapy for JMML, we examined the following.
1. Comprehensive gene analysis (1) Method QIAamp DNA from bone marrow containing leukemia cells of 135 JMML patients and 15 Nounan syndrome related myeloproliferative disease (NS / MPD) patients, or peripheral blood mononuclear cells DNA was extracted using Blood Mini Kit (Qiagen) and RNA was extracted using RNeasy Mini Kit (Qiagen). The degree of RNA degradation was confirmed using an Agilent 2200 TapeStation and RNA ScreenTape (Agilent).

<All exome analysis>
From the DNA obtained from 60 JMML patients and 9 NS / MPD patients, using SureSelect XT target enrichment system and SureSelect Human All Exon v3 or v5 bait (Agilent) creates a library for whole exome analysis did. Next-generation sequencing was performed using HiSeq 2500 (Illumina), and the obtained sequence data was analyzed using Genomon (http://genomon.hgc.jp/exome/) to identify gene mutations.

<PCR based target deep sequence analysis>
Gene regions of PTP N11, NRAS, KRAS, CBL, NF1, SETBP1, JAK3, SH3BP1 using Quick Taq HS DyeMix (TOYOBO) from DNA obtained from 86 JMML patients and 6 NS / MPD patients Is amplified and purified using QIAquick PCR Purification Kit (QIAGEN), NotI (Fermentas), T4 DNA ligase (Takara Bio), and then analyzed for analysis using Illumina pair-end library protocol (Illumina) I created a rally. After that, sequencing and analysis were performed in the same procedure as exome analysis.

<Capture based target deep sequence analysis>
SureSelect custom bait (Agilent Muramatsu, H. et al. Clinical utility of next-generation sequencing for inherited bone) targeted at 184 genes from DNA obtained from 12 JMML patients and 2 NS / MPD patients A library for analysis was created using marrow failure syndromes. Genet Med (2017). and SureSelect XT target enrichment system (Agilent). After that, sequencing and analysis were performed in the same procedure as exome analysis.

<RNA sequence analysis>
From RNA obtained from 117 JMML patients and 12 NS / MPD patients, a library for RNA sequence analysis was created using NEBNext Ultra RNA Prep Kit for Illumina (New England Biolabs). Next generation sequencing was performed using HiSeq 2500 (Illumina), and the resulting sequence data was analyzed using Tophat-fusion software to detect fusion genes.
<Genome-wide DNA methylation analysis>
Analysis was performed using Infinium HumanMethylation 450 BeadChip (Illumina) from the DNA obtained from 95 JMML patients and 11 NS / MPD patients, and the β value was calculated.

(2) Results and Discussion The clinical findings, laboratory findings and genetic analysis results of each case are shown in FIG. As in previous reports, 89% of cases identified RAS pathway related gene mutations. Moreover, as a result of DNA methylation analysis, it was roughly divided into two groups of hypermethylation profile and hypomethylation profile.

2. Expression analysis We analyzed gene expression profiles based on RNA-seq data in 105 cases. As a result of all gene based hierarchical clustering, 4 groups of clusters were identified. Cluster A1 was significantly correlated with PTPN11 mutations and had a poor prognosis. Furthermore, hierarchical clustering using 435 genes related to diagnostic classification model (DC model) designed for classification of myelodysplastic syndrome (MDS) and leukemia was similarly performed, and three clusters (cluster 1 -3) was identified. Cluster 1 corresponds to the expression profile of AML-type in previous studies (Non-Patent Document 9), and also correlates with hypermethylation profile, PTPN11 / NF1 mutation, two or more mutations, cluster A1, with poor prognosis 5-year overall survival rate (5-year OS) (95% CI): 47.2% (28.2% to 64.1%) vs. 61.4% (47.2% to 72.7%), p = 0.20, 5-year graft survival rate for 5 years (5-year TFS) (95% CI): 0% to 28.5% (17.3% to 40.7%), p = 2.6 × 10 ^-6 ]. In addition, when differentially expressed genes were analyzed between the two groups of hypermethylation profile and hypomethylation profile using the technique of differential expression analysis, LIN28B was most significantly upregulated in hypermethyl profile Identified. High expression of LIN28B was identified as a poor prognostic marker of JMML in previous studies (Non-patent Document 8), and high expression of LIN28B was frequently observed in patients with hypermethylation profile (p = 2.1 × ^10-13 ).

3. Discovery of receptor-type tyrosine kinase fusion gene in JMML (1) Method RNA was extracted from bone marrow containing leukemia cells of 105 JMML patients using RNeasy Mini Kit (QIAGEN). After checking the degree of degradation of RNA using Agilent 2200 TapeStation and RNA ScreenTape (Agilent), a library for RNA sequence analysis was created using NEBNext Ultra RNA Prep Kit for Illumina (New England Biolabs). Next generation sequencing was performed using HiSeq 2500 (Illumina), and the resulting sequence data was analyzed using Tophat-fusion software to detect fusion genes.

(2) Results and Discussion In 3 cases, a fusion gene related to receptor tyrosine kinase was detected (FIG. 2). All detected fusion genes were fused in-frame. Tyrosine kinase-related fusion genes were detected in 3 out of 16 cases (19%) without classical RAS pathway mutations. Among them, DCTN1-ALK and RANBP2-ALK have been reported as gain-of-function mutations in non-small cell lung cancer and the like. The remaining TBL1XR1-ROS1 was also a gene that TBL1XR1 and ROS1 were both fused to other genes and reported to be associated with tumorigenesis. In general, a fusion gene related to receptor tyrosine kinase is reported to be a fusion of a kinase domain of tyrosine kinase and a domain related to dimer formation of a fusion partner, which is expected to lead to gain of function The TBL1XR1-ROS1 fusion protein also retains the kinase domain of ROS1 and the domain associated with dimerization of TBL1XR1, strongly suggesting that this fusion leads to gain of function. It has been reported that both ALK and ROS1 strongly activate the RAS pathway through fusion gene formation to be involved in tumorigenesis, and activate the RAS pathway by a mechanism different from classical RAS pathway gene mutation, thereby causing JMML to It is suggested that it is related to the onset.

4. RanBP2-ALK tumor growth inhibition in vitro effect of crizotinib in positive patients (1) a method RanBP2-ALK fusion gene positive patients (UPN168) of CD34-positive cells extracted from the bone marrow (1 × 10 ³ cells) were MethoCult ^TM H4434 classic (cytokines (+)) or MethoCult ^TM H4230 (cytokines (-)) (STEMCELL Technologies Inc.) crizotinib diluted in DMSO (Sigma-Aldrich, Inc.) to (ALK / ROS1 / MET inhibitor Pfizer) to 0,20, The cells were cultured for 2 weeks in a medium supplemented with 80, 200 and 500 nM. Two weeks later, the number of colony forming unit-granulocyte macrophage (CFU-GM) and burst-forming unit-erythroid (BFU-E) in each medium was counted.

(2) Results and discussion The results are shown in FIG. In any of the cytokines (+) and cytokines (-), crizotinib inhibited JMML colony formation in a concentration-dependent manner. Crizotinib has an antiproliferative effect in vitro in RANBP2-ALK positive JMML cases, suggesting that it may also be useful clinically.

5. Administration of crizotinib to RANBP2-ALK positive patients (1) Methods and clinical course (Figure 4)
UPN168 (RANBP2-ALK positive) was resistant to conventional AML-type chemotherapy, developed blast crisis over time, and showed a rapid increase in tumor cells. It is thought that radical cure is very difficult by conventional chemotherapy and hematopoietic stem cell transplantation treatment. CDNA was synthesized using ThermoScript RT-PCR system (Thermo) with RNA extracted from bone marrow mononuclear cells at diagnosis and at day 91 as a template. RT-PCR using PrimeSTAR GXL DNA polymerase was performed using the following primer set corresponding to the sequences of RANBP2 and ALK.
<RANBP2-ALK cDNA primer set (design position RANBP2 exon 15, ALK exon 20, product size 671 bp)>
Forward (RANBP2-ALK forward primer): ATTTTTCACAGAGAGGCAGAAAGACATTGA (SEQ ID NO: 10)
Reverse (RANBP2-ALK reverse primer): GTCTTGCCAGCAAAGCAGTAG (SEQ ID NO: 11)

As a result of RT-PCR, RANBP2-ALK was detected from all samples. As described above, crizotinib (Pfizer) exhibited a tumor suppressor effect in vitro, suggesting that it may be effective in this case.

The contents of the above were explained to the patient and the patient's parents, and after obtaining consent, oral administration of crizotinib (280 mg / m ² / day) was started from the 104th day in addition to conventional chemotherapy. The dose of crizotinib was determined based on the results of a phase I trial of crizotinib for pediatric patients with refractory solid tumors and anaplastic large cell lymphoma (Mosse, YP et al. Safety and activity of crizotinib for paediatric patients with refractory Lancet Oncol 14, 472-80 (2013)) solid tumours or anaplastic large-cell lymphoma: a Children's Oncology Group phase 1 consortium study. Thereafter, the same evaluation was made using RNA extracted from peripheral blood mononuclear cells collected on the 135th day, and it became negative. ALK break apart FISH and monosomy 7 FISH were similarly confirmed to be negative, and it was judged that molecular biological solution was achieved. Thereafter, bone marrow transplantation was performed from HLA-matched siblings, and disease-free survival was confirmed 11 months after transplantation.

(2) Discussion crizotinib was clinically useful in RANBP2-ALK positive JMML cases. The remaining two cases with the ALK-ROS1 fusion gene did not receive crizotinib and died of tumor progression.

6. Confirmation of the tumor growth inhibitory effect of crizotinib in classical RAS pathway mutation positive JMML samples (1) method CD34 positive cells (1 × 10 ³⁾ extracted from the bone marrow of four JMML patients positive for existing RAS pathway gene mutations ) (0, 200, 500 nM of crizotinib (Pfizer) diluted with Metho CultTM H 4434 classic (cytokine (+)) or Metho CultTM H 4 230 (cytokine (-)) (STEMCELL Technologies) in DMSO (Sigma-Aldrich) The cultures were cultured for 2 weeks. Two weeks later, the number of colony forming unit-granulocyte macrophage (CFU-GM) in each medium was counted.
(2) Results and Discussion In all four cases crizotinib inhibited JMML colony formation in a concentration-dependent manner. This effect was stronger in the KRAS and PTPN11 gene mutation positive cases than in the CBL mutation cases. Crizotinib is negative for ALK fusion gene, suggesting that classical RAS gene mutation-positive cases may suppress tumor growth.

7. Integrated genetic analysis This study is the first integrated genetic analysis of JMML, including genome-wide methylation profiling, RNA-seq, and resequencing data; methylation and gene expression profiles, genetic alterations, clinical testing and other tests An evaluation of the correlation between the findings was made. Hypermethylation profiles are highly correlated with established risk factors of JMML, including high age at diagnosis, elevated HbF, decreased platelet count, PTPN11 and two or more gene mutations, LIN28B overexpression, and AML-like expression profile The group was identified as having a poor prognosis (FIG. 6). The hypermethylation profile group showed an "AML-type" methylation and expression profile with poor prognosis, even though blasts did not increase to the level of AML at diagnosis. The various clinical biomarkers reported so far may reflect different aspects of the same poor prognosis group of JMML patients; clinical features (age, HbF levels, platelet count) and LIN28B expression It suggests the possibility that it can be used as a surrogate marker for this poor prognosis group.

8. Tumor growth inhibitory effect of ALK tyrosine kinase inhibitor other than crizotinib and luxoritinib (JAK2 tyrosine kinase inhibitor) in vitro (1) method PTPN11 p.D61 V mutation positive and CD34 positive cells (1 × 10 ³ ) as MethoCult ^TM H4434 classic (cytokine (+)) or Metho Cult ^TM H4230 (cytokine (-)) (STEMCELL Technologies) in a medium supplemented with alectinib, seritinib or TAE 684 or luxolitinib diluted with DMSO (Sigma-Aldrich) at a predetermined concentration Incubated for 2 weeks. As a control, a test group to which crizotinib was added was provided. Two weeks later, the number of colony forming unit-granulocyte macrophage (CFU-GM) in each medium was counted.

(2) Results and discussion The results are shown in FIG. In any of the cytokines (+) and cytokines (-), alectinib, seritinib and TAE684 inhibited JMML colony formation in a concentration-dependent manner. In addition, luxoritinib also showed concentration-dependent inhibition of colony formation.

9. Summary We have successfully identified subgroups of JMML with a poor prognosis, with hypermethylation profiles, AML-type expression profiles, and two or more gene mutations, and clinical and biological poor prognostic factors are related to each other. It became clear that In addition, novel fusion genes (DCTN1-ALK, RANBP2-ALK, and TBL1XR1-ROS1) related to receptor tyrosine kinases have been identified. Furthermore, it became clear that an ALK tyrosine kinase inhibitor such as crizotinib, which is an ALK / ROS1 / MET inhibitor, could be a promising molecular target drug for JMML. On the other hand, it has been shown that JAK2 tyrosine kinase inhibitors can also be molecular targeted therapeutic agents for JMML.

The therapeutic agents of the present invention provide new therapeutic strategies for JMML. The present invention can contribute to the improvement of the treatment result of JMML, the improvement of prognosis and the like. New fusion genes identified from JMML cases are useful not only as therapeutic targets but also as test / diagnostic markers for JMML.

The present invention is not limited to the description of the embodiments and examples of the above-mentioned invention. Various modifications are also included in the present invention as long as those skilled in the art can easily conceive of the claims without departing from the scope of the claims. The contents of articles, published patent publications, patent publications, etc. specified in the present specification are incorporated by reference in their entirety.

SEQ ID NO: 10: Description of artificial sequences: RANBP2-ALK forward primer
SEQ ID NO: 11: Description of artificial sequences: RANBP2-ALK reverse primer

Claims (11)

1. A therapeutic agent for juvenile myelomonocytic leukemia, comprising an ALK tyrosine kinase inhibitor or a JAK2 tyrosine kinase inhibitor.
2. The juvenile myelomonocytic leukemia therapeutic agent according to claim 1, wherein the ALK tyrosine kinase inhibitor is a tyrosine kinase inhibitor against ALK and ROS1.
3. The juvenile myelomonocytic leukemia therapeutic agent according to claim 1, wherein the ALK tyrosine kinase inhibitor is crizotinib, alectinib, seritinib or TAE684.
4. The juvenile myelomonocytic leukemia therapeutic drug according to claim 1, wherein the JAK2 tyrosine kinase inhibitor is luxolitinib.
5. The therapeutic agent for juvenile myelomonocytic leukemia according to any one of claims 1 to 4, wherein the fusion gene of ALK or ROS1 is administered to a patient who is positive.
6. The juvenile myelomonocytic leukemia therapeutic drug according to any one of claims 1 to 5, which is used in combination with another drug.
7. The juvenile myelomonocytic leukemia therapeutic drug according to claim 6, wherein the other drug is an anticancer drug.
8. Testing methods for juvenile myelomonocytic leukemia, including the following steps (1) to (3):
   (1) preparing a sample containing leukemia cells isolated from a patient with juvenile myelomonocytic leukemia;
   (2) detecting the presence or absence of a fusion gene of ALK or ROS1 or a fusion protein encoded by the fusion gene in the sample;
   (3) determining that the fusion gene or the fusion protein is detected to be compatible with treatment with an ALK tyrosine kinase inhibitor.
9. ALK or ROS1 fusion gene as a cause of juvenile myelomonocytic leukemia.
10. Method of screening for substances effective for the treatment of juvenile myelomonocytic leukemia, comprising the following steps (i) to (iii):
    (i) preparing a cell that expresses a fusion gene of ALK or ROS1;
    (ii) culturing the cells in the presence of a test substance;
    (iii) measuring the number of viable cells or the number of colonies to determine the efficacy of the test substance.
11. A method for treating juvenile myelomonocytic leukemia, comprising administering a therapeutically effective amount of an ALK tyrosine kinase inhibitor or a JAK2 tyrosine kinase inhibitor to a patient with juvenile myelomonocytic leukemia.

Images