JP2006518997A - Novel acyl coenzyme A: polynucleotide encoding monoacylglycerol acyltransferase-3 (MGAT3) and uses thereof - Google Patents

Abstract

The present invention provides novel polynucleotides encoding MGAT3 polypeptides, fragments and homologues thereof. Also provided are vectors, host cells, antibodies, and recombinant and synthetic methods for producing the polypeptides. The present invention further relates to diagnostic and therapeutic methods for applying these novel MGAT3 polypeptides to the diagnosis, treatment and / or prevention of various diseases and / or disorders associated with these polypeptides (eg obesity). . The present invention further relates to screening methods for identifying agonists and antagonists of the polynucleotides and polypeptides of the present invention.

Description

  This application claims the benefit of US Provisional Patent Application No. 60 / 441,567, filed Jan. 21, 2003, which is incorporated herein by reference in its entirety.

  The present invention provides novel polynucleotides, fragments and homologs thereof that encode monoacylglycerol acyltransferase-3 (“MGAT3”) polypeptides. Also provided are vectors, host cells, antibodies, and recombinant and synthetic methods for producing the polypeptides. Furthermore, the present invention provides a diagnostic and therapeutic method for applying these novel MGAT3 polypeptides to the diagnosis, treatment and / or prevention (particularly the treatment of obesity) of various diseases and / or disorders related to these polypeptides. About. The present invention further relates to screening methods for identifying agonists and antagonists of the polynucleotides and polypeptides of the present invention.

Triacylglycerol (TAG), an important molecule for eukaryotic fuel storage, is synthesized by two main pathways: the glycerol 3-phosphate pathway and the monoacylglycerol pathway. The glycerol 3-phosphate pathway is present in all tissues, but the monoacylglycerol pathway is restricted to small intestinal enterocytes (Bell, RM and RAColeman, Annu. Rev. Biochem . (1980) 49: 459-87). The monoacylglycerol pathway is believed to be crucial for the packaging of dietary fat into chylomicron lipoprotein particles (Levy, E., Can. J. Physiol. Pharmacol. (1992) 70 (4): 413-9).

Acylcoenzyme A: Monoacylglycerol acyltransferase (“MGAT”) (EC 2.3.1.22) is the enzyme best known for its role in the initiation of the first step of the monoacylglycerol pathway (Lehner R. and A. Kuksis, Prog. Lipid Res. (1996) 35 (2): 169-201). In order for insoluble dietary fat such as TAG to be absorbed by the intestine, dietary fat molecules must first be digested by pancreatic lipase into soluble free fatty acids and 2-monoacylglycerol. These products are rapidly absorbed by intestinal cells and within a few minutes of their appearance in the small intestinal lumen, MGAT uses these molecules as substrates to form diacylglycerol (DAG). In addition, DAG is acylated by diacylglycerol acyltransferase (DGAT) to reform TAG. The newly formed TAG molecule is then packaged with other complex lipids such as cholesterol esters, phospholipids and a small amount of protein to form round lipoprotein particles called kilomicrons. Chylomicron, 90% of which is composed of TAG, is secreted quickly into the lymph, where it serves as a source of energy for the body (Lehner, R. and A. Kuksis, supra).

Like other neurolipid synthetic proteins, MGAT is an integral membrane protein and has not been purified to date from any source yet. The molecular identity of the gene encoding intestinal MGAT was difficult to capture. The first cDNA clone (named MGAT1) that was shown to have MGAT enzyme activity was identified by Yen et al . (Yen, CL et al., Proc. Natl. Acad. Sci. USA (2002) 99 (13) . ): 8512-7). However, MGAT1 is expressed in the stomach, kidney, white adipose tissue and brown adipose tissue, but not in the small intestine. Therefore, MGAT1 cannot explain the high intestinal MGAT enzyme activity that is important for fat absorption physiology (Yen, CL et al., Supra).

It is known that drugs that inhibit the absorption of dietary fat may be effective in the treatment of obesity (Zhi, J. et al. (1995) J. Clin. Pharmacol. , 35 (11): 1103-8, Lucas, KH and B. Kaplan-Machli (2001) Ann. Pharmaother. , 35 (3): 314-28). However, such drug mechanisms include inhibition of pancreatic lipase, which leads to the undesirable side effect of fecal incontinence (Kolanowski, J. (1999) Drug Saf. , 20 (2): 119-31). . An alternative approach is to digest fat into fatty acids in the intestine and then prevent fatty acid incorporation or packaging into kilomicron particles.

Since intestinal MGAT is a critical enzyme for this pathway, there is a continuing need to identify genes responsible for MGAT intestinal enzyme activity and hence for the absorption of dietary fat. Such gene regulation would be a method of treating obesity. The present invention is an invention directed to such a demand.
(Summary of Invention)

  The present invention relates to at least one of the amino acid sequences shown in FIGS. 1A-B (SEQ ID NO: 2) or ATCC deposit numbers PTA-4454 and PTA-4803 deposited on June 12, 2002 and November 14, 2002, respectively. The MGAT3 cDNA clone is directed to a novel cDNA named monoacylglycerol acyltransferase-3 (hereinafter “MGAT3”) that encodes the MGAT protein having the amino acid sequence encoded by the cDNA clone. MGAT3 is a polynucleotide sequence (SEQ ID NO: 1) set forth in FIGS. 1A-1B or at least 1 deposited as ATCC deposit numbers PTA-4454 and PTA-4803 on June 12, 2002 and November 14, 2002, respectively. It has the polynucleotide sequence of two MGAT3 cDNA clones.

  MGAT3 was identified using bioinformatics methods and cloned using molecular techniques. MGAT3 meets the standards of MGAT responsible for absorption of dietary fat. The expression profile of human MGAT3 is significantly limited to the gastrointestinal tract. Intestinal MGAT inhibition is one approach to anti-obesity treatment since preventing fat absorption is one of the sure ways to cause weight loss. MGAT3 is therefore an important target for the treatment of obesity and related disease states.

  The present invention employs recombinant vectors containing the isolated nucleic acid molecules of the present invention, host cells containing the recombinant vectors, methods of producing such vectors and host cells, and recombinant techniques Also included are their use in the manufacture of MGAT proteins or MGAT peptides. Synthetic methods for producing the polypeptides and polynucleotides of the invention are provided. Also provided are diagnostic methods for detecting diseases, disorders and / or conditions associated with MGAT polypeptides and MGAT polynucleotides, and therapeutic methods for treating such diseases, disorders and / or conditions. Furthermore, the present invention relates to a screening method for identifying a binding partner of the polypeptide, particularly a screening method for identifying an activator and an inhibitor of the novel MGAT polypeptide of the present invention.

  In one aspect, the invention is directed to an isolated nucleic acid molecule consisting of a polynucleotide having the nucleotide sequence of SEQ ID NO: 1.

  In another embodiment, the present invention relates to (a) a polynucleotide fragment of SEQ ID NO: 1 or ATCC deposit numbers PTA-4454 or PTA-4803 deposited on June 12, 2002 and November 14, 2002, respectively. A polynucleotide fragment of the cDNA sequence contained in one and capable of hybridizing to SEQ ID NO: 1, (b) a polypeptide fragment of SEQ ID NO: 2, or deposited on June 12, 2002 and November 14, 2002, respectively A polynucleotide encoding a polypeptide fragment encoded by a cDNA sequence contained in one of ATCC Accession Nos. PTA-4454 or PTA-4803 and capable of hybridizing to SEQ ID NO: 1, (c) SEQ ID NO: A cDNA sequence contained in one of the two polypeptide domains or ATCC deposit numbers PTA-4454 or PTA-4803 deposited on June 12, 2002 and November 14, 2002, respectively, and hybridized to SEQ ID NO: 1. (D) the polypeptide epitope of SEQ ID NO: 2, or the ATCC deposit deposited on June 12, 2002 and November 14, 2002, respectively. A polynucleotide encoding a polypeptide epitope encoded by a cDNA sequence contained in one of number PTA-4454 or PTA-4803 and capable of hybridizing to SEQ ID NO: 1, (e) a complementary sequence to SEQ ID NO: 1 A polynucleotide corresponding to (antisense) and a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides described in (f) (a) to (e), Do not hybridize under stringent conditions to nucleic acid molecules with nucleotide sequences of only A or T residues. Directed to an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of:

  In another embodiment, the present invention is directed to any of the above nucleic acid molecules, wherein the polynucleotide fragment consists of a nucleotide sequence encoding MGAT3.

  In another embodiment, the present invention is directed to a recombinant vector comprising any of the above isolated nucleic acid molecules.

  In another embodiment, the present invention is directed to a recombinant host cell comprising any of the above recombinant vectors.

  In another embodiment, the invention includes (a) SEQ ID NO: 2 or one of ATCC deposit numbers PTA-4454 or PTA-4803 deposited on June 12, 2002 and November 14, 2002, respectively. A polypeptide fragment of the encoded sequence, (b) SEQ ID NO: 2 or one of ATCC deposit numbers PTA-4454 or PTA-4803 deposited on June 12, 2002 and November 14, 2002, respectively. A polypeptide domain of the encoded sequence included, (c) SEQ ID NO: 2, or one of ATCC deposit numbers PTA-4454 or PTA-4803 deposited on June 12, 2002 and November 14, 2002, respectively And (d) SEQ ID NO: 2, or ATCC deposit number PTA-4454 or PTA-4803 deposited on June 12, 2002 and November 14, 2002, respectively. Consisting of a full-length protein, of the encoded sequence, contained in one of Directed to an isolated polypeptide comprising an amino acid sequence selected from the group.

  In another embodiment, the present invention is directed to the isolated polypeptide described above, wherein the full-length protein comprises a deletion of a contiguous amino acid sequence from its C-terminus or N-terminus.

  In another embodiment, the present invention is directed to an isolated antibody that specifically binds to the isolated polypeptide.

  In another embodiment, the present invention is directed to a recombinant host cell that expresses the isolated polypeptide.

  In another embodiment, the present invention provides a method for producing an isolated polypeptide, comprising: (a) culturing the recombinant host cell under conditions such that the polypeptide is expressed; and b) directed to a method comprising recovering said polypeptide. The invention also encompasses polypeptides produced by such methods.

  In another aspect, the present invention is directed to a method for preventing, treating or ameliorating a medical condition comprising administering to a mammalian subject a therapeutically effective amount of the polypeptide or a modulator thereof. It is done.

  In another aspect, the invention is directed to a method of treating obesity, comprising administering to a obese mammalian subject a therapeutically effective amount of the polypeptide or modulator thereof.

  In another embodiment, the present invention provides a method of diagnosing a pathological condition or susceptibility to a pathological condition in a subject, comprising: (a) determining the presence or absence of a mutation in the polynucleotide; and (b ) To a method comprising diagnosing a pathological condition or susceptibility to a pathological condition based on the presence or absence of the mutation.

  In another embodiment, the present invention relates to a method for diagnosing a pathological condition or susceptibility to a pathological condition in a subject, wherein (a) the presence or expression level of the polypeptide in a biological sample is determined. And (b) diagnosing the pathological condition or susceptibility to the pathological condition based on the presence or expression level of the polypeptide.

  In another embodiment, the present invention provides (a) a polynucleotide encoding the polypeptide of SEQ ID NO: 2, (b) ATCC deposit number PTA deposited on June 12, 2002 and November 14, 2002, respectively. -4454 or PTA-4803 selected from the group consisting of a polynucleotide encoding a polypeptide encoded by a cDNA and (c) a polynucleotide corresponding to the complementary sequence (antisense) of SEQ ID NO: 1 Directed to an isolated nucleic acid molecule consisting of a polynucleotide having a nucleotide sequence of

  In another embodiment, the present invention is directed to the isolated nucleic acid molecule, wherein the polynucleotide comprises a nucleotide sequence encoding MGAT3.

  In another embodiment, the present invention is directed to a recombinant vector comprising the isolated nucleic acid molecule.

  In another embodiment, the present invention is directed to a recombinant host cell comprising the above recombinant vector.

  In another embodiment, the present invention provides (a) a full-length protein of SEQ ID NO: 2, (b) ATCC deposit number PTA-4454 or PTA deposited on June 12, 2002 and November 14, 2002, respectively. Directed to an isolated polypeptide consisting of an amino acid sequence selected from the group consisting of a polypeptide encoded by the cDNA contained in one of -4803.

  In another aspect, the present invention is directed to a method of diagnosing a pathological condition, wherein the condition is a disorder associated with abnormal MGAT activity, such as obesity, and a gastrointestinal disorder, such as Crohn's disease. It is done.

In another embodiment, the present invention is a method for preventing, treating or ameliorating a medical condition, wherein the condition is a disorder associated with abnormal MGAT activity, such as obesity, and a gastrointestinal disorder, such as Crohn's disease Directed to the method.
(Detailed description of the invention)

  The invention will be more readily understood with reference to the following detailed description of preferred embodiments of the invention and the examples described herein.

  The present invention is directed to a novel cDNA named monoacylglycerol acyltransferase-3 (hereinafter “MGAT3”) that has substantial homology to known acylglycerol acyltransferase enzymes. MGAT3 is also called DGA-C and DGA-3. MGAT3 is derived from the amino acid sequence shown in FIGS. 1A-B (SEQ ID NO: 2) or the MGAT3 cDNA clone deposited on June 12, 2002 and November 14, 2002 as ATCC deposit numbers TPA-4454 and PTA-4803, respectively. It encodes an MGAT protein with the encoded amino acid sequence. MGAT3 is the polynucleotide sequence shown in FIGS. 1A-B (SEQ ID NO: 1) or the MGAT3 cDNA clones deposited on June 12, 2002 and November 14, 2002 as ATCC deposit numbers TPA-4454 and PTA-4803, respectively. Having a polynucleotide sequence of MGAT3 was identified using bioinformatics methods and cloned using molecular techniques. MGAT3 meets the standards of MGAT responsible for absorption of dietary fat. The expression profile of human MGAT3 is significantly limited to the gastrointestinal tract. Intestinal MGAT inhibition is one approach to anti-obesity treatment since preventing fat absorption is one of the sure ways to cause weight loss. MGAT3 is therefore an important target for the treatment of obesity and related disease states.

  The present invention employs recombinant vectors containing the isolated nucleic acid molecules of the present invention, host cells containing the recombinant vectors, methods of producing such vectors and host cells, and recombinant techniques Also included are their use in the manufacture of MGAT proteins or MGAT peptides. Synthetic methods for producing the polypeptides and polynucleotides of the invention are provided. Also provided are diagnostic methods for detecting diseases, disorders and / or conditions associated with MGAT polypeptides and MGAT polynucleotides, and therapeutic methods for treating such diseases, disorders and / or conditions. Furthermore, the present invention relates to a screening method for identifying a binding partner of the polypeptide, particularly a screening method for identifying an activator and an inhibitor of the novel MGAT polypeptide of the present invention.

  MGAT3 meets the standards of MGAT responsible for absorption of dietary fat. The expression profile of human MGAT3 is significantly limited to the gastrointestinal tract. Specifically, in the ileum, MGAT3 transcripts are found about 45,000 times greater than the amount observed in most tissues other than the digestive system. When recombinant MGAT3 is expressed in a baculovirus insect cell line, strong MGAT enzyme activity is produced. Importantly, recombinant MGAT3 has superior substrate specificity for acylation of 2-monoacylglycerol compared to other stereoisomers, which must be met by real intestinal MGAT It is a requirement.

Clinically, Crohn's disease is diagnosed as an intestinal disorder that impairs calorie absorption (Kastin, DA and ALBuchman (2002) Curr . Opin . Clin . Nutr . Metab . Care , 5 (6): 699-706. ). As a result, patients are delayed in growth followed by localized enteritis (Hendrickson, BA, R. Gokhale and JHCho (2002) Clin. Microbiol. Rev. , 15 (1): 79-94). The present invention demonstrates that the steady state level of MGAT3 mRNA is significantly reduced in the ileum of patients with Crohn's disease. The consequence of such a deficiency is the accumulation of free fatty acids. It is well documented that fatty acids can act as inflammatory agents in the gut and that dietary management of fatty acids is a therapeutic approach for the treatment of various inflammatory bowel diseases, including Crohn's disease ( Aldhous, MC et al. (2001) Proc. Nutr. Soc. , 60 (4): 457-61). The loss of MGAT3 expression is consistent with these observations.

MGAT3 is also located at the intestinal muc3A locus on chromosome 7q22.1. This region has previously been shown to be a susceptibility locus for both Crohn's disease and ulcerative colitis (Satsangi, J. et al. (1996) Nat. Genet. , 14 (2): 199-202). . These findings further emphasize the physiological significance of MGAT3 in intestinal fat absorption and indicate that therapeutic approaches to supplement MGAT3 function can help correct Crohn's disease. Also, monitoring the loss of MGAT3 expression can serve as a biomarker for disease progression and as a tool for early diagnosis.

  In the present invention, the term “isolated” refers to a material that has been removed from its original environment (eg, the natural environment if the material is present in nature), and thus the material is “by hand”. It has been modified from the natural state. For example, an isolated polynucleotide may be part of a vector or composition, or may be contained within a cell, but in such a case, the vector, composition or specific cell It can be said to be “isolated” because it is not the original environment of the polynucleotide. The term “isolated” refers to genomic or cDNA libraries, whole cell or total mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred to blots), sheared It does not refer to whole cell genomic DNA preparations, or other compositions where the salient features of the polynucleotide / sequence of the invention are not technically proven.

  As used herein, “polynucleotide” refers to the nucleic acid sequence contained in SEQ ID NO: 1, or ATCC deposit numbers PTA-4454 or PTA-4803 (deposited on June 12, 2002 and November 14, 2002, respectively). It refers to the cDNA contained within the MGAT3 clone with one of the “deposited clones”). The MGAT3 clone was deposited with the American Type Culture Collection (“ATCC”) located at University Boulevard 10801, 20110-2209, Virginia, USA. The ATCC deposit made in the present invention was made in accordance with the provisions of the Budapest Treaty concerning the international recognition of the deposit of microorganisms in patent proceedings. By way of example only, the polynucleotide may contain the nucleotide sequence of a full-length cDNA sequence including 5 'and 3' untranslated sequences, coding regions with or without signal sequences, secreted protein coding regions. In addition, fragments, epitopes, domains and variants of the nucleic acid sequence can be included. Furthermore, “polypeptide” as used herein refers to a molecule having a translated amino acid sequence generated from a broadly defined polynucleotide.

  The “polynucleotide” of the present invention includes a polynucleotide having the ability to hybridize under stringent hybridization conditions to the sequence contained in SEQ ID NO: 1, its complementary strand, or cDNA in a clone deposited with ATCC. Are also included. “Stringent hybridization conditions” include 50% formamide, 5 × SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × Denhardt's solution, 10% dextran sulfate, and Refers to washing the filter at about 65 ° C. in 0.1 × SSC after overnight incubation at 42 ° C. in a solution containing 20 μg / ml denatured sheared salmon sperm DNA.

Also contemplated are nucleic acid molecules that hybridize to the polynucleotides of the invention under conditions of low stringency hybridization. Altering the stringency of hybridization and signal detection is accomplished primarily by manipulation of formamide concentration (decreasing the formamide percentage decreases stringency), salt conditions, or temperature. For example, low stringency hybridization conditions include 6 × SSPE (20 × SSPE = 3M NaCl, 0.2M NaH ₂ PO ₄ , 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 μg / ml Incubating overnight at 37 ° C in a solution containing salmon sperm blocking DNA, followed by washing at 50 ° C with 1xSSPE, 0.1% SDS. In addition, in order to achieve even lower stringency, a wash following stringent hybridization can be performed at a higher salt concentration (eg, 5 × SSC).

  Note that the above-described changes in conditions can be achieved by the introduction and / or substitution of alternative blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include, for example, Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations. In order to introduce a specific blocking reagent, it may be necessary to change the hybridization conditions described above due to compatibility problems.

  Of course, a polynucleotide that hybridizes only to a poly A + sequence (eg, the 3 ′ terminal poly A + region of a cDNA shown in the sequence listing) or a complementary series of T (or U) residues is included in the definition of “polynucleotide”. Will not be included. This is because such a polynucleotide can be linked to any nucleic acid molecule containing a poly (A) segment or its complementary strand (eg, virtually any double-stranded cDNA clone made using oligo dT as a primer). Because it will hybridize.

  The polynucleotide of the present invention may be composed of any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or unmodified DNA or modified RNA or modified DNA. For example, a polynucleotide is a single-stranded and double-stranded DNA, a DNA that is a mixture of a single-stranded region and a double-stranded region, a single-stranded and double-stranded RNA, a single-stranded region and a double-stranded region, A mixture of RNA, DNA and RNA (which may be single stranded, more typically double stranded or a mixture of single and double stranded regions) It can consist of a hybrid molecule containing The polynucleotide can also be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. The polynucleotide may also contain one or more modified bases or a DNA or RNA backbone that has been modified to provide stability or for other reasons. “Modified” bases include, for example, tritylated bases and unusual bases such as inosine. Since various modifications can be made to DNA and RNA, “polynucleotide” includes chemically, enzymatically or metabolically modified forms.

  The polypeptide of the present invention can be composed of amino acids linked to each other by peptide bonds or modified peptide bonds (ie, peptide isosteres), and may contain amino acids other than the 20 types of amino acids encoded by the polynucleotides. The polypeptide can be modified by natural processes such as post-translational processing or by chemical modification techniques well known in the art. Such modifications are explained in detail in basic textbooks and are described in more detail in monographs as well as in the vast research literature. Modifications can be present anywhere in the polypeptide, including the peptide backbone, amino acid side chains, and the amino terminus or carboxy terminus. It will be appreciated that the same type of modification may be present in the same or varying degrees at several places in a given polypeptide. Also, a given polypeptide can contain many types of modifications. The polypeptide may be branched as a result of, for example, ubiquitin binding, or may be a cyclic polypeptide with or without branching. Cyclic, branched and branched cyclic polypeptides may occur as a result of post-translation natural processes or may be produced by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, flavin covalent bond, heme moiety covalent bond, nucleotide or nucleotide derivative covalent bond, lipid or lipid derivative covalent bond, phosphatidylinositol covalent bond , Cross-linking, cyclization, disulfide bond formation, demethylation, covalent cross-linking formation, cysteine formation, pyroglutamic acid formation, formylation, γ-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodine , Methylation, myristoylation, oxidation, PEGylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, addition of amino acids to proteins by transfer RNA, such as arginylation, and ubiquitination Included (eg TECreighton "Proteins-Structure and Molecu lar Properties ", 2nd edition, WHFreeman and Company, New York (1993), BC Johnson," Posttranslational Covalent Modification of Proteins "Academic Press, New York, 1-12 (1983), Seifter et al., Meth Enzymol 182: 626-646 (1990), Rattan et al., Ann NY Acad Sci 663: 48-62 (1992)).

  A “polypeptide with biological activity” refers to an activity that is similar (but not necessarily identical) to the activity of a polypeptide of the invention, including mature forms, as measured in a specific biological assay. Polypeptides that display dose-dependently or dose-independently. If a dose dependency exists, it need not be identical to the polypeptide, and only needs to be substantially similar in dose dependency of a given activity compared to the polypeptide of the invention (ie, a candidate). The polypeptide exhibits a higher activity than the polypeptide of the present invention, or is not less than about 25 times, preferably not less than about 10 times, most preferably compared to the polypeptide of the present invention. Will show activity less than about one third).

  It is another aspect of the present invention to provide a modulator of MGAT3 that can affect the function or activity of MGAT3 in cells that should be modulated or affected by the function or activity of MGAT3. Furthermore, modulators of MGAT3 can affect downstream systems and molecules that are regulated by MGAT3 in cells or downstream systems and molecules that interact with MGAT3 in cells. Modulators of MGAT3 include compounds, substances, drugs, drugs, etc. that antagonize, inhibit, reduce, block, suppress, reduce or eliminate MGAT3 function and / or activity. Such compounds, substances, drugs, drugs and the like can be collectively referred to as “antagonists”. Alternatively, MGAT3 modulators include compounds, substances, drugs, drugs, etc. that agonize, enhance, increase, enhance or amplify MGAT3 function in cells. Such compounds, substances, drugs, drugs and the like can be collectively referred to as “agonists”.

  As used herein, the term “modulate” refers to an increase or decrease in the amount, quality or effect of a particular activity, DNA, RNA, or protein. As used herein, the term “modulation” is intended to encompass agonists and / or antagonists of a particular activity, DNA, RNA or protein.

  The term “organism” as used herein includes any organism listed herein, but preferably refers to a eukaryote, more preferably a mammal, and most preferably a human.

  The polynucleotides and polypeptides of the present invention are used to hybridize and discover novel related DNA sequences as probes for identifying and isolating full-length cDNA and / or genomic DNA corresponding to the polynucleotides of the present invention. As a probe for positional cloning of this sequence or related sequences, as a probe for “subtracting out” known sequences in the process of discovering other novel polynucleotides, to quantify gene expression levels And as a probe for a microarray.

  Furthermore, the polynucleotides and polypeptides of the present invention may comprise 1, 2, 3, 4, 5, 6, 7, 8 or more membrane domains.

  In a preferred embodiment, the present invention also provides a method for further refining the biological function of the polynucleotide and / or polypeptide of the present invention.

  Specifically, the present invention provides methods for identifying orthologs, homologs, paralogs, variants, and / or allelic variants of the present invention using the polynucleotides and polypeptides of the present invention. In addition, the polynucleotides and polypeptides of the present invention can be used to identify the entire coding region of the present invention, the non-coding region of the present invention, the regulatory sequences of the present invention, and the secreted, mature, pro, and prepro forms of the present invention. Where appropriate, methods of identification are also provided.

  As a preferred embodiment, the present invention identifies unique glycosylation sites in the polynucleotides and polypeptides of the present invention and then enhances protein folding, inhibits protein aggregation, intracellular transport to organelles, for example To modify, delete and / or add to the site so that several desirable characteristics are obtained, including regulation of protein, increased resistance to proteolysis, modulation of protein antigenicity, and mediation of cell-cell adhesion I will provide a.

  As a further preferred embodiment, molecular evolution techniques are used to evolve the polynucleotides and polypeptides of the present invention with the goal of creating and identifying novel variants with desirable structural, functional and / or physical characteristics A method is also provided.

  The present invention further addresses other experimental methods and techniques currently available for function assignment. These methods include construction of primers or hybrid partners using, for example, spotting clones to arrays, microarray technology, PCR-based methods (eg quantitative PCR), antisense methods, gene knockout experiments, and sequence information from clones Other techniques that can be included are included, but are not limited to these.

  Given the strong homology to members of the DGAT gene family, MGAT3 polypeptides are expected to share at least some biological activity with such family members. Considering the tissue distribution of MGAT3, together with the strong homology to the DGAT gene family and the functions that accompany them, MGAT3 polynucleotides and MGAT3 polypeptides are found in a variety of pathological conditions, including inflammatory bowel disease, including Crohn's disease It is suggested to be involved in.

  The MGAT3 polynucleotides and MGAT3 polypeptides of the present invention have uses including modulation of inflammation (eg, inflammation in the intestine of a mammal), including agonists and / or fragments thereof. The MGAT3 polynucleotides and MGAT3 polypeptides of the present invention, including agonists and / or fragments thereof, can be useful for diagnosis, treatment, prognosis and / or prevention of gastrointestinal diseases or disorders including obesity.

  Considering the strong homology to members of the DGAT gene family in conjunction with prominent localized expression in the intestine, MGAT3 polynucleotides and MGAT3 polypeptides are useful for gastrointestinal diseases and / or gastrointestinal disorders such as obesity, ulcers, hypersensitivity Bowel syndrome, inflammatory bowel disease, diarrhea, traveler diarrhea, drug-related diarrhea, polyp, absorption disorder, constipation, diverticulitis, intestinal vascular disease, intestinal obstruction, intestinal infection, ulcerative colitis, bacterial dysentery, cholera, Crohn's disease, amoebiasis, intestinal fever, Whipple's disease, peritonitis, intraperitoneal abscess, hereditary hemochromatosis, gastroenteritis, viral gastroenteritis, food poisoning, mesenteric ischemia, mesenteric infarction, and metabolic diseases and It is suggested that it may be useful for treatment, diagnosis, prognosis and / or prevention such as metabolic disorders. In addition, the polynucleotides and polypeptides, including fragments and / or antagonists thereof, treat, prevent, diagnose, and diagnose the following gastrointestinal infections, including but not limited to: Also has uses that include predicting their susceptibility to gastrointestinal infections: Salmonella infection, E. coli infection, E. coli O157: H7 infection, Shiga toxin-producing E. coli infection, Campylobacter infection (eg Campylobacter fetus, Campylobacter upsaliensis, Campylobacter hyointestinalis, Campylobacter lari, Campylobacter jejuni, Campylobacter cis Pylobacter mucosalis (Campylobacter mucosalis), Campylobacter sputorum, Campylobacter rectus, Campylobacter curvus, Campylobacter spum (Campylobacter sp. Heliobacter cinaedi), Helicobacter fennelliae, etc., enteritis Yersinia infection, Vibrio genus infection (eg Vibrio mimicus, Vibrio parahaemolyticus, Vibrio fluvias, Vibrio fluviali, Vibrio furnissii, Vibrio hollisae, Vibrio vulnificus, Vibrio arginolyticus (Vibri) o alginolyticus), Vibrio metschnikovii, Vibrio damsela, Vibrio cincinnatiensis, etc., erotic monkeys (eg Aeromonas hydrophila, Aeromonas eromon soro) , Aeromonas caviae), Plesiomonas shigelliodes infection, Giardia infection (eg, Rumble flagellate), Cryptosporidium infection, Listeria infection, Shigella amoeba infection, rotavirus infection, Norwalk virus infection , Clostridium difficile infection, Clostriudium perfringens infection, Staphylococcal infection, Bacillus infection, and the causative microorganisms listed above Any gastrointestinal disorders and / or gastrointestinal disorders other related causes microorganisms include other anywhere in the specification.

  MGAT3 polynucleotides and MGAT3 polypeptides, including fragments and / or antagonists thereof, identify modulators of MGAT3 function, such as antibodies (for detection or neutralization), naturally occurring modulators and small molecule modulators, etc. It can have uses that include the identification of Antibodies to the domain of the MGAT3 protein (including the MGAT3 epitope described herein) could be used as a diagnostic agent for gastrointestinal disorders in patients.

  MGAT3 polypeptides and polynucleotides are diseases related to MGAT3 protein overexpression or underexpression by identifying mutations in the MGAT3 gene using MGAT3 probes or determining the expression level of MGAT3 protein or MGAT3 mRNA To help diagnose. MGAT3 polypeptides are also useful for screening for compounds that affect the activity of the protein.

  The glycerol phospholipid domain of MGAT3 is thought to be crucial for the acyltransferase reaction. Molecular engineering of this active site domain structure (especially the predicted catalytic amino acid) and other functional domains of the DGAT gene family (eg, active site domain binding pocket) makes it possible to produce MGAT3 with tailor-made activity. Thus, MGAT3 polypeptides and fragments thereof, together with any homologous products obtained by genetic engineering of the structure, are useful for designing MGAT3 biological activity and DGAT overall modulators based on NMR.

  MGAT3 polypeptides and MGAT3 polynucleotides can be overexpressed by identifying mutations in the MGAT3 polynucleotide sequence using the MGAT3 sequence as a probe, or by determining the expression level of MGAT3 protein or MGAT3 mRNA. And / or uses including diagnosing diseases associated with underexpression. MGAT3 polypeptides can be useful for screening compounds that affect the activity of the protein. The MGAT3 peptide can also be used to generate specific antibodies or as a bait in yeast two-hybrid screens to find proteins that interact specifically with MGAT3.

  MGAT3 polynucleotides and polypeptides, including fragments and agonists thereof, may have uses including detection, diagnosis, treatment, amelioration and / or prevention of diseases and disorders such as obesity and Crohn's disease.

  Although the encoded polypeptide is believed to be able to share at least some biological activity with DGAT family members, several methods for determining the exact biological function of this clone are known in the art. Known or described in other sections of this specification. Briefly, the function of this clone can be determined by applying the microarray method. Nucleic acids corresponding to MGAT3 polynucleotides, as well as other clones of the invention can be placed on a microchip for expression profiling. Depending on which polynucleotide probe is used to hybridize to the slide, changes in the expression of a particular gene can provide additional insight into the function of that gene based on the condition under study. For example, an increase or decrease in the expression level compared to normal intestinal tissue observed when the polynucleotide probe to be used is derived from the affected intestinal tissue may indicate, for example, a function of regulating intestinal function.

  In addition, for example, quantitative PCR can be applied to evaluate protein functions. Real-time quantitative PCR will make it possible, for example, to follow the expression of the MGAT3 gene throughout the entire developmental process. In quantitative PCR, such experiments can be accomplished by simply obtaining a small amount of tissue from each developmentally important stage. Therefore, applying the quantitative PCR method to refine the biological function of this polypeptide is encompassed by the present invention. In the case of MGAT3, a disease correlation related to MGAT3 can be analyzed by comparing the mRNA expression level of MGAT3 in a normal tissue with a diseased tissue (particularly an affected intestinal tissue). A significant increase or decrease in MGAT3 expression levels in affected tissues suggests that MGAT3 plays a role in disease progression, and that antagonists to MGAT3 polypeptides may be therapeutically useful in the treatment, prevention and / or amelioration of the disease To do. Alternatively, a significant increase or decrease in the level of MGAT3 expression in the affected tissue indicates that MGAT3 plays a protective role against disease progression and that an agonist of MGAT3 polypeptide therapeutically treats, prevents and / or ameliorates the disease. May suggest that it can help. A quantitative PCR probe corresponding to the polynucleotide sequence set forth in SEQ ID NO: 1 (FIGS. 1A-B) is also encompassed by the present invention.

  Protein function can also be assessed by complementation assays in yeast. For example, in the case of MGAT3, transforming yeast lacking MGAT activity and assessing their viability gives convincing evidence that MGAT3 polypeptide has MGAT activity. Will be able to. Other assay conditions and assay methods are known in the art that can be used in assessing the function of the polynucleotides and polypeptides of the invention, some of which are described elsewhere herein. Disclosed in the section.

  Alternatively, the biological function of the encoded polypeptide can be determined by disrupting the homologue of this polypeptide in mice and / or rats and observing the resulting phenotype. Such knockout experiments are known in the art, some of which are disclosed in other sections of this specification.

  Furthermore, the biological function of this polypeptide can also be determined by producing antisense mice and / or transgenic rats by applying antisense methods and / or sense methods. When a specific gene is expressed in a sense direction or an antisense direction in a transgenic mouse or a transgenic rat, the expression level of the specific gene may be increased or decreased, respectively. By changing the endogenous expression level of a gene, a particular phenotype can be observed, which can then be used to derive an indication of the function of that gene. A gene is always over- or under-expressed in all cells of the organism using a strong ubiquitous promoter, or one or more discretes of the organism using a well-characterized tissue-specific promoter Or can be expressed at a specific point in development using an inducible promoter and / or a promoter that is regulated according to the stage of development.

  In the case of MGAT3 transgenic mice or MGAT3 transgenic rats, if the phenotype is not evident under normal growth conditions, observing organisms in a disease state may lead to an understanding of the function of the gene. Therefore, it is encompassed by the present invention to apply antisense and / or sense methods to the production of transgenic mice or rats and thus refine the biological function of the polypeptide.

  As a preferred embodiment, the present invention encompasses the following N-terminal MGAT3 deletion polypeptides: M1-I341, G2-I341, V3-I341, A4-I341, T5-I341, T6-I341 of SEQ ID NO: 2, L7-I341, Q8-I341, P9-I341, P10-I341, T11-I341, T12-I341, S13-I341, K14-I341, T15-I341, L16-I341, Q17-I341, K18-I341, Q19- I341, H20-I341, L21-I341, E22-I341, A23-I341, V24-I341, G25-I341, A26-I341, Y27-I341, Q28-I341, Y29-I341, V30-I341, L31-I341, T32-I341, F33-I341, L34-I341, F35-I341, M36-I341, G37-I341, P38-I341, F39-I341, F40-I341, S41-I341, L42-I341, L43-I341, V44- I341, F45-I341, V46-I341, L47-I341, L48-I341, F49-I341, T50-I341, S51-I341, L52-I341, W53-I341, P54-I341, F55-I341, S56-I341, V57-I341, F58-I341, Y59-I341, L60-I341, V61-I341, W62-I341, L63-I341, Y64-I341, V65-I341, D66-I341, W67-I341, D68-I341, T69- I341, P70-I341, N71-I341, Q72-I341, G73-I341, G74-I341, R75-I341, R76-I341, S77-I341, E78-I341, W79-I341, I80-I341 R81-I341, N82-I341, R83-I341, A84-I341, I85-I341, W86-I341, R87-I341, Q88-I341, L89-I341, R90-I341, D91-I341, Y92-I341, Y93- I341, P94-I341, V95-I341, K96-I341, L97-I341, V98-I341, K99-I341, T100-I341, A101-I341, E102-I341, L103-I341, P104-I341, P105-I341, D106-I341, R107-I341, N108-I341, Y109-I341, V110-I341, L111-I341, G112-I341, A113-I341, H114-I341, P115-I341, H116-I341, G117-I341, I118- I341, M119-I341, C120-I341, T121-I341, G122-I341, F123-I341, L124-I341, C125-I341, N126-I341, F127-I341, S128-I341, T129-I341, E130-I341, S131-I341, N132-I341, G133-I341, F134-I341, S135-I341, Q136-I341, L137-I341, F138-I341, P139-I341, G140-I341, L141-I341, R142-I341, P143- I341, W144-I341, L145-I341, A146-I341, V147-I341, L148-I341, A149-I341, G150-I341, L151-I341, F152-B41, Y153-I341, L154-I341, P155-I341, V156-I341, Y157-I341, R158-I341, D159-I341, Y160-I341, I161-I341, M162-I341, S163-I341, F164-I341, G165-I341 L166-I341, C167-I341, P168-I341, V169-I341, S170-I341, R171-I341, Q172-I341, S173-I341, L174-I341, D175-I341, F176-I341, I177-I341, L178- I341, S179-I341, Q180-I341, P181-I341, Q182-I341, L183-I341, G184-I341, Q185-I341, A186-I341, V187-I341, V188-I341, I189-I341, M190-I341, V191-I341, G192-I341, G193-I341, A194-I341, H195-I341, E196-I341, A197-I341, L198-I341, Y199-I341, S200-I341, V201-I341, P202-I341, G203- I341, E204-I341, H205-I341, C206-I341, L207-I341, T208-I341, L209-I341, Q210-I341, K211-I341, R212-I341, K213-I341, G214-I341, F215-I341, V216-I341, R217-I341, L218-I341, A219-I341, L220-I341, R221-I341, H222-I341, G223-I341, A224-I341, S225-I341, L226-I341, V227-I341, P228- I341, V229-I341, Y230-I341, S231-I341, F232-I341, G233-I341, E234-I341, N235-I341, D236-I341, I237-I341, F238-I341, R239-I341, L240-I341, K241-I341, A242-I341, F243-I341, A244-I341, T245-I341, G246-I341, S247-I341, W248-I341, Q24 9-I341, H250-I341, W251-I341, C252-I341, Q253-I341, L254-I341, T255-I341, F256-I341, K257-I341, K258-I341, L259-I341, M260-I341, G261- I341, F262-I341, S263-I341, P264-I341, C265-I341, I266-I341, F267-I341, W268-I341, G269-I341, R270-I341, G271-I341, L272-I341, F273-I341, S274-I341, A275-I341, T276-I341, S277-I341, W278-I341, G279-I341, L280-I341, L281-I341, P282-I341, F283-I341, A284-I341, V285-I341, P286- I341, I287-I341, T288-I341, T289-I341, V290-I341, V291-I341, G292-I341, R293-I341, P294-I341, I295-I341, P296-I341, V297-I341, P298-I341, Q299-I341, R300-I341, L301-I341, H302-I341, P303-I341, T304-I341, E305-I341, E306-I341, E307-I341, V308-I341, N309-I341, H310-I341, Y311- I341, H312-I341, A313-I341, L314-I341, Y315-I341, M316-I341, T317-I341, A318-I341, L319-I341, E320-I341, Q321-I341, L322-I341, F323-I341, E324-I341, E325-I341, H326-I341, K327-I341, E328-I341, S329-I341, C330-I341, G331-I341, V332-I3 41, P333-I341, A334-I341, and / or S335-I341.

  Polynucleotide sequences encoding these polypeptides are also provided. The invention also encompasses the use of these N-terminal MGAT3-deleted polypeptides as immunogenic and / or antigenic epitopes as described elsewhere herein.

  As a preferred embodiment, the present invention encompasses the following C-terminal MGAT3 deletion polypeptides: M1-I341, M1-F340, M1-T339, M1-L338, M1-C337, M1-T336 of SEQ ID NO: 2, M1-S335, M1-A334, M1-P333, M1-V332, M1-G331, M1-C330, M1-S329, M1-E328, M1-K327, M1-H326, M1-E325, M1-E324, M1- F323, M1-L322, M1-Q321, M1-E320, M1-L319, M1-A318, M1-T317, M1-M316, M1-Y315, M1-L314, M1-A313, M1-H312, M1-Y311, M1-H310, M1-N309, M1-V308, M1-E307, M1-E306, M1-E305, M1-T304, M1-P303, M1-H302, M1-L301, M1-R300, M1-Q299, M1- P298, M1-V297, M1-P296, M1-I295, M1-P294, M1-R293, M1-G292, M1-V291, M1-V290, M1-T289, M1-T288, M1-I287, M1-P286, M1-V285, M1-A284, M1-F283, M1-P282, M1-L281, M1-L280, M1-G279, M1-W278, M1-S277, M1-T276, M1-A275, M1-S274, M1- F273, M1-L272, M1-G271, M1-R270, M1-G269, M1-W268, M1-F267, M1-I266, M1-C265, M1-P264, M1-S263, M1-F262, M1-G261, M1-M260, M1-L259, M1-K258, M1-K257, M1-F256, M1-T255, M1-L254, M1-Q253, M1-C252, M1-W251, M1-H250, M1-Q249, M1-W248, M1-S247, M1-G246, M1-T245, M1-A244, M1-F243, M1- A242, M1-K241, M1-L240, M1-R239, M1-F238, M1-I237, M1-D236, M1-N235, M1-E234, M1-G233, M1-F232, M1-S231, M1-Y230, M1-V229, M1-P228, M1-V227, M1-L226, M1-S225, M1-A224, M1-G223, M1-H222, M1-R221, M1-L220, M1-A219, M1-L218, M1- R217, M1-V216, M1-F215, M1-G214, M1-K213, M1-R212, M1-K211, M1-Q210, M1-L209, M1-T208, M1-L207, M1-C206, M1-H205, M1-E204, M1-G203, M1-P202, M1-V201, M1-S200, M1-Y199, M1-L198, M1-A197, M1-E196, M1-H195, M1-A194, M1-G193, M1- G192, M1-V191, M1-M190, M1-I189, M1-V188, M1-V187, M1-A186, M1-Q185, M1-G184, M1-L183, M1-Q182, M1-P181, M1-Q180, M1-S179, M1-L178, M1-I177, M1-F176, M1-D175, M1-L174, M1-S173, M1-Q172, M1-R171, M1-S170, M1-V169, M1-P168, M1- C167, M1-L166, M1-G165, M1-F164, M1-S163, M1-M162, M1-I161, M1-Y160, M1-D159, M1-R158, M1-Y157, M1-V156, M1-P155, M1-L154, M1-Y153, M1-F152, M1-L151, M1-G150, M1-A149, M1-L148, M1-V147, M1-A146, M1-L145, M1-W144, M1-P143, M1- R142, M1-L141, M1-G140, M1-P139, M1-F138, M1-L137, M1-Q136, M1-S135, M1-F134, M1-G133, M1-N132, M1-S131, M1-E130, M1-T129, M1-S128, M1-F127, M1-N126, M1-C125, M1-L124, M1-F123, M1-G122, M1-T121, M1-C120, M1-M119, M1-I118, M1- G117, M1-H116, M1-P115, M1-H114, M1-A113, M1-G112, M1-L111, M1-V110, M1-Y109, M1-N108, M1-R107, M1-D106, M1-P105, M1-P104, M1-L103, M1-E102, M1-A101, M1-T100, M1-K99, M1-V98, M1-L97, M1-K96, M1-V95, M1-P94, M1-Y93, M1- Y92, M1-D91, M1-R90, M1-L89, M1-Q88, M1-R87, M1-W86, M1-I85, M1-A84, M1-R83, M1-N82, M1-R81, M1-I80, M1-W79, M1-E78, M1-S77, M1-R76, M1-R75, M1-G74, M1-G73, M1-Q72, M1-N71, M1-P70, M1-T69, M1-D68, M1- W67, M1-D66, M1-V65, M1-Y64, M1-L63, M1-W62, M1-V61, M1-L60, M1-Y59, M1-F58, M1-V57, M1-S56, M1-F55, M1-P54, M1-W53, M1-L52, M1-S51, M1-T50, M1-F49, M1-L48, M1-L47, M1-V46, M1-F45, M1-V44, M1-L43, M1-L42, M1-S41, M1-F40, M1-F39, M1-P38, M1- G37, M1-M36, M1-F35, M1-L34, M1-F33, M1-T32, M1-L31, M1-V30, M1-Y29, M1-Q28, M1-Y27, M1-A26, M1-G25, M1-V24, M1-A23, M1-E22, M1-L21, M1-H20, M1-Q19, M1-K18, M1-Q17, M1-L16, M1-T15, M1-K14, M1-S13, M1- T12, M1-T11, M1-P10, M1-P9, M1-Q8, and / or M1-L7.

  Polynucleotide sequences encoding these polypeptides are also provided. The invention also encompasses the use of these C-terminal MGAT3 deleted polypeptides as immunogenic and / or antigenic epitopes as described elsewhere herein.

  As another option, preferred polypeptides of the present invention correspond to, for example, an internal region of the MGAT3 polypeptide of SEQ ID NO: 2 (eg, any combination of N-terminal MGAT3 polypeptide deletion and C-terminal MGAT3 polypeptide deletion) A polypeptide sequence may be included. For example, the internal region could be defined by the formula: amino acid NX-amino acid CX [where NX represents any N-terminal deleted polypeptide amino acid of MGAT3 (SEQ ID NO: 2) and CX is MGAT3 (sequence Represents any C-terminal deleted polypeptide amino acid of number 2)]. Polynucleotides encoding these polypeptides are also provided. The invention also encompasses the use of these polypeptides as immunogenic and / or antigenic epitopes as described elsewhere herein.

The Motif algorithm (Genetics Computer Group, Inc.) shows that the MGAT3 polypeptide of the present invention contains one amidation site. Hormones and other active peptide precursors that are C-terminal amidated are always immediately followed by a glycine residue that provides an amide group, and in most cases at least two consecutive basic residues ( Arg or Lys), which generally function as active peptide precursor cleavage sites. Any amino acid can be amidated, but neutral hydrophobic residues such as Val or Phe are good substrates, while charged residues such as Asp or Arg are much less reactive. The consensus pattern of the amidation site is as follows: xG (R, K) (R, K) [wherein “x” represents the amidation site]. Additional information regarding asparagine glycosylation can be found in the following publications which are incorporated herein by reference: Kreil G. (1984) Meth. Enzymol . 106: 218-223, and Bradbury AF, Smyth DG ( 1987) Biosci. Rep. 7: 907-916.

  As a preferred embodiment, the following amidation site polypeptide is encompassed by the present invention: DTPNQGGRRSEWIR (SEQ ID NO: 25). Polynucleotides encoding these polypeptides are also provided. The present invention also encompasses the use of this MGAT3 amidation site polypeptide as an immunogenic and / or antigenic epitope as described elsewhere herein.

  Based on the Motif algorithm (Genetics Computer Group, Inc.), it was confirmed that the MGAT3 polypeptide of the present invention contains several phosphorylation sites. Phosphorylation of these sites can modulate some biological activity of the MGAT3 polypeptide. For example, phosphorylation at a specific site may be involved in regulating the ability of the protein to associate or bind to other molecules (eg, proteins, ligands, substrates, DNA, etc.).

  The MGAT3 polypeptide was predicted using the Motif algorithm (Genetics Computer Group, Inc.) to contain two PKC phosphorylation sites. In vivo, protein kinase C exhibits selectivity for phosphorylation of serine or threonine residues. A PKC phosphorylation site has the following consensus pattern: (S, T) x (R, K) [wherein S or T represents a phosphorylation site and “x” represents an intervening amino acid residue].

Additional information regarding PKC phosphorylation sites can be found in Woodget JR et al. (1986) Eur. J. Biochem. 161: 177-184 and Kishimoto A. et al. (1985) J. Biol. Chem. 260: 12492-12499 . Which are hereby incorporated by reference. As a preferred embodiment, the following PKC phosphorylation site polypeptides are encompassed by the present invention: LQPPTTSKTLQKQ (SEQ ID NO: 13) and / or HWCQLTFKKLMGF (SEQ ID NO: 14). Polynucleotides encoding these polypeptides are also provided. The present invention also encompasses the use of these MGAT3 PKC phosphorylation site polypeptides as immunogenic and / or antigenic epitopes as described elsewhere herein.

  The MGAT3 polypeptide was predicted to contain three casein kinase II phosphorylation sites using the Motif algorithm (Genetics Computer Group, Inc.). Casein kinase II (CK-2) is a protein serine / threonine kinase with cyclic nucleotide and calcium independent activity. CK-2 phosphorylates a wide variety of proteins. The substrate specificity of this enzyme can be summarized as follows: (1) prefers Ser over Thr under equivalent conditions, (2) an acidic residue (Asp or Glu) is a phosphate group accepting site Additional acidic residues at positions (3) +1, +2, +4, and +5, which must be present at the third residue from the C-terminus, increase the rate of phosphorylation. Most physiological substrates have at least one acidic residue at these positions, (4) Asp is preferred over Glu as the donor of acidic determinants, and (5) N-terminus of the acceptor site The basic residue in the lowers the phosphorylation rate, but the acidic residue increases the phosphorylation rate.

  The consensus pattern of the casein kinase II phosphorylation site is as follows: (S, T) x2 (D, E) [where "x" represents any amino acid and S or T is the phosphorylation site ].

Additional information specific to the casein kinase II phosphorylation site can be found by reference to the following publication: Pinna LA (1990) Biochim. Biophys. Acta 1054: 267-284 (this document is incorporated herein by reference in its entirety). Incorporated into the book).

  As a preferred embodiment, the following casein kinase II phosphorylation site polypeptides are encompassed by the present invention: LVPVYSFGENDIFR (SEQ ID NO: 4), QRLHPTEEEVNHYH (SEQ ID NO: 5), and / or HALYMTALEQLFEE (SEQ ID NO: 6). Polynucleotides encoding these polypeptides are also provided. The present invention also encompasses the use of this casein kinase II phosphorylation site polypeptide as an immunogenic and / or antigenic epitope as described elsewhere herein.

  The Motif algorithm (Genetics Computer Group, Inc.) indicates that the MGAT3 polypeptide contains one glycosylation site. As discussed in more detail herein, glycosylation of proteins enhances protein folding, inhibits protein aggregation, regulates intracellular transport to organelles, increases resistance to proteolysis, modulates protein antigenicity And is thought to perform a variety of functions, including mediating cell-cell adhesion.

The asparagine glycosylation site has the following consensus pattern: N- (P) (S, T)-(P) [where N represents the glycosylation site]. However, it is well known that potential N-glycosylation sites are specific for the consensus sequence Asn-Xaa-Ser / Thr. However, since protein folding plays an important role in regulating N-glycosylation, the presence of a consensus tripeptide alone is not sufficient to conclude that asparagine residues are glycosylated. It has been shown that the presence of proline between Asn and Ser / Thr inhibits N-glycosylation. Recent statistical analysis of glycosylation sites supports this and also shows that about 50% of sites with proline on the C-terminal side of Ser / Thr are not glycosylated. Additional information regarding asparagine glycosylation can be found by reference to the following literature, incorporated herein by reference: Marshall RD (1972) Annu. Rev. Biochem . , 41: 673-702, Pless DD, Lennarz WJ (1977) Proc. Natl. Acad. Sci., USA 74: 134-138, Bause E. (1983) Biochem. J. 209: 331-336, Gavel Y., von Heijne G. (1990) Protein Eng ., 3: 433-442, and Miletich JP, Broze GJJr (1990) J.Biol.Chem, 265:.. 11397-11404.

  As a preferred embodiment, the following asparagine glycosylation site polypeptide is encompassed by the present invention: TGFLCNFSTESNGF (SEQ ID NO: 3). A polynucleotide encoding the polypeptide is also provided. The present invention also encompasses the use of this MGAT3 asparagine glycosylation site polypeptide as an immunogenic epitope and / or antigenic epitope as described elsewhere herein.

  The MGAT3 polypeptide was predicted to contain 5 N-myristoylation sites using the Motif algorithm (Genetics Computer Group, Inc.). A significant number of eukaryotic proteins are acylated by covalent addition of myristic acid (C14 saturated fatty acid) via an amide bond to its N-terminal residue. The sequence specificity of the enzyme myristoyl CoA: protein N-myristoyltransferase (NMT) responsible for this modification has been derived from studies using known N-myristoylated protein sequences and synthetic peptides. Its specificity seems to be as follows: i) N-terminal residue must be glycine, ii) Uncharged residue is allowed in position 2, iii) Charged residue, proline and large hydrophobic Sex residues are not allowed, iv) Most if not all residues are allowed in positions 3 and 4, v) Small uncharged residues are allowed in position 5 (Ala, Ser, Thr, Cys, Asn and Gly). Serine is preferred, and vi) Proline is not allowed at position 6.

  The consensus pattern of N-myristoylation is as follows: G- (E, D, R, K, H, P, F, Y, W) x2 (S, T, A, G, C, N)- (P) [wherein “x” represents any amino acid and G is an N-myristoylation site].

Additional information specific to N-myristoylation sites can be found by referring to the following publications: Toowler DA et al. (1988) Annu. Rev. Biochem . 57: 69-99 (1988) and Grand RJA (1989) . ) Biochem. J. 258: 625-638 (these documents are incorporated herein by reference in their entirety).

  As a preferred embodiment, the following N-myristoylation site polypeptides are encompassed by the present invention: MGVATTLQPPTT (SEQ ID NO: 7), DTPNQGGRRSEWIRNR (SEQ ID NO: 8), GAHPHGIMCTGFLCNF (SEQ ID NO: 9), VIMVGGAHEALYSVPG (SEQ ID NO: 10) IFWGRGLFSATSWGLL (SEQ ID NO: 11), and / or HKESCGVPASTCLTFI (SEQ ID NO: 12). Polynucleotides encoding these polypeptides are also provided. The invention also encompasses the use of these N-myristoylation site polypeptides as immunogenic and / or antigenic epitopes as described elsewhere herein.

  The invention also encompasses immunogenic and / or antigenic epitopes of the MGAT3 polypeptide.

MGAT3 contains a putative glycerol phospholipid domain (GenBank accession number PS50239, Coleman, RA et al. (1978) J. Biol. Chem. , 253 (20): 7256-61). This is shown in bold in FIG. 1A and is preferably around amino acid F152 to amino acid R239.

  The invention also provides species homologues, allelic variants and / or orthologues. Those skilled in the art will rely on sequences disclosed herein or sequences obtained from clones deposited with the ATCC, using techniques well known in the art, SEQ ID NO: 1, SEQ ID NO: 2 or at least one deposit. One could obtain full-length genes (including but not limited to full-length coding regions), allelic variants, splice variants, orthologs and / or species homologs of the gene corresponding to the clone. For example, generate appropriate probes or primers corresponding to the 5 'region, 3' region, or internal region of the sequences described herein to screen for suitable nucleic acid sources for allelic variants and / or desired homologs By doing so, allelic variants and / or species homologs can be isolated and identified.

  The polypeptides of the present invention can be produced by any suitable method. Such polypeptides include isolated natural polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by combining these methods. Means for producing such polypeptides are well known in the art.

  The polypeptide may take the form of a protein or be part of a larger protein (eg, a fusion protein). It is advantageous to include an additional amino acid sequence containing a secretory or leader sequence, a pro sequence, or a sequence that aids purification (eg, multiple histidine residues), or additional sequences to provide stability during recombinant production. There are many cases.

The polypeptides of the present invention are preferably provided in an isolated form and are preferably substantially purified. Recombinantly produced polypeptides can be produced using techniques described herein or other techniques known in the art (eg, those described in Smith and Johnson, Gene 67: 31-40 (1988)). Can be substantially purified, such as by a step method. Polypeptides of the present invention may be naturally occurring, synthetic, or synthesized using the protocols described herein or other protocols known in the art, such as antibodies of the present invention raised against full-length proteins. It can also be purified from recombinant sources.

  The invention includes polynucleotides having sequences that are complementary to the sequences of the polynucleotides of the invention disclosed herein. Such a sequence can be complementary to the nucleic acid encoding the sequence disclosed as SEQ ID NO: 1, the sequence contained in the deposit, and / or the sequence disclosed as SEQ ID NO: 2.

  The present invention provides the ability to hybridize to the polynucleotides described herein, preferably under conditions of low stringency, more preferably under stringent conditions, most preferably under highly stringent conditions. Also included are polynucleotides having Examples of stringency conditions are shown in Table 1 below. Highly stringent conditions are, for example, conditions that are at least as stringent as conditions A to F, and stringent conditions are, for example, at least as stringent as conditions G to L, and have low stringency. The conditions are, for example, at least as stringent as the conditions M to R.

‡: “Hybrid length” is the expected length for the hybridizing region of the hybridizing polynucleotide. When hybridizing a polynucleotide of unknown sequence, it is assumed that the hybrid is a hybrid of a hybridizing polynucleotide of the present invention. When hybridizing polynucleotides of known sequence, the hybrid length can be determined by aligning the polynucleotide sequences and identifying one or more regions with optimal sequence complementarity. Methods for aligning two or more polynucleotide sequences and / or determining the percent identity between two polynucleotides are well known in the art (such as the MegAlign program of the DNA ^* Star program suite).

†: SSC in hybridization buffer and wash buffer (1 × SSC is 0.15 M NaCl and 15 mM sodium citrate), SSPE (1 × SSPE is 0.15 M NaCl, 10 mM NaH ₂ PO ₄ , and 1.25 mM EDTA, It can be replaced with pH7.4). After hybridization is complete, wash for 15 minutes. Hybridization and wash solutions may further contain 5 × Denhart reagent, 0.5-1.0% SDS, 100 μg / ml denatured fragmented salmon sperm DNA, 0.5% sodium pyrophosphate, and up to 50% formamide.

^* Tb to Tr: For hybrids that are expected to be less than 50 base pairs in length, the hybridization temperature should be 5-10 ° C. below the melting temperature Tm of the hybrid, where Tm is Determined according to the equation. For hybrids less than 18 base pairs in length, Tm (° C.) = 2 (number of A + T bases) +4 (number of G + C bases). In the case of a hybrid having a length of 18 base pairs to 49 base pairs, Tm (° C.) = 81.5 + 16.6 (log ₁₀ [Na ⁺ ]) + 0.41 (% G + C) − (600 / N) [where, N is the number of bases in the hybrid, and [Na ⁺ ] is the sodium ion concentration in the hybridization buffer ([Na ⁺ ] = 0.165 M for 1 × SSC).

  ±: The present invention encompasses the replacement of any one or more DNA or RNA hybrid partners by PNA or modified polynucleotides. Such modified polynucleotides are known in the art and are described in further detail in this specification.

  Additional examples of stringency conditions for polynucleotide hybridization can be found in Sambrook, J., EFFritsch and T. Maniatis “Molecular Cloning: A Laboratory Manual” (1989, Cold Spring Harbor Laboratory Press, New York, which is incorporated herein by reference. (Cold Spring Harbor, USA), Chapters 9 and 11, and FMAusubel et al., “Current Protocols in Molecular Biology” (1995, John Wiley and Sons, Inc.), Sections 2.10 and 6.3-6.4, etc. Yes.

  Such hybridizing polynucleotides have at least 70% sequence identity (more preferably at least 80% identity, most preferably at least 90% or 95% identity) with the polypeptides of the invention to which they hybridize. The sequence identity is determined by comparing the sequences of the hybridizing polynucleotides when aligned to minimize overlap and coincidence while simultaneously minimizing sequence gaps. The determination of the degree of coincidence is well known in the art and will be described in more detail in this specification.

The present invention encompasses the application of PCR methods to the polynucleotide sequences of the invention, clones deposited with the ATCC, and / or cDNA encoding the polypeptides of the invention. PCR techniques for amplifying nucleic acids are described in US Pat. No. 4,683,195 and Saiki et al., Science , 239: 487-491 (1988). PCR can include, for example, the following steps: denaturation of template nucleic acid (if double stranded), primer annealing to target, and polymerization. The nucleic acid probed in the amplification reaction or the nucleic acid used as the template can be genomic DNA, cDNA, RNA, or PNA. PCR can be used to amplify specific sequences in genomic DNA, specific RNA sequences, and / or cDNA transcribed from mRNA. Reference books on general usage of PCR technology including specific method parameters include, for example, Mullis et al., Cold Spring Harbor Symp. Quant. Biol. , 51: 263 (1987), edited by Ehrlich “PCR Technology” (Stockton Press, New York, 1989), Ehrlich et al. (1991) Science , 252: 1643-1650, and Innis et al. “PCR Protocols, A Guide to Methods and Applications” (Academic Press, New York, 1990).

  The present invention relates to a polypeptide comprising the polypeptide sequence of SEQ ID NO: 2, the polypeptide encoded by the polynucleotide set forth as SEQ ID NO: 1, and / or the polypeptide sequence encoded by the cDNA in at least one deposited clone. A mature form or a mature form of a polypeptide comprising the same polypeptide sequence is also included. The invention also encompasses a polynucleotide encoding the mature form of the invention, such as the polynucleotide of SEQ ID NO: 1 and / or the polynucleotide sequence provided in the cDNA of at least one deposited clone.

  According to the signal hypothesis, proteins secreted by eukaryotic cells have a signal sequence or secretory leader sequence that is cleaved from the mature protein as the growing protein chain begins to be exported across the rough endoplasmic reticulum. It is. Most eukaryotic cells cleave secreted proteins with the same specificity. However, there may be more than one mature molecular species of a protein because the cleavage of the secreted protein is not completely uniform. Furthermore, it has long been known that the cleavage specificity of a secreted protein is ultimately determined by the primary structure of the complete protein, i.e. inherent to the amino acid sequence of the polypeptide.

A method for predicting whether a protein has a signal sequence and a method for predicting a breakpoint of the sequence can be used. For example, the method of McGeoch, Virus Res . 3: 271-286 (1985) utilizes information obtained from a short N-terminal charged region of a complete (uncut) protein and subsequent uncharged regions. In the method of von Heinje, Nucleic Acids Res . 14: 4683-4690 (1986) Use the information that is available. In each of these methods, the accuracy of predicting the breakpoints of known mammalian secreted proteins is in the range of 75-80% (von Heinje, supra). However, for a given protein, the breakpoints expected by these two methods are not always the same.

An established method for identifying the positions of signal sequences and their cleavage sites was the SignalP program (v1.1) developed by Henrik Nielsen et al., Protein Engineering 10: 1-6 (1997). The program relies on an algorithm developed by von Heinje, with additional parameters to improve prediction accuracy.

  Recently, a hidden Markov model has been developed (H. Neilson et al., Ismb 1998; 6: 122-30), which has been incorporated into the recent SignalP (v2.0). This new method enhances the ability to identify cleavage sites by distinguishing between signal peptides and uncleaved signal anchors. The present invention includes applying the methods disclosed herein to any polypeptide sequence of the present invention to predict signal peptide positions including cleavage sites.

  However, as will be appreciated by those skilled in the art, the cleavage site may vary from organism to organism and no absolute prediction can be made. Thus, the polypeptide of the present invention may contain a signal sequence. A polypeptide of the invention comprising a signal sequence may be within 5 residues of the expected breakpoint (ie ± 5 residues, preferably -5, -4, -3, -2, -1, +1, +2, + It has an N-terminus that begins with 3, +4, or +5 residues. Similarly, it is also understood that cleavage of the signal sequence from the secreted protein is not completely uniform, so that more than one secreted species may occur. These polypeptides and polynucleotides encoding such polypeptides are encompassed by the present invention.

  Furthermore, the signal sequence identified by the above analysis may not necessarily predict the natural signal sequence. For example, the natural signal sequence may be further upstream than the predicted signal sequence. However, the expected signal sequence probably has the ability to direct secreted proteins to the ER. Nevertheless, the present invention provides a mature protein produced by expression of the polynucleotide sequence of SEQ ID NO: 1 and / or the polynucleotide sequence contained in the cDNA of at least one deposited clone in mammalian cells (eg, COS cells described below). . In the present invention, these polypeptides and polynucleotides encoding such polypeptides are contemplated.

  The present invention also includes a polynucleotide sequence disclosed in SEQ ID NO: 1 herein, its complementary strand, and / or a variant of a cDNA sequence contained in at least one deposited clone (eg, allelic variant, ortholog, etc.). To do.

  The present invention relates to a polypeptide sequence disclosed in SEQ ID NO: 2 and / or a fragment thereof, a polypeptide encoded by the polynucleotide sequence of SEQ ID NO: 1, and / or a mutation of a polypeptide encoded by a cDNA in at least one deposited clone Includes the body.

  “Variant” refers to a polynucleotide or polypeptide that differs from a polynucleotide or polypeptide of the invention but retains its basic properties. In general, variants are generally very similar to a polynucleotide or polypeptide of the invention and are identical in many regions.

  Accordingly, one embodiment of the present invention provides (a) the nucleotide sequence set forth in SEQ ID NO: 1 encoding an MGAT3-related polypeptide having the amino acid sequence shown in the Sequence Listing, or June 12, 2002 and November 14, 2002 The nucleotide according to SEQ ID NO: 1 encoding a cDNA contained in one of ATCC deposit numbers PTA-4454 or PTA-4803 deposited each day, and (b) a mature MGAT3-related polypeptide having the amino acid sequence shown in the sequence listing Or a cDNA contained in one of ATCC accession numbers PTA-4454 or PTA-4803 deposited on June 12, 2002 and November 14, 2002, respectively, (c) MGAT3 having the amino acid sequence shown in the Sequence Listing The nucleotide sequence set forth in SEQ ID NO: 1, which encodes a biologically active fragment of a related polypeptide, or ATCC deposit number PTA-4454 deposited on June 12, 2002 and November 14, 2002, respectively Included on one side of PTA-4803 (D) a nucleotide sequence set forth in SEQ ID NO: 1 that encodes an antigenic fragment of an MGAT3-related polypeptide having the amino acid sequence shown in the Sequence Listing, or June 12, 2002 and November 14, 2002 The cDNA contained in one of the deposited ATCC deposit numbers PTA-4454 or PTA-4803, (e) the human cDNA plasmid contained in SEQ ID NO: 1, or deposited on June 12, 2002 and November 14, 2002, respectively. A nucleotide sequence encoding an MGAT3-related polypeptide comprising the complete amino acid sequence encoded by the cDNA contained in one of ATCC Accession Nos. PTA-4454 or PTA-4803, (f) the human cDNA plasmid contained in SEQ ID NO: 1 or 2002 Nuclease encoding mature MGAT3-related polypeptide having the amino acid sequence encoded by the cDNA contained in one of ATCC accession numbers PTA-4454 or PTA-4803 deposited on June 12, 2012 and November 14, 2002, respectively Otide sequence, (g) human cDNA plasmid contained in SEQ ID NO: 1 or cDNA contained in one of ATCC deposit numbers PTA-4454 or PTA-4803 deposited on June 12, 2002 and November 14, 2002, respectively. A nucleotide sequence encoding a biologically active fragment of an MGAT3-related polypeptide having the amino acid sequence encoded by (h) a human cDNA plasmid contained in SEQ ID NO: 1 or June 12, 2002 and November 14, 2002 A nucleotide sequence encoding an antigenic fragment of an MGAT3-related polypeptide having an amino acid sequence encoded by a cDNA contained in one of ATCC deposit numbers PTA-4454 or PTA-4803 deposited each day; (i) above (a) , (B), (c), (d), (e), (f), (g), or a nucleotide sequence complementary to any of the nucleotide sequences described in (h), Poly with a nucleotide sequence Provided is an isolated nucleic acid molecule comprising or consisting of a nucleotide.

  The invention includes, for example, at least about 80 of any of the nucleotide sequences set forth in (a), (b), (c), (d), (e), (f), (g), or (h) above. %, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, It is also directed to a polynucleotide sequence comprising or consisting of a 99.6%, 99.7%, 99.8%, or 99.9% matching polynucleotide sequence. Polynucleotides encoded by these nucleic acid molecules are also encompassed by the present invention. In another embodiment, the present invention provides the above (a), (b), (c), (d), (e), (f) under stringent conditions or under low stringency conditions. ), (G), or (h) includes a nucleic acid molecule comprising or consisting of a polynucleotide that hybridizes to the polynucleotide described in (h). Polynucleotides that hybridize to the complementary strands of these nucleic acid molecules under stringent hybridization conditions or under low stringency conditions, as well as the polypeptides encoded by these polypeptides, are encompassed by the present invention. The

  The present invention is not limited to the following examples and at least about 80%, 95%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% , Including 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% amino acid sequences that match or consist of the same amino acid sequence: The polypeptide sequence specified as number 2, the polypeptide sequence encoded by the cDNA provided in at least one deposited clone, and / or a polypeptide fragment of any of the polypeptides described herein. Polynucleotides encoded by these nucleic acid molecules are also encompassed by the present invention. In another embodiment, the present invention provides the above (a), (b), (c), (d), (e), (f) under stringent conditions or under low stringency conditions. ), (G), or (h) includes a nucleic acid molecule comprising or consisting of a polynucleotide that hybridizes to the polynucleotide described in (h). Polynucleotides that hybridize to the complementary strands of these nucleic acid molecules under stringent hybridization conditions or low stringency conditions, as well as the polypeptides encoded by these polypeptides, are encompassed by the present invention. Is done.

  The present invention includes, for example, the polypeptide sequence shown in SEQ ID NO: 2, the polypeptide sequence encoded by the nucleotide sequence of SEQ ID NO: 1, ATCC deposit number PTA-deposited on June 12, 2002 and November 14, 2002, respectively. A polypeptide sequence encoded by the cDNA contained in one of 4454 or PTA-4803, and / or a polypeptide fragment of any of these polypeptides (eg, a fragment described herein), etc., at least about 80%, 85 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, It is also directed to polypeptides comprising or consisting of 99.7%, 99.8%, or 99.9% matching amino acid sequences. Polynucleotides that hybridize to complementary strands of nucleic acid molecules encoding these polypeptides under stringent hybridization conditions or under low stringency conditions are similar to the polypeptides encoded by these polynucleotides. Are encompassed by the present invention.

  A nucleic acid having a nucleotide sequence that is at least, for example, 95% “consistent” with a reference nucleotide sequence of the present invention, is that the nucleotide sequence of the nucleic acid is pointed at a rate of up to 5 per 100 nucleotides of the reference nucleotide sequence encoding the polypeptide Except for the point that it may contain a mutation, it means to match the reference sequence. In other words, to obtain a nucleic acid with a nucleotide sequence that is at least 95% identical to the reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence can be deleted or replaced with another nucleotide, or the reference sequence Nucleotide numbers up to 5% of the total number of nucleotides in can be inserted into the reference sequence.

  In practice, certain nucleic acid molecules or polypeptides will be at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 with the nucleotide sequence of the present invention. %, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% Can be determined using. A preferred method (also referred to as global sequence alignment) for determining the overall optimal match between the query sequence (the sequence of the invention) and the subject sequence is Higgins, DG et al., Computer Applications in the Biosciences (CABIOS), 8 ( 2): It can be determined using the CLUSTALW computer program (Thompson, JD et al., Nucleic Acids Research, 2 (22): 4673-4680 (1994)) based on the algorithm of 189-191 (1992). In the sequence alignment, the query sequence and the target sequence are both DNA sequences. RNA sequences can be compared by converting U to T. However, the CLUSTALW algorithm automatically converts U to T when comparing an RNA sequence to a DNA sequence. The result of this global sequence alignment is expressed as a match rate. The preferred parameters used in CLUSTALW alignment of DNA sequences to calculate percent identity by pairwise alignment are: Matrix = IUB, k-tuple = 1, top diagonal Number of Top Diagonals = 5, Gap Penalty = 3, Gap Open Penalty = 10, Gap Extension Penalty = 0.1, Scoring Method ( Scoring Method = Percent, Window Size = 5 or the length of the target nucleotide sequence, whichever is shorter. The following CLUSTALW parameters are preferred for multiple alignments: Gap Opening Penalty = 10, Gap Extension Parameter = 0.05, Gap Separation Penalty Range ) = 8, End Gap Separation Penalty = Off,% Identity for Alignment Delay = 40%, Residue Specific Gap (Residue Specific) Gaps) = off, Hydrophilic Residue Gap = off, and Transition Weighting = 0. The above-mentioned pairwise alignment and multiple alignment parameters for CLUSTALW correspond to the default parameters provided in the AlignX software program (Vector NTI program suite, version 6.0).

  The present invention involves manually correcting the percent match results when the subject sequence is shorter than the query sequence due to a 5 ′ or 3 ′ deletion rather than an internal deletion. If only local pairwise match rates are needed, no manual correction is required. However, the global match rate may be determined from the global polynucleotide alignment with manual correction. Calculation of percent identity based on global polynucleotide alignment is often preferred. Because they reflect not only locally matched polynucleotides, but also the percentage of matches between the entire polynucleotide molecule (ie, including not only overlapping regions but also polynucleotide overhangs). Since the CLUSTALW program does not take into account the 5 ′ and 3 ′ truncations of the subject sequence when calculating the match rate, manual correction is required to determine the global match rate. If the target sequence lacks the 5 'or 3' end compared to the query sequence, query the number of bases of the query sequence that is not matched / aligned on the 5 'side and 3' side of the target sequence. The percent identity is corrected by calculating as a percentage of the total number of bases in the sequence. Whether a nucleotide is matched / aligned is determined by the result of CLUSTALW sequence alignment. This percentage is then subtracted from the match rate calculated by the CLUSTALW program using the specified parameters to obtain the final match score. This corrected score can be used for the purposes of the present invention. For the purpose of manually adjusting the match score, only bases outside the 5 'and 3' bases of the target sequence that are not matched / aligned with the query sequence when displayed in CLUSTALW alignment are calculated.

  For example, a 90 base subject sequence is aligned with a 100 base query sequence to determine the match rate. Since the deletion is at the 5 'end of the subject sequence, the CLUSTALW alignment does not show a match / alignment of the first 10 bases at the 5' end. Since these 10 unpaired bases correspond to 10% of the sequence (number of mismatched bases at the 5 'and 3' ends / total number of bases in the query sequence), from the match score calculated by the CLUSTALW program, Subtract 10%. If the remaining 90 bases were perfectly matched, the final match rate would be 90%. As another example, a 90 base subject sequence is compared with a 100 base query sequence. This time, it is assumed that the deletion is an internal deletion, and there is no base that does not match / align with the query sequence on the 5 ′ side or 3 ′ side of the target sequence. In this case, the matching rate calculated by CLUSTALW is not manually corrected. In this case as well, only bases that are on the 5 ′ side and 3 ′ side of the target sequence and do not match / align with the query sequence are subject to manual correction. For the purposes of the present invention, no other manual correction is required.

  A polypeptide having an amino acid sequence that is at least 95% “matched” with the query amino acid sequence of the present invention, except that the subject polypeptide sequence can contain amino acid mutations in a ratio of up to 5 per 100 amino acids of the query amino acid sequence. , Meaning that the amino acid sequence of the subject polypeptide matches the query sequence. In other words, to obtain a polypeptide having an amino acid sequence that is at least 95% identical to the query sequence, up to 5% of the amino acid residues of the amino acid residues in the subject sequence can be inserted, deleted, or another Or can be substituted with an amino acid. These variations of the reference sequence are interspersed individually between residues in the reference sequence at the amino-terminal or carboxy-terminal position of the reference amino acid sequence, or at any position between these terminal positions, or within the reference sequence Can exist as one or more consecutive groups.

As a matter of fact, a particular polypeptide has at least about 80%, 85%, 90%, 91% 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9 It can be determined by a conventional method using a known computer program. A preferred method (also referred to as global sequence alignment) for determining the overall optimal match between a query sequence (a sequence of the invention) and a subject sequence is Higgins, DG et al., Computer Applications in the Biosciences (CABIOS), 8 ( 2): can be determined using the CLUSTALW computer program based on the algorithm of 189-191 (1992) (Thompson, JD et al., Nucleic Acids Research , 2 (22): 4673-4680 (1994)). In the sequence alignment, the query sequence and the target sequence are both amino acid sequences. The result of this global sequence alignment is expressed as a match rate. The preferred parameters used in CLUSTALW alignment of DNA sequences to calculate percent identity by pairwise alignment are: Matrix = BLOSUM, k-tuple = 1, top diagonal Number of Top Diagonals = 5, Gap Penalty = 3, Gap Open Penalty = 10, Gap Extension Penalty = 0.1, Scoring Method ( Scoring Method = Percent, Window Size = 5 or the length of the target nucleotide sequence, whichever is shorter. The following CLUSTALW parameters are preferred for multiple alignments: Gap Opening Penalty = 10, Gap Extension Parameter = 0.05, Gap Separation Penalty Range ) = 8, End Gap Separation Penalty = Off,% Identity for Alignment Delay = 40%, Residue Specific Gap (Residue Specific) Gaps) = off, Hydrophilic Residue Gap = off, and Transition Weighting = 0. The pairwise alignment and multiple alignment parameters for CLUSTALW described above correspond to the default parameters provided in the AlignX software program (Vector NTI program suite, version 6.0).

  The present invention involves manually correcting the match results when the subject sequence is shorter than the query sequence due to an N-terminal deletion or C-terminal deletion rather than an internal deletion. If only local pairwise match rates are needed, no manual correction is required. However, the global match rate may be determined from the global polypeptide alignment with manual correction. Calculation of percent identity based on global polypeptide alignment is often preferred. Because they reflect not only locally matched polypeptides, but also the percentage of matches between the entire polypeptide molecule (ie, including not only overlapping regions but also polypeptide overhangs). The CLUSTALW program does not take into account the N-terminal truncation and C-terminal truncation of the subject sequence when calculating the percent identity, so manual correction is required to determine the global percent identity. In the case of a target sequence lacking the N-terminal and C-terminal compared to the query sequence, the number of residues in the query sequence that are not matched / aligned on the N-terminal side and C-terminal side of the target sequence is calculated. The percent identity is corrected by calculating as a percentage of the total base number. Whether a residue is matched / aligned is determined by the results of the CLUSTALW sequence alignment. This percentage is then subtracted from the match rate calculated by the CLUSTALW program using the specified parameters to obtain the final match score. This final match score can be used for the purposes of the present invention. For the purpose of manually adjusting the match score, only residues that are N-terminal and C-terminal to the target sequence and that do not match / align with the query sequence, i.e., the most N-terminal and C-most of the target sequence Only query residue positions outside the terminal residues are considered.

  For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. Since the deletion is at the N-terminus of the subject sequence, the CLUSTALW alignment does not show a match / alignment of the first 10 residues at the N-terminus. These 10 unpaired residues represent 10% of the sequence (number of N-terminal and C-terminal non-matching residues / total number of residues in the query sequence), so from the match score calculated by the CLUSTALW program , Deduct 10%. If the remaining 90 residues were perfectly matched, the final match rate would be 90%. As another example, a 90 residue subject sequence is compared to a 100 residue query sequence. This time, it is assumed that the deletion is an internal deletion, and there is no residue that does not match / align with the query sequence at the N-terminal side or C-terminal side of the subject sequence. In this case, the matching rate calculated by CLUSTALW is not manually corrected. In this case as well, only the residue positions that are outside the N-terminal and C-terminal of the target sequence and not matched / aligned with the query sequence when displayed by CLUSTALW alignment are subject to manual correction. For the purposes of the present invention, no other manual correction is required.

  In addition to the methods described above for aligning two or more polynucleotide or polypeptide sequences and obtaining percent identity values for the aligned sequences, in some cases, known structural features of the sequences to be aligned, such as for each sequence It may be desirable to use a modified version of the CLUSTALW algorithm that takes SWISS-PROT names into account. The result of such a modified CLUSTALW algorithm can give a more accurate match value for two polynucleotide or polypeptide sequences. Support for such modified versions of CLUSTALW is provided within the CLUSTALW algorithm and will be readily understood by those skilled in bioinformatics.

  Variants can include modifications in the coding region, non-coding region, or both. Particularly preferred are polynucleotide variants that contain modifications that result in silent substitutions, additions or deletions, but do not alter the properties or activities of the encoded polypeptide. Nucleotide variants generated by silent substitutions due to the degeneracy of the genetic code are preferred. Furthermore, a variant in which 5 to 10, 1 to 5, or 1 to 2 amino acids are substituted, deleted or added in any combination is also preferable. Polynucleotide variants can be produced for a variety of reasons, for example, to optimize codon expression for a particular host (to change codons in the mRNA to those preferred by bacterial hosts such as E. coli).

  A natural variant is called an “allelic variant” and refers to one of several alternative forms of a gene that occupies a given locus on a chromosome in an organism (“Genes II”, edited by Lewin, B.). John Wiley & Sons, New York (1985)). These allelic variants can differ at the polynucleotide and / or polypeptide level and are encompassed by the present invention. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or direct synthesis.

The characteristics of the polypeptides of the present invention can be improved or modified by creating variants using known methods of protein engineering and recombinant DNA technology. For example, one or more amino acids can be deleted from the N-terminus or C-terminus of the protein without substantial loss of biological function. The authors of Ron et al . , J. Biol. Chem. 268: 2984-2988 (1993) found that variants with heparin binding activity after deletion of 3, 8 or 27 amino-terminal amino acid residues. KGF protein was reported. Interferon gamma was also up to 10 times more active when 8-10 amino acid residues were deleted from the carboxy terminus of this protein (Dobeli et al., J. Biotechnology 7: 199-216 (1988) ).

Furthermore, abundant evidence demonstrates that mutants often retain biological activity similar to that of natural proteins. For example, Gayle and coworkers ( J. Biol. Chem. , 268: 22105-22111 (1993)) performed a comprehensive mutational analysis of the human cytokine IL-1a. They used random mutagenesis to create more than 3,500 IL-1a mutants with an average of 2.5 amino acid changes per variant over the entire length of the molecule. Multiple mutations were examined at all possible amino acid positions. The researchers found that changing most of the molecule had little effect on [binding or biological activity]. In fact, of the over 3,500 nucleotide sequences investigated, only 23 amino acid sequences yielded proteins with significantly different activity from the wild type.

  In addition, deletion of one or more amino acids from the N-terminus or C-terminus of a polypeptide will still preserve other biological activity, even if one or more biological functions are modified or lost. It can be drunk. For example, removing less than a majority of the protein residues from the N-terminus or C-terminus probably preserved the ability of the deletion mutant to induce and / or bind to an antibody that recognizes the protein. Will be. Whether a particular polypeptide lacking the N-terminal or C-terminal residue of a protein retains such immunogenic activity is known in the routine methods described herein or in the art It can be easily determined by other conventional methods.

  Alternatively, such N-terminal deletion or C-terminal deletion of the polypeptide of the present invention may actually significantly increase one or more of the biological activities of the polypeptide. For example, the biological activity of many polypeptides is governed by the presence of regulatory domains at one or both ends. Such regulatory domains effectively inhibit the biological activity of those polypeptides instead of activation events (eg, binding to cognate ligands or cognate receptors, phosphorylation, proteolytic processing, etc.). ing. Thus, by removing the regulatory domain of a polypeptide, the polypeptide can be effectively rendered biologically active in the absence of an activation event.

Accordingly, the present invention further encompasses polypeptide variants that exhibit substantial biological activity. Such variants include deletions, insertions, inversions, repeats, and substitutions that are selected so as to have little effect on activity, according to general rules known in the art. For example, guidance on how to make phenotypically silent amino acid substitutions is described in Bowie et al., Science 247: 1306-1310 (1990). In this document, the authors show that there are two main strategies for studying amino acid sequence tolerance to changes.

  The first strategy takes advantage of the tolerance of amino acid substitution by natural selection that occurs during evolution. By comparing amino acid sequences of different species, conserved amino acids can be identified. These conserved amino acids are probably important for protein function. In contrast, the amino acid positions that natural selection allows substitutions indicate that these positions are not essential for protein function. Thus, positions that allow amino acid substitutions could be altered while retaining the biological activity of the protein.

  The second strategy uses genetic engineering to identify regions important for protein function by introducing amino acid mutations at specific positions in the cloned gene. For example, site-directed mutagenesis or alanine scanning mutagenesis (a method that introduces a single alanine mutation at every residue in the molecule) can be used (Cunningham and Wells, Science 244: 1081-1085 ( 1989)). The resulting mutant molecules can then be tested for biological activity.

  As the authors have stated, these two strategies have revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors also indicate which amino acid mutations are likely to be tolerated at certain amino acid positions in the protein. For example, most of the amino acid residues buried (within the three-dimensional structure of the protein) require nonpolar side chains, but the characteristics of the surface side chains are generally hardly conserved.

The present invention encompasses polypeptides that exhibit one or more functions that are the same as the functions exhibited by the polypeptides of the present invention because of low similarity but sufficient similarity. Similarity is determined by conservative amino acid substitutions. Such a substitution is a substitution that replaces a given amino acid in a polypeptide with another amino acid having similar characteristics (eg, chemical properties). According to Cunningham et al., Supra, such a conservative substitution appears to be phenotypically silent. Further guidance regarding which amino acid changes are likely to be phenotypically silent is described in Bowie et al., Science 247: 1306-1310 (1990).

  Permissible conservative amino acid substitutions of the present invention include aliphatic or hydrophobic amino acids Ala, Val, Leu and Ile substitutions, hydroxyl residues Ser and Thr substitutions, acidic residues Asp and Glu substitutions, Substitution between amide residues Asn and Gln, substitution between basic residues Lys, Arg and His, substitution between aromatic residues Phe, Tyr and Trp, and small amino acids Ala, Ser, Thr, Met and Gly Substitutions are included.

  The present invention further includes conservative substitutions described in Table 2 below.

  In addition to the uses described above, such amino acid substitutions can also increase the stability of the protein or peptide. The invention includes, for example, amino acid substitutions that contain one or more non-peptide bonds (substituting for peptide bonds) in a protein or peptide sequence. Also included are analogs containing amino acid residues other than natural L-amino acids, such as D-amino acids or unnatural or synthetic amino acids, such as β- or γ-amino acids.

  Both agreement and similarity can be easily calculated by referring to the following publications: Lesk, AM, “Computational Molecular Biology” (Oxford University Press, New York, 1988), Smith, DW “Biocomputing: Informatics and Genome Projects” (Academic Press, New York, 1993), Griffin, AM and Griffin, HG edition “Informatics Computer Analysis of Sequence Data, Part 1” (Humana Press, New Jersey, 1994), von Heinje, G. “Sequence Analysis in Molecular Biology” (Academic Press, 1987) and “Sequence Analysis Primer” edited by Gribskov, M. and Devereux, J. (M Stockton Press, New York, 1991).

  The invention further encompasses amino acid substitutions based on the probability that certain amino acid substitutions result in conservation of function. Such a probability is determined by aligning multiple genes with related functions and evaluating the relative penalty of each substitution for proper gene function. Such probabilities are often described in the form of a matrix and are used in the calculation of similarity by several algorithms (eg BLAST, CLUSTALW, GAP, etc.). In this case, similarity refers to the degree to which one amino acid can be used in place of another without loss of function. An example of such a matrix is a PAM250 or BLOSUM62 matrix.

  In addition to the normative, chemically conserved substitutions described above, the present invention generally does not fall into a conservative substitution, but includes substitutions that can be said to be chemically conserved in certain situations. To do. For example, analysis of the enzyme catalysis of proteases shows that certain amino acids within the active site of some enzymes may have strongly perturbed pKa due to the unique microenvironment of the active site. ing. This perturbation of pKa allows some amino acids to substitute for other amino acids while preserving enzyme structure and function. Examples of amino acids known to have perturbed pKa include lysozyme Glu-35 residue, chymotrypsin Ile-16 residue, papain His-159 residue. Conservation of function involves the amino acids undergoing anomalous protonation or anomalous deprotonation compared to a standard pKa that is not perturbed. The perturbation of pKa may allow these amino acids to actively participate in general acid-base catalysis due to the unique ionization environment within the enzyme active site. Thus, substitutions with amino acids that can act as general acids or general bases in the microenvironment of the active site or active cavity of an enzyme with the same or similar ability as wild-type amino acids serve in effect as conservative amino substitutions. Let ’s go.

  In addition to conservative amino acid substitutions, variants of the invention also include, but are not limited to: (i) substitution with one or more non-conservative amino acid residues (substitute amino acid residues are May be encoded by the genetic code or not encoded by the genetic code), or (ii) substitution by one or more amino acid residues having a substituent, or (iii) the mature polypeptide and another compound, eg A fusion with a compound (such as polyethylene glycol) that increases the stability and / or solubility of the polypeptide, or (iv) an additional amino acid such as an IgG Fc fusion region peptide, or a leader or secretory sequence, or purification. Fusions with sequences to facilitate. Such variant polypeptides are considered within the skill of the artisan in view of the teachings herein.

For example, a polypeptide variant in which a charged amino acid is replaced with another charged or neutral amino acid can result in a protein with improved characteristics, such as a protein with reduced aggregation. Aggregation of pharmaceutical formulations reduces activity and increases clearance due to the immunogenic activity of the aggregate (Pinckard et al. (1967) Clin. Exp. Immunol. 2: 331-340 (1967), Robbins et al., Diabetes 36: 838-845 (1987), Cleland et al., Crit . Rev. Therapeutic Drug Carrier Systems 10: 307-377 (1993)).

  Further, the present invention provides molecular evolution (“DNA”) to the polynucleotide disclosed as SEQ ID NO: 1, the sequence of a clone submitted as contained in the deposit, and / or the cDNA encoding the polypeptide disclosed as SEQ ID NO: 2. Polypeptide variants produced by applying the “shuffling”) method are also encompassed. Such DNA shuffling techniques are known in the art.

  Yet another embodiment of the present invention contains at least one amino acid substitution, but no more than 50 amino acid substitutions are included, more preferably no more than 40 amino acid substitutions are included, even more preferably It relates to a polypeptide comprising an amino acid sequence of the invention having an amino acid sequence that does not contain more than 30 amino acid substitutions, and more preferably does not contain more than 20 amino acid substitutions. Of course, the peptide or polypeptide has an amino acid sequence comprising an amino acid sequence of the invention containing at least one amino acid substitution not exceeding 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 It is highly preferred that its preference increases in the above order. In a specific embodiment, the number of additions, substitutions and / or deletions in the amino acid sequences of the invention or fragments thereof (eg, mature and / or other fragments described herein) are 1-5, 5 ˜10, 5-25, 5-50, 10-50, or 50-150, with conservative amino acid substitutions being preferred.

  The present invention is directed to polynucleotide fragments of the polynucleotides of the present invention, and the polypeptides encoded by said polynucleotides and / or fragments.

  In the present invention, the “polynucleotide fragment” is a part of a nucleic acid sequence included in at least one deposited clone or a part of a nucleic acid sequence encoding a polypeptide encoded by cDNA in at least one deposited clone. A nucleic acid sequence, or a nucleic acid sequence that is part of the nucleic acid sequence shown in SEQ ID NO: 1 or a part of the complementary strand of SEQ ID NO: 1, or a nucleic acid sequence that is part of a polynucleotide sequence encoding the polypeptide of SEQ ID NO: 2, Refers to a short polynucleotide having The nucleotide fragments of the present invention are preferably at least about 15 nt, more preferably at least about 20 nt, more preferably at least about 30 nt, even more preferably at least about 40 nt, at least about 50 nt, at least about 75 nt, or at least about 150 nt in length. is there. For example, a fragment of “at least 20 nt long” includes 20 or more consecutive bases selected from the cDNA sequence contained in at least one deposited clone or the nucleotide sequence shown in SEQ ID NO: 1. In this case, “about” encompasses the specifically stated value and values that are one or two nucleotides larger (5, 4, 3, 2, or 1 nucleotide) larger or smaller. These nucleotide fragments have uses including, but not limited to, diagnostic probes and primers as discussed herein. Of course, larger fragments (eg, 50, 150, 500, 600, 2000 nucleotides) are preferred.

  Polypeptides and polynucleotide fragments characterized by structural or functional domains, such as alpha and alpha helix forming regions, beta and beta sheet forming regions, turns and turn forming regions, coils and coil forming regions, hydrophilic regions, hydrophobic Also preferred are fragments comprising a sex region, an alpha amphipathic region, a beta amphipathic region, a flexible region, a surface forming region, a substrate binding region, and a high antigenic index region. The polypeptide fragment of SEQ ID NO: 2 contained in the conserved domain is specifically encompassed by the present invention. In addition, polynucleotides encoding these domains are also contemplated.

  Other preferred polypeptide fragments are biologically active fragments. Biologically active fragments are those that exhibit activity similar to, but not necessarily identical to, the polypeptides of the invention. The biological activity of the fragment can include an improved desired activity or a reduced undesirable activity. Polynucleotides encoding these polypeptide fragments are also encompassed by the present invention.

  In a preferred embodiment, the functional activity exhibited by a polypeptide encoded by a polynucleotide fragment of the invention can be one or more biological activities typically associated with a full-length polypeptide of the invention. Specific examples of these biological activities include the ability of a fragment to bind to at least one of the same antibodies that bind to the full-length protein, interact with at least one of the same proteins as the protein that binds to the full-length protein. The ability of a fragment, the ability of a fragment to elicit at least one of the same immune responses elicited by a full-length protein (ie, the ability to cause the immune system to generate antibodies specific for the same epitope), and full-length protein binding Such as the ability of a fragment to bind to at least one of the same polynucleotides, the ability to bind to a ligand of a full-length protein, and the ability of a fragment to form a multimer with a full-length protein. However, one skilled in the art will also appreciate that some fragments may have desirable biological activity that is not directly related to the biological activity of the full-length protein. The functional activity of the polypeptides of the present invention (including fragments, variants, derivatives and analogs thereof) can be determined by a number of methods available to those skilled in the art, some of which are described herein. I will explain the terms anew.

  The present invention includes an epitope of a polypeptide having the amino acid sequence of SEQ ID NO: 2, or one of ATCC deposit numbers PTA-4454 or PTA-4803 deposited on June 12, 2002 and November 14, 2002, respectively. An epitope of a polypeptide sequence encoded by the polynucleotide sequence or the complementary strand of the sequence of SEQ ID NO: 1 under stringent hybridization conditions or low stringency hybridization conditions as defined above or June 2002 12 Containing an epitope of a polypeptide sequence encoded by a polynucleotide that hybridizes to the complementary strand of the sequence contained in one of ATCC accession numbers PTA-4454 or PTA-4803 deposited on November 14, 2002, respectively, or A polypeptide comprising the same epitope is included. The present invention further includes a polynucleotide sequence encoding an epitope of the polypeptide sequence of the present invention (eg, the sequence disclosed in SEQ ID NO: 1), a polynucleotide sequence of a complementary strand of the polynucleotide sequence encoding the epitope of the present invention, and Also included are polynucleotide sequences that hybridize to the complementary strand under stringent hybridization conditions as defined above or under low stringency hybridization conditions.

The term “epitope” as used herein refers to a portion of a polypeptide that has antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably a human. In a preferred embodiment, the present invention includes a polypeptide comprising an epitope, as well as a polynucleotide encoding the polypeptide. As used herein, the term “immunogenic epitope” refers to an antibody response in an animal's body as determined by any method of the art known in the art, such as the method of producing an antibody described below. It is defined as an inducing part (see eg Geysen et al., Proc. Natl. Acad. Sci. USA 81: 3998-4002 (1983)). As used herein, the term “antigen epitope” refers to an antibody that immunizes its antigen when determined by any method well known in the art, such as the immunoassay described herein. It is defined as a moiety that can specifically bind. Non-specific binding is excluded from immunospecific binding, but cross-reactivity with other antigens is not necessarily excluded from immunospecific binding. An antigenic epitope need not necessarily be immunogenic.

Fragments that function as epitopes can be produced by any conventional means (see, eg, Houghten, Proc. Natl. Acad. Sci. USA 82: 5131-5135 (1985). See US Pat. No. 4,631,211. Is described in more detail).

In the present invention, the antigenic epitope is preferably at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least Contains at least 25, at least 30, at least 40, at least 50, most preferably from about 15 to about 30 stretches of amino acids. Preferred polypeptides comprising an immunogenic epitope or antigenic epitope are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, Or 100 amino acid residues or more in length. Other non-exclusive preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as portions thereof. An antigenic epitope is useful, for example, in producing antibodies (including monoclonal antibodies) that specifically bind that epitope. Preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as any combination of 2, 3, 4, 5 or more of these antigenic epitopes. Antigenic epitopes can be used as target molecules in immunoassays (see, eg, Wilson et al., Cell 37: 767-778 (1984), Sutcliffe et al., Science 219: 660-666 (1983)).

Similarly, immunogenic epitopes can be used to induce antibodies by methods well known in the art (eg, Sutcliffe et al., Supra, Wilson et al., Supra, Chow et al., Proc. Natl. Acad. Sci. USA). 82: 910-914, and Bittle et al. , J. Gen. Virol. 66: 2347-2354 (1985)). Preferred immunogenic epitopes include the immunogenic epitopes disclosed herein, as well as any combination of 2, 3, 4, 5 or more of these immunogenic epitopes. To elicit an antibody response, a polypeptide comprising one or more immunogenic epitopes can be presented to an animal system (such as a rabbit or mouse) together with a carrier protein such as albumin and the polypeptide is of sufficient length ( The polypeptide can also be presented without a carrier if it has at least about 25 amino acids. However, immunogenic epitopes containing only 8-10 amino acids are at least sufficient to produce antibodies that have the ability to bind to linear epitopes in denatured polypeptides (eg, by Western blotting). It has been shown.

The epitope-bearing polypeptides of the present invention can be used to induce antibodies according to methods well known in the art including, for example, in vivo immunization, in vitro immunization, phage display and the like. See, for example, Sutcliffe et al. , Supra, Wilson et al. , Supra, and Bittle et al. , J. Gen. Virol. , 66: 2347-2354 (1985). When using in vivo immunization, animals may be immunized with free peptides, but anti-peptide antibodies can be obtained by coupling the peptides to a polymeric carrier such as keyhole limpet hemocyanin (KLH) or tetanus toxoid The value can also be increased. For example, peptides containing cysteine residues can be coupled to a carrier using a linker such as maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other peptides can be coupled to the more common linking agent (glutaraldehyde Etc.) can be coupled to the carrier. Animals such as rabbits, rats and mice can be isolated with a free peptide or a peptide coupled with a carrier, for example, about 100 μg peptide or carrier protein and Freund's adjuvant or any other adjuvant known to stimulate an immune response Immunization is carried out by intraperitoneal and / or intradermal injection of an emulsion containing To obtain useful titers of anti-peptide antibodies that can be detected, for example, by ELISA assays using free peptide adsorbed on a solid surface, several booster injections can be performed, for example, at intervals of about 2 weeks. You may need to do it. The titer of anti-peptide antibody in the serum obtained from the immunized animal can be determined by selecting the anti-peptide antibody, eg, by adsorption to a peptide on a solid support, according to methods well known in the art, and It can be increased by performing elution.

As will be appreciated by those skilled in the art and as discussed above, the polypeptides of the invention comprising immunogenic or antigenic epitopes can be fused to other polypeptide sequences. For example, the polypeptide of the present invention is fused to an immunoglobulin (IgA, IgE, IgG, IgM) constant domain, or a part thereof (CH1, CH2, CH3 or any combination thereof and a part thereof) to obtain a chimeric polypeptide. be able to. Such a fusion protein can facilitate purification or increase the in vivo half-life. This has been shown for chimeric proteins consisting of the first two domains of a human CD4 polypeptide and the various domains of the constant region of a mammalian immunoglobulin heavy or light chain. For example EP394,827, Traunecker et al., Nature, 331: 84-86 (1988 ) see the like. Enhanced delivery of antigens to the immune system that occurs across the epithelial barrier has been demonstrated for antigens conjugated to FcRn binding partners, such as IgG or Fc fragments (eg, insulin) (eg, PCT Publication WO 96/22024 and (See WO99 / 04813). IgG fusion proteins with disulfide-linked dimeric structures due to disulfide bonds in the IgG moiety have also been found to bind and neutralize other molecules more efficiently than monomeric polypeptides or fragments alone. ing. See, for example, Fountoulakis et al . , J. Biochem. , 270: 3958-3964 (1995). Recombining the nucleic acid encoding the above epitope with the gene of interest as an epitope tag (eg, hemagglutinin (“HA”) tag or flag tag) to aid in the detection and purification of the expressed polypeptide. You can also. For example, the system described by Janknecht et al. Allows easy purification of non-denaturing fusion proteins expressed in human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88: 8972 -897). In this system, a gene of interest is subcloned into a vaccinia recombination plasmid such that the open reading frame of the gene is fused at translation to an amino-terminal tag consisting of six histidine residues. This tag serves as a matrix binding domain for the fusion protein. An extract obtained from cells infected with this recombinant vaccinia virus can be loaded onto a Ni ²⁺ nitriloacetic acid-agarose column, and a protein having a histidine tag can be selectively eluted with an imidazole-containing buffer.

Additional fusion proteins of the invention can be made by techniques of gene shuffling, motif shuffling, exon shuffling, and / or codon shuffling (collectively referred to as “DNA shuffling”). DNA shuffling can be used to modulate the activity of the polypeptides of the invention, and such methods can be used to create polypeptides with altered activity and agonists and antagonists of the polypeptides. . General considerations include, for example, US Pat. Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252 and 5,837,458, and Patten et al., Curr. Opinion Biotechnol. 8: 724-33 (1997), Harayama, Trends. See Biotechnol. 16 (2): 76-82 (1998), Hansson et al . , J. Mol . Biol. 287: 265-76 (1999), Lorenzo and Blasco, Biotechniques 24 (2): 308-13 (1998). (These patents and publications are incorporated herein by reference in their entirety). In one embodiment, modification of the polynucleotides corresponding to SEQ ID NO: 1 and the polypeptides encoded by these polynucleotides can be achieved by DNA shuffling. In DNA shuffling, two or more DNA segments are assembled by homologous recombination or site-specific recombination to generate mutations in the polynucleotide sequence. In another embodiment, the polynucleotide of the invention or encoded by subjecting it to random mutagenesis by error-prone PCR, random nucleotide insertion, or other methods prior to recombination. Polypeptides may be altered. In another embodiment, one or more components, motifs, sections, portions, domains, fragments, etc. of a polynucleotide encoding a polypeptide of the invention may be combined with one or more components, motifs, sections, one or more heterologous molecules. It may be recombined with a part, domain, fragment or the like.

  Additional polypeptides of the invention (as determined by immunoassays well known in the art for assaying specific antibody-antigen binding) of the polypeptide, polypeptide fragment or variant of SEQ ID NO: 2 and / or the present It relates to antibodies and T cell antigen receptors (TCR) that immunospecifically bind the epitopes of the invention. Examples of antibodies of the present invention include polyclonal antibodies, monoclonal antibodies, monovalent antibodies, bispecific antibodies, heteroconjugate antibodies, multispecific antibodies, human antibodies, humanized or chimeric antibodies, single chain antibodies. , Fab fragments, F (ab ′) fragments, fragments produced by the Fab expression library, anti-idiotype (anti-Id) antibodies (eg, including anti-Id antibodies to the antibodies of the present invention), and epitope binding properties of the above-described antibodies This includes, but is not limited to, fragments. The term “antibody” as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, ie, molecules that contain an antigen binding site that immunospecifically binds an antigen. The immunoglobulin molecules of the invention can be any type (eg IgG, IgE, IgM, IgD, IgA and IgY), which class (eg IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or any subclass of immunoglobulin molecule. May be. Furthermore, the term “antibody” (Ab) or “monoclonal antibody” (Mab) refers to not only complete molecules but also antibody fragments (eg, Fab and F (ab ′) 2 fragments) that have the ability to specifically bind to proteins. Etc.). Fab and F (ab ') 2 fragments lack the Fc fragment of the complete antibody, disappear from the animal or plant circulation more rapidly than the complete antibody, and have less nonspecific tissue binding (Wahl et al., J Nucl. Med. 24: 316-325 (1983)). Accordingly, these fragments are preferred, as are the products of FAB or other immunoglobulin expression libraries. Furthermore, the antibodies of the present invention also include chimeric, single chain and humanized antibodies.

  The antibody is most preferably a human antigen-binding antibody fragment of the present invention, including, for example, Fab, Fab ′ and F (ab ′) 2, Fd, single chain Fv (scFv), single chain antibody , A disulfide bond Fv (sdFv), and a fragment containing a VL domain or a VH domain. An antigen-binding antibody fragment comprising a single chain antibody may comprise the variable region alone or in combination with all or part of the hinge region, CH1, CH2 and CH3 domains. In addition, antigen-binding fragments that include any combination of variable region and hinge region, CH1, CH2, and CH3 domains are also encompassed by the present invention. The antibodies of the present invention may be derived from any animal including birds and mammals. The antibody is preferably a human, murine (eg, mouse and rat), donkey, sheep, rabbit, goat, guinea pig, camel, horse, or chicken antibody. As used herein, “human” antibodies include antibodies having the amino acid sequence of human immunoglobulins, as described below and as described, for example, in US Pat. No. 5,939,598 by Kucherlapati et al. Examples include antibodies isolated from libraries, antibodies isolated from animals that are transgenic for one or more human immunoglobulins and do not express endogenous immunoglobulins, and the like.

The antibodies of the invention can have monospecificity, bispecificity, trispecificity, or more multispecificity. Multispecific antibodies can be specific for different epitopes of the polypeptide of the invention, or can be specific for both the polypeptide of the invention and a heterologous epitope (such as a heterologous polypeptide or solid support material). it can. For example, PCT publication WO93 / 17715, WO92 / 08802, WO91 / 00360, WO92 / 05793, Tutt et al., J. Immunol. 147: 60-69 (1991), U.S. Pat.Nos. 4,474,893, 4,714,681, See 5,573,920, 5,601,819, Kostelny et al. , J. Immunol. 148: 1547-1553 (1992) and the like.

  The antibodies of the invention can be described or identified in the context of an epitope of the polypeptide or a portion thereof that they recognize or specifically bind. The epitope or polypeptide portion is identified as described herein, for example by N-terminal position and C-terminal position, or by size expressed in consecutive amino acid residues, or listed in tables and figures Can do. Antibodies that specifically bind any epitope or polypeptide of the invention can also be excluded. Accordingly, the present invention encompasses antibodies that specifically bind a polypeptide of the present invention and also addresses their exclusion.

The antibodies of the present invention can also be described or identified in the context of their cross-reactivity. Antibodies that do not bind any other analog, ortholog or homolog of the polypeptide of the invention are included. A polypeptide that is at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, and at least 50% identical to a polypeptide of the invention Antibodies that bind (calculated using methods known in the art as described herein) are also encompassed by the present invention. In a specific embodiment, the antibodies of the invention cross-react with mouse, rat and / or rabbit homologues of human proteins and their corresponding epitopes. Concordance with the polypeptide of the present invention is less than 95%, less than 90%, less than 85%, less than 80%, less than 75% (calculated by methods known in the art as described herein), 70 Antibodies that do not bind polypeptides that are less than%, less than 65%, less than 60%, less than 55%, and less than 50% are also encompassed by the present invention. As a specific embodiment, the cross-reactivity described above may comprise a single specific antigen polypeptide or a specific immunogen polypeptide, or 2, 3, 4, 5 or more specific antigen polypeptides disclosed herein and Cross-reactivity for a combination of / or specific immunogenic polypeptides. In addition, antibodies that bind a polypeptide encoded by a polynucleotide that hybridizes to the polynucleotide of the invention under stringent hybridization conditions (described herein) are also encompassed by the invention. The antibodies of the invention can also be described or identified in the context of their binding affinity for the polypeptides of the invention. Preferred binding affinities include dissociation constants, i.e.Kd, of 5 × 10 ⁻² M, 10 ⁻² M, 5 × 10 ⁻³ M, 10 ⁻³ M, 5 × 10 ⁻⁴ M, 10 ⁻⁴ M, 5 x 10 ^-5 M, 10 ^-5 M, 5 x 10 ^-6 M, 10 ^-6 M, 5 x 10 ^-7 M, 10 ^-7 M, 5 x 10 ^-8 M, 10 ^-8 M, 5 x ^{10 -9 M, 10 -9 M,} 5 × 10 -10 M, 10 -10 M, 5 × 10 -11 M, 10 -11 M, 5 × 10 -12 M, 10 -12 M, 5 × 10 - Those that are less than ¹³ M, 10 ⁻¹³ M, 5 × 10 ⁻¹⁴ M, 10 ⁻¹⁴ M, 5 × 10 ⁻¹⁵ M, or 10 ⁻¹⁵ M.

  The present invention competitively inhibits binding of an antibody to an epitope of the present invention as determined by any method known in the art for determining competitive binding, such as the immunoassays described herein. Antibodies are also provided. In preferred embodiments, the antibody competitively binds to the epitope by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50%. Inhibit.

  The antibody of the present invention can act as an agonist or antagonist of the polypeptide of the present invention. For example, the invention encompasses antibodies that partially or completely disrupt receptor / ligand interactions with the polypeptides of the invention. The antibodies of the present invention preferably bind an antigenic epitope disclosed herein or a portion thereof. The invention features both receptor-specific antibodies and ligand-specific antibodies. The invention also features receptor-specific antibodies that do not prevent ligand binding but prevent receptor activation. Receptor activation (ie, signal transduction) can be determined by the techniques described herein or other techniques known in the art. For example, receptor activation is determined by detecting phosphorylation of the receptor or its substrate (eg tyrosine or serine / threonine) by immunoprecipitation followed by Western blot analysis (eg as described above). Can do. In specific embodiments, the ligand activity or receptor activity is at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60% of the activity in the absence of the antibody. Or an antibody that inhibits at least 50%.

The present invention relates to receptor-specific antibodies that prevent both ligand binding and receptor activation, as well as antibodies that recognize receptor-ligand complexes and preferably do not specifically recognize unbound receptors or unbound ligands. Also features. Neutralizing antibodies that bind the ligand and prevent the ligand from binding to the receptor, as well as antibodies that prevent receptor activation by binding the ligand but do not prevent the ligand from binding the receptor, Included in the present invention. Furthermore, antibodies that activate the receptor are also encompassed by the present invention. These antibodies can act as receptor agonists, for example by inducing receptor dimerization (ie, enhancing or activating all or part of the biological activity of ligand-mediated receptor activation). sell). These antibodies can be identified as agonists, antagonists or inverse agonists related to biological activity, including the specific biological activity of the peptides of the invention disclosed herein. For example, PCT publication WO 96/40281, US Pat. No. 5,811,097, Deng et al., Blood 92 (6): 1981-1988 (1998), Chen et al., Cancer Res. 58 (16): 3668-3678 (1998), Harrop et al., J. Immunol. 161 (4): 1786-1794 (1998), Zhu et al., Cancer Res. 58 (15): 3209-3214 (1998), Yoon et al. , J. Immunol. 160 (7): 3170-3179 ( 1998), Prat et al . , J. Cell. Sci. 111 (Pt2): 237-247 (1998), Pitard et al ., J. Immunol . Methods 205 (2): 177-190 (1997), Liautard et al., Cytokine 9 ( 4): 233-241 (1997), Carlson et al . , J. Biol. Chem. 272 (17): 11295-11301 (1997), Taryman et al., Neuron 14 (4): 755-762 (1995), Muller et al., See Structure 6 (9): 1153-1167 (1998), Bartunek et al., Cytokine 8 (1): 14-20 (1996), all of which are incorporated herein by reference in their entirety.

  The antibodies of the invention can be used for, but not limited to, purification, detection and targeting of the polypeptides of the invention, including, for example, in vitro and in vivo diagnostic and therapeutic methods. For example, the antibodies are useful in immunoassays for qualitatively and quantitatively measuring the level of a polypeptide of the invention in a biological sample. See, for example, Harlow et al., “Antibodies: A Laboratory Manual” (Cold Spring Harbor Laboratory Press, 2nd edition, 1988), which is incorporated herein by reference in its entirety.

  The antibodies of the present invention can be used alone or in combination with other compositions. The antibody may further be recombinantly fused to the heterologous polypeptide at the N-terminus or C-terminus, or chemically conjugated (including covalent and non-covalent conjugation) to the polypeptide or other composition. Can do. For example, the antibodies of the invention can be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, radionuclides or toxins. See, for example, PCT publications WO92 / 08495, WO91 / 14438, WO89 / 12624, US Pat. No. 5,314,995, and EP396,387.

  The antibodies of the present invention include modified derivatives, i.e. derivatives that have been modified by covalently attaching some type of molecule to the antibody in a manner that does not prevent the antibody from eliciting an anti-idiotypic response. The For example, antibody derivatives are modified by glycosylation, acetylation, PEGylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, linkage to cellular ligands or other proteins, etc. But is not limited to these. Any of a number of chemical modifications can be made by known techniques including, but not limited to, specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, and the like. In addition, the derivative may contain one or more non-classical amino acids.

  The antibodies of the present invention can be produced by any suitable method known in the art.

  The antibody of the present invention may comprise a polyclonal antibody. Methods for producing polyclonal antibodies are known to those skilled in the art (Harlow et al., “Antibodies: A Laboratory Manual” (Cold Spring Harbor Laboratory Press, 2nd edition, 1988) and Chapter 2 of “Current Protocols”; Incorporated herein by reference in its entirety). In a preferred method, a preparation of MGAT3 protein is produced and purified to make it substantially free of natural contaminants. The preparation is then introduced into the animal so that a polyclonal antiserum with high specific activity is produced. For example, administering the polypeptide of the present invention to various host animals, such as but not limited to rabbits, mice, rats, etc., to induce the production of serum containing polyclonal antibodies specific for that antigen. Can do. Administration of the polypeptides of the invention may require one or more injections of the immunizing agent and optionally an adjuvant. Depending on the host species, various adjuvants can be used to increase the immunological response, such as Freund's (complete and incomplete) adjuvants, minerals such as aluminum hydroxide Surfactants such as gels, lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentials such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum However, the present invention is not limited thereto. Such adjuvants are also well known in the art. In the present invention, the term “immunizing agent” refers to a polypeptide of the present invention (including fragments, variants and / or derivatives thereof), a fusion with a heterologous polypeptide, and other forms of polypeptides described herein. Can be defined.

  Typically, the immunizing agent and / or adjuvant is injected into the mammal by multiple subcutaneous or intraperitoneal injections, but may be administered by intramuscular and / or intravenous injection. The immunizing agent can include a polypeptide of the invention or a fusion protein or variant thereof. Depending on the nature of the polypeptide (ie, hydrophobicity, hydrophilicity, stability, net charge, isoelectric point, etc.), proteins that are known to be immunogenic in the immunized mammal It may be beneficial to conjugate an immunizing agent. Such conjugation involves chemical conjugation or fusion by derivatizing an active chemical functional group such that a covalent bond is formed to both the polypeptide of the invention and the immunogenic protein. Conjugation by protein-based methods or other methods known to those skilled in the art is included. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Depending on the host species, various adjuvants can be used to increase the immunological response, such as Freund's (complete and incomplete) adjuvants, minerals such as aluminum hydroxide Surfactants such as gels, lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful humans such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum There are adjuvants, but are not limited to these. Other examples of adjuvants that can be used include MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicorynomycolate). The immunization protocol can be selected by one skilled in the art without undue experimentation.

The antibody of the present invention may comprise a monoclonal antibody. Monoclonal antibodies can be obtained by hybridoma methods such as Kohler and Milstein, Nature , 256: 495 (1975) and US Pat. No. 4,376,110, Harlow et al. “Antibodies: A Laboratory Manual” (Cold Spring Harbor Laboratory Press, 2nd edition, 1988), Hammerling et al. "Monoclonal Antibodies and T-Cell Hybridomas" (Elsevier, New York, 563-681, 1981), Koehler et al . , Eur. J. Immunol. 6: 511 (1976), Koehler et al . , Eur. J. Immunol. 6 292 (1976), or other methods known to those skilled in the art. Other examples of methods that can be used to produce monoclonal antibodies include human B cell hybridoma technology (Kosbor et al., 1983, Immunology Today 4:72, Cole et al., 1983, Proc. Natl. Acad. Sci. USA 80: 2026-2030) and EBV hybridoma technology (Cole et al., 1985, “Monoclonal Antibodies And Cancer Therapy” (Alan R. Liss, Inc.), pages 77-96)) and the like. Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma producing the mAb of this invention can be cultivated in vitro or in vivo. Since mAbs with high antibody titers are produced in vivo, this is currently the preferred production method.

  Hybridoma methods typically produce antibodies that specifically bind to immunizing agents by immunizing mice, humanized mice, mice with human immune systems, hamsters or other suitable host animals with immunizing agents. Induce lymphocytes that have the ability to produce or produce the same antibody. Alternatively, lymphocytes may be immunized in vitro.

  The immunizing agent will typically include a polypeptide of the invention or a fusion protein thereof. Preferably, the immunizing agent consists of an MGAT3 polypeptide, more preferably consistent with MGAT3 polypeptide expressing cells. Such cells can be cultured in any suitable tissue culture medium, but with the addition of 10% fetal calf serum (inactivated at about 56 ° C.) and about 10 g / l non-essential amino acid, about 1,000 U / The cells are preferably cultured in Earl's modified Eagle's medium supplemented with ml penicillin and about 100 μg / ml streptomycin. In general, peripheral blood lymphocytes ("PBL") are used when human-derived cells are desired, and splenocytes or lymph node cells are used when non-human mammalian cell sources are desired. Next, hybridoma cells are formed by fusing lymphocytes with an immortal cell line using an appropriate fusion agent such as polyethylene glycol (Goding “Monoclonal Antibodies: Principles and Practice” (Academic Press, 1986). Pages 59-103). Immortal cell lines are usually transformed mammalian cells, especially myeloma cells from rodents, cows and humans. Usually, rat or mouse myeloma cell lines are used. The hybridoma cells can be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of unfused, immortalized cells. For example, if the parent cell does not have the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the culture medium for hybridomas typically contains the substances hypoxanthine, aminopterin, and Will contain thymidine ("HAT medium").

Preferred immortal cell lines are those that fuse efficiently, support stable high level expression of antibodies by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortal cell lines are murine myeloma lines available from, for example, the Salk Institute Cell Distribution Center (San Diego, Calif.) And the American Type Culture Collection (Manassas, Va.). The parent myeloma cell line (SP2O) provided by ATCC is more preferred. As inferred throughout this specification, human and mouse-human heteromyeloma cell lines have also been described for the production of human monoclonal antibodies (Kozbor, J. Immunol. , 133: 3001 (1984). Brodeur et al., “Monoclonal Antibody Production Techniques and Applications” (Marcel Dekker, Inc., New York, 1987), pages 51-63).

  The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies against the polypeptides of the invention. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay such as a radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA). Such techniques are known in the art and are within the skill of the artisan. The binding affinity of the monoclonal antibody can be determined, for example, by the Scatchard analysis of Munson and Pollart, Anal. Biochem., 107: 220 (1980).

After identifying the desired hybridoma cells, the clones are subcloned by limiting dilution and propagated by standard methods (Goding, supra) and / or according to Wands et al. ( Gastroenterology 80: 225-232 (1981)) Can do. Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640. Alternatively, the hybridoma cells may be grown in vivo as mammalian ascites.

  Monoclonal antibodies secreted by subclones can be obtained from culture medium or ascites by conventional immunoglobulin purification methods such as protein A-sepharose, hydroxyapatite chromatography, gel exclusion chromatography, gel electrophoresis, dialysis, or affinity chromatography. It can be isolated or purified.

  Those skilled in the art will appreciate that the present invention is not limited to their production in hybridomas, as there are various monoclonal antibody production methods in the art. For example, monoclonal antibodies can be produced by recombinant DNA methods as described in US Pat. No. 4,816,567. In this case, the term “monoclonal antibody” refers to an antibody derived from a single eukaryotic, phage or prokaryotic clone. DNA encoding the monoclonal antibodies of the present invention can be obtained using conventional methods (eg, genes encoding the heavy and light chains of murine antibodies, or from human, humanized or other sources). Such as by using an oligonucleotide probe capable of specifically binding to the gene encoding such a chain) and can be easily sequenced. The hybridoma cells of the invention serve as a preferred source of such DNA. Once the DNA has been isolated, place it in an expression vector, and then place the expression vector in a host cell such as a monkey COS cell, a Chinese hamster ovary (CHO) cell, or a myeloma cell that does not normally produce immunoglobulin protein. Introducing, the synthesis of monoclonal antibodies in recombinant host cells can be achieved. Also, for example, the coding sequences of human heavy and light chain constant domains can be used in place of homologous murine sequences (US Pat. No. 4,816,567, Morrison et al., Supra) or all or one of the coding sequences of non-immunoglobulin polypeptides. The DNA may be modified, such as by covalently attaching the moiety to an immunoglobulin coding sequence. Such non-immunoglobulin polypeptides are used in place of the constant domains of the antibodies of the invention, or in place of the variable domains of one antigen binding site of the antibodies of the invention to generate chimeric bivalent antibodies. can do.

  The antibody can be a monovalent antibody. Methods for producing monovalent antibodies are well known in the art. For example, in some methods, immunoglobulin light chains and modified heavy chains are expressed recombinantly. The heavy chain is generally cleaved at any point in the Fc region so that heavy chain crosslinking does not occur. Alternatively, the relevant cysteine residues are replaced with another amino acid residue or are deleted so that crosslinking does not occur.

  In vitro methods are also suitable for the production of monovalent antibodies. Production of its fragments, particularly Fab fragments, by antibody digestion can be accomplished by routine methods known in the art. Monoclonal antibodies can be produced using a wide variety of techniques known in the art, including the use of hybridomas, recombinant techniques, and phage display techniques, or combinations thereof. For example, monoclonal antibodies can be obtained by hybridoma technology such as Harlow et al. “Antibodies: A Laboratory Manual” (Cold Spring Harbor Laboratory Press, 2nd edition, 1988), Hammerling et al. “Monoclonal Antibodies and T-Cell Hybridomas” (Elsevier, New York, 1981). Can be produced using hybridoma technology known in the art, such as described on pages 563 to 681 (the above publications are incorporated herein by reference in their entirety). The term “monoclonal antibody” as used herein is not limited to antibodies produced through hybridoma technology. The term “monoclonal antibody” refers to an antibody that is derived from a single clone, such as a eukaryotic clone, a prokaryotic clone, or a phage clone, and not the method by which it is produced.

  Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art and are discussed in detail herein in the Examples. By way of non-limiting example, mice can be immunized with a polypeptide of the invention or cells that express such a peptide. If an immune response is detected, for example, if an antibody specific for the antigen is detected in the serum of the mouse, the spleen of the mouse is collected and splenocytes are isolated. The splenocytes are then fused by well-known techniques to any suitable myeloma cells, for example cells from the cell line SP20 available from ATCC. Hybridomas are selected and cloned by limiting dilution. The hybridoma clones are then assayed for cells secreting antibodies capable of binding the polypeptides of the invention by methods known in the art. Ascites fluid, which generally contains high levels of antibodies, can be produced by immunizing mice with positive hybridoma clones.

  Accordingly, the present invention provides a hybridoma cell that secretes the antibody of the present invention (this hybridoma is preferably fused with splenocytes isolated from a mouse immunized with the antigen of the present invention with a myeloma cell and then the fusion And a method for producing a monoclonal antibody comprising culturing the resulting hybridoma (produced by screening for a hybridoma clone that secretes an antibody capable of binding the polypeptide of the present invention), and the method. Provided antibodies.

  Antibody fragments that recognize specific epitopes can be produced by known techniques. For example, the Fab fragment and F (ab ′) 2 fragment of the present invention are prepared by using an immunoglobulin molecule using an enzyme such as papain (when producing a Fab fragment) or pepsin (when producing an F (ab ′) 2 fragment). It can be produced by proteolytic cleavage. The F (ab ′) 2 fragment contains the variable region, the light chain constant region and the CH1 domain of the heavy chain.

For example, the antibodies of the present invention can be generated using various phage display methods known in the art. In the phage display method, these functional antibody domains are displayed on the surface of a phage particle carrying a polynucleotide sequence encoding the functional antibody domain. As a specific embodiment, such phages can be utilized to display antigen binding domains expressed from a repertoire (eg, human or murine) or combinatorial antibody library. Phages that express an antigen binding domain that binds the antigen of interest can be selected or identified using the antigen (eg, using a labeled antigen or antigen bound or captured to a solid surface or bead, etc.). The phage used in these methods is typically a filamentous phage containing fd and M13, and the binding domain is a Fab, Fv or disulfide stabilized Fv antibody domain is a phage gene III protein or phage gene VIII protein. Expressed in a recombinantly fused state to the phage. Examples of phage display methods that can be utilized to generate the antibodies of the present invention include Brinkman et al ., J. Immunol . Methods 182: 41-50 (1995), Ames et al ., J. Immunol . Methods 184: 177. -186 (1995), Kettleborough et al . , Eur. J. Immunol. 24: 952-958 (1994), Persic et al., Gene 187: 9-18 (1997), Burton et al., Advances in Immunology 57: 191-280 (1994) ), PCT application PCT / GB91 / 01134, PCT publications WO90 / 02809, WO91 / 10737, WO92 / 01047, WO92 / 18619, WO93 / 11236, WO95 / 15982, WO95 / 20401, and US Pat. Nos. 5,698,426, 5,223,409 No. 5,403,484, No. 5,580,717, No. 5,427,908, No. 5,750,753, No. 5,821,047, No. 5,571,698, No. 5,427,908, No. 5,516,637, No. 5,780,225, No. 5,658,727, No. 5,733,743 and No. 5,969,108 There are disclosed methods, each of which is incorporated herein by reference in its entirety.

As described in the above references, after phage selection, for example, as detailed below, the antibody coding region is isolated from the phage and used to make whole antibodies, including human antibodies, or any other Can be produced and expressed in any desired host, such as mammalian cells, insect cells, plant cells, yeast and bacteria. For example, PCT publication WO 92/22324, Mullinax et al., BioTechniques 12 (6): 864-869 (1992), Sawai et al., AJRI 34: 2634 (1995), and Better et al., Science 240: 1041-1043 (1988) (these) For recombinant production of Fab, Fab ′ and F (ab ′) 2 fragments using methods known in the art, such as those disclosed in US Pat. Technology can also be used. Examples of techniques that can be utilized to produce single chain Fv and single chain antibodies include US Pat. Nos. 4,946,778 and 5,258,498, Huston et al., Methods in Enzymology 203: 46-88 (1991), Techniques described in Shu et al., PNAS 90: 7995-7999 (1993), and Skerra et al., Science 240: 1038-1040 (1988).

For some applications, such as in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use chimeric, humanized or human antibodies. A chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Methods for producing chimeric antibodies are known in the art. For example, Morrison, Science 229: 1202 (1985), Oi et al., BioTechniques 4: 214 (1986), Gillies et al. (1989) J. Immunol. Methods 125: 191-202, Cabilly et al. , Taniguchi et al., EP171496, Morrison et al., EP173494, Neuberger et al., WO8601533, Robinson et al., WO8702671, Boulianne et al., Nature 312: 643 (1984), Neuberger et al., Nature 314: 268 (1985), US Pat. No. 5,807,715, No. See, for example, 4,816,567 and 4,816,397. A humanized antibody is an antibody molecule derived from a non-human species that binds a desired antigen, having one or more complementarity determining regions (CDRs) derived from a non-human species and a framework region derived from a human immunoglobulin molecule. To alter (preferably improve) antigen binding, framework residues in the human framework regions will often be replaced with the corresponding residue from the CDR donor antibody. These framework substitutions are identified at specific positions by methods well known in the art, such as identifying framework residues important for antigen binding by modeling the interaction of CDRs with framework residues, and by sequence comparison. Such as by Queen et al., US Pat. No. 5,585,089 and Riechmann et al., Nature 332: 323 (1988), which are hereby incorporated by reference in their entirety. I want to be) Antibodies can be produced, for example, by CDR grafting (EP239,400, PCT publication WO91 / 09967, US Pat. Nos. 5,225,539, 5,530,101 and 5,585,089), veneering or resurfacing (EP592,106, EP519). , 596, Padlan, Molecular Immunology 28 (4/5): 489-498 (1991), Studnicka et al., Protein Engineering 7 (6): 805-814 (1994), Roguska et al., PNAS 91: 969-973 (1994) ), And chain shuffling (US Pat. No. 5,565,332) and the like, and can be humanized using various techniques known in the art. Generally, one or more amino acid residues having a non-human origin have been introduced into a humanized antibody. These non-human amino acid residues are often referred to as “import” residues, which are typically taken from an “import” variable domain. Humanization is basically performed by the method of Winter and its collaborators (Jones et al., Nature , 321: 522-525 (1986), Riechmann et al., Nature , 332: 323-327 (1988), Verhoeyen et al., Science , 239: 1534-1536 (1988)) by replacing the corresponding sequence of a human antibody with a rodent CDR or CDR sequence. Accordingly, such “humanized” antibodies are chimeric antibodies (US Pat. No. 4,816,567) in which a much smaller portion than the fully human variable domain is replaced with the corresponding sequence from a non-human species. In practice, humanized antibodies typically replace some CDR residues and possibly some FR residues with residues from similar sites in rodent antibodies. It is a human antibody.

Generally, a humanized antibody has at least one CDR region that all or substantially all corresponds to the same region of a non-human immunoglobulin, and all or substantially all of the FR region is the same region of a human immunoglobulin consensus sequence. It will contain substantially all of the (typically two) variable domains. A humanized antibody optimally will also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones et al., Nature , 321: 522-525 (1986)). Riechmann et al., Nature 332: 323-329 (1988) and Presta, Curr. Op. Struct. Biol. , 2: 593-596 (1992)).

For therapeutic treatment of human patients, antibodies that are fully human antibodies are particularly desirable. Human antibodies can be produced by a variety of methods known in the art, including the phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also U.S. Pat. Nos. 4,444,887 and 4,716,111 and PCT publications WO98 / 46645, WO98 / 50433, WO98 / 24893, WO98 / 16654, WO96 / 34096, WO96 / 33735 and WO91 / 10741. Each of these documents is incorporated herein by reference in its entirety. The technology of Cole et al. And Boerder et al. Can also be used to produce human monoclonal antibodies (Cole et al. “Monoclonal Antibodies and Cancer Therapy” Alan R. Riss (1985) and Boerner et al. , J. Immunol. , 147 (1): 86-95 (1991)).

  Human antibodies are not capable of expressing functional endogenous immunoglobulins, but can also be produced using transgenic mice capable of expressing human immunoglobulin genes. For example, human heavy and light chain immunoglobulin gene complexes can be introduced randomly or by homologous recombination into mouse embryonic stem cells. Alternatively, human variable regions, constant regions and diversity regions may be introduced into mouse embryonic stem cells along with human heavy and light chain genes. The mouse heavy and light chain immunoglobulin genes can be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, homozygous deletion of the JH region prevents endogenous antibody production. The modified embryonic stem cells are expanded and microinjected into a blastocyst to produce a chimeric mouse. The chimeric mice are then mated to produce homozygous offspring that express human antibodies. The transgenic mice are immunized as usual with the selected antigen, eg, all or part of a polypeptide of the invention. Monoclonal antibodies against the antigen can be obtained from immunized transgenic mice using conventional hybridoma technology. The human immunoglobulin transgene carried by the transgenic mouse rearranges during B cell differentiation and then undergoes class switching and somatic mutation. Accordingly, such techniques can be used to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this human antibody production technique, see Lonberg and Huszar, Int. Rev. Immunol. 13: 65-93 (1995). A detailed discussion regarding this human antibody and human monoclonal antibody production technique and the protocol for producing such an antibody can be found, for example, in PCT publications WO98 / 24893, WO92 / 01047, WO96 / 34096, WO96 / 33735, European Patent 0598877. U.S. Pat. (Incorporated herein in its entirety). In addition, Abgenix, Inc. (Fremont, Calif.), Genpharm (San Jose, Calif.), And Medarex, Inc. (New Jersey) are used to provide human antibodies to selected antibodies using techniques similar to those described above. You can also contract with companies such as Princeton.

Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, such as mice, in which the endogenous immunoglobulin genes are partially or completely inactivated. Upon challenge, human antibody production is observed that is very similar to that seen in humans in all respects, including gene rearrangement, assembly, and generation of an antibody repertoire. This approach is described, for example, in US Pat. Nos. 5,545,807, 5,545,806, 5,569,825, 5,625,126, 5,633,425, 5,661,106, and the following scientific literature: Marks et al . , Biotechnol. , 10: 779-783 (1992), Lonberg et al., Nature 368: 856-859 (1994), Fishwild et al., Nature Biotechnol. , 14: 845-51 (1996), Neuberger, Nature Biotechnol. , 14: 826 (1996), Lonberg And Huszer, Intern. Rev. Immunol. , 13: 65-93 (1995).

Antibodies that are fully human antibodies that recognize selected epitopes can be generated using a technique called “guided selection”. In this approach, selected non-human monoclonal antibodies, such as mouse antibodies, are used to guide the selection of antibodies that are fully human antibodies that recognize the same epitope (Jespers et al., Bio / technology 12: 899-903 (1988)). ).

In addition, antibodies against the polypeptides of the present invention can now be used to generate anti-idiotypic antibodies that “mimic” the polypeptides of the present invention using techniques well known to those of skill in the art (eg, Greenspan and Bona, FASEB J. 7 (5): 437-444 (1989) and Nissinoff, J. Immunol. 147 (8): 2429-2438 (1991)). For example, by using an antibody that binds to the polypeptide of the present invention and competitively inhibits polypeptide multimerization and / or binding of the polypeptide to a ligand, and / or Alternatively, the binding domain can be “mimicked” resulting in the generation of an anti-idiotype that binds to and neutralizes the polypeptide and / or its ligand. Such neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic measures to neutralize polypeptide ligands. For example, such anti-idiotype antibodies can be used to block its biological activity by binding a polypeptide of the invention and / or binding its ligand / receptor.

  Such anti-idiotype antibodies capable of binding to MGAT3 polypeptide can be produced in a two-step process. Such a method takes advantage of the fact that the antibody is the antigen itself and therefore it is possible to obtain an antibody that binds to the second antibody. In this method, protein-specific antibodies are used to immunize animals, preferably mice. Next, hybridoma cells are produced using the spleen cells of such animals, and the hybridoma cells are screened to produce antibodies capable of blocking the ability to bind to the protein-specific antibody by the polypeptide. Identify clones. Such antibodies include anti-idiotype antibodies against the protein specific antibodies and can be used to immunize animals to induce the formation of additional protein specific antibodies.

  The antibody of the present invention may be a bispecific antibody. Bispecific antibodies are monoclonal (preferably human or humanized) antibodies that have binding specificities for at least two different antigens. In the present invention, one of the binding specificities is the specificity for the polypeptide of the present invention, and the other is any other antigen, preferably a cell surface protein, receptor, receptor subunit, tissue-specific antigen, virus-derived protein Specificity for an envelope protein encoded by a virus, a protein derived from a bacterium, a surface protein of a bacterium, or the like.

Methods for producing bispecific antibodies are known in the art. Traditionally, recombinant production of bispecific antibodies is based on the co-expression of two pairs of immunoglobulin heavy / light chains, where the two heavy chains have different specificities (Milstein and Cuello, Nature , 305: 537-539 (1983)). Due to the random combination of immunoglobulin heavy and light chains, these hybridomas (quadromas) potentially produce a mixture of 10 antibody molecules, only one of which has the correct bispecific structure. Purification of the correct molecule is usually performed by an affinity chromatography step. Similar approaches are disclosed in WO93 / 08829 (published May 13, 1993) and Traunecker et al., EMBO J. , 10: 3655-3659 (1991).

Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. This fusion is preferably with an immunoglobulin heavy chain constant region comprising at least part of the hinge, CH2, and CH3 regions. It is preferred that the first heavy chain constant region (CH1) containing the site necessary for light chain binding be present in at least one of the fusions. DNA encoding the immunoglobulin heavy chain fusion and, if necessary, DNA encoding the immunoglobulin light chain are inserted into separate expression vectors and used to cotransform a suitable host organism. For further details regarding the generation of bispecific antibodies see, for example, Suresh et al., Methods in Enzym. 121: 210 (1986).

  Heteroconjugate antibodies are also encompassed by the present invention. Heteroconjugate antibodies are composed of two covalently linked antibodies. Such antibodies are proposed, for example, for targeting immune system cells to unwanted cells (US Pat. No. 4,676,980) and also for treating HIV infection (WO91 / 00360, WO92 / 00373, EP03089). Has been. These antibodies could be produced in vitro using known methods of synthetic protein chemistry, for example using crosslinkers. For example, immunotoxins can be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate, and the reagents disclosed in, for example, US Pat. No. 4,676,980.

  The present invention further provides polynucleotides comprising the nucleotide sequences encoding the antibodies of the present invention and fragments thereof. The present invention relates to an antibody that binds specifically to a polypeptide of the present invention, preferably SEQ ID NO: 2, preferably under stringent hybridization conditions or low stringency hybridization conditions as defined above. Also included are polynucleotides that hybridize to polynucleotides that encode antibodies that bind to polypeptides having amino acid sequences.

These polynucleotides can be obtained by any method known in the art and their nucleotide sequences determined. For example, if the nucleotide sequence of an antibody is known, the polynucleotide encoding that antibody can be assembled from chemically synthesized oligonucleotides (eg, as described in Kutmeier et al., BioTechniques 17: 242 (1994)). it can. Briefly, in this method, overlapping oligonucleotides containing a portion of the antibody-encoding sequence are synthesized, the oligonucleotides annealed and ligated, and then the ligated oligonucleotides are amplified by PCR.

  Alternatively, a polynucleotide encoding the antibody may be generated from nucleic acid derived from a suitable nucleic acid source. Although clones containing nucleic acid encoding a particular antibody are not available, if the sequence of the antibody molecule is known, the nucleic acid encoding the immunoglobulin can be chemically synthesized or an appropriate nucleic acid source (eg, An antibody cDNA library, or any tissue or cell that expresses the antibody, such as a cDNA library made from a hybridoma cell selected to express an antibody of the present invention, or a single cell from such a tissue or cell Oligonucleotide probes specific to the gene sequence from isolated nucleic acids, preferably poly A + RNA), using synthetic primers that can hybridize to the 3 'and 5' ends of the sequence For example, a cDNA clone encoding the antibody is cDNA live. By identifying the Li can be obtained. In that case, the amplified nucleic acid generated by PCR can be cloned into a replicable cloning vector using methods well known in the art.

  Once the nucleotide sequence of the antibody and the corresponding amino acid sequence have been determined, nucleotide sequence manipulation methods well known in the art, such as recombinant DNA techniques, site-directed mutagenesis, PCR and the like (eg, Sambrook et al. “Molecular Cloning, A Laboratory Manual (See techniques described in 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1990) and Ausubel et al., “Current Protocols in Molecular Biology” (John Wiley & Sons, New York, 1998)). Can be used to produce antibodies with different amino acid sequences, for example, resulting in amino acid substitutions, deletions, and / or insertions.

  As a specific embodiment, the heavy chain and / or by determining the sequence hypervariable region by methods well known in the art, for example, by comparison with known amino acid sequences of other heavy and light chain variable regions. Alternatively, the amino acid sequence of the light chain variable domain can be examined to identify the sequence of the complementarity determining region (CDR). Using routine recombinant DNA technology, one or more CDRs can be inserted into a framework region, eg, into a human framework region, to humanize a non-human antibody as described above. The framework region may be a natural or consensus framework region, preferably a human framework region (for a list of human framework regions, see eg, Chothia et al., J. Mol. Biol. 278: 457-479 (1998)) See). The polynucleotide produced by the combination of the framework region and the CDR preferably encodes an antibody that specifically binds the polypeptide of the present invention. Preferably, as described above, one or more amino acid substitutions can be made in the framework regions, and those amino acid substitutions preferably improve the binding of the antibody to its antigen. In addition, antibody molecules lacking one or more interchain disulfide bonds can be obtained by performing amino acid substitutions or deletions of one or more variable region cysteine residues that participate in interchain disulfide bonds using such methods. It can also be produced. Other modifications to the polynucleotide are also possible in the art and are encompassed by the present invention.

In addition, a technology developed to produce a “chimeric antibody” by joining a gene derived from a mouse antibody molecule having an appropriate antigen specificity with a gene derived from a human antibody molecule having an appropriate biological activity (Morrison Proc. Natl. Acad. Sci. , 81: 851-855 (1984), Neuberger et al., Nature 312: 604-608 (1984), Takeda et al., Nature 314: 452-454 (1985)). Can do. As described above, a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region, such as a humanized antibody.

Alternatively, techniques described for the production of single chain antibodies (US Pat. No. 4,946,778, Bird, Science 242: 423-42 (1988), Huston et al., Proc. Natl. Acad. Sci. USA 85: 5879-5883 ( 1988), and Ward et al., Nature 334: 544-54 (1989)) can also be adapted for the production of single chain antibodies. Single chain antibodies are formed by linking heavy and light chain fragments of the Fv region by amino acid bridges to form single chain polypeptides. Techniques for assembling functional Fv fragments in E. coli can also be used (Skerra et al., Science 242: 1038-1041 (1988)).

  More preferably, the clone encoding the antibody of the present invention can be obtained according to the method described in the Examples of the present specification.

  The antibodies of the invention can be produced by any antibody synthesis method known in the art, in particular by chemical synthesis or preferably by recombinant expression techniques.

  Recombinant expression of an antibody of the invention or a fragment, derivative or analogue thereof (eg, heavy or light chain of the antibody of the invention or single chain antibody of the invention) contains a polynucleotide encoding the antibody. It is necessary to construct an expression vector. Once a polynucleotide encoding the antibody molecule of the present invention, or the heavy chain or light chain of the antibody of the present invention or a part thereof (preferably containing a heavy chain or light chain variable domain) is obtained, recombinant DNA method Thus, a vector for antibody molecule production can be produced using techniques well known in the art. Accordingly, described herein is a method for producing a protein by expressing a polynucleotide containing a nucleotide sequence encoding an antibody. Methods which are well known to those skilled in the art can be used to construct expression vectors containing the antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Accordingly, the present invention provides a replicable vector comprising a nucleotide sequence encoding an antibody molecule of the present invention or a heavy or light chain or heavy or light chain variable domain thereof operably linked to a promoter. Such vectors may comprise a nucleotide sequence encoding the constant region of the antibody molecule (see, eg, PCT publication WO86 / 05807, PCT publication WO89 / 01036 and US Pat. No. 5,122,464), and the entire heavy or light chain The antibody variable domains may be cloned into such vectors.

  After introducing the expression vector into a host cell by a conventional technique, the transfected cell is cultured by a conventional technique to produce the antibody of the present invention. Accordingly, the present invention includes host cells comprising a polynucleotide encoding an antibody of the invention or a heavy or light chain thereof or a single chain antibody of the invention operably linked to a heterologous promoter. As a preferred embodiment for the expression of a double chain antibody, the vectors encoding heavy and light chains can be co-expressed in a host cell to express the entire immunoglobulin molecule, as described in detail below.

A variety of host-expression vector systems may be utilized to express the antibody molecules of the invention. Such a host-expression system represents a medium that can be used to create a coding sequence of interest and then purify it, but when further transformed or transfected with an appropriate nucleotide coding sequence. Also represents a cell capable of expressing an antibody molecule of the invention in situ. These include microorganisms such as recombinant bacteriophage DNA containing antibody coding sequences, bacteria transformed with plasmid DNA or cosmid DNA expression vectors (eg E. coli, Bacillus subtilis), recombinant yeast expression containing antibody coding sequences Yeast transformed with a vector (eg, Saccharomyces, Pichia), an insect cell line infected with a recombinant viral expression vector containing an antibody coding sequence (eg baculovirus), a recombinant viral expression vector containing an antibody coding sequence ( Plant cell lines infected with, for example, cauliflower mosaic virus CaMV, tobacco mosaic virus TMV), plant cell lines transformed with recombinant plasmid expression vectors containing antibody coding sequences (eg Ti plasmids), or mammalian cell genomes Promoters derived from (eg Mammalian cell lines (eg, COS, CHO, BHK, 293, 3T3 cells) that carry a recombinant expression construct containing a metallothionein promoter) or a mammalian virus-derived promoter (eg, adenovirus late promoter, vaccinia virus 7.5K promoter), etc. There are, but are not limited to these. For the expression of the recombinant antibody molecule, preferably a bacterial cell such as Escherichia coli, more preferably a eukaryotic cell (especially when expressing the whole recombinant antibody molecule) is used. For example, combining mammalian cells such as Chinese hamster ovary cells (CHO) with vectors such as the major intermediate early gene promoter sequence from human cytomegalovirus provides an effective antibody expression system (Foecking et al., Gene 45: 101 (1986), Cockett et al., Bio / Technology 8: 2 (1990)).

In bacterial systems, several expression vectors can be advantageously selected depending upon the use intended for the antibody molecule being expressed. For example, if a large amount of such protein is to be produced to produce a pharmaceutical composition of antibody molecules, a vector that expresses a high level of fusion protein product that is easy to purify would be desirable. Such vectors include, for example, the E. coli expression vector pUR278 (Ruther et al., EMBO J.) , which can individually ligate antibody coding sequences to the lacZ coding region in reading frame to produce a fusion protein . 2: 1791 (1983)), pIN vectors (Inouye and Inouye, Nucleic Acids Res. 13: 3101-3109 (1985), Van Heeke and Schuster, J. Biol. Chem. 24: 5503-5509 (1989)) There are, but are not limited to these. A pGEX vector can also be used to express a foreign polypeptide as a fusion protein with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can be easily purified from lysed cells by adsorption and binding to matrix glutathione-agarose beads followed by elution in the presence of free glutathione. Since the pGEX vector is designed to include a thrombin cleavage site or a factor Xa protease cleavage site, the cloned target gene product can be released from the GST moiety.

  In insect systems, Autographa californica nuclear polyhedrosis virus (AcNPV) can be used as a vector for expressing foreign genes. The virus grows in Spodoptera frugiperda cells. Antibody coding sequences can be individually cloned into nonessential regions (eg, polyhedrin gene) of the virus and placed under the control of an AcNPV promoter (eg, polyhedrin promoter).

In mammalian host cells, several viral-based expression systems are available. In cases where an adenovirus is used as an expression vector, the antibody coding sequence of interest can be ligated to an adenovirus transcription / translation control complex (eg, the late promoter and tripartite leader sequence). This chimeric gene can then be inserted into the adenovirus genome by in vitro recombination or in vivo recombination. Insertion into a non-essential region of the viral genome (eg, E1 or E3 region) will produce viable recombinant viruses capable of expressing antibody molecules in infected hosts (eg, Logan and Shenk, Proc . Natl. Acad. Sci. USA 81: 355-359 (1984)). Specific initiation signals may be required for efficient translation of the inserted antibody coding sequence. These signals include the ATG start codon and adjacent sequences. In addition, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure that the entire insert is translated. These exogenous translational control signals and initiation codons can have a variety of origins and can be naturally occurring or synthetic. Expression efficiency can be improved by including appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., Methods in Enzymol. 153: 51-544 (1987)).

  In addition, a host cell strain can be selected that modulates the expression of the inserted sequences in a particular desired manner, or a host cell strain that modifies and processes the gene product in a particular desirable manner. Such modifications (eg glycosylation) and processing (eg cleavage) of protein products may be important for protein function. Host cells have distinct and specific mechanisms for post-translational processing and post-translational modification of proteins. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To achieve this goal, eukaryotic host cells with cellular mechanisms for proper processing of primary transcripts, glycosylation and phosphorylation of gene products can be used. Such mammalian host cells include, for example, CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, WI38, and particularly breast cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT20, and T47D, and, for example, CRL7030 And normal breast cell lines such as, but not limited to, Hs578Bst.

  Stable expression is preferred for long-term, high-yield production of recombinant proteins. For example, a cell line that stably expresses an antibody molecule can be designed. Instead of using an expression vector containing a viral origin of replication, transform host cells with DNA and selectable markers controlled by appropriate expression control elements (eg, promoters, enhancer sequences, transcription terminators, polyadenylation sites, etc.) can do. After introduction of the foreign DNA, the engineered cells may be grown in a nutrient enriched medium for 1-2 days and then switched to a selective medium. The selectable marker in the recombinant plasmid confers resistance to selection, allows cells to grow until the plasmid is stably integrated into its chromosome and forms a growth foci, and they are cloned into cell lines. Can be grown. This method can be advantageously used to produce cell lines that express antibody molecules. Such engineered cell lines can be particularly useful for screening and evaluation of compounds that interact directly or indirectly with antibody molecules.

Several selection systems can be used. For example, herpes simplex virus thymidine kinase gene (Wigler et al., Cell 11: 223 (1977)), hypoxanthine-guanine phosphoribosyltransferase gene (Szybalska and Szybalski, Proc. Natl. Acad. Sci. USA 48: 202 (1992)) And the adenine phosphoribosyltransferase gene (Lowy et al., Cell 22: 817 (1980)) can be used in, but not limited to, tk ⁻ , hgprt ⁻ or aprt ⁻ cells, respectively. Antimetabolite resistance can also be used as a basis for selection for the following genes: dhfr conferring resistance to methotrexate (Wigler et al., Natl . Acad . Sci . USA 77: 357 (1980), O'Hare Proc. Natl. Acad. Sci. USA 78: 1527 (1981)), gpt conferring resistance to mycophenolic acid (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78: 2072 (1981)), Neo conferring resistance to aminoglycoside G-418 (Clinical Pharmacy 12: 488-505, Wu and Wu, Biotherapy 3: 87-95 (1991), Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32: 573-596 (1993) ), Mulligan, Science 260: 926-932 (1993), Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993), May, 1993, TIB TECH 11 (5): 155-215), and Hygro conferring resistance to hygromycin (Santerre et al., Gene 30: 147 (1984)). For selection of desired recombinant clones, methods widely known in the technical field of recombinant DNA technology can be applied routinely, and such methods are incorporated herein by reference in their entirety, for example. Ausubel et al. “Current Protocols in Molecular Biology” (John Wiley & Sons, New York, 1993), Kriegler “Gene Transfer and Expression, A Laboratory Manual” (Stockton Press, New York, 1990), Dracopoli et al. “Current Protocols in Human Genetics "(John Wiley & Sons, New York, 1994), Chapters 12 and 13, Colberre-Garapin et al., J. Mol. Biol. 150: 1 (1981) and the like.

Expression levels of antibody molecules can be increased by vector amplification (for an overview, “The use of vectors based on gene amplification for the expression” by Bebbington and Hentschel in “DNA cloning”, Volume 3 (Academic Press, New York, 1987). of cloned genes in mammalian cells ”(see Use of Gene Amplification-Based Vectors to Express Cloned Genes in Mammalian Cells)). If the marker in the vector system that expresses the antibody is amplifiable, increasing the level of inhibitor present in the host cell culture will increase the copy number of the marker gene. Since the amplified region is associated with the antibody gene, the amount of antibody produced will also increase (Crouse et al . , Mol. Cell. Biol. 3: 257 (1983)).

A host cell may be simultaneously transfected with two expression vectors of the present invention, one vector encoding a heavy chain derived polypeptide and the other vector encoding a light chain derived polypeptide. These two vectors can contain the same selectable marker so that the expression levels of the heavy and light chain polypeptides are equal. Alternatively, a single vector encoding both heavy and light chain polypeptides and capable of expressing them can be used. In such cases, the light chain should be placed in front of the heavy chain (Proudfoot, Nature 322: 52 (1986), Kohler, Proc. Natl. Acad. Sci ) so that there is no excess of toxic free heavy chain . USA 77: 2197 (1980)). The heavy and light chain coding sequences may include cDNA or genomic DNA.

  Once the antibody molecule of the present invention has been produced by an animal, chemically synthesized, or recombinantly expressed, it can be purified by any immunoglobulin molecule purification method known in the art, eg, chromatography (eg: Purified by ion exchange, affinity, especially by affinity for specific antigen after protein A, and size fractionation column chromatography), centrifugation, fractional lysis, or any other standard protein purification technique it can. Furthermore, the antibodies of the invention or fragments thereof can be fused to heterologous polypeptide sequences as described herein or known in the art to facilitate purification.

The invention includes recombinant fusion or chemistry to a polypeptide of the invention (or a portion thereof, preferably 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide). In general, an antibody that is conjugated (including both covalent and non-covalent conjugation) to form a fusion protein is included. The fusion does not necessarily have to be a direct fusion, but may be a fusion via a linker sequence. The antibody may be specific for an antigen other than a polypeptide of the invention (or a portion thereof, preferably 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide). Good. For example, an antibody can be used to target a polypeptide of the invention to a particular cell type in vitro or in vivo by fusing or conjugating the polypeptide of the invention to an antibody specific for a particular cell surface receptor. Can be used. Antibodies fused or conjugated to the polypeptides of the invention may be used in in vitro immunoassays and purification methods using methods known in the art. See, eg, Harbor et al. (Supra) and PCT publication WO 93/21232, EP 439,095, Naramura et al . , Immunol. Lett . 39: 91-99 (1994), US Pat. No. 5,474,981, incorporated by reference herein in its entirety . PNAS 89: 1428-1432 (1992), Fell et al., J. Immunol. 146: 2446-2452 (1991).

The invention further encompasses compositions comprising a polypeptide of the invention fused or conjugated to an antibody domain other than the variable region. For example, a polypeptide of the invention can be fused or conjugated to an antibody Fc domain or a portion thereof. The antibody portion fused to a polypeptide of the invention can comprise a constant region, hinge region, CH1 domain, CH2 domain, and CH3 domain, or any combination of whole domains or portions thereof. The polypeptide may be fused or conjugated to the above antibody portion to form a multimer. For example, the Fc portion fused to the polypeptide of the present invention can form a dimer by a disulfide bond between the Fc portions. By fusing polypeptides to portions of IgA and IgM, more sophisticated multimeric forms can be made. Methods for fusing or conjugating a polypeptide of the present invention to an antibody moiety are known in the art. For example, U.S. Pat . Natl.Acad.Sci.USA 88: 10535-10539 (1991), Zheng et al., J.Immunol 154:. 5590-5600 (1995 ), and Vil et al., Proc.Natl.Acad.Sci.USA 89: 11337-11341 (1992), which are hereby incorporated by reference in their entirety.

As noted above, a polypeptide corresponding to the polypeptide, polypeptide fragment, or variant of SEQ ID NO: 2 is used to increase the in vivo half-life of the polypeptide or using methods known in the art. The antibody portion can be fused or conjugated for use in a separate immunoassay. Furthermore, the polypeptide corresponding to SEQ ID NO: 2 can be fused or conjugated to the above antibody portion to facilitate purification. One reported example describes a chimeric protein consisting of the first two domains of a human CD4 polypeptide and various domains of the mammalian immunoglobulin heavy or light chain constant region (EP394, 827, Traunecker et al., Nature 331: 84-86 (1988)). In addition, polypeptides of the invention fused or conjugated to disulfide-linked antibodies (by IgG) bind other molecules more efficiently than monomeric secreted proteins or protein fragments alone. There is a possibility of neutralization (Fountoulakis et al . , J. Biochem. 270: 3958-3964 (1995)). In many cases, the Fc moiety in the fusion protein is useful for therapy and diagnosis, for example, can result in improved pharmacokinetic properties (EP A 232,262). It may also be desirable to delete the Fc portion after the fusion protein is expressed, detected and purified. For example, if the fusion protein is used as an antigen for immunization, the Fc portion may interfere with therapy and diagnosis. In drug discovery, human proteins such as hIL-5 are fused to the Fc moiety for the purpose of, for example, high-throughput screening assays to identify hIL-5 antagonists (Bennett et al., J. Molecular Recognition 8: 52-58 (1995), Johanson et al . , J. Biol. Chem. 270: 9459-9471 (1995)).

Furthermore, the antibody of the present invention or a fragment thereof can be fused to a marker sequence such as a peptide for facilitating purification. In a preferred embodiment, the marker amino acid sequence is a hexahistidine peptide. This is a tag provided in vectors (many of which are commercially available) including the pQE vector (QIAGEN, Inc., Chatsworth Eaton Avenue 9259, CA). For example, as described in Gentz et al., Proc. Natl. Acad. Sci. USA 86: 821-824 (1989), the use of hexahistidine simplifies purification of the fusion protein. Other peptide tags useful for purification include, for example, the “HA” tag (Wilson et al., Cell 37: 767 (1984)), which corresponds to an epitope derived from influenza hemagglutinin protein, and the “flag” tag. It is not limited to these.

Furthermore, the present invention also includes an antibody or fragment thereof conjugated to a diagnostic or therapeutic agent. An antibody can be used diagnostically, for example, for the purpose of monitoring tumor development or progression as part of a clinical trial to determine the efficacy of a treatment method. Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals using various positron tomography methods, non-radioactive paramagnetic metal ions, etc. Can be mentioned. The detectable substance can be conjugated directly to the antibody (or fragment thereof) using techniques known in the art, or indirectly via an intermediate (such as a linker known in the art). Can be ring or conjugated. For example, see US Pat. No. 4,741,900 for metal ions that can be conjugated to antibodies used as diagnostics in accordance with the present invention. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase, and examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin Examples of fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phyroerythrin, examples of luminescent materials include luminol, and bioluminescent materials Examples of these include luciferase, luciferin and aequorin, and examples of suitable radioactive materials include ¹²⁵ I, ¹³¹ I, ¹¹¹ In, or ⁹⁹ Tc.

In addition, the antibody or fragment thereof may be conjugated to a therapeutic moiety such as a cytotoxin (eg, cytostatic or cytocidal), therapeutic agent, or radioactive metal ion, eg, an alpha emitter such as ²¹³ Bi. A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracindione, mitoxantrone, mitromycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and its analogs or homologs. Therapeutic agents include, for example, antimetabolites (eg, methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, decarbazine), alkylating agents (eg, mechlorethamine, thiotepa, chlorambucil, melphalan, carmustine (BSNU) and Lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamineplatinum (DDP) cisplatin), anthracyclines (eg, daunorubicin (formerly called daunomycin) And doxorubicin), antibiotics (eg dactinomycin (formerly called actinomycin), bleomycin, mitramycin, and anthramycin (AMC)), and mitotic fraction Such as, but not limited to, crack inhibitors (eg, vincristine and vinblastine).

The conjugates of the invention can be used to modify a given biological response. The therapeutic or drug moiety should not be construed as limited to classic chemotherapeutic agents. For example, the drug moiety can be a protein or polypeptide having the desired biological activity. Such proteins include toxins such as abrin, ricin A, Pseudomonas exotoxin, or diphtheria toxin, or proteins such as tumor necrosis factor, α-interferon, β-interferon, nerve growth factor, platelet derived growth factor, tissue Plasminogen activator, apoptotic agent such as TNF-alpha, TNF-beta, AIM I (see International Publication No. WO97 / 33899), AIM II (see International Publication No. WO97 / 34911), Fas ligand (Takahashi et al., Int . Immunol) . 6: 1567-1574 (1994)), see VEGI (International Publication No. WO99 / 23105), thrombotic agent (thrombotic agent) or anti-angiogenic agent, e.g., angiostatin or endostatin, or biological response modifiers, e.g. Lymphokine, interleukin-1 (“IL-1”), interleukin-2 (“IL-2”), interleukin-6 (“IL-6”) ), Granulocyte macrophage colony stimulating factor (“GM-CSF”), granulocyte colony stimulating factor (“G-CSF”), or other growth factors.

  The antibodies can be bound to a solid support, which is particularly useful for immunoassay or purification of the target antigen. Such solid supports include, but are not limited to, for example, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.

  Techniques for conjugating such therapeutic moieties to antibodies are well known. For example, “Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy” described in pages 243 to 56 of “Monoclonal Antibodies And Cancer Therapy” (Alan R. Liss, Inc., 1985) edited by Reisfeld et al. Monoclonal antibodies for immunotargeting ”,“ Controlled Drug Delivery ”edited by Robinson et al. (2nd edition, Marcel Dekker, Inc., 1987), pages 623-53,“ Antibodies For Drug Delivery ” (Antibodies for drug delivery) ", Pinchera et al.," Monoclonal Antibodies '84: Biological And Clinical Applications "(1985), pages 475-506," Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A " Review (Antibody carrier for cytotoxic agents in cancer therapy: overview) "," Monoclonal Antibodies For Cancer Detection And Therapy "edited by Baldwin et al. (Academic Press, 1985), pages 303-16," Analysis, Results, And Future Prospective O f The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy ”, and Thorpe et al.,“ The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates ”. Conjugate production and cytotoxicity) "Immunol. Rev. 62: 119-58 (1982).

  Alternatively, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate, as described by Segal in US Pat. No. 4,676,980, which is incorporated herein by reference in its entirety.

  Antibodies administered alone or in combination with cytotoxic factors and / or cytokines should be used as therapeutic agents, both with and without a therapeutic moiety attached Can do.

The invention also includes the production of synthetic antibodies to the polypeptides of the invention. An example of a synthetic antibody is described in Radrizzani, M. et al., Medicina , (Aires), 59 (6): 753-8 (1999). Recently, a new class of synthetic antibodies has been described and is called molecularly imprinted polymer (MIP) (Semorex, Inc.). Antibodies, peptides and enzymes are often used as molecular recognition elements in chemical and biological sensors. However, they lack stability and do not have a signal transmission mechanism, so their utility as a detection device is limited. Molecularly imprinted polymers (MIP) have the ability to mimic the function of biological receptors, but with less stability constraints. With such a polymer, high sensitivity and selectivity can be obtained while maintaining excellent thermal stability and mechanical stability. MIP has the ability to bind small molecules and target molecules such as organics and proteins, and its potency is equal to or greater than that of natural antibodies. These “super” MIPs have higher affinity for the target, so effective binding can be achieved at lower concentrations.

  MIP complements a selected target during synthesis by using the target molecule itself (eg, polypeptide, antibody, etc.) or a substance with a very similar structure as its “print” or “template”. Imprinted with a typical size, shape, charge and functionality. MIP can be modified with the same reagents as for antibodies. For example, fluorescent “super” MIPs can be coated onto beads or wells and used for sensitive separations or assays, or for high-throughput screening of proteins.

Furthermore, MIP based on the structure of the polypeptide of the present invention may be useful for screening compounds that bind to the polypeptide of the present invention. Such MIPs may serve as a synthetic “receptor” by mimicking the native structure of the polypeptide. In fact, the ability of MIP to act as a synthetic receptor has already been demonstrated for estrogen receptors (Ye, L., Yu, Y., Mosbach, K., Analyst. , 126 (6): 760-5 (2001), Dickert, FL, Hayden, O., Halikaias, KP, Analyst. , 126 (6): 766-71 (2001)). Synthetic receptors can be mimicked in their native form (eg as a whole protein) or as a series of short peptides corresponding to the protein (Rachkov, A., Minoura, N., Biochim. Biophys. Acta. , 1544 (1-2): 255-66 (2001)). Such synthetic receptor MIPs can be used in any one or more screening methods described elsewhere herein.

MIP has also been shown to help "detect" the presence of mimicked molecules (Cheng, Z., Wang, E., Yang, X., Biosens. Bioelectron. , 16 (3): 179-85 ( 2001), Jenkins, AL, Yin, R., Jensen, JL, Analyst. , 126 (6): 798-802 (2001), Jenkins, AL, Yin, R., Jensen, JL, Analyst. , 126 (6 ): 798-802 (2001)). For example, MIPs designed using the polypeptides of the present invention can be used in assays designed to identify and in some cases quantitate the level of the polypeptide in the sample. Such MIPs can be used as a substitute for the components described in the assays or kits (eg, ELISA, etc.) provided by the present invention.

Several methods can be used to generate MIPs for specific receptors, ligands, polypeptides, peptides, organic molecules. Esteban et al . , J. Anal. Chem. , 370 (7): 795-802 (2001), which is incorporated herein by reference in its entirety with the references cited therein. Some are listed. For example, Hart, BR, Shea, KJ, J. Am. Chem. Soc . , 123 (9): 2072-3 (2001) and Quaglia, M., Chenon, K., which are incorporated herein by reference in their entirety. Other methods such as Hall, AJ, De, Lorenzi, E., Sellergren, B., J. Am. Chem. Soc . , 123 (10): 2146-54 (2001) are also known in the art. And are encompassed by the present invention.

The antibodies of the present invention have a variety of uses. For example, such antibodies can be used in diagnostic assays to detect the presence of a polypeptide of the invention in a sample or to quantify the polypeptide of the invention in a sample. Such a diagnostic assay can include at least two steps. First, the sample is exposed to the antibody. In this case, the sample is a tissue (for example, a tissue such as a human or an animal), a biological fluid (for example, blood, urine, sputum, semen, amniotic fluid, saliva, etc.), a biological extract (for example, a tissue homogenate or a cell homogenate, etc. ), Protein microchips (see, eg, Arenkov P. et al., Anal Biochem. , 278 (2): 123-131 (2000)), or chromatography columns. In the second step, the antibody bound to the substrate is quantified. Alternatively, the method further comprises a first step of covalently, electrostatically or reversibly binding the antibody to the solid support and the bound antibody as defined above and other And a second step of exposing the sample as defined in the section.

Various diagnostic assay techniques are known in the art, such as competitive binding assays performed in heterogeneous or homogeneous phases, direct or indirect sandwich assays, and immunoprecipitation assays (Zola “Monoclonal Antibodies: A Manual of Techniques "(CRC Press, Inc., 1987), pages 47-158). An antibody used in a diagnostic assay can be labeled with a detectable moiety. The detectable moiety should have the ability to generate a detectable signal directly or indirectly. For example, the detectable moiety can be a radioisotope such as ² H, ¹⁴ C, ³² P, or ¹²⁵ I, a fluorescent or chemiluminescent compound such as fluorescein isothiocyanate, rhodamine, or luciferin, or alkaline phosphatase, beta-galactosidase, green It can be an enzyme such as a fluorescent protein or horseradish peroxidase. Methods for conjugating antibodies to detectable moieties and known in the art are Hunter et al., Nature, 144: 945 (1962), Dafvid et al., Biochem., 13: 1014 (1974), Pain. Et al., J. Immunol. Metho., 40: 219 (1981) and Nygren, J. Histochem. And Cytochem., 30: 407 (1982). .

  Antibodies against the polypeptides of the invention are useful for affinity purification of such polypeptides from recombinant cell culture or natural sources. In this method, an antibody against a specific polypeptide is immobilized on a suitable support, such as a Sephadex resin or filter paper, using methods well known in the art. The immobilized antibody is then contacted with a sample containing the polypeptide to be purified, and then substantially all of the present in the sample other than the desired polypeptide bound to the immobilized antibody. The support is washed with a solvent suitable for removing material. Finally, the support is washed with another solvent suitable for releasing the desired polypeptide from the antibody.

The antibody of the present invention can be used for immunophenotyping of cell lines and biological samples. The translation product of the gene of the present invention can serve as a cell-specific marker, more specifically as a cell marker that is differentially expressed at various differentiation and / or maturation stages of a particular cell type. Monoclonal antibodies against a specific epitope or combination of epitopes will allow screening of cell populations that express the marker. By using various techniques, a monoclonal antibody can be used to screen a cell population that expresses a marker. Such techniques include magnetic separation using antibody-coated magnetic beads, “panning” with antibodies bound to a solid matrix (ie, plate), flow cytometry, etc. (eg, US Pat. No. 5,985,660, and Morrison). Et al., Cell , 96: 737-49 (1999)).

  These techniques allow screening of specific cell populations, such as screening for cell populations that may be found associated with hematologic malignancies (ie, minimal residual disease (MRD) in patients with acute leukemia), and graft-versus-host disease ( For example, screening for “non-self” cells in transplantation to prevent (GVHD). Alternatively, these techniques also allow screening for hematopoietic stem and progenitor cells that have the ability to proliferate and / or differentiate as may be found in human umbilical cord blood.

  The antibodies of the invention can be assayed for immunospecific binding by any method known in the art. Immunoassays that can be used include, for example, Western blot, radioimmunoassay, ELISA (enzyme-linked immunosorbent assay), “sandwich” immunoassay, immunoprecipitation assay, precipitation reaction, gel diffusion precipitation reaction, immunodiffusion assay, aggregation assay , Complement binding assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, and other competitive and non-competitive assay systems using other techniques. Such assays are routine assays and are well known in the art (eg, “Current Protocols in Molecular Biology” edited by Ausubel et al., Vol. 1, John Wiley & Sons, Inc., New York, 1994)). Representative immunoassays are briefly described below (although these are not intended to be limiting).

  In an immunoprecipitation protocol, a cell population is generally divided into RIPA buffer (1% NP-40 or Triton X-100, for example, supplemented with protein phosphatases and / or protease inhibitors (eg EDTA, PMSF, aprotinin, sodium vanadate, etc.). 1% sodium deoxycholate, 0.1% SDS, 0.15M NaCl, 0.01M sodium phosphate, pH 7.2, 1% tradirol) and so on, add the antibody of interest to the cell lysate, Incubate at 4 ° C for a period of time (eg 1-4 hours), add protein A and / or protein G sepharose beads to the cell lysate, incubate at 4 ° C for about 1 hour or more, wash the beads with lysis buffer, Resuspend the beads in SDS / sample buffer. The ability of the antibody of interest to immunoprecipitate a particular antigen can be assessed, for example, by Western blot analysis. One skilled in the art will be familiar with parameters that can be adjusted to increase antibody binding and reduce background (eg, pre-clarification of cell lysates with Sepharose beads). For further discussion regarding immunoprecipitation protocols, see, for example, 10.16.1 of Ausubel et al., “Current Protocols in Molecular Biology” (Volume 1, John Wiley & Sons, Inc., New York, 1994).

In Western blot analysis, a protein sample is generally prepared, the protein sample is electrophoresed on a polyacrylamide gel (for example, 8% to 20% SDS-PAGE depending on the molecular weight of the antigen), and the protein sample is nitrogenated from the polyacrylamide gel. Transfer to a membrane such as cellulose, PVDF or nylon, block the membrane with blocking solution (eg PBS with 3% BSA or skim milk), wash the membrane with wash buffer (eg PBS-Tween 20) and block Block membrane with primary antibody (antibody of interest) diluted in buffer, wash membrane with wash buffer, and conjugate to enzyme substrate (eg horseradish peroxidase or alkaline phosphatase) or radioactive molecule (eg ³² P or ¹²⁵ I) Secondary antibody (primary The membrane is blocked with an antibody recognizing antibody (for example, an anti-human antibody) diluted in a blocking buffer, the membrane is washed with a washing buffer, and the presence of the antigen is detected. Those skilled in the art will be familiar with parameters that can be adjusted to increase the detected signal and reduce background noise. See, for example, 10.8.1 of Ausubel et al., “Current Protocols in Molecular Biology” (Vol. 1, John Wiley & Sons, Inc., New York, 1994) for further discussion on Western blot protocols.

  In ELISA, an antigen is prepared, a well of a 96-well microtiter plate is coated with the antigen, and an antibody of interest conjugated to a detectable compound such as an enzyme substrate (eg, horseradish peroxidase or alkaline phosphatase) is added to the well. Incubate for a period of time to detect the presence of antigen. In ELISA, it is not necessary to conjugate the antibody of interest to a detectable compound; instead, a secondary antibody conjugated to the detectable compound (recognizing the antibody of interest) is placed in the well. May be added. Further, instead of coating the well with the antigen, the antibody may be coated to the well. In this case, a secondary antibody conjugated to a detectable compound can be added after the antigen of interest is added to the coated well. Those skilled in the art will be familiar with parameters that can be adjusted to increase the signal detected, as well as other variations of ELISAs known in the art. For further discussion on ELISA, see, eg, 11.2.1 of Ausubel et al., “Current Protocols in Molecular Biology” (Volume 1, John Wiley & Sons, Inc., New York, 1994).

The binding affinity of the antibody for the antigen and the off-rate of the antibody-antigen interaction can be determined by competitive binding assays. An example of a competitive binding assay is one in which a labeled antigen (eg ³ H or ¹²⁵ I) is incubated with an antibody of interest in the presence of an increasing series of unlabeled antigens to detect antibody bound to the labeled antigen. Immunoassay. The affinity of the antibody of interest for a particular antigen and the rate of binding dissociation can be determined from the data by Scatchard plot analysis. Competition with the second antibody can also be determined using a radioimmunoassay. In this case, the antigen is incubated with an antibody of interest conjugated to a labeled compound (eg, ³ H or ¹²⁵ I) in the presence of an increasing series of amounts of unlabeled second antibody.

  The present invention further provides an antibody comprising administering an antibody of the present invention to an animal, preferably a mammal, most preferably a human patient to treat one or more of the diseases, disorders, or conditions disclosed herein. Directed to treatment based. The therapeutic compounds of the present invention include, for example, the antibodies of the present invention (including fragments, analogs and derivatives thereof described herein) and nucleic acids encoding the antibodies of the present invention (fragments thereof, similar to those described herein). Body and derivatives as well as anti-idiotype antibodies). An antibody of the invention includes a disease, disorder or condition associated with abnormal expression and / or activity of the polypeptide of the invention (including but not limited to any one or more of the diseases, disorders or conditions described herein). Not) can be used for treatment, suppression or prevention. Treatment and / or prevention of a disease, disorder or condition associated with aberrant expression and / or activity of a polypeptide of the invention includes, for example, alleviation of symptoms associated with those diseases, disorders or conditions. It is not limited to. The antibodies of the present invention can be provided in pharmaceutically acceptable compositions known in the art or described herein.

  To summarize the therapeutic use of the antibodies of the invention, the polynucleotides or polypeptides of the invention can be bound locally or systemically in the body, for example by complement (CDC) or by effector cells ( ADCC) -mediated antibody direct cytotoxicity. Some of these approaches are described in more detail below. Using the teachings herein, one of ordinary skill in the art will know how to use the antibodies of the invention for diagnostic, monitoring or therapeutic purposes without undue experimentation.

  The antibodies of the present invention may be used in combination with other monoclonal or chimeric antibodies, or lymphokines or hematopoietic growth factors (eg, IL-2, IL-) that act to increase the number or activity of effector cells that interact with the antibody, for example. 3 and IL-7) can be used advantageously.

  The antibodies of the present invention may be administered alone or in combination with other types of treatments (eg, radiation therapy, chemotherapy, hormone therapy, immunotherapy and anti-tumor agents). In general, it is preferred to administer a product derived from the same species as the patient or a product having the same species reactivity (in the case of antibodies) as the patient. Thus, as a preferred embodiment, human antibodies, fragments, derivatives, analogs or nucleic acids are administered to human patients for treatment or prevention.

Both the immunoassay for the polynucleotides or polypeptides of the invention (including fragments thereof) and the treatment of disorders associated with the polynucleotides or polypeptides of the invention (including fragments thereof) It is preferred to use antibodies that have a high affinity for peptides or polynucleotides or fragments or regions thereof and / or have strong inhibitory and / or neutralizing effects in vivo. Such an antibody, fragment or region will preferably have an affinity for a polynucleotide or polypeptide of the invention (including fragments thereof). Preferred binding affinities include dissociation constants or Kd of 5 × 10 ⁻² M, 10 ⁻² M, 5 × 10 ⁻³ M, 10 ⁻³ M, 5 × 10 ⁻⁴ M, 10 ⁻⁴ M, 5 × 10 ^-5 M, 10 ^-5 M, 5 × 10 ^-6 M, 10 ^-6 M, 5 × 10 ^-7 M, 10 ^-7 M, 5 × 10 ^-8 M, 10 ^-8 M, 5 × 10 ^-9 M, 10 ^-9 M, 5 x 10 ^-10 M, 10 ^-10 M, 5 x 10 ^-11 M, 10 ^-11 M, 5 x 10 ^-12 M, 10 ^-12 M, 5 x 10 ^-13 M, 10 ⁻¹³ M, 5 × 10 ⁻¹⁴ M, 10 ⁻¹⁴ M, 5 × 10 ⁻¹⁵ M, and those that are less than 10 ⁻¹⁵ M.

  Antibodies against the polypeptides of the invention are useful for inhibiting allergic reactions in animals. For example, by administering a therapeutically acceptable dose of one or more antibodies of the invention, or a cocktail of the antibodies, or administering them in combination with other antibodies from various sources, the animal May not trigger an allergic reaction to.

  In addition, a gene encoding an antibody against the polypeptide of the present invention having the potential to induce an allergic and / or immune response in the body of an organism is cloned, and the antibody gene is expressed in the antibody gene so that the antibody gene is expressed. It is also conceivable to transform an organism (eg constitutively or inductively). In this way, the organism will become effectively resistant to allergic reactions due to ingestion or presence of immune / allergic reactive polypeptides. Furthermore, such use of the antibody of the present invention may be particularly effective for the prevention and / or amelioration of autoimmune diseases and / or disorders. This is because such conditions are typically the result of antibodies directed against endogenous proteins. For example, if the polypeptide of the present invention is responsible for modulating the immune response to a self-antigen, either a promoter disclosed herein or another promoter known in the art and an antibody against the polypeptide of the present invention By transforming the organism and / or individual with a construct comprising a polynucleotide that encodes, it would be possible to effectively inhibit the organism from eliciting an immune response against the self-antigen. The application of the present invention to therapy and / or gene therapy will be described in detail again in this specification.

  Alternatively, the antibody of the present invention is produced in a plant (eg, the gene of an antibody against the polypeptide of the present invention is cloned and the plant is transformed with a vector containing said gene suitable for constitutive expression of said antibody in the plant. Then, the animal could be given transient immunity against the specific antigen targeted by the antibody (eg, US Pat. Nos. 5,914,123 and 6,034,298).

  In another embodiment, the antibody of the present invention, preferably a polyclonal antibody, more preferably a monoclonal antibody, most preferably a single chain antibody is selected from genes of one or more specific genes in humans, mammals and / or other organisms. It can be used as a means of inhibiting expression. See for example Dow Agrosciences LLC International Publication No. 00/05391 (published February 3, 2000). The application of such methods to the antibodies of the invention is known in the art and is described in further detail elsewhere in this specification.

  In yet another embodiment, the antibodies of the invention can also serve to multimerize the polypeptides of the invention. For example, certain proteins, when multimeric, may increase biological activity (ie, increase the effective concentration of the protein so that more protein is available locally). Such an increase in activity can occur).

  In one specific embodiment, a sequence encoding an antibody or functional derivative thereof is included to treat, suppress or prevent a disease or disorder associated with aberrant expression and / or activity of a polypeptide of the invention by gene therapy. Nucleic acid is administered. Gene therapy refers to a therapy performed by administration of an expressed or expressible nucleic acid to a subject. In this embodiment of the invention, the nucleic acids produce the proteins that mediate the therapeutic effect they encode.

  Any of the methods of gene therapy that can be utilized in the art can be used according to the present invention. A typical method will be described below.

For a general review of gene therapy, see Goldspiel et al., Clinical Pharmacy 12: 488-505 (1993), Wu and Wu, Biotherapy 3: 87-95 (1991), Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32: 573- 596 (1993), Mulligan, Science 260: 926-932 (1993), and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993), May, TIBTECH 11 (5): 155-215 (1993) Refer to). Methods that are well known and can be used in the field of recombinant DNA technology include “Current Protocols in Molecular Biology” edited by Ausubel et al. (John Wiley & Sons, New York, 1993) and Kriegler “Gene Transfer and Expression, A Laboratory Manual "(Stockton Press, New York, 1990).

In a preferred embodiment, the compound comprises a nucleic acid sequence encoding an antibody, said nucleic acid sequence being part of an expression vector that expresses the antibody or fragment thereof or chimeric protein or heavy or light chain in a suitable host. . In particular, such nucleic acid sequences have a promoter operably linked to the antibody coding region, said promoter being inducible or constitutive and optionally tissue specific. In another specific embodiment, a region that promotes homologous recombination at a desired site in the genome is located on either side of the antibody coding sequence and other desired sequences, so that the region within the chromosome of the antibody-encoding nucleic acid can be Nucleic acid molecules are used that allow expression (Koller and Smithies, Proc. Natl. Acad. Sci. USA 86: 8932-8935 (1989), Zijlstra et al., Nature 342: 435-438 (1989)). In certain specific embodiments, the antibody molecule expressed is a single chain antibody. Alternatively, the nucleic acid sequence includes sequences encoding both the heavy and light chains of an antibody or fragments thereof.

  Delivery of the nucleic acid to the patient can be either directly (in this case exposing the patient directly to the nucleic acid or nucleic acid delivery vector) or indirectly (in this case, after first transforming the cell with the nucleic acid in vitro, then Cells can be transplanted into a patient). These two approaches are called in vivo gene therapy or ex vivo gene therapy, respectively.

In one specific embodiment, the nucleic acid sequence is directly administered in vivo and expressed in vivo to produce the encoded product. This can be done by any of a number of methods known in the art, for example by constructing them as part of a suitable nucleic acid expression vector and administering them so that they enter the cell (for example, By defective or attenuated retrovirus or other viral vectors (see US Pat. No. 4,980,286) or by direct injection of naked DNA, or using microparticle bombardment (eg, gene gun, Biolistic (Dupont)) Or by coating with lipids or cell surface receptors or transfection agents, encapsulation in liposomes, microparticles or microcapsules, or by linking to peptides known to enter the nucleus, or receptors Linking to ligands that undergo endocytosis via To (e.g., Wu and Wu, J.Biol.Chem, 262:. 4429-4432 (1987)) ( this method can be used to target cell types which specifically express the receptors) Etc.) can be achieved. In another embodiment, the nucleic acid-ligand complex can be formed such that the ligand comprises a fusion-inducible viral peptide that disrupts endosomes, allowing the nucleic acid to avoid degradation by lysosomes. In yet another embodiment, nucleic acids can be targeted in vivo such that cell-specific uptake and expression occurs by targeting specific receptors (eg, PCT Publication WO92 / 06180, WO92 / 22635, WO92 / 20316, WO93 / 14188, WO93 / 20221, etc.). Alternatively, nucleic acids can be introduced into cells and incorporated into host DNA by homologous recombination and expressed (Koller and Smithies, Proc. Natl. Acad. Sci. USA 86: 8932-8935 (1989) Zijlstra et al., Nature 342: 435-438 (1989)).

In a specific embodiment, a viral vector containing a nucleic acid sequence encoding an antibody of the invention is used. For example, retroviral vectors can be used (see Miller et al., Meth. Enzymol. 217: 581-599 (1993)). These retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into host cell DNA. Nucleic acid sequences encoding antibodies used for gene therapy are cloned into one or more vectors that facilitate delivery of the gene to the patient. Further details regarding retroviral vectors can be found in Boesen et al., Biotherapy 6: 291-302 (1994). This document describes the use of retroviral vectors to deliver the mdrl gene to hematopoietic stem cells in order to create stem cells with increased resistance to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy include Clowes et al . , J. Clin. Invest. 93: 644-651 (1994), Kiem et al., Blood 83: 1467-1473 (1994), Salmons and Gunzberg, Human Gene Therapy 4: 129-141 (1993) and Grossman and Wilson, Curr. Opin . In Genetics and Devel. 3: 110-114 (1993).

Adenoviruses are also viral vectors that can be used for gene therapy. Adenoviruses are particularly attractive as vehicles for delivering genes to the respiratory epithelium. Adenoviruses originally infect respiratory epithelia where they cause a mild disease. Non-respiratory targets for adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of having the ability to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3: 499-503 (1993) review adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5: 3-10 (1994) demonstrated the introduction of genes into the rhesus monkey respiratory epithelium using adenoviral vectors. Other uses of adenovirus in gene therapy are Rosenfeld et al., Science 252: 431-434 (1991), Rosenfeld et al., Cell 68: 143-155 (1992), Mastrangeli et al . , J. Clin. Invest. 91: 225 -234 (1993), PCT publication WO94 / 12649, and Wang et al., Gene Therapy 2: 775-783 (1995). In a preferred embodiment, an adenoviral vector is used.

It has also been proposed to use adeno-associated virus (AAV) for gene therapy (Walsh et al . , Proc. Soc. Exp. Biol. Med. 204: 289-300 (1993), US Pat. No. 5,436,146).

  In another approach to gene therapy, genes are introduced into cells in tissue culture by methods such as electroporation, lipofection, calcium phosphate transfection, or viral infection. This introduction method usually involves the introduction of a selectable marker into the cell. Next, a selective pressure is applied to the cells to isolate the cells that have taken up and expressed the introduced gene. The cells are then delivered to the patient.

In this embodiment, the resulting recombinant cells are administered in vivo after the nucleic acid is introduced into the cells. Such transfer can be accomplished by any method known in the art, such as transfection, electroporation, microinjection, viral or bacteriophage vectors containing the nucleic acid sequence, cell fusion, chromosomal gene transfer, microcells. Can be carried out by, but not limited to, gene transfer by, spheroplast fusion and the like. Many techniques for introducing foreign genes into cells are known in the art (eg, Loeffler and Behr, Meth. Enzymol . 217: 599-618 (1993), Cohen et al . , Meth. Enzymol . 217: 618-644 ( 1993), Cline, Pharmac. Ther. 29: 69-92m (1985), etc.), as long as the necessary developmental and physiological functions of the recipient cells are not destroyed, they can also be used in the present invention. This technique should be able to stably introduce the nucleic acid into the cell so that the nucleic acid is expressed by the cell, preferably inherited and expressed by its cell progeny.

  The resulting recombinant cells can be delivered to a patient by various methods known in the art. Recombinant blood cells (eg, hematopoietic stem cells or hematopoietic progenitor cells) are preferably administered intravenously. The expected amount of cells used will depend on the desired effect, patient condition, etc. and can be determined by one skilled in the art.

  Cells into which a nucleic acid can be introduced for gene therapy include any desired available cell type, such as epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes, blood cells, E.g. T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes, various stem cells or progenitor cells, in particular hematopoietic stem cells or hematopoietic progenitor cells such as bone marrow, cord blood, peripheral Examples include, but are not limited to, those obtained from blood, fetal liver, and the like.

  In a preferred embodiment, the cells used for gene therapy are self for the patient.

In one embodiment where recombinant cells are used for gene therapy, nucleic acid sequences encoding the antibodies are introduced into the cells such that they are expressed by the cells or their progeny, and then the recombinant cells are administered in vivo. To obtain a therapeutic effect. In a specific embodiment, stem cells or progenitor cells are used. In this embodiment of the invention, any stem and / or progenitor cell that can be isolated and maintained in vitro can potentially be used (eg PCT Publication WO 94/08598, Stemple and Anderson, Cell 71: 973-985 (1992), Rheinwald, Meth. Cell Bio. 21A: 229 (1980), and Pittelkow and Scott, Mayo Clinic Proc. 61: 771 (1986)).

  In one specific embodiment, a nucleic acid introduced for gene therapy is operably linked to a coding region such that the expression of the nucleic acid is controlled by controlling the presence or absence of a suitable transcription inducer. Inducible promoters.

  The compounds or pharmaceutical compositions of the invention are tested in vivo, preferably after testing in vitro, for the desired therapeutic or prophylactic activity prior to use in humans. For example, in vitro assays to demonstrate the therapeutic or prophylactic efficacy of a compound or pharmaceutical composition include the effect of the compound on cell lines or patient tissue samples. The effect of a compound or composition on cell lines and / or patient tissue samples can be determined utilizing techniques known to those skilled in the art, such as rosette formation assays and cell lysis assays. In the present invention, patient tissue samples are grown in culture and exposed to the compound or otherwise administered as an in vitro assay that can be used to determine if administration of a particular compound is indicated. And in vitro cell culture assays that observe the effect of the compound on tissue samples.

  The present invention provides methods for treatment, suppression and prevention by administering to a subject an effective amount of a compound of the present invention or a pharmaceutical composition of the present invention, for example, an antibody of the present invention. In a preferred embodiment, the compound is substantially purified (eg, substantially free from substances that limit its effect or cause undesirable side effects). The subject is preferably an animal, such as but not limited to cows, pigs, horses, chickens, cats, dogs, etc., preferably mammals, most preferably humans.

  Formulations and methods of administration that can be used when the compounds contain nucleic acids or immunoglobulins are described above. Other suitable formulations and administration routes can also be selected from those described below.

For example, encapsulation in liposomes, microparticles, or microcapsules, recombinant cells capable of expressing the compound, receptor-mediated endocytosis (eg, Wu and Wu, J. Biol. Chem. , 262: 4429-4432 (1987)), various delivery systems are known, such as constructing nucleic acids as part of a retrovirus or other vector, and they can be used to administer the compounds of the invention. Examples of the introduction method include (but are not limited to) intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compound or composition can be administered by any convenient route, such as by infusion or bolus injection, or by absorption through epithelial or dermal mucosal linings such as oral mucosa, rectum and intestinal mucosa, etc. Can be administered together with other biologically active agents. Administration can be systemic or local. Furthermore, it may be desirable to introduce the pharmaceutical compound or pharmaceutical composition of the invention into the central nervous system by a suitable route including intraventricular and intrathecal injection. Intraventricular injection can be facilitated by an intraventricular catheter connected to a reservoir, such as, for example, an Ommaya reservoir. For example, pulmonary administration using an inhaler or nebulizer and a formulation containing an aerosolizing agent can also be used.

  As a specific embodiment, it may be desirable to administer the pharmaceutical compound or pharmaceutical composition of the invention locally to the area in need of treatment. This can be done, for example, by local injection during surgery, or by topical application in combination with a wound dressing after surgery, or by injection, using a catheter, or using a suppository, or a membrane such as a silastic membrane or This can be done with, but is not limited to, implants made of porous, non-porous or gel-like materials containing fibers. When administering the proteins (including antibodies) of the present invention, preferably care should be taken to use materials that do not absorb the protein.

In another embodiment, the compound or composition can be delivered in vesicles, particularly liposomes (Langer, Science 249: 1527-1533 (1990), edited by Lopez-Berestein and Fidler, “Liposomes in the See pages 353-365 (Treat et al.), 317-327 (Lopez-Berestein) of the “Therapeutic of Infectious Disease and Cancer” (Liss, New York, 1989). ).

In yet another embodiment, the compound or composition can be delivered in a controlled release system. In one embodiment, a pump can be used (Langer, supra, Sefton, CRC Crit. Ref. Biomed. Eng. 14: 201 (1987), Buchwald et al., Surgery 88: 507 (1980), Saudek et al., N. .Engl.J.Med. 321: 574 (1989)). As another embodiment, polymeric materials can also be used (Langer and Wise, “Medical Applications of Controlled Release” (CRC Pres., Boca Raton, Florida, 1974), Smolen and Ball, “Controlled Drug Bioavailability, Drug Product. Design and Performance "(Wiley, New York, 1984), Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23: 61 (1983), Levy et al., Science 228: 190 (1985), During et al. , Ann.Neurol 25:. 351 (1989 ), Howard et al., J.Neurosurg 71:. 105 (1989 ) see also). In yet another embodiment, a controlled release system can be placed in the vicinity of the therapeutic target, i.e., the brain, so that the required dose is only a fraction of the systemic dose (e.g., “Medical Applications of Controlled Release,” supra). Vol. 115-138 (by Goodson) (1984)).

  Other controlled release systems are discussed in a review by Langer (Science 249: 1527-1533 (1990)).

In a specific embodiment where the compound of the invention is a nucleic acid encoding a protein, the nucleic acid is constructed as part of a suitable nucleic acid expression vector to promote expression of the protein encoded by the nucleic acid, For example, by use of retroviral vectors (see US Pat. No. 4,980,286) or by direct injection or by use of microparticle bombardment (eg gene gun, Biolistic (Dupont)) or lipid or cell surface receptors or transfection agents Or by linking to a homeobox-like peptide known to enter the nucleus (eg Joliot et al., Proc. Natl. Acad. Sci. USA 88: 1864-1868 (1991 )), Etc. so that the nucleic acid is introduced into the cell, thereby administering the nucleic acid in vivo. Rukoto can. Alternatively, a nucleic acid can be introduced into a cell and expressed in a host DNA by homologous recombination.

  The present invention also provides a pharmaceutical composition. Such compositions comprise a therapeutically effective amount of the compound and a pharmaceutically acceptable carrier. In one specific embodiment, the term “pharmaceutically acceptable” is approved by a federal or state government regulatory agency, or veterinary in the United States Pharmacopeia or other generally accepted pharmacopoeia, It means that it is described especially for human use. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water, and oils, including petroleum, animal or vegetable derived oils or synthetic oils, such as arachis oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, nonfat dry milk, glycerol, propylene , Glycol, water, ethanol and so on. The composition can optionally further comprise minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include standard carriers such as pharmaceutical mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate and the like. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E.W.Martin. Such compositions will contain a therapeutically effective amount of the compound, preferably purified, together with a suitable amount of carrier so as to provide a dosage form for proper administration to the patient. . The formulation must be suitable for the mode of administration.

  In a preferred embodiment, the composition is formulated as a pharmaceutical composition adapted for intravenous administration to humans according to conventional methods. Typically, the intravenous composition is a sterile isotonic aqueous buffer solution. If desired, the composition can also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. In general, the ingredients are either individually or mixed together as a unit dosage form, such as a lyophilized powder or anhydrous concentrate in a sealed container such as an ampoule or sachet indicating the amount of active agent. Supplied. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical water or pharmaceutical saline. When the composition is administered by injection, an ampoule of sterile water for injection or saline for injection can be prepared so that the ingredients can be mixed prior to administration.

  The compounds of the present invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed by anions derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, and the like, as well as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, hydroxide Those formed by cations derived from ferric iron, isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine and the like are included.

  The amount of a compound of the invention that will be effective in the treatment, suppression and prevention of a disease or disorder associated with aberrant expression and / or activity of the polypeptide of the invention can be determined by standard clinical techniques. If necessary, an in vitro assay may be used to facilitate confirmation of the optimal dose range. The exact dose used in the formulation will depend on the route of administration and the severity of the disease or disorder, and should be determined according to the judgment of the physician and the circumstances of each patient. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems.

  In the case of antibodies, the dose to the patient is typically 0.1 mg to 100 mg per kg patient body weight. The dosage to the patient is preferably 0.1 mg to 20 mg per kg patient body weight, more preferably 1 mg to 10 mg per kg patient body weight. In general, in the human body, human antibodies have longer half-lives than antibodies derived from other species due to immune responses to foreign polypeptides. Thus, in many cases, human antibodies can reduce dosage and frequency of administration. Furthermore, the dose and frequency of administration of the antibodies of the invention can be reduced by increasing antibody uptake and tissue penetration (eg, brain penetration) by modifications such as lipidation.

  The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the components of the pharmaceutical composition of the present invention. Where necessary, such containers may contain authorities for manufacture, use or sale intended for human administration in a form designated by the governmental body that regulates the manufacture, use or sale of the drug or biological product. A display reflecting the approval of

Diagnostic and imaging with antibodies Labeled antibodies that specifically bind to the polypeptide of interest and fragments and analogs thereof detect diseases, disorders and / or conditions associated with abnormal expression and / or activity of the polypeptides of the invention Can be used for diagnostic purposes to diagnose or monitor. In accordance with the present invention, (a) assaying the expression of a polypeptide of interest in a cell or body fluid of an individual using one or more antibodies specific for the polypeptide of interest, and (b) its gene expression Detection of aberrant expression of the polypeptide of interest, including comparing the level of In this case, an increase or decrease in the polypeptide gene expression level assayed compared to the standard expression level indicates abnormal expression.

  The present invention is a diagnostic assay for diagnosing a disorder comprising: (a) expression of a polypeptide of interest in a cell or body fluid of an individual using one or more antibodies specific for the polypeptide of interest. Assaying and (b) comparing the level of gene expression to a standard gene expression level, wherein an increase or decrease in the assayed polypeptide gene expression level when compared to the standard expression level. Provide diagnostic assays that indicate a particular disorder. In the case of cancer, the presence of a relatively large amount of transcript in a biopsy tissue obtained from an individual indicates a predisposition to the onset of the disease, or the disease is diagnosed before actual clinical symptoms appear. It can be a means for detection. This type of more definitive diagnosis may allow health professionals to take preventive or aggressive treatment earlier, thus preventing the onset or further progression of cancer.

The antibodies of the invention can be used to assay protein levels in biological samples by classical immunohistological methods known to those skilled in the art (see, eg, Jalkanen et al . , J. Cell. Biol. 101 : 976-985 (1985), Jalkanen et al . , J. Cell. Biol. 105: 3087-3096 (1987)). Other antibody-based methods useful for the detection of protein gene expression include immunoassays such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable antibody assay labels are known in the art, such as enzyme labels, such as glucose oxidase, iodine ⁽¹²⁵ I, ¹²¹ I), carbon ⁽¹⁴ C), sulfur ⁽³⁵ S), tritium ⁽³ H), Examples include radioisotopes such as indium ( ¹¹² In) and technetium ( ⁹⁹ Tc), luminescent labels such as luminol, fluorescent labels such as fluorescein and rhodamine, and biotin.

  One aspect of the invention is the detection and diagnosis of a disease or disorder associated with aberrant expression of a polypeptide of interest in an animal, preferably a mammal, most preferably a human. In one embodiment, the diagnosis comprises a) administering an effective amount of a labeled molecule that specifically binds to the polypeptide of interest (eg, parenteral, subcutaneous, or intraperitoneal administration), b) said label Waiting for a period of time following administration, in order to preferentially concentrate molecules to sites in the subject where the polypeptide is expressed (and to remove unbound labeled molecules to background levels), c Detection of a labeled molecule above the background level is associated with abnormal expression of the polypeptide of interest comprising: a) determining a background level; and d) detecting a labeled molecule within the subject. It is intended to indicate that you have a specific disease or disorder. The background level can be determined by various methods, such as comparing the amount of labeled molecule detected to a standard value previously determined for a particular system.

It will be understood in the art that the amount of imaging component required to obtain a diagnostic image depends on the size of the object and the imaging system used. When using radioisotope components, the amount of radioactivity injected will typically range from about 5 to 20 millicuries of ^99m Tc in human subjects. The labeled antibody or antibody fragment will then preferentially accumulate at the cellular site containing the specific protein. For in vivo tumor imaging, see chapter 13 of SWBurchiel and BARhodes, “Tumor Imaging: The Radiochemical Detection of Cancer” (Masson Publishing Inc., 1982), SWBurchiel et al., “Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments and The immunopharmacokinetics of the fragment) ”.

  The post-administration period for preferential enrichment of labeled molecules to sites within the subject and removal of unbound labeled molecules to background levels depends on several variables including the type of label used and the method of administration. 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment, the period after administration is 5-20 days or 5-10 days.

  In certain embodiments, the monitoring of a disease or disorder is by repeating the diagnostic method of the disease or disorder, for example, 1 month after the first diagnosis, 6 months after the first diagnosis, 1 year after the first diagnosis, etc. Done.

  The presence of the labeled molecule in the patient can be detected using in vivo scanning methods known in the art. These methods depend on the type of label used. One skilled in the art will be able to determine a suitable method for detecting a particular label. Methods and apparatus that can be used in the diagnostic method of the present invention include, for example, computer tomography (CT) and whole body scans such as positron tomography (PET), magnetic resonance imaging (MRI), and ultrasound imaging There are, but are not limited to these.

  In one specific embodiment, the molecule is labeled with a radioisotope, and the molecule in the patient is detected using a radiation responsive surgical instrument (Thurston et al., US Pat. No. 5,441,050). In another embodiment, the molecules are labeled with a fluorescent compound and the molecules in the patient are detected using a fluorescence responsive scanning device. In another embodiment, the molecule is labeled with a positron emitting metal and the molecule in the patient is detected using positron tomography. In yet another embodiment, the molecule is labeled with a paramagnetic label and the molecule in the patient is detected using magnetic resonance imaging (MRI).

  The present invention provides kits that can be used in the above methods. In certain embodiments, the kit comprises an antibody of the invention, preferably a purified antibody, in one or more containers. In certain specific embodiments, the kits of the invention comprise a substantially isolated polypeptide having an epitope that specifically immunoreacts with an antibody included in the kit. Preferably, the kit of the invention further comprises a control antibody that does not react with the polypeptide of interest. In another specific embodiment, the kit of the invention comprises means for detecting binding of an antibody to a polypeptide of interest (eg, a substrate capable of detecting the antibody, eg, a fluorescent compound, an enzyme substrate, a radioactive compound or a luminescent compound). Or a second antibody that recognizes the first antibody can be conjugated to a detectable substrate).

  In another specific embodiment of the invention, the kit is a diagnostic kit for serum screening comprising antibodies specific for proliferative and / or cancerous polynucleotides and polypeptides. Such a kit may include a control antibody that does not react with the polypeptide of interest. Such a kit can include a substantially isolated polypeptide antigen comprising an epitope that specifically immunoreacts with at least one anti-polypeptide antigen antibody. In addition, such kits include means for detecting binding of the antibody to the antigen (eg, the antibody can be conjugated to a fluorescent compound such as fluorescein or rhodamine that can be detected by flow cytometry. it can). In a specific embodiment, the kit can include a recombinantly produced or chemically synthesized polypeptide antigen. The polypeptide antigens of this kit can also be attached to a solid support.

  As a more specific embodiment, the detection means of the kit described above includes a solid support on which the polypeptide antigen is attached. Such a kit may further comprise an unattached reporter-labeled anti-human antibody. In this embodiment, antibody binding to the polypeptide antigen can be detected by binding of the reporter-labeled antibody.

  As a further embodiment, the present invention includes a diagnostic kit for serum screening comprising an antigen of the polypeptide of the present invention. The diagnostic kit includes a substantially isolated antibody that specifically immunoreacts with a polypeptide antigen or polynucleotide antigen, and means for detecting binding of the polynucleotide antigen or polypeptide antigen to the antibody. In certain embodiments, the antibody is attached to a solid support. As a specific embodiment, the antibody may be a monoclonal antibody. The detection means of the kit can include a second labeled monoclonal antibody. Alternatively or additionally, the detection means may comprise a labeled competitor antigen.

  In one diagnostic configuration, test serum is reacted with a solid phase reagent having a surface-bound antigen obtained by the method of the present invention. Proportional to the amount of anti-antigen antibody bound to the solid support by binding the antibody to the reagent using a specific antigen, removing unbound serum components by washing, and then reacting the reagent with a reporter-labeled anti-human antibody To bind the reporter to the reagent. The reagent is washed again to remove unbound labeled antibody and the amount of reporter bound to the reagent is determined. A reporter is typically an enzyme that is detected by incubating the solid phase in the presence of a suitable fluorescent, luminescent or chromogenic substrate (Sigma, St. Louis, MO).

  The solid surface reagents described above are made by known techniques for attaching protein material to solid support materials such as polymer beads, immersion test strips, 96-well plates or filter materials. These attachment methods generally involve non-specific adsorption of proteins to the support and typically free to chemically reactive groups (eg, activated carboxyl, hydroxyl, or aldehyde groups) on the solid support. Protein covalent bonds through the amino group of Alternatively, streptavidin-coated plates can be used with biotinylated antigens.

  Accordingly, the present invention provides an assay system or assay kit for performing this diagnostic method. The kit generally includes a support having a recombinant antigen bound to the surface and a reporter-labeled anti-human antibody for detecting the anti-antigen antibody bound to the surface.

  Any of the polypeptides of the invention can be used to make a fusion protein. For example, the polypeptide of the present invention can be used as an antigen tag when fused to a second protein. The second protein can be indirectly detected by binding to the polypeptide using an antibody raised against the polypeptide of the present invention. In addition, certain proteins target cell locations based on transport signals, so the polypeptides of the invention can also be used as targeting molecules when fused to other proteins.

  Examples of domains that can be fused to the polypeptides of the present invention include not only heterologous signal sequences, but also other heterologous functional regions. The fusion does not necessarily have to be a direct fusion, but may be a fusion via a linker sequence.

  Furthermore, the fusion protein may be designed so that the characteristics of the polypeptide of the present invention are improved. For example, a region of additional amino acids, particularly charged amino acids, can be added to the N-terminus of a polypeptide to improve stability and persistence during purification from host cells or subsequent handling and storage. . Peptide moieties may be added to the polypeptide to facilitate purification. Such regions can be removed prior to the final manufacturing process of the polypeptide. It is also possible to introduce a peptide cleavage site between such peptide moieties, which can be further exposed to protease activity to remove the peptide from the protein of the invention. The addition of peptide moieties (including peptide cleavage sites) to facilitate polypeptide handling is well known in the art and is a routine technique.

Further, the polypeptides (including fragments, particularly epitopes) of the present invention may comprise a constant domain component of immunoglobulin (IgA, IgE, IgG, IgM) or a part thereof (CH1, CH2 including whole domain and part thereof) , CH3, and any combination thereof) can be combined into a chimeric polypeptide. These fusion proteins facilitate purification and show an increased in vivo half-life. In one reported example, a chimeric protein is described that consists of the first two domains of a human CD4 polypeptide and various domains of a mammalian immunoglobulin heavy or light chain constant region (EP A 394,827, Traunecker et al., Nature 331: 84-86 (1988)). Fusion proteins with disulfide-linked dimeric structures (by IgG) can also bind and neutralize other molecules more efficiently than monomeric secreted proteins or protein fragments alone (Fountoulakis et al., J. Biochem. 270: 3958-3964 (1995)).

Similarly, EP-AO 464 533 (corresponding Canadian Patent No. 2045869) discloses a fusion protein comprising various portions of the constant region of an immunoglobulin molecule and another human protein or part thereof. In many cases, the Fc portion in the fusion protein is useful for therapy and diagnosis, and can result in improvements such as pharmacokinetic properties (EP-A 0232 262). Alternatively, it may be desirable to delete the Fc portion after the fusion protein is expressed, detected and purified. For example, when a fusion protein is used as an antigen for immunization, the Fc portion can be a therapeutic and diagnostic obstacle. For example, in drug discovery, human proteins such as hIL-5 are fused to the Fc moiety for high-throughput screening assays and used to identify antagonists of hIL-5 (D. Bennett et al., J. Molecular Recognition). 8: 52-58 (1995) and K. Johanson et al., J. Biol . Chem , 270: 9459-9471 (1995)).

Furthermore, the polypeptide of the present invention can be fused to a marker sequence (also referred to as “tag”). Since an antibody specific for such a “tag” is available, an antibody specific for the polypeptide of the present invention is not necessary, and therefore purification and / or identification of the fusion protein of the present invention is not necessary. It becomes quite easy. Such purification can take the form of affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag (eg, an anti-tag antibody attached to the matrix of the flow column). In a preferred embodiment, the marker amino acid sequence is a hexahistidine peptide. This is a tag provided in vectors (many of which are commercially available) including the pQE vector (QIAGEN, Inc., Chatsworth Eaton Avenue 9259, CA). For example, hexahistidine facilitates purification of the fusion protein as described in Gentz et al., Proc. Natl. Acad. Sci. USA 86: 821-824 (1989). The “HA” tag corresponds to an epitope derived from influenza hemagglutinin protein (Wilson et al., Cell 37: 767 (1984)).

One skilled in the art will recognize that there are other “tags” that can be readily used in place of the tags described above for purification and / or identification of the polypeptides of the invention (Jones C. et al., J Chromatogr A.707 (1): 3-22 (1995)). For example, c-myc tag and 8F9, 3C7, 6E10, G4m B7 and 9E10 antibodies (Evan et al., Molecular and Cellular Biology 5: 3610-3616 (1985)), herpes simplex virus glycoprotein D (gD) tag and its antibody (Paborsky et al., Protein Engineering 3 (6): 547-553 (1990)), Flag-peptide, ie octapeptide sequence DYKDDDDK (SEQ ID NO: 24) (Hopp et al . , Biotech. 6: 1204-1210 (1988))), KT3 epitope peptide (Martin et al., Science 255: 192-194 (1992)), α-tubulin epitope peptide (Skinner et al . , J. Biol. Chem. 266: 15136-15166 (1991)), T7 gene 10 protein peptide tag (Lutz-Freyermuth et al., Proc. Natl. Sci. USA 87: 6363-6397 (1990)), FITC epitope (Zymed, Inc.), GFP epitope (Zymed, Inc.), and rhodamine epitope (Zymed, Inc.) Etc.

  The invention also encompasses the binding of up to 9 codons encoding a series of repeating arginine amino acids of up to 9 residues to the coding region of the polynucleotide of the invention. The invention also encompasses chemical derivatization of the polypeptides of the invention with a series of repeating arginine amino acids of up to 9 residues. It has recently been shown that such tags, when attached to a polypeptide, serve as a universal path for compounds to enter the cell without further derivatization or manipulation (Wender, P. et al., Unpublished data).

  Protein fusions involving the polypeptides of the invention (including fragments and / or variants thereof) can be used in the following non-limiting examples: protein subcellular localization, protein-protein by immunoprecipitation Determination of interactions, purification of proteins by affinity chromatography, functional and / or structural characterization of proteins. The invention also encompasses the application of hapten-specific antibodies to any of the uses described above for epitope fusion proteins. For example, a polypeptide of the invention can be chemically derivatized to attach a hapten molecule (eg, DNP (Zymed, Inc.)). Since a monoclonal antibody specific for such a hapten can be obtained, the protein can be easily purified by, for example, immunoprecipitation.

  Polypeptides of the present invention (including fragments and / or variants thereof) and antibodies to such polypeptides, fragments and / or variants may comprise several known toxins and future toxins such as ricin, saporin (Mashiba H et al., Ann.NYAcad.Sci. 1999; 886: 2335) or HC toxin (Tonukari NJ et al., Plant Cell. 2000 Feb; 12 (2): 237-248) Can do. Such fusions could be used to deliver the toxin to the desired tissue where a ligand or protein capable of binding to the polypeptide of the invention is present.

The present invention relates to a fusion of an antibody against a polypeptide of the present invention (including variants and fragments thereof) and said toxin for delivering the toxin to a specific location in a cell, a specific tissue, and / or a specific species. Is included. While such bifunctional antibodies are known in the art, PJ Hudson, Curr. Opp. In. Imm. 11: 548-557 (1999) also discloses other advantageous fusions. This publication is incorporated herein by reference in its entirety, along with the references cited therein. In this case, the term “toxin” refers to any heterologous protein, small molecule, radionuclide, cytotoxic agent, liposome, adhesion molecule, glycoprotein, ligand, cell or tissue specific ligand, enzyme, bioactive agent, biological Response modifiers, antifungal agents, hormones, steroids, vitamins, peptides, peptide analogs, antiallergic agents, antituberculosis agents, antiviral agents, antibiotics, antiprotozoal agents, chelating agents, radioactive particles, radioactive ions, X-rays It can be broadly interpreted to include contrast agents, monoclonal antibodies, polyclonal antibodies and genetic material. In light of this specification, one of ordinary skill in the art will be able to determine whether a particular “toxin” can be used in a compound of the invention. Examples of suitable “toxins” listed above are merely exemplary and are not intended to limit the “toxins” that can be used in the present invention.

  Any of these above fusions can be produced using the polynucleotides or polypeptides of the invention.

  The invention also relates to vectors, host cells, and recombinant polypeptide production containing the polynucleotides of the invention. The vector can be, for example, a phage, plasmid, virus, or retroviral vector. Retroviral vectors may have replication ability or may be replication defective. In the latter case, viral propagation will generally occur only in complementing host cells.

  The polynucleotide can be conjugated to a vector containing a selectable marker for propagation in the host. In general, plasmid vectors are introduced as a precipitate, such as a calcium phosphate precipitate, or as a complex with a charged lipid. If the vector is a virus, it can be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.

  The polynucleotide insert is operable in any suitable promoter such as, but not limited to, the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the SV40 early and late promoters, and the retrovirus LTR promoter. Should be linked. Other suitable promoters will be known to those skilled in the art. The expression construct will further contain a transcription initiation and termination site, and the transcribed region will contain a ribosome binding site for translation. The coding portion of the transcript expressed by these constructs will preferably include a translation start codon at the beginning and a stop codon (UAA, UGA or UAG) appropriately positioned at the end of the translated polypeptide. .

  As noted above, the expression vector will preferably include at least one selectable marker. Such markers include dihydrofolate reductase, G418 or neomycin resistance genes for eukaryotic cell culture, and tetracycline, kanamycin or ampicillin resistance genes for culture in E. coli and other bacteria. Representative examples of suitable hosts include bacterial cells such as E. coli, Streptomyces and Salmonella typhimurium cells, yeast cells (eg, Saccharomyces cerevisiae or Pichia pastoris ( Pichia pastoris: ATCC accession number 201178)) fungal cells, insect cells such as Drosophila S2 cells and Spodoptera Sf9 cells, animal cells such as CHO, COS, 293, Bowes melanoma cells, and There are plant cells, but it is not limited to these. Suitable culture media and culture conditions for the above-described host cells are known in the art.

  Preferred for bacteria are pQE70, pQE60 available from QIAGEN, Inc., and pBluescript vector, Phagescript vector, pNH8A, pNH16a, pNH18A, pNH46A available from pQE9, Stratagene Cloning Systems, Inc. As well as ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5, etc., available from Pharmacia Biotech, Inc. Preferred eukaryotic vectors include pWLNEO, pSV2CAT, pOG44, pXT1, and pSG available from Stratagene, and pSVK3, pBPV, pMSG, pSVL available from Pharmacia. Preferred expression vectors for use in yeast systems include pYES2, pYD1, pTEF1 / Zeo, pYES2 / GS, pPICZ, pGAPZ, pGAPZalph, pPIC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K, pPIC9K, And PA0815 (both available from Invitrogen, Carlsbad, Calif.), But are not limited to these. Other suitable vectors will be apparent to those skilled in the art.

  Introduction of the construct into the host cell can be accomplished by calcium phosphate transfection, DEAE-dextran transfection, cationic lipid transfection, electroporation, transduction, infection, and other methods. Such methods are described in many standard laboratory publications such as Davis et al. “Basic Methods In Molecular Biology” (1986). It is contemplated that the polypeptides of the present invention may actually be expressed by host cells that do not have a recombinant vector.

  Polypeptides of the invention are well known including ammonium sulfate precipitation or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography. By this method, it can be recovered from the recombinant cell culture and purified. Most preferably, it is purified using high performance liquid chromatography ("HPLC").

  The polypeptide of the invention, preferably its secreted form, can also be recovered from: body fluids, tissues and cells, whether directly isolated or cultured Products purified from natural sources, chemical synthesis products, and products produced by recombinant techniques from prokaryotic or eukaryotic hosts such as bacteria, yeast, higher plants, insects, and mammalian cells. Depending on the host used in the recombinant production method, the polypeptide of the present invention may or may not be glycosylated. The polypeptides of the present invention may also initially include a modified methionine residue, optionally as a result of a process by the host. For example, it is well known in the art that the N-terminal methionine encoded by the translation initiation codon is generally removed with high efficiency after translation in any eukaryotic cell. The N-terminal methionine of most proteins is efficiently removed by most prokaryotes, but for some proteins this prokaryotic removal process depends on the nature of the amino acid to which the N-terminal methionine is covalently attached. Is insufficient.

In one embodiment, the yeast Pichia pastoris is used to express a polypeptide of the invention in a eukaryotic system. Pichia pastoris is a methylotrophic yeast that can metabolize methanol as the sole carbon source. The main step in the methanol metabolic pathway is the oxidation of methanol to formaldehyde using O ₂ . This reaction is catalyzed by the enzyme alcohol oxidase. In order to metabolize methanol as the sole carbon source, Pichia pastoris must produce high levels of alcohol oxidase, in part due to the relatively low affinity of alcohol oxidase for O ₂ . Therefore, in a growth medium that relies on methanol as the main carbon source, the activity of the promoter region of one of the two alcohol oxidase genes (AOX1) is significantly higher. Alcohol oxidase produced from the AOX1 gene in the presence of methanol accounts for up to about 30% of the total soluble protein of Pichia pastoris. Ellis, SB et al . , Mol. Cell. Biol. 5: 1111-21 (1985), Koutz, PJ, et al., Yeast 5: 167-77 (1989), Tschopp, JF et al. , Nucl. Acids Res. 15: 3859- See 76 (1987). Thus, heterologous coding sequences that undergo transcriptional regulation of all or part of the AOX1 regulatory sequences, such as the polynucleotides of the present invention, are expressed at exceptionally high levels in Pichia yeast grown in the presence of methanol.

  As an example, using the plasmid vector pPIC9K, DNA encoding the polypeptide of the present invention described herein can be ligated to essentially DR Higgins and J. Cregg, “Pichia Protocols: Methods in Molecular Biology” (The Humana Press , Totowa, NJ, 1998) and expressed in the Pichia yeast system. This expression vector allows the expression and secretion of the protein of the invention by a strong AOX1 promoter linked to a Pichia pastoris alkaline phosphatase (PHO) secretion signal peptide (ie leader) located upstream of the multicloning site.

  Those skilled in the art will readily recognize that many other yeast vectors, such as pYES2, pYD1, pTEF1 / Zeo, pYES2 / GS, pPICZ, pGAPZ, pGAPZalpha, pPIC9, pPIC3.5, pHIL-D2 instead of pPIC9K. , PHIL-S1, pPIC3.5K, and PAO815 can also be used as long as signals such as transcription, translation, and (optionally) secretion (including in-frame AUG, if necessary) are in place it can.

  In another embodiment, high level expression of a heterologous coding sequence, e.g., a polynucleotide of the invention, can be performed by cloning the heterologous polynucleotide of the invention into an expression vector, e.g., pGAPZ or pGAPZalpha, and It can also be achieved by growing in the absence.

The present invention not only encompasses host cells with the vector constructs discussed herein, but is engineered to delete or replace endogenous genetic material (eg, coding sequences) and / or From a vertebrate engineered to contain genetic material (eg, a heterologous polynucleotide sequence) that activates, modifies and / or amplifies an endogenous polynucleotide operably linked to a polynucleotide of the invention, Also encompassed are primary, secondary and immortalized host cells, especially from mammals. For example, using techniques known in the art, a heterologous regulatory region (eg, a promoter and / or enhancer) and an endogenous polynucleotide sequence are operably linked by homologous recombination to form a new transcription unit. (Eg, US Pat. No. 5,641,670 issued June 24, 1997, US Pat. No. 5,733,761 issued March 31, 1998, WO 96/29411 published September 26, 1996). No. 94/12650 published August 4, 1994, Koller et al., Proc. Natl. Acad. Sci. USA 86: 8932-8935 (1989), and Zijlstra et al., Nature 342: 435-438 ( 1989), etc. Each publication is incorporated herein by reference in its entirety.

  Polypeptides of the invention can also be chemically synthesized using techniques known in the art (eg, Creighton “Proteins: Structures and Molecular Principles” (WHFreeman & Co., New York, 1983) and Hunkapiller et al. , Nature, 310: 105-111 (1984)). For example, a polypeptide corresponding to a fragment of the polypeptide sequence of the present invention can be synthesized using a peptide synthesizer. Furthermore, if desired, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the polypeptide sequence. Non-classical amino acids include, for example, D-isomers of common amino acids, 2,4-diaminobutyric acid, α-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, γ-Abu, ε-Ahx, 6 -Aminohexanoic acid, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, Designer amino acids such as cyclohexylamine, β-alanine, fluoroamino acids, β-methylamino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogs in general, but are not limited to these. Furthermore, the amino acid may be D (dextrorotatory) or L (left-handed).

  The invention can be used during or after translation, for example, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, conjugation to antibody molecules or other cellular ligands, etc. Includes polypeptides that are differentially modified. Numerous chemical modifications, such as cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, specific chemical cleavage by NaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin Etc. (but not limited to these).

  Other post-translational modifications encompassed by the present invention include, for example, N-linked or O-linked carbohydrate chains, N-terminal or C-terminal processing, attachment of chemical moieties to the amino acid backbone, N-linked or O-linked These include chemical modification of the conjugated carbohydrate chain and addition or deletion of the N-terminal methionine residue that occurs as a result of prokaryotic host cell expression. Polypeptides include detectable labels such as enzymes, fluorescence, isotope labels, affinity labels, and epitope-tagged peptide fragments (eg, FLAG, HA, GST, thioredoxin, maltose binding proteins, etc.) that allow detection and isolation of proteins ), Attachment of affinity tags such as biotin and / or streptavidin, covalent attachment of chemical moieties to the amino acid backbone, N- or C-terminal processing of polypeptide ends (eg proteolytic processing), N-terminal methionine residues It can also be modified by deletion or the like.

  The present invention also provides chemically modified derivatives of the polypeptide of the present invention that have new advantages, such as increased polypeptide solubility, stability and circulation time, or decreased immunogenicity (see US Pat. No. 4,179,337). The chemical moiety for derivatization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol / propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like. Polypeptides can be modified at random positions within the molecule, or can be modified at predetermined positions within the molecule, and one, two, three or more chemical moieties can be attached to the polypeptide.

  The invention further encompasses chemical derivatives of the polypeptides of the invention, preferably wherein the chemical moiety is a hydrophilic polymer residue. Typical hydrophilic polymers (including derivatives) include polymers with repeating units containing one or more hydroxy groups (polyhydroxy polymers), such as poly (vinyl alcohol), polymers with repeating units containing one or more amino groups (polyamines) Polymers), such as peptides, polypeptides, proteins and lipoproteins, such as albumin and natural lipoproteins, etc., polymers containing one or more carboxy groups (polycarboxy polymers), such as carboxymethylcellulose, alginic acid and its salts, such as alginic acid Sodium and calcium alginate, glycosaminoglycans and salts thereof, such as hyaluronic acid salts, phosphorylated and sulfated derivatives of carbohydrates, genetic material such as interleukin-2 and interferon, and phosphoro Oh benzoate oligomers, and repeating units polymers containing one or more sugar moieties (polysaccharide polymers), it can be mentioned, for example, carbohydrates.

  The molecular weight of the hydrophilic polymer can vary and is generally about 50 to about 5,000,000, with polymers having a molecular weight of about 100 to about 50,000 being preferred. The polymer may be branched or unbranched. More preferred polymers have a molecular weight of about 150 to about 10,000, with a molecular weight of 200 to about 8,000 being even more preferred.

  In the case of polyethylene glycol, the preferred molecular weight is from about 1 kDa to about 100 kDa in terms of ease of handling and manufacture. (The term “about” is used in polyethylene glycol preparations where some molecules are larger Heavy, indicating that some molecules are lighter than the indicated molecular weight). Desired therapeutic profile (eg desired duration of sustained release, effects on biological activity, if any, ease of handling, degree or lack of antigenicity, other known effects of polyethylene glycol on therapeutic proteins or analogs Other sizes may also be used.

  Other preferred polymers that can be used to derivatize the polypeptides of the invention include, for example, poly (ethylene glycol) (PEG), poly (vinyl pyrrolidone), polyoxomers, polysorbates, and poly (vinyl alcohol). PEG is particularly preferred. Of the PEG polymers, PEG polymers having a molecular weight of about 100 to about 10,000 are preferred. More preferably, the PEG polymer has a molecular weight of about 200 to about 8,000, with PEG 2,000, PEG 5,000 and PEG 8,000 having molecular weights of 2,000, 5,000 and 8,000, respectively, being more preferred. In addition to those exemplified above, other suitable hydrophilic polymers will be apparent to those skilled in the art based on this specification. In general, the polymers used can include polymers to which the polypeptides of the invention can be attached by alkylation or acylation reactions.

  The polyethylene glycol molecule (or other chemical moiety) should be attached to the protein in view of its effect on the functional or antigenic domain of the protein. A number of attachment methods are available to those skilled in the art. For example, EP 0 401 384 (PEG coupling to G-CSF), incorporated herein by reference, Malik et al., Exp. Hematol. 20: 1028-1035 (1992) (GM- using tresyl chloride) See CSF PEGylation. For example, polyethylene glycol can be covalently linked through amino acid residues by reactive groups such as free amines or carboxyl groups. A reactive group is a group that can bind an activated polyethylene glycol molecule. Examples of amino acid residues having free amino acids include lysine residues and N-terminal amino acid residues. Examples of amino acid residues having free carboxyl groups include aspartic acid residues, glutamic acid residues and C-terminal amino acid residues. Residues can be mentioned. Sulfhydryl groups may also be utilized as reactive groups for attachment of polyethylene glycol molecules. For therapeutic purposes, attachment to an amino group is preferred, such as attachment to the N-terminus or lysine residue.

  In some cases, a protein with a chemically modified N-terminus may be particularly desirable. When using polyethylene glycol as an example of this composition, various polyethylene glycol molecules (depending on molecular weight, degree of branching, etc.), the ratio of polyethylene glycol molecules to protein (polypeptide) molecules in the reaction mixture, the PEGylation reaction to be performed The type and method of obtaining the selected N-terminal PEGylated protein can be selected. By purifying N-terminal PEGylated material from a population of PEGylated protein molecules as a way to obtain N-terminal PEGylated preparations (ie, to isolate this moiety from other monoPEGylated moieties if necessary) A method can be mentioned. Selective chemical chemical modification at the N-terminus can be achieved by reductive alkylation that exploits the different types of primary amino groups (lysine vs. N-terminus) reactivity that can be involved in derivatives in specific proteins. it can. Under appropriate reaction conditions, substantially selective N-terminal protein derivatization with carbonyl group-containing polymers is achieved.

  As is the case with the various polymers exemplified above, the polymer residues may contain functional groups in addition to the functional groups typically involved, for example, in linking polymer residues to the polypeptides of the invention. it is conceivable that. Such functional groups include, for example, carboxyl, amine, hydroxy and thiol groups. These functional groups on the polymer residue can be reacted with substances that can generally react with such functional groups and serve for targeting to specific tissues in the body, such as affected tissues, if desired. Representative materials that can be reacted with additional functional groups include, for example, proteins (including antibodies), carbohydrates, peptides, glycoproteins, glycolipids, lectins, and nucleosides.

  In addition to the residue of the hydrophilic polymer, a sugar residue can be mentioned as a chemical substance used for derivatizing the polypeptide of the present invention. Representative sugars that can be derived include monosaccharides or sugar alcohols such as erythrose, threose, ribose, arabinose, xylose, lyxose, fructose, sorbitol, mannitol and sedheptulose (preferred monosaccharides are fructose, mannose, xylose) , Arabinose, mannitol and sorbitol), and disaccharides such as lactose, sucrose, maltose and cellobiose. Other saccharides include, for example, inositol and ganglioside heads. In addition to those exemplified above, other suitable saccharides will be apparent to those skilled in the art based on this specification. In general, saccharides that can be used for derivatization include saccharides that can be attached to the polypeptides of the invention by alkylation or acylation reactions.

  The present invention further includes derivatization of the polypeptides of the invention with, for example, lipids (including cationic, anionic, polymerized, charged, synthetic, saturated or unsaturated lipids, and any combination thereof), stabilizers, and the like. Includes.

  The present invention can perform, for example, a stabilizing function (for example, increase the half-life of a polypeptide in a dissolved state, increase the water solubility of a polypeptide, increase the hydrophilicity or hydrophobicity of a polypeptide, etc.). Derivatization) of the polypeptide of the invention with a compound. Polymers useful as stabilizing materials can be natural, semi-synthetic (modified natural) or synthetic. Typical natural polymers include, for example, natural polysaccharides as described below: arabinan, fructan, fucans, galactan, galacturonan, glucan, mannan, xylan (eg, inulin), levan, fucoidan, carrageenan, galacto Galatocarolose, pectinic acid, pectin such as amylose, pullulan, glycogen, amylopectin, cellulose, dextran, dextrin, dextrose, glucose, polyglucose, polydextrose, pustulan, chitin, agarose, keratin, chondroitin, dermatan, hyaluronic acid , Alginic acid, xanthine gum, starch and various other natural homopolymers or heteropolymers such as the following aldoses, ketoses, acids or polymers Contains one or more of: erythose, threose, ribose, arabinose, xylose, lyxose, allose, altrose, glucose, dextrose, mannose, gulose, idose, galactose, talose, erythrulose, ribulose, xylulose, psicose , Fructose, sorbose, tagatose, mannitol, sorbitol, lactose, sucrose, trehalose, maltose, cellobiose, glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine, aspartic acid, glutamic acid, lysine, arginine, histidine, glucuronic acid, Gluconic acid, glucaric acid, galacturonic acid, mannuronic acid, glucosamine, galactosamine and neuraminic acid, and those Natural derivatives of Thus, suitable polymers include, for example, proteins such as albumin, polyalginates, and polylactide coglycolide polymers. Exemplary semisynthetic polymers include, for example, carboxymethylcellulose, hydroxymethylcellulose, hydroxypropylmethylcellulose, methylcellulose, and methoxycellulose. Exemplary synthetic polymers include, for example, polyphosphazenes, hydroxyapatites, fluoroapatite polymers, polyethylenes (eg, polyethylene glycols (eg, including a class of compounds called Pluronic® sold by BASF, Parsippany, NJ)) and Polyethylene terephthalate), polypropylene (such as polypropylene glycol), polyurethane (such as polyvinyl alcohol (PVA), polyvinyl chloride, and polyvinyl pyrrolidone), polyamides including nylon, polystyrene, polylactic acid, fluorocarbon polymers, fluorocarbons Examples include polymers (such as polytetrafluoroethylene), acrylates, methacrylates, and polymethyl methacrylates, and derivatives thereof. A method for producing a derivatized polypeptide of the invention that utilizes a polymer as a stabilizing compound is described in detail in the specification of Unger, incorporated herein by reference in its entirety, as is known in the art. It will be apparent to those skilled in the art when considered in conjunction with information as described and referred to in US Pat. No. 5,205,290.

  The invention further encompasses additional modifications of the polypeptides of the invention. Such additional modifications are known in the art and are described in detail in US Pat. No. 6,028,066, incorporated herein by reference in its entirety, along with derivatization methods and the like.

  The polypeptides of the present invention may be monomeric or multimeric (ie, dimers, trimers, tetramers and higher higher multimers). Accordingly, the present invention relates to monomers and multimers of the polypeptides of the present invention, their production, and compositions (preferably therapeutic agents) containing them. In a specific embodiment, the polypeptides of the present invention are monomers, dimers, trimers or tetramers. In a further embodiment, the multimer of the present invention is at least a dimer, at least a trimer, or at least a tetramer.

  Multimers encompassed by the present invention may be homomers or heteromers. As used herein, the term homomer refers to the amino acid sequence of SEQ ID NO: 2 or the amino acid sequence encoded by the cDNA contained in at least one deposited clone (fragments corresponding to these polypeptides described herein, Multimers containing only mutants, splice variants, and fusion proteins). These homomers can include polypeptides having the same amino acid sequence or different amino acid sequences. In one specific embodiment, the homomers of the present invention are multimers that contain only polypeptides having the same amino acid sequence. In another specific embodiment, the homomers of the present invention are multimers containing polypeptides having different amino acid sequences. In a specific embodiment, the multimer of the present invention is a homodimer (eg, comprising polypeptides having the same or different amino acid sequences) or homotrimer (eg, the same amino acid sequence and / or different amino acids). Including a polypeptide having a sequence). In a further embodiment, the homomultimer of the invention is at least a homodimer, at least a homotrimer, or at least a homotetramer.

  As used herein, the term heteromer refers to a multimer comprising one or more heterologous polypeptides (ie, polypeptides of different proteins) in addition to the polypeptide of the present invention. In a specific embodiment, the multimer of the present invention is a heterodimer, heterotrimer or heterotetramer. In further embodiments, the heteromultimer of the invention is at least a heterodimer, at least a heterotrimer, or at least a heterotetramer.

  The multimers of the invention can be the result of hydrophobic, hydrophilic, ionic and / or covalent bonds, and / or can be indirectly linked, such as by liposome formation. Thus, in one embodiment, multimers of the invention, such as homodimers or homotrimers, are formed when they contact each other in a dissolved state of the polypeptides of the invention. In another embodiment, the heteromultimer of the present invention, such as a heterotrimer or heterotetramer, is an antibody against the polypeptide of the present invention in a state in which the polypeptide of the present invention is dissolved (the fusion protein of the present invention). In contact with a heterologous polypeptide sequence in it). In another embodiment, the multimers of the present invention are formed by covalent bonds with and / or between the polypeptides of the present invention. Such covalent bonds may involve one or more amino acid residues contained in a polypeptide sequence (eg, those listed in the sequence listing or included in the polypeptide encoded by the deposited clone). As an example, this covalent bond is a bridge between cysteine residues within a polypeptide sequence that interact in a native (ie, naturally occurring) polypeptide. In another example, the covalent bond is the result of a chemical or recombinant operation. Alternatively, such covalent bonds may involve one or more amino acid residues contained in the heterologous polypeptide sequence in the fusion protein of the invention.

  In certain instances, covalent bonds are between heterologous sequences contained in the fusion proteins of the invention (see, eg, US Pat. No. 5,478,925). In one specific embodiment, the covalent bond is between the heterologous sequences contained in the Fc fusion protein of the invention (described herein). In another embodiment, the covalent bond of the fusion protein of the invention is another protein capable of forming a covalently linked multimer, such as osteoprotegerin (eg, International Publication No. 98/49305) etc.) between heterologous polypeptide sequences. In another embodiment, two or more polypeptides of the present invention are joined via a peptide linker. Examples include the peptide linkers described in US Pat. No. 5,073,627 (incorporated herein by reference). A protein comprising a plurality of polypeptides of the present invention separated by a peptide linker can be produced using conventional recombinant DNA techniques.

  Another method of producing a multimeric polypeptide of the invention uses a polypeptide of the invention fused to a leucine zipper or isoleucine zipper polypeptide sequence. Leucine zippers and isoleucine zipper domains are polypeptides that promote multimerization of proteins containing those domains. Leucine zippers were first identified in several DNA-binding proteins (Landschulz et al., Science 240: 1759 (1988)) and have since been found in a wide variety of proteins. Known leucine zippers include natural peptides and derivatives thereof that dimerize or trimerize. Examples of leucine zipper domains suitable for producing the soluble multimeric proteins of the present invention are those described in PCT application WO94 / 10308, which is incorporated herein by reference. A recombinant fusion protein comprising a polypeptide of the invention fused to a polypeptide sequence that dimerizes or trimerizes in a dissolved state is expressed in a suitable host cell, and the resulting soluble multimeric fusion protein is obtained Recover from the culture supernatant using techniques known in the art.

The trimeric polypeptides of the present invention may provide the advantage of increased biological activity. Preferred leucine zipper moieties and isoleucine moieties are those that preferentially form trimers. One example is the leucine zipper derived from pulmonary surfactant protein D (SPD) described in Hoppe et al. ( FEBS Letters 344: 191 (1994)) and US patent application Ser. No. 08 / 446,922, incorporated herein by reference. It is. For the production of the trimeric polypeptide of the present invention, other peptides derived from the natural trimeric protein may be used.

  In another example, proteins of the present invention associate by interaction between Flag® polypeptide sequences contained in a fusion protein of the present invention that contains Flag® polypeptide sequences. In yet another embodiment, the associating protein of the present invention associates by the interaction of a heterologous polypeptide sequence contained in the Flag® fusion protein of the present invention with an anti-Flag® antibody.

  The multimers of the present invention can be produced using chemical techniques known in the art. For example, a polypeptide to be included in a multimer of the present invention can be chemically cross-linked using linker molecules and linker molecule length optimization techniques known in the art (eg, as is described herein by reference). See U.S. Pat. No. 5,478,925, etc., incorporated in this document) In addition, the multimers of the present invention can be produced using techniques known in the art by forming one or more intermolecular bridges between cysteine residues in the sequence of the polypeptide to be included in the multimer, (Eg see US Pat. No. 5,478,925, which is incorporated herein by reference in its entirety). Furthermore, the polypeptide of the present invention is modified by adding cysteine or biotin to the C-terminus or N-terminus of the polypeptide by a conventional method, and applying techniques known in the art, one or more of these modified polypeptides Can also be produced (see, for example, US Pat. No. 5,478,925, incorporated herein by reference in its entirety). In addition, by applying techniques known in the art, liposomes containing polypeptide components to be included in the multimer of the present invention may be produced (for example, incorporated herein by reference as it is). See US Pat. No. 5,478,925).

  Alternatively, the multimers of the present invention can be produced using genetic engineering techniques known in the art. In certain embodiments, a polypeptide contained in a multimer of the invention is recombinantly produced using other fusion protein techniques described herein or known in the art (eg, as described herein by reference). US Pat. No. 5,478,925, incorporated herein by reference). In a specific embodiment, a polynucleotide sequence encoding a polypeptide of the present invention is ligated to a sequence encoding a linker polypeptide, and the translation product of the polypeptide is converted from the original C-terminus to the N-terminus (leader). A polynucleotide encoding the homodimer of the present invention is produced by ligating to a synthetic polynucleotide that encodes in the reverse direction (excluding the sequence), eg, US Pat. (See 5,478,925 etc.) In another embodiment, applying other recombinant techniques described herein or known in the art, containing a transmembrane domain (or hydrophobic peptide or signal peptide) and by membrane reconstitution techniques Recombinant polypeptides of the invention that can be incorporated into liposomes are produced (see, eg, US Pat. No. 5,478,925, incorporated herein by reference).

  Furthermore, the polynucleotides of the invention could be operably linked to “artificial” or chimeric promoters and transcription factors. In particular, an artificial promoter could contain or consist of any combination of cis-acting DNA sequence elements recognized by a trans-acting transcription factor. Preferably, the cis-acting DNA sequence element and the trans-acting transcription factor are operable in mammals. Further, such “artificial” promoter trans-acting factors may themselves be “artificial” or chimeric designs and may act as activators or repressors on said “artificial” promoters. right.

  Each polynucleotide described herein can be used as a reagent in a number of ways. The following description should be considered representative and utilizes known techniques.

  The polynucleotide of the present invention is useful for chromosome identification. New chromosomal markers are still needed because there are few chromosomal marking reagents based on actual sequence data (repetitive polymorphisms) currently available. Each polynucleotide of the present invention can be used as a chromosomal marker.

  Briefly, by creating a PCR primer (preferably 15-25 bp) from the sequence shown in SEQ ID NO: 1, the sequence can be mapped to a chromosome. By selecting a primer using computer analysis, it is possible to ensure that the primer does not span more than one predicted exon in the genomic DNA. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only hybrids containing the human gene corresponding to SEQ ID NO: 1 will give an amplified fragment.

  Somatic cell hybrids also provide a rapid method of PCR mapping polynucleotides to specific chromosomes. One thermal cycler can be used to allocate more than 3 clones per day. Furthermore, sublocalization of polynucleotides can also be achieved using a panel of specific chromosomal fragments. Other gene mapping methods that can be used include in situ hybridization, pre-screening with flow-sorted labeled chromosomes, and preselection by hybridization to construct a chromosome-specific cDNA library.

  The exact chromosomal location of the polynucleotide can also be obtained using metaphase chromosome spread fluorescence in situ hybridization (FISH). In this technique, a polynucleotide of only about 500 to 600 bases is used, but a polynucleotide of 2,000 to 4,000 bp is preferable. For an overview of this technology, see Verma et al. “Human Chromosomes: A Manual of Basic Techniques” Pergamon Press, New York (1988).

  For chromosome mapping, polynucleotides can be used individually (to mark a single chromosome or a single site on that chromosome) or as a panel (multiple sites and / or multiple sites) To mark chromosomes). Preferred polynucleotides correspond to non-coding regions of cDNA. This is because the coding sequence is more likely to be conserved within the gene family, and the possibility of cross-hybridization during chromosomal mapping is increased.

  Once a polynucleotide has been mapped to the correct chromosomal location, the physical location of the polynucleotide can be used for linkage analysis. Linkage analysis establishes the co-inheritance of chromosomal location and expression of a particular disease. Disease mapping data is known in the art. Assuming a mapping resolution of 1 megabase and 1 gene per 20 kb, a cDNA that is precisely localized to a chromosomal region implicated in the disease can be one of 50-500 potential causative factors.

  Thus, once co-inheritance is established, polynucleotide and corresponding gene differences between affected and unaffected organisms can be examined. First, visible structural changes in the chromosome, such as deletions or translocations, are examined by PCR on chromosome spreads. If there is no structural change, confirm the presence of a point mutation. A mutation that is observed in some or all of the affected organism but not in a normal organism indicates that the mutation may be responsible for the disease. However, distinguishing the mutation from the polymorphism requires complete sequencing of the polypeptide and the corresponding gene. Once a new polymorphism is identified, this polymorphic polypeptide can be used for further linkage analysis.

  Increases or decreases in gene expression in affected organisms compared to unaffected organisms can be assessed using the polynucleotides of the invention. Any of these changes (change in expression, chromosomal rearrangement, or mutation) can be used as a diagnostic or prognostic marker.

  Accordingly, the present invention is a diagnostic method useful for diagnosing a disorder, wherein the expression level of the polynucleotide of the present invention in a cell or body fluid is measured, and the measured gene expression level is compared with a standard level of polynucleotide expression level. And an increase or decrease in gene expression levels compared to a standard also indicates a disorder.

  “Measuring the expression level of the polynucleotide of the present invention” means directly measuring the level of the polypeptide of the present invention or the level of mRNA encoding the polypeptide in the first biological sample (for example, absolute protein level or mRNA). Measuring or estimating qualitatively or quantitatively, such as by determining or estimating the level), or relatively (eg, by comparing to the polypeptide level or mRNA level in a second biological sample) means. Preferably, the polypeptide level or mRNA level in the first biological sample is measured or estimated and compared to a standard polypeptide level or mRNA level. The standard is determined by taking from a second biological sample obtained from an individual without the disorder or by averaging levels obtained from a population of organisms without the disorder. As will be appreciated in the art, once a standard polypeptide level or mRNA level is known, it can be used repeatedly as a standard for comparison.

  “Biological sample” means any biological sample obtained from an organism, body fluid, cell line, tissue culture or other source comprising a polypeptide or mRNA of the invention. As mentioned above, biological samples include body fluids (eg sputum, amniotic fluid, urine, saliva, breast milk, secretions, interstitial fluid, blood, serum, spinal fluid, etc.) containing the polypeptide of the present invention. , But not limited to), and other tissue sources found to express the polypeptides of the invention. Methods for obtaining tissue biopsies and body fluids from organisms are well known in the art. Tissue biopsy is a preferred source when the biological sample is to contain mRNA.

  The above-described methods are preferably applicable to diagnostic methods and / or kits in which the polynucleotide and / or polypeptide is attached to a solid support. As an exemplary method, the support can be a “gene chip” or “biological chip” as described in US Pat. Nos. 5,837,832, 5,874,219, and 5,856,174. Furthermore, such a gene chip to which a polynucleotide of the invention is attached can be used to identify polymorphisms between polynucleotide sequences using a polynucleotide isolated from a test subject. Knowledge about such polymorphisms (ie their location as well as their presence) may be useful in identifying disease loci for many disorders, including proliferative diseases and conditions. Such methods are described in US Pat. Nos. 5,858,659 and 5,856,104. The aforementioned US patents are incorporated herein by reference.

The invention encompasses polynucleotides of the invention that are chemically synthesized or reproduced as peptide nucleic acids (PNA) or reproduced by other methods known in the art. The use of PNA will serve as a preferred form when the polynucleotide is incorporated on a solid support or gene chip. In the present invention, peptide nucleic acid (PNA) is a polyamide-type DNA analog, and monomer units of adenine, guanine, thymine and cytosine are commercially available (Perceptive Biosystems). Certain components of DNA, such as phosphorus, phosphorus oxide, or deoxyribose derivatives are not present in PNA. PENielsen, M.Egholm, RHBerg and O.Buchardt, Science 254, 1497 (1991), and M.Egholm, O.Buchardt, L.Christensen, C.Behrens, SMFreier, DADriver, RHBerg, SKKim, B.Norden and PENielsen , Nature 365, 666 (1993), PNA binds specifically and tightly to complementary DNA strands and is not degraded by nucleases. In fact, PNA binds to DNA more strongly than DNA itself. This is probably because there is no electrostatic repulsion between the two chains, and the polyamide backbone is more flexible. For this reason, PNA / DNA duplexes bind under a wider range of stringency conditions than DNA / DNA duplexes to facilitate multiplex hybridization. Because the binding properties of PNA: DNA hybrids are stronger, smaller probes can be used than for DNA. In addition, PNA / DNA hybridization is likely to be able to determine a single base mismatch. This is because the melting point (T _m ) decreases by 8 ° C to 20 ° C when there is one mismatch in the PNA / DNA15mer, whereas this decrease is 4 ° C to 16 ° C for the DNA / DNA15mer duplex. That's why. In addition, since there is no charged group in PNA, hybridization can be performed with low ionic strength, and salt interference that may occur during analysis can be reduced.

In addition to the above, polynucleotides can also be used to control triple helix formation or gene expression by antisense DNA or RNA. Antisense technology is discussed in, for example, Okano, J. Neurochem. 56: 560 (1991), “Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression” (CRC Press, Boca Raton, Florida, 1988). Triple helix formation is discussed, for example, in Lee et al., Nucleic Acids Research 6: 3073 (1979), Cooney et al., Science 241: 456 (1988), and Dervan et al., Science 251: 1360 (1991). Both methods rely on the binding of polynucleotides to complementary DNA or RNA. In these techniques, preferred polynucleotides are usually 20-40 bases in length, and regions of genes involved in transcription (triple helix-Lee et al. , Nucl. Acids Res. 6: 3073 (1979), Cooney et al., Science 241: 456 (1988), and Dervan et al., Science 251: 1360 (1991)) or mRNA itself (antisense-Okano, J. Neurochem. 56: 560 (1991), “Oligodeoxy-nucleotides as Antisense Inhibitors of Gene Expression” (CRC Press, Boca Raton, Florida, 1988)). Triple helix formation optimally blocks RNA transcription from DNA, while antisense RNA hybridization blocks translation of mRNA molecules into polypeptides. Both techniques are effective in model systems, and the information disclosed herein can be used to design antisense or triple helix polynucleotides in an effort to treat or prevent disease.

The invention is operative in any 5 ′ or 3 ′ end or any position of the oligonucleotides, antisense oligonucleotides, triple helix oligonucleotides, ribozymes, PNA oligonucleotides and / or polynucleotides of the invention. Includes the addition of linked nuclear localization signals. See, for example, G. Cutrona et al . , Nat. Biotech . , 18: 300-303 (2000), incorporated herein by reference.

The polynucleotides of the present invention are also useful for gene therapy. One goal of gene therapy is to insert a normal gene into an organism with a defective gene in an attempt to correct the genetic defect. The polynucleotide disclosed in the present invention provides a very accurate means of targeting such genetic defects. Another goal is to insert a new gene that did not exist in the host genome, thus giving the host cell a new trait. As an example, a chimeric RNA / DNA oligonucleotide corresponding to that sequence using the polynucleotide sequence of the present invention, specifically designed to induce a host cell mismatch repair mechanism in an organism, for example when injected systemically. (Bartlett, RJ et al., Nat . Biotech, 18: 615-622 (2000), which is hereby incorporated by reference in its entirety). Such RNA / DNA oligonucleotides can be used to correct genetic defects in certain host strains and / or introduce a desired phenotype into the host (eg, endogenous equivalents of the polynucleotides of the invention). It could be designed that sex genes are introduced) with specific polymorphisms that can lead to improvement and / or prevention of disease symptoms and / or disorders. Another option is to use the polynucleotide sequence of the present invention to provide a double-stranded oligonucleotide corresponding to that sequence so as to correct a genetic defect in certain host strains and / or Special so that the desired phenotype is introduced into the host (eg, specific polymorphisms may be introduced into endogenous genes corresponding to the renucleotides of the invention that may result in amelioration and / or prevention of disease symptoms and / or disorders) You may build what was designed. Methods of using such double stranded oligonucleotides are known in the art and are encompassed by the present invention (see EP1007712, incorporated herein by reference in its entirety).

  The polynucleotides are also useful for identifying organisms from a small number of biological samples. For example, the US military is considering using restriction fragment length polymorphism (RFLP) to identify its personnel. In this technique, an individual's genomic DNA is digested with one or more restriction enzymes and probed on a Southern blot to obtain a unique band for identifying personnel. This method does not have the weaknesses of the current “Dog Tag” that can be lost, replaced, or stolen, making positive identification difficult. The polynucleotide of the present invention can be used as a new RFLP DNA marker.

  The polynucleotides of the present invention can also be used as an alternative to RFLP by determining the actual DNA sequence of a selected portion of the genome of an organism in base units. These sequences can be used to generate PCR primers for amplifying and isolating the selected DNA, and the DNA thus obtained can be sequenced. Since each organism will have a unique set of DNA sequences, this technique can be used to identify the organism. Once a unique ID database is established for an organism, it can be positively identified from very small tissue samples, whether the organism is alive or dead. Similarly, the polynucleotide of the present invention can be used as a polymorphic marker in addition to identification of transformed or non-transformed cells and / or tissues.

  There is also a need for reagents that can identify the source of a particular tissue. Such a need arises, for example, when a tissue of unknown origin is given. Suitable reagents can include, for example, DNA probes or primers specific for a particular tissue made from the sequences of the present invention. Such a panel of reagents can be used to identify tissue by species and / or organ type. Similarly, these reagents can be used to screen tissue cultures for contamination. Furthermore, as described above, such reagents can also be used to screen and / or identify transformed and / or non-transformed cells and / or tissues.

  At a minimum, the polynucleotides of the present invention “subtract-out” known sequences as molecular weight markers in Southern gels, as diagnostic probes for the presence of specific mRNAs in specific cell types, and in the process of discovering new polynucleotides. To select and create oligomers for attachment to "gene chips" or other supports, to generate anti-DNA antibodies using DNA immunization techniques, and to elicit immune responses It can be used as an antigen for

  Each polypeptide described herein can be used in a number of ways. The following description should be considered representative and utilizes known techniques.

The polypeptides of the present invention can be utilized to assay protein levels in a biological sample using antibody-based techniques. For example, protein expression in tissues can be studied by classical immunohistological methods (Jalkanen, M. et al., J. Cell. Biol. 101: 976-985 (1985), Jalkanen, M. et al., J. Cell. Biol. 105: 3087-3096 (1987)). Other antibody-based methods useful for the detection of protein gene expression include immunoassays such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). Suitable antibody assay labels are known in the art, such as enzyme labels, such as glucose oxidase, iodine ⁽¹²⁵ I, ¹²¹ I), carbon ⁽¹⁴ C), sulfur ⁽³⁵ S), tritium ⁽³ H), Examples include radioisotopes such as indium ( ¹¹² In) and technetium ( ⁹⁹ Tc), fluorescent labels such as fluorescein and rhodamine, and biotin.

  In addition to assaying protein levels in biological samples, proteins can also be detected in vivo by imaging methods. Antibody labels or markers for in vivo imaging of proteins include those that can be detected by X-ray imaging, NMR, or ESR. In the case of radiography, suitable labels include radioactive isotopes such as barium or cesium that emit detectable radiation but do not cause obvious harm to the measurement object. Suitable markers for NMR and ESR include those that have a detectable characteristic spin (eg, deuterium) and can be incorporated into antibodies by labeling nutrients that feed related hybridomas.

A protein-specific antibody or antibody fragment labeled with a suitable detectable imaging component, such as a radioisotope ( ¹³¹ I, ¹¹² In, ^99m Tc, etc.), a radiopaque substance, or a substance detectable by nuclear magnetic resonance Are introduced into a mammal (eg, by parenteral, subcutaneous or intraperitoneal administration). It will be understood in the art that the amount of imaging component required to obtain a diagnostic image depends on the size of the object and the imaging system used. When using radioisotope components, the amount of radioactivity injected will typically range from about 5 to 20 millicuries of ^99m Tc in human subjects. The labeled antibody or antibody fragment will then preferentially accumulate at the cellular site containing the specific protein. For in vivo tumor imaging, see chapter 13 of SWBurchiel and BARhodes, “Tumor Imaging: The Radiochemical Detection of Cancer” (Masson Publishing Inc., 1982), SWBurchiel et al., “Immunopharmacokinetics of radiolabeled antibodies and fragments thereof ( Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments) ”.

  Thus, the present invention comprises (a) assaying the expression of a polypeptide of the present invention in a cell or body fluid of an individual and (b) comparing the level of gene expression to a standard gene expression level, An increase or decrease in the level of polypeptide gene expression assayed when compared to the level provides a method wherein the disorder is indicated. In the case of cancer, the presence of a relatively large amount of transcript in biopsy tissue obtained from an individual may indicate a predisposition to the development of the disease. Alternatively, such presence may provide a means for detecting the disease before clinical symptoms actually appear. This more definitive type of diagnosis would allow health professionals to take preventive or aggressive treatment earlier, thus preventing the development or further progression of cancer.

  Similarly, antibodies against the polypeptides of the present invention can also be used in the treatment, prevention and / or diagnosis of diseases. For example, administration of an antibody against a polypeptide of the invention can bind the polypeptide and reduce overproduction of the polypeptide. The polypeptide can also be activated by administration of the antibody, for example, by binding to a polypeptide (receptor) bound to the membrane.

  At a minimum, the polypeptides of the present invention can be used as molecular weight markers on SDS-PAGE gels or molecular sieve gel filtration columns by methods well known to those skilled in the art. Polypeptides can also be used to produce antibodies, which can be used to measure protein expression from recombinant cells as a way to assess host cell transformation. Furthermore, the polypeptides of the present invention can also be used to test the following biological activities.

  Another aspect of the invention relates to gene therapy methods for treating or preventing disorders, diseases and conditions. This gene therapy method relates to the introduction of nucleic acid (DNA, RNA and antisense DNA or RNA) sequences into animals to express the polypeptides of the invention. This method requires a polynucleotide encoding a polypeptide of the invention operably linked to a promoter and any other genetic element required for expression of the polypeptide by a target tissue. Such gene therapy and gene delivery techniques are known to those skilled in the art, see for example WO90 / 11092, which is incorporated herein by reference.

Thus, for example, cells obtained from a patient are manipulated ex vivo using a polynucleotide (DNA or RNA) comprising a promoter operably linked to a polynucleotide of the invention, and then manipulated The cells can be given to a patient to be treated with the polypeptide. Such methods are well known in the art. See, for example, Belldegrun et al., J. Natl. Cancer Inst. , 85: 207-216 (1993), Ferrantini et al., Cancer Research , 53: 107-1112 (1993), Ferrantini et al., J. , which is incorporated herein by reference . Immunology 153: 4604-4615 (1994), Kaido, T. et al., Int . J. Cancer 60: 221-229 (1995), Ogura et al., Cancer Research 50: 5102-5106 (1990), Santodonato et al., Human Gene Therapy 7: 1-10 (1996), Santodonato et al., Gene Therapy 4: 1246-1255 (1997), and Zhang et al., Cancer Gene Therapy 3: 31-38 (1996). In certain embodiments, the engineered cell is an arterial cell. Arterial cells can be reintroduced into the patient by direct injection into the artery or tissue surrounding the artery or by catheterization.

  As described in detail below, polynucleotide constructs can be injected by any method that delivers an injectable substance into an animal cell, for example, into the interstitial space of tissue (heart, muscle, skin, lung, liver, etc.). And so on. The polynucleotide construct can be delivered in a pharmaceutically acceptable liquid or aqueous carrier.

  In certain embodiments, the polynucleotides of the invention are delivered as naked polynucleotides. The term “naked” polynucleotide, DNA or RNA refers to a delivery vehicle that acts to assist, facilitate or facilitate entry into the cell, such as a viral sequence, viral particle, liposomal formulation, lipofectin or precipitant, etc. Refers to an array that does not contain However, the polynucleotide of the present invention can also be delivered in liposome preparations and lipofectin preparations that can be produced by methods well known to those skilled in the art. Such methods are described, for example, in US Pat. Nos. 5,593,972, 5,589,466, and 5,580,859, which are incorporated herein by reference.

  The polynucleotide vector constructs of the invention used in gene therapy methods are preferably constructs that do not integrate into the host genome and do not contain sequences that allow replication. Suitable vectors include pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene, pSVK3, pBPV, pMSG and pSVL available from Pharmacia, and pEF1 / V5, pcDNA3.1, and pRc / CMV2 available from Invitrogen. There is. Other suitable vectors will be apparent to those skilled in the art.

  Any strong promoter known to those skilled in the art can be used to express a polynucleotide sequence of the invention. Suitable promoters include adenovirus promoters such as the adenovirus late promoter, or heterologous promoters such as the cytomegalovirus (CMV) promoter, respiratory syncytial virus (RSV) promoter, MMT promoter, inducible promoters such as the metallothionein promoter, Examples include heat shock promoter, albumin promoter, ApoAI promoter, human globin promoter, viral thymidine kinase promoter such as herpes simplex virus thymidine kinase promoter, retroviral LTR, β-actin promoter, and human growth hormone promoter. The promoter may be a natural promoter of the polynucleotide of the present invention.

  Unlike other gene therapy techniques, one major advantage of introducing naked nucleic acid sequences into target cells is the transient nature of polynucleotide synthesis in the cells. Studies have shown that non-replicating DNA sequences can be introduced into cells to produce the desired polypeptide over a period of up to 6 months.

  The polynucleotide construct of the present invention comprises muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, intestine, testis, ovary, uterus, It can be delivered to the interstitial space of tissues in animals including rectum, nervous system, eye, gland, connective tissue and the like. The interstitial space of the tissue contains interstitial fluid, mucopolysaccharide matrix in lattice fibers of organ tissue, elastic fibers of the tube wall or tuft wall, collagen fibers of fiber tissue, or connective tissue or bone defects that wrap muscle cells. The same matrix in the recess is included. It is also the space occupied by circulatory plasma and lymphatic lymphatic fluid. Delivery to the interstitial space of muscle tissue is preferred for the reasons described below. The polynucleotide constructs of the present invention can be conveniently delivered by injection into a tissue containing these cells. The polynucleotide constructs of the present invention are preferably delivered to and expressed in differentiated permanent non-dividing cells. However, delivery and expression can also be achieved with non-differentiated cells or incompletely differentiated cells, such as blood stem cells or skin fibroblasts. In vivo muscle cells are particularly capable of taking up and expressing polynucleotides.

  When injecting a naked nucleic acid sequence, an effective amount of DNA or RNA will range from about 0.05 mg / kg body weight to about 50 mg / kg body weight. Preferably, the dosage will range from about 0.005 mg / kg to about 20 mg / kg, more preferably from about 0.05 mg / kg to about 5 mg / kg. Of course, those skilled in the art will appreciate that this dosage will vary depending on the tissue site to be injected. Appropriate and effective doses of nucleic acid sequences can be readily determined by one skilled in the art and will depend on the condition being treated and the route of administration.

  The preferred route of administration is by the parenteral route of injection into the interstitial space of the tissue. However, other parenteral routes may also be used for delivery, for example to the lung or bronchial tissue, throat or nasal mucosa, especially inhalation of aerosol formulations. Furthermore, naked DNA constructs can also be delivered to the artery during the angioplasty by the catheter being used for the surgery.

  Naked polynucleotides can be obtained by any method known in the art including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter injection, so-called “gene gun”, and the like. Delivered.

  The construct may be delivered using a delivery vehicle such as a viral sequence, viral particle, liposomal formulation, lipofectin, precipitant, and the like. Such delivery methods are known in the art.

In some embodiments, the polynucleotide constructs of the invention are complexed in a liposome preparation. Liposome preparations used in the present invention include cationic (positively charged), anionic (negatively charged) and neutral preparations. However, cationic preparations are particularly preferred. This is because a strong charge complex can be formed between the cationic liposome and the polyanionic nucleic acid. Cationic liposomes are functional forms of plasmid DNA (Felgner et al., Proc. Natl. Acad. Sci. USA , 84: 7413-7416 (1987), which is incorporated herein by reference), mRNA ( Malone et al., Proc. Natl. Acad. Sci. USA , 86: 6077-6081 (1989), which is incorporated herein by reference), and purified transcription factors (Debs et al., J. Biol . Chem. ., 265: 10189-10192 (1990), this paper has been shown to mediate intracellular delivery of incorporated herein by reference).

Cationic liposomes are readily available. For example, N [1- (2,3-dioleyloxy) propyl] -N, N, N-triethylammonium (DOTMA) liposomes are particularly useful, from GIBCO BRL (Grand Island, NY) of Lipofectin. (See also Felgner et al., Proc. Natl. Acad. Sci. USA , 84: 7413-7416 (1987), incorporated herein by reference). Other commercially available liposomes include transfectace (DDAB / DOPE) and DOTAP / DOPE (Boehringer).

Other cationic liposomes can be made from readily available materials using techniques well known in the art. For example, for the synthesis of DOTAP (1,2-bis (oleoyloxy) -3- (trimethylammonio) propane) liposomes, see PCR Publication No. WO 90/11092 (incorporated herein by reference). I want. The production of DOTMA liposomes is explained in the literature. See, for example, Felgner et al., Proc. Natl. Acad. Sci. USA , 84: 7413-7417, incorporated herein by reference. Similar methods can be used to produce liposomes from other cationic lipid materials.

  Similarly, anionic and neutral liposomes are readily available, such as from Avanti Polar Lipids (Birmingham, Alab.), Or can be readily manufactured using readily available materials. Such materials include, for example, phosphatidylcholine, cholesterol, phosphatidylethanolamine, dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), dioleoylphosphatidylethanolamine (DOPE), and the like. These materials can also be mixed with DOTMA and DOTAP starting materials in appropriate ratios. Methods for producing liposomes using these materials are well known in the art.

  For example, commercially available dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), and dioleoylphosphatidylethanolamine (DOPE) in various combinations with added cholesterol or added cholesterol Normal liposomes can be produced. Thus, for example, DOPG / DOPC vesicles can be produced by drying each 50 mg of DOPG and DOPC under a stream of nitrogen into a sonicated vial. The sample is placed under a vacuum pump overnight and then hydrated with deionized water the next day. Next, use a Heat Systems 350 sonicator equipped with an inverted cup (bath type) probe, and circulate the tank at 15EC at the maximum setting. Sonicate for 2 hours in. As another option, negatively charged vesicles can be produced without sonication to obtain multilamellar vesicles or extruded through nucleopore membranes to obtain unilamellar vesicles with discrete sizes Can also be manufactured. Other methods are known to those skilled in the art and can be used.

Liposomes can consist of multilamellar vesicles (MLV), small unilamellar vesicles (SUV) or large unilamellar vesicles (LUV), with SUV being preferred. Various liposome-nucleic acid complexes are prepared using methods well known in the art. See, for example, Straubinger et al., Methods of Immunology , 101: 512-527 (1983), which is incorporated herein by reference. For example, an MLV containing nucleic acid can be produced by depositing a thin layer of phospholipid on the wall of a glass tube and then hydrating it with a solution of the substance to be encapsulated. SUVs are produced by extending the sonication of MLV to obtain a uniform population of unilamellar liposomes. A substance to be encapsulated is added to a previously formed suspension of MLV and then sonicated. When using liposomes containing cationic lipids, dry lipid membranes can be resuspended in a suitable solution in sterile water or isotonic buffer (eg 10 mM Tris / NaCl), sonicated and pre-formed Liposomes are mixed directly with DNA. Since the positively charged liposome binds to the cationic DNA, the liposome and DNA form a very stable complex. SUV is useful for small nucleic acid fragments. LUVs are produced by a number of methods known in the art. Commonly used methods include Ca ²⁺ -EDTA chelation (Papahadjopoulos et al., Biochim . Biophys. Acta , 394: 483 (1975), Wilson et al., Cell , 17: 77 (1979)), ether injection (Deamer et al. Biochim. Biophys. Acta. 443: 629 (1976), Ostro et al . , Biochem. Biophys. Res. Commun. , 76: 836 (1977), Fraley et al., Proc. Natl. Acad. Sci. USA , 76: 3348 ( 1979)), detergent dialysis (Enoch et al., Proc. Natl. Acad. Sci. USA , 76: 145 (1979)), and reverse phase evaporation (REV) (Fraley et al . , J. Biol. Chem. , 255: 10431) . (1980), Szoka et al., Proc. Natl. Acad. Sci. USA , 75: 145 (1978), Schaefer-Ridder et al., Science , 215: 166 (1982)). Embedded in the book.

  In general, the ratio of DNA to liposome will be from about 10: 1 to about 1:10. Preferably, this ratio will be from about 5: 1 to about 1: 5. More preferably, this ratio will be about 3: 1 to 1: 3. More preferably, this ratio will be about 1: 1.

  US Pat. No. 5,676,954 (incorporated herein by reference) reports on the injection of genetic material into mice complexed with a cationic liposome carrier. U.S. Pat.Nos. 4,897,355, 4,946,787, 5,049,386, 5,459,127, 5,589,466, 5,693,622, 5,580,859, 5,703,055, and WO 94/9469, which are hereby incorporated by reference. Describes cationic lipids used in transfecting DNA into cells and mammals. US Pat. Nos. 5,589,466, 5,693,622, 5,580,859, 5,703,055, and WO 94/9469, which are hereby incorporated by reference, include DNA-cationic lipid complexes. A method of delivering the body to a mammal has been described.

  In some embodiments, cells are engineered ex vivo or in vivo using retroviral particles comprising RNA having a sequence encoding a polypeptide of the invention. Retroviruses from which retroviral plasmid vectors can be obtained include, for example, Moloney murine leukemia virus, spleen necrosis virus, Rous sarcoma virus, Harvey sarcoma virus, bird leukemia virus, gibbon leukemia virus, human immunodeficiency virus, myeloproliferative sarcoma virus , And breast cancer virus, but are not limited to these.

The retroviral plasmid vector is used to transduce the packaging cell line so that a production cell line is formed. Examples of packaging cells that can be transfected include PE501, PA317, R-2, described in Miller, Human Gene Therapy , 1: 5-14 (1990), incorporated herein by reference in its entirety. Examples include, but are not limited to, R-AM, PA12, T19-14X, VT19-17-H2, RCRE, RCRIP, GP + E-86, GP + envAml2, and DAN cell lines. The vector can be transduced into the packaging cells by any means known in the art. Such means include, but are not limited to, for example, electroporation, the use of liposomes, and CaPO4 precipitation. As an alternative, the retrovirus may be encapsulated in liposomes or coupled to lipids and administered to the host.

  The producer cell line produces infectious retroviral vector particles comprising the polynucleotide of the invention. Such retroviral vector particles can then be used to transduce eukaryotic cells in vitro or in vivo. Transduced eukaryotic cells will express the polypeptides of the invention.

In some other embodiments, cells are engineered ex vivo or in vivo using a polynucleotide of the invention contained in an adenoviral vector. Adenoviruses can be engineered to encode and express the polypeptide of the present invention and at the same time be inactivated with respect to the ability to replicate in the normal lytic viral life cycle. Adenovirus expression occurs without viral DNA integration into the host cell chromosome, reducing concerns about insertional mutagenesis. Furthermore, adenovirus has been used as a live enteral vaccine for many years and has shown an excellent safety profile (Schwartz et al . , Am. Rev. Respir. Dis. , 109: 233-238 (1974)). Finally, adenovirus-mediated gene transfer has been demonstrated in numerous examples, including the introduction of alpha-1-antitrypsin and CFTR into the lungs of cotton rats (Rosenfeld et al., Science , 252: 431-434 (1991). ), Rosenfeld et al., Cell , 68: 143-155 (1992)). In addition, all extensive studies attempting to prove that adenovirus is the causative agent of human cancer were negative (Green et al., Proc. Natl. Acad. Sci. USA , 76: 6606 (1979)).

Suitable adenoviral vectors useful in the present invention are described, for example, by Kozarsky and Wilson, Curr. Opin. Genet. Devel. , 3: 499-503 (1993), Rosenfeld et al., Cell , 68: 143, incorporated herein by reference . -155 (1992), Engelhardt et al., Human Genet. Ther. , 4: 759-769 (1993), Yang et al., Nature Genet. , 7: 362-369 (1994), Wilson et al., Nature , 365: 691-692. (1993) and U.S. Pat. No. 5,652,224. For example, the adenovirus vector Ad2 is useful and can grow in human 293 cells. These cells contain the E1 region of adenovirus and constitutively express E1a and E1b. Expressed E1a and E1b complement deficient adenoviruses by providing products of these genes that have been deleted from the vector. In addition to Ad2, other variants of adenovirus (eg, Ad3, Ad5 and Ad7) are also useful in the present invention.

  Preferably, the adenovirus used in the present invention is replication defective. Replication deficient adenoviruses require the help of helper viruses and / or packaging cell lines to form infectious particles. The resulting virus has the ability to infect cells and can express a polynucleotide of interest operably linked to a promoter, but is unable to replicate in most cells. A replication defective adenovirus may have a deletion in one or more of all or part of the following genes: E1a, E1b, E3, E4, E2a, or L1-L5.

In some other embodiments, cells are engineered ex vivo or in vivo using adeno-associated virus (AAV). AAV is a naturally occurring defective virus that requires a helper virus for the production of infectious particles (Muzyczka, Curr. Topics in Microbiol. Immunol. , 158: 97 (1992)). It is also one of several viruses that can integrate its DNA into non-dividing cells. Vectors containing only 300 base pairs of AAV can be packaged and integrated, but space for exogenous DNA is limited to about 4.5 kb. Methods for making and using such AAV are known in the art. For example, see U.S. Pat. Nos. 5,139,941, 5,173,414, 5,354,678, 5,436,146, 5,474,935, 5,478,745, and 5,589,377.

  For example, an AAV vector suitable for use in the present invention will contain all the sequences necessary for DNA replication, encapsidation, and host-cell integration. Polynucleotide constructs containing the polynucleotides of the invention can be obtained from AAV vectors using standard cloning methods such as those described in Sambrook et al., “Molecular Cloning: A Laboratory Manual” (Cold Spring Harbor Press (1989)). Inserted. The recombinant AAV vector is then transfected into the packaging cells and infected with helper virus using any standard technique such as lipofection, electroporation, calcium phosphate precipitation, and the like. Suitable helper viruses include adenovirus, cytomegalovirus, vaccinia virus, or herpes virus. Once the packaging cells are transfected and infected, they will produce infectious AAV virions containing the polynucleotide constructs of the invention. These viral particles are then used to transduce eukaryotic cells ex vivo or in vivo. The transduced cell will contain the polynucleotide construct integrated into its genome and will express the desired gene product.

In another gene therapy approach, a heterologous regulatory region and an endogenous polynucleotide sequence (eg, one encoding a polypeptide sequence of interest) are operably linked by homologous recombination (eg, June 24, 1997). U.S. Patent No. 5,641,670 issued on the same day, International Publication No. 96/29411 published on September 26, 1996, International Publication No. 94/12650 published on August 4, 1994, Koller et al., Proc. Natl. Acad. Sci. USA, 86: 8932-8935 (1989), and Zijlstra et al., Nature , 342: 435-438 (1989)). This method results in the activation of genes that are present in the target cell but are not normally expressed in that cell or are expressed at a level lower than desired.

  Polynucleotide constructs containing a promoter sandwiched between targeting sequences are made using standard techniques known in the art. Suitable promoters are those described herein. The targeting sequence exhibits sufficient complementarity to the endogenous sequence such that homologous recombination between the promoter-targeting sequence and the endogenous sequence is possible. Since the targeting sequence is sufficiently close to the 5 ′ end of the desired endogenous polynucleotide sequence, the promoter will be operably linked to the endogenous sequence when homologous recombination occurs.

  Promoters and targeting sequences can be amplified using PCR. The amplified promoter preferably includes different restriction enzyme sites at the 5 'and 3' ends. Preferably, the 3 ′ end of the first targeting sequence includes the same restriction enzyme site as the 5 ′ end of the amplified promoter, and the 5 ′ end of the second targeting sequence is the same restriction site as the 3 ′ end of the amplified promoter. including. The amplified promoter and targeting sequence is digested and ligated together.

  Promoter-targeting sequence constructs are delivered to cells as naked polynucleotides or in combination with transfection facilitating agents detailed above, such as liposomes, viral sequences, viral particles, whole viruses, lipofection, precipitants, etc. . The P promoter-targeting sequence can be delivered by any method, such as direct needle injection, intravenous injection, local administration, catheter injection, particle accelerator, and the like. These methods are described in detail below.

  The promoter-targeting sequence construct is taken up by the cell. Homologous recombination occurs between the construct and the endogenous sequence, and the endogenous sequence is placed under the control of the promoter. The promoter then expresses the endogenous sequence.

  The polynucleotide encoding the polypeptide of the present invention can be administered together with other polynucleotide encoding a blood vessel-derived protein. Vascular derived proteins include, for example, acidic and basic fibroblast growth factor, VEGF-1, VEGF-2 (VEGF-C), VEGF-3 (VEGF-B), epidermal growth factor alpha and beta, platelet derived endothelium Cell growth factor, platelet derived growth factor, tumor necrosis factor alpha, hepatocyte growth factor, insulin-like growth factor, colony stimulating factor, macrophage colony stimulating factor, granulocyte / macrophage colony stimulating factor, and nitric oxide synthase, etc. It is not limited to these.

  The polynucleotide encoding the polypeptide of the present invention preferably contains a secretory signal sequence that facilitates secretion of the protein. Typically, the signal sequence is placed in the coding region of the polynucleotide to be expressed, near the 5 ′ end of the coding region or at the 5 ′ end of the coding region. The signal sequence may be homologous or heterologous to the polynucleotide of interest, and may be homologous or heterologous to the transfected cell. In addition, the signal sequence can be chemically synthesized using methods known in the art.

Any of the above polynucleotide constructs may be administered by any mode of administration as long as the resulting expression of one or more molecules is sufficient to produce a therapeutic effect. These methods include, for example, direct needle injection, systemic injection, catheter injection, biolistic injectors, particle accelerators (ie “gene guns”), gel foam sponge depots, other commercially available depot materials, osmotic pressure Pumps (eg Alza minipumps), oral or suppository solid (tablets or pills) pharmaceutical formulations, and decanting or topical application during surgery. For example, direct injection of a naked calcium phosphate precipitation plasmid into the rat liver and rat spleen, or direct injection of the protein-coated plasmid into the portal vein results in gene expression of the foreign gene in the rat liver (Kaneda et al., Science , 243: 375 (1989)).

  A preferred method of local administration is by direct injection. Preferably, a recombinant molecule of the invention complexed with a delivery vehicle is administered by direct injection into or in the area of the artery. Administering the composition locally within the region of the artery refers to injecting the composition into a region of several centimeters, preferably several millimeters, within the artery.

  Another method of local administration is to contact the polynucleotide construct of the present invention in or near the surgical wound. For example, the patient can be operated on and the surface of the tissue inside the wound can be covered with a polynucleotide construct, or the construct can be injected into a region of the tissue inside the wound.

  A therapeutic composition useful for systemic administration includes a recombinant molecule of the present invention complexed to a targeted delivery vehicle of the present invention. Suitable systemic delivery vehicles include liposomes that include a ligand for targeting the vehicle to a specific site.

Preferred systemic administration methods include intravenous injection, aerosol, oral and transdermal (topical) delivery. Intravenous injection can be performed using standard methods in the art. Aerosol delivery can also be performed using standard techniques in the art (eg, Stribling et al., Proc. Natl. Acad. Sci. USA , 189: 11277-11281 (1992), incorporated herein by reference). See). Oral delivery can be accomplished by conjugating the polynucleotide construct of the present invention to a carrier that can resist degradation by digestive enzymes in the intestine of the animal. Examples of such carriers are plastic capsules or tablets as are known in the art. Topical delivery can be accomplished by mixing the polynucleotide constructs of the present invention with a lipophilic reagent (eg, DMSO) that can penetrate the skin.

  Determining the effective amount of a substance to be delivered includes, for example, the chemical structure and biological activity of the substance, the age and weight of the animal, the exact condition requiring treatment and its severity, and the route of administration, etc. Can depend on a number of factors. The frequency of treatment depends on a number of factors, such as the amount of polynucleotide construct administered at one time, the health condition and medical history of the subject being administered. The exact amount, number of doses and timing will be determined by the attending physician or veterinarian. The therapeutic composition of the present invention can be administered to any animal, preferably to mammals and birds. Preferred mammals include humans, dogs, cats, mice, rats, rabbits, sheep, cows, horses and pigs, with humans being particularly preferred.

  A polynucleotide or polypeptide of the invention, or agonist or antagonist of the invention can be used in an assay to test for one or more biological activities. If these polynucleotides and polypeptides show activity in a particular assay, the molecules may be involved in diseases related to their biological activity. Thus, the polynucleotide or polypeptide, or agonist or antagonist could be used to treat the associated disease.

  Furthermore, in order to select a molecule that modulates the activity of the polypeptide of the present invention, it is also conceivable to use the polypeptide of the present invention or a polynucleotide encoding these polypeptides. In such methods, the polypeptides of the invention are contacted with a selected compound suspected of having antagonist or agonist activity and the activity of these polypeptides after binding is assayed.

  This invention is particularly useful for screening therapeutic compounds performed with any of a variety of drug screening techniques using the polypeptides of the invention or binding fragments thereof. The polypeptide or fragment used in such a test may be immobilized on a solid support, may be expressed on the cell surface, may be in a dissolved free state, It may be located inside. One method of drug screening utilizes eukaryotic or prokaryotic host cells that are stably transformed with a recombinant nucleic acid that expresses the polypeptide or fragment. Drugs are screened against such transformed cells in a competitive binding assay. For example, the formation of a complex between the test agent and the polypeptide of the present invention can be measured.

  Thus, the present invention provides a method of screening for drugs or any other agent that affects the activity mediated by the polypeptides of the present invention. These methods involve contacting such an agent with a polypeptide of the invention or a fragment thereof and assaying for the presence of a complex of the agent and polypeptide or a fragment thereof by methods well known in the art. Including that. In such competitive binding assays, the agent to be screened is typically labeled. After incubation, free drug is separated from what is present as bound. The amount of free or uncomplexed label is a measure of the ability of a particular agent to bind to a polypeptide of the invention.

  Another drug screening technique allows for high-throughput screening of compounds with appropriate binding affinity for the polypeptides of the invention, which technique is incorporated herein by reference. This is described in detail in patent application 84/03564 (published September 13, 1984). Briefly, a number of different small peptide test compounds are synthesized on a solid substrate, such as a plastic pin or some other surface. The peptide test compound is reacted with the polypeptide of the invention and washed. The bound polypeptide is then detected by methods well known in the art. The purified polypeptide is coated directly onto the plate used in the drug screening technique described above. Alternatively, non-neutralizing antibodies can be used to capture the peptide and immobilize it on the solid support.

  The present invention also contemplates the use of competing drug screening assays in which neutralizing antibodies capable of binding the polypeptides of the present invention specifically compete with the test compound for binding to the polypeptide or fragment thereof. In this method, an antibody is used to detect any peptide having one or more antigenic epitopes in common with a polypeptide of the invention.

  The human MGAT3 polypeptides and / or peptides of the invention, or immunogenic fragments or oligopeptides thereof, can be used to screen therapeutic agents or compounds with various drug screening techniques. Fragments used in such screening assays may be in a dissolved and free state, fixed to a solid support, supported on the cell surface, or intracellularly. May be present. The decrease or disappearance of the binding complex formation activity between the ion channel protein and the test drug can be measured. Accordingly, the present invention provides a method of screening or assaying a plurality of compounds for specific binding affinity with an MGAT3 polypeptide or binding peptide fragment of the present invention, comprising preparing a plurality of compounds, and MGAT3 peptide or binding The peptide fragment is mixed with each of the plurality of compounds for a time sufficient to allow binding under appropriate conditions to detect binding of the MGAT3 polypeptide or peptide to each of the plurality of test compounds, Accordingly, provided is a method comprising identifying a compound that specifically binds to an MGAT3 polypeptide or peptide.

  The present invention provides methods for identifying novel human MGAT3 polypeptides and / or compounds that modulate the activity of the peptides. In this method, a potential or candidate compound or drug modulator of the biological activity of MGAT3 is mixed with an MGAT3 polypeptide or peptide, such as the MGAT3 amino acid sequence set forth in SEQ ID NO: 2, and the biological of the MGAT3 polypeptide or peptide The effect of the candidate compound or drug modulator on activity is measured. Such measurable effects include, for example, physical binding interactions, the ability to cleave appropriate substrates, effects on natural and cloned MGAT3-expressing cell lines, and modulator effects, or other physiology mediated by MGAT3 There is a target scale.

  In another method of identifying a compound that modulates the biological activity of a novel MGAT3 polypeptide of the invention, a potential or candidate compound or drug modulator of MGAT3 biological activity is expressed in a host cell that expresses the MGAT3 polypeptide. And the effect of the candidate compound or drug modulator on the biological activity of the MGAT3 polypeptide is measured. The host cell may be a cell that can be induced to express an MGAT3 polypeptide, eg, by inducible expression. Physiological effects of a given modulator candidate on MGAT3 polypeptide can also be measured. Thus, a cellular assay for a particular MGAT3 modulator may be a direct measurement or quantification of the physical biological activity of an MGAT3 polypeptide, or may be a measurement or quantification of a physiological effect. In such methods, preferably the MGAT3 polypeptide described herein is used or contains the expression vector described herein, wherein the MGAT3 polypeptide is expressed, overexpressed or upregulated. Overexpressed recombinant MGAT3 polypeptide is used in a suitable host cell for expressed expression.

  Another embodiment of the present invention is a method for screening for a compound capable of modulating the biological activity of an MGAT3 polypeptide, comprising a nucleic acid sequence encoding the MGAT3 polypeptide or a functional peptide or part thereof. Preparing a host cell containing an expression vector having the expression, determining the biological activity of the expressed MGAT3 polypeptide in the absence of the modulator compound, contacting the cell with the modulator compound, and expressing the expressed MGAT3 polypeptide A method comprising determining a biological activity in the presence of a modulator compound. In such a method, the difference between the activity of the MGAT3 polypeptide in the presence of the modulator compound and the activity of the MGAT3 polypeptide in the absence of the modulator compound indicates the modulating effect of the compound.

  In the assay of the present invention, essentially any chemical compound can be used as a potential modulator or ligand. The compound to be tested as an MGAT3 modulator can be any small chemical compound or biological entity (eg, protein, sugar, nucleic acid, lipid). Test compounds will typically be small chemical compounds and peptides. In general, compounds used as potential modulators can be dissolved in aqueous or organic (eg DMSO-based) solutions. The assay is designed to screen large compound libraries by automating the assay steps and providing compounds from any convenient source. The assay is typically performed in parallel in a microtiter format on a microtiter plate, for example by a robotic assay. There are many suppliers of chemical compounds, such as Sigma (St. Louis, MO), Aldrich (St. Louis, MO), Sigma-Aldrich (St. Louis, MO), Fluka Chemika-Biochemica Analytika (Buchs, Switzerland). The compounds may also be synthesized by methods known in the art.

  High-throughput screening methods are particularly contemplated for detecting modulators of the novel MGAT3 polynucleotides and polypeptides described herein. Such high-throughput screening methods typically provide a combinatorial compound or peptide library containing a large number of potential therapeutic compounds (eg, ligands or modulator compounds). These combinatorial compound libraries or ligand libraries are then screened in one or more assays to identify those library components (eg, specific species or subclasses) that exhibit the desired characteristic activity. Identify. The compounds so identified can serve as normal lead compounds or can themselves be used as potential or real therapeutics.

  A combinatorial compound library is a collection of diverse chemical compounds produced by combining many chemical building blocks (ie, reagents such as amino acids) by chemical synthesis or biological synthesis. As an example, a linear combinatorial library, such as a polypeptide or peptide library, can consider a set of chemical building blocks for all possible lengths of a given compound (ie the number of amino acids in the polypeptide or peptide compound). Formed by combining in a method. Millions of chemical compounds can be synthesized by such combinatorial mixing of chemical building blocks.

The generation and screening of combinatorial compound libraries is well known to those skilled in the art. Combinatorial libraries include, for example, peptide libraries (US Pat. No. 5,010,175, Furka, 1991, Int. J. Pept. Prot. Res. , 37: 487-493, and Houghton et al., 1991, Nature , 354: 84- 88), but is not limited to these. Other chemistries can also be used to create chemical diversity libraries. Examples of chemical diversity library chemistry include peptoids (PCT Publication No. WO91 / 019735), encoded peptides (PCT Publication No. WO93 / 20242), random biooligomers (PCT Publication No. WO92 / 00091), Benzodiazepines (US Pat. No. 5,288,514), hydantoins, benzodiazepines and diversomers such as dipeptides (Hobbs et al., 1993, Proc. Natl. Acad. Sci. USA , 90: 6909-6913), vinyl poly Peptides (Hagihara et al., 1992, J. Amer. Chem. Soc. , 114: 6568), non-peptide peptoid mimetics with glucose scaffolds (Hirschmann et al., 1992, J. Amer. Chem. Soc. , 114: 9217-9218), similar organic synthesis of small compound libraries (Chen et al., 1994, J. Amer. Chem. Soc. , 116: 2661), oligocarbamates (Cho et al., 1993, Science , 261: 1303) and / or Peptidylphosphonate (Campbell et al., 1994, J Org. Chem. , 59: 658), nucleic acid libraries (Ausubel, Berger and Sambrook, all supra), peptide nucleic acid libraries (US Pat. No. 5,539,083), antibody libraries (eg, Vaughn et al., 1996, Nature Biotechnology , 14 (3): 309-314 and PCT / US96 / 10287), carbohydrate libraries (eg Liang et al., 1996, Science , 274-1520-1522 and US Pat. No. 5,593,853), small organic molecule libraries (eg benzodiazepines) Baum C & EN, Jan. 18, 1993, p. 33, and U.S. Patent No. 5,288,514, isoprenoids, U.S. Patent No. 5,569,588, thiazolidinones and metathiazanones, U.S. Patent No. 5,549,974, pyrrolidines, U.S. Patent No. 5,525,735 And 5,519,134, morpholino compounds, US Pat. No. 5,506,337, etc.), but are not limited thereto.

  Equipment for creating combinatorial libraries is commercially available (eg, Advanced Chem Tech (Louisville, KY) 357MPS, 390MPS, Rainin (Wovan, Mass.) Symphony, Applied Biosystems (Foster City, CA) 433A, Millipore 9050Plus (Bedford, Mass.) And many combinatorial libraries are available on the market (eg ComGenex (Princeton, NJ), Asinex (Moscow, Russia), Tripos, Inc. (St. Louis, MO), ChemStar, Ltd. (Moscow, Russia), 3D Pharmaceuticals (Exton, PA), Martek Biosciences (Columbia, Maryland), etc.).

  In one embodiment, the present invention provides a high-throughput solid phase in vitro assay in which cells or tissues that express ion channels are attached to a solid phase substrate. Such high throughput assays can screen up to thousands of modulators or ligands in a single day. Specifically, each well of the microtiter plate is used to perform a separate assay for the selected potential modulator, or every 5-10 wells if the effect of concentration or incubation time is to be observed. One modulator can be tested at a time. Thus, a single standard microtiter plate can assay about 96 modulators. Using 1536 well plates, one plate can easily assay from about 100 to about 1500 compounds. Since several different plates can be assayed per day, assay screening of, for example, up to about 6000-20000 compounds is possible using the described integrated system.

  In another embodiment, the present invention encompasses screening and small molecule (eg, drug) detection assays involving the detection or identification of small molecules that can bind to a given protein, ie, MGAT3 polypeptide or peptide. Assays suitable for high throughput screening methods are particularly preferred.

  In such bound detection, identification or screening assays, functional assays are typically not necessary. What is needed is a target protein (preferably substantially purified) and a compound library or compound panel (eg, ligand, drug, small molecule) or biological object to be screened or assayed for binding to the protein target. Only. Preferably, most small molecules that bind to the target protein will modulate activity in some way due to selective, higher affinity binding to functional regions or functional sites on the protein.

An example of such an assay is the fluorescence-based heat shift assay (3-Dimensional Pharmaceuticals, Inc. (3DP), Exton, Pa.) Described in US Pat. See also J. Zimmerman, 2000, Gen. Eng.News , 20 (8). In this assay, small molecules (eg, drugs, ligands) that bind to expressed, and preferably purified ion channel polypeptides, are bound to their binding affinity by analysis of the thermal unfolding curve of the protein-drug or ligand complex. It is possible to detect based on the decision. If desired, the drug or binding molecule determined by this technique can be further assayed by methods as described herein to determine whether the molecule affects the function or activity of the target protein, or It can be determined whether to modulate function or activity.

  For purification of MGAT3 polypeptides or peptides for measuring biological binding or ligand binding activity, prepared by performing continuous freeze-thaw cycles (eg 1-3 times) in the presence of standard protease inhibitors The whole cell lysate that can be made can be the source. MGAT3 polypeptides can be obtained by standard protein purification methods, such as affinity chromatography using specific antibodies described below, or by ligands specific for the epitope tags incorporated into the recombinant MGAT3 polypeptide molecules described herein. Partial or complete purification can be performed. The binding activity can then be measured as described.

  A compound that modulates or modulates the biological activity or physiology of an MGAT3 polypeptide of the present invention identified by the methods described herein is a preferred embodiment of the present invention. Such modulatory compounds are for treating a condition mediated by the novel MGAT3 polypeptide by administering to an individual in need thereof a therapeutically effective amount of a compound identified by the methods described herein. It is believed that it can be used in treatment and therapy methods.

  Furthermore, the present invention provides a method of treating an individual in need of treatment of a disease, disorder or condition mediated by the MGAT3 polypeptide of the present invention, the MGAT3 modulating compound identified by the methods described herein Of administering a therapeutically effective amount of to the individual.

In a specific embodiment, the antagonist of the present invention is a nucleic acid corresponding to the sequence contained in SEQ ID NO: 1 or its complementary strand and / or the nucleotide sequence contained in at least one deposited clone. In one embodiment, the antisense sequence is generated in vivo by the organism, and in another embodiment, the antisense sequence is administered separately (eg, O'Connor, Neurochem. , 56: 560 (1991), " Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression ”(CRC Press, Boca Raton, Florida, 1988)). Antisense technology can be used to control gene expression by antisense DNA or RNA or by triple helix formation. Antisense technology is discussed, for example, in Okano, Neurochem. , 56: 560 (1991), “Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression” (CRC Press, Boca Raton, Florida, 1988). Triple helix formation is discussed, for example, in Lee et al., Nucleic Acids Research , 6: 3073 (1979), Cooney et al., Science , 241: 456 (1988), and Dervan et al., Science , 251: 1300 (1991). . These methods are based on the binding of polynucleotides to complementary DNA or RNA.

For example, inhibition of growth of non-lymphocytic leukemia cell line HL-60 and other cell lines using c-myc and c-myb antisense RNA constructs has been described previously (Wickstrom et al. (1988), Anfossi et al. (1989)). These experiments were performed in vitro by incubating cells with oligonucleotides. A similar approach for in vivo is described in WO91 / 15580. Briefly, for a given antisense RNA, a pair of oligonucleotides are made as follows. The sequence complementary to the first 15 bases of the open reading frame is flanked by an EcoR1 site at the 5 ′ end and a HindIII site at the 3 ′ end. Next, the oligonucleotide pairs are heated at 90 ° C. for 1 minute and annealed in 2 × ligation buffer (20 mM Tris HCl, pH 7.5, 10 mM MgCl ₂ , 10 mM dithiothreitol (DTT) and 0.2 mM ATP). Ligate to the EcoR1 / HindIII site of the retroviral vector PMV7 (WO91 / 15580).

For example, antisense RNA oligonucleotides of about 10-40 base pairs in length can be designed using the 5 ′ coding portion of a polynucleotide encoding the mature polypeptide of the invention. DNA oligonucleotides are designed to be complementary to a region of the gene involved in transcription, thus preventing receptor transcription and production. Antisense RNA oligonucleotides hybridize to mRNA in vivo and prevent the mRNA molecule from being translated into a receptor polypeptide. Antisense oligonucleotides may be single stranded or double stranded. Double-stranded RNA is described in Paddison et al . , Proc. Nat. Acad. Sci. , 99: 1443-1448 (2002) and International Publication Nos. WO01 / 29058 and WO99 / 32619, which are incorporated herein by reference. It can design based on description of.

In one embodiment, the antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence. For example, the vector or portion thereof is transcribed to produce the antisense nucleic acid (RNA) of the invention. Such vectors will contain sequences encoding the antisense nucleic acid of the invention. Such a vector may remain episomal or become chromosomally integrated, as long as it is transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. The vector can be a plasmid, virus, or other vector known in the art used for replication and expression in vertebrate cells. Expression of the sequence encoding the polypeptide of the present invention or a fragment thereof can be by any promoter known in the art to act in vertebrate cells, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include, for example, the SV40 early promoter region (Bernoist and Chambon, Nature , 29: 304-310 (1981)), the Rous sarcoma virus 3 ′ long terminal repeat (Yamamoto et al., Cell , 22: 787-797). (1980)), herpes thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. USA, 78: 1441-1445 (1981)), regulatory sequences of metallothionein genes (Brinster et al., Nature , 296: 39-42 (1982) )), But is not limited to these.

  The antisense nucleic acid of the invention comprises a sequence that is complementary to at least a portion of an RNA transcript of a gene of interest. However, absolute complementarity is preferred but not necessary. As used herein, a sequence “complementary to at least a portion of RNA” means a sequence having sufficient complementarity to have the ability to hybridize with RNA to form a stable duplex, In the case of double-stranded antisense nucleic acids of the invention, one strand of double-stranded DNA can be examined or triplex formation can be assayed. The ability to hybridize will depend on the degree of complementarity as well as the length of the antisense nucleic acid. In general, the larger the nucleic acid that hybridizes, the more stable duplexes (in some cases, triplexes) can be formed even with more mismatches with the RNA sequence of the present invention. One skilled in the art can ascertain the extent of acceptable mismatch using standard methods to determine the melting point of the hybridized complex.

Oligonucleotides complementary to the 5 ′ end of the message, eg, from the 5 ′ untranslated sequence to the AUG start codon (including the AUG start codon), should most efficiently inhibit translation. However, sequences complementary to the 3 'untranslated sequence of mRNA have also been shown to effectively inhibit translation of mRNA. For a general theory, see Wagner, R., Nature , 372: 333-335 (1994). Thus, oligonucleotides complementary to the 5 ′ untranslated noncoding region or 3 ′ untranslated noncoding region of the polynucleotide sequences of the invention can be used in antisense methods to inhibit translation of endogenous mRNA. right. Oligonucleotides complementary to the 5 ′ untranslated region of the mRNA should include the complementary strand of the AUG start codon. Antisense oligonucleotides complementary to the mRNA coding region are not very efficient translation inhibitors, but could be used in the present invention. Whether designed to hybridize to the 5 'region, 3' region or coding region of an mRNA, antisense nucleic acids should have a length of at least 6 nucleotides and oligos from 6 to about 50 nucleotides in length. It is preferably a nucleotide. In specific embodiments, the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides, or at least 50 nucleotides.

The polynucleotides of the invention can be single-stranded or double-stranded DNA or RNA or chimeric mixtures or derivatives or modified forms thereof. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate ester backbone moiety, for example, for the purpose of improving the stability, hybridization, etc. of the molecule. The oligonucleotides include other groups such as peptides (to target host cell receptors in vivo) or cell membranes (eg Letsinger et al., Proc. Natl. Acad. Sci. USA , 86: 6553-6556 (1989)). Lemaitre et al . , Proc. Natl. Acad. Sci. , 84: 648-652 (1987), see PCT Publication No. W088 / 09810 published December 15, 1988) or the blood brain barrier (eg, 1988 4 Agents that facilitate transport across PCT Publication W089 / 10134 published 25th May, hybridization-inducing cleavage agents (see, eg, Krol et al., BioTechniques , 6: 958-976 (1988)) or insertions An agent (see, for example, Zon, Pharm. Res . , 5: 539-549 (1988)) may be added. To achieve this goal, the oligonucleotide can be conjugated with another molecule, such as a peptide, a hybridization-inducing cross-linking agent, a transport agent, a hybridization-inducing cleavage agent, and the like.

  Antisense oligonucleotides include, for example, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylamino Methyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylcuocin, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- Mannosyl cuocin, 5'-methoxycarboxymethyluracil, 5-methoxy Uracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, cuocin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4- Thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) It may comprise at least one modified base moiety selected from the group including, but not limited to, uracil, (acp3) w, and 2,6-diaminopurine and the like.

  The antisense oligonucleotide may also include at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, hexose, and the like.

  In yet another embodiment, the antisense oligonucleotide is a phosphorothioate, phosphorodithioate, phosphoramidothioate, phosphoramidate, phosphordiamidate, methylphosphonate, alkylphosphotriester, and formacetal or Including at least one modified phosphate backbone selected from the group including, but not limited to, analogs thereof.

In yet another embodiment, the antisense oligonucleotide is an α-anomeric oligonucleotide. α-anomeric oligonucleotides form special double-stranded hybrids with complementary RNA, in contrast to normal β-units, in which the strands run parallel to each other (Gautier et al. , Nucl. Acids Res. 15: 6625-6641 (1987)). The oligonucleotide is composed of 2-O-methyl ribonucleotide (Inoue et al. , Nucl. Acids Res. , 15: 6131-6148 (1987)) or chimeric RNA-DNA analog (Inoue et al., FEBS Lett. 215: 327-330) . (1987)).

The polynucleotides of the invention can be synthesized by standard methods known in the art, for example, using an automated DNA synthesizer (eg, commercially available from Biosearch, Applied Biosystems, etc.). For example, phosphorothioate oligonucleotides can be synthesized by the method of Stein et al. ( Nucl. Acids Res. , 16: 3209 (1988)), and methylphosphonate oligonucleotides are produced using a controlled pore glass polymer support. (Sarin et al., Proc. Natl. Acad. Sci. USA , 85: 7448-7451 (1988)).

  Although antisense nucleotides complementary to the coding region sequences of the present invention may be used, those complementary to the transcribed untranslated region are most preferred.

Potential antagonists of the present invention also include catalytic RNAs, ie ribozymes (eg PCT International Publication WO 90/11364, published Oct. 4, 1990, Sarver et al., Science, 247: 1222-1225 (1990)). See). Although ribozymes that cleave mRNA at specific recognition sequences can be used to destroy the mRNA corresponding to the polynucleotides of the present invention, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at sites determined by flanking regions that form complementary base pairs with the target mRNA. The only requirement is that the target mRNA has the following sequence of two bases, namely 5′-UG-3 ′. The construction and production of hammerhead ribozymes is well known in the art and is described in detail in Haseloff and Gerlach, Nature , 334: 585-591 (1988). There are a large number of potential hammerhead ribozyme cleavage sites for each nucleotide sequence disclosed in the sequence listing. Preferably, the cleavage recognition site is located near the 5 'end of the mRNA corresponding to the polynucleotide of the invention, i.e., the efficiency is increased and the intracellular accumulation of non-functional mRNA transcripts is minimized. Design a ribozyme.

  As in the antisense method, the ribozyme of the present invention can consist of a modified oligonucleotide (eg, so as to improve stability, targeting, etc.) and can be applied to cells that express the polynucleotide of the present invention in vivo. Should be delivered. A DNA construct encoding a ribozyme can be introduced into a cell in the same manner as described above for the introduction of antisense-encoding DNA. A preferred delivery method uses a ribozyme under the control of a strong constitutive promoter, such as a polIII or poII promoter, so that the transfected cells produce an amount of ribozyme sufficient to destroy endogenous messages and inhibit translation. Use the “coding” DNA construct. Ribozymes are catalytic molecules, unlike antisense molecules, and are therefore effective even at lower intracellular concentrations than antisense molecules.

  Antagonist / agonist compounds inhibit the cell growth and cell proliferation effects (ie stimulation of tumor angiogenesis) of the polypeptides of the invention on neoplastic cells and neoplasia, and thus, for example, abnormal cell growth and tumor growth or tumor growth. Can be used to retard or prevent cell proliferation.

  The antagonist / agonist can also be used to prevent hypervascular disease and prevent proliferation of epithelial lens cells after extracapsular cataract surgery. Prevention of the mitogenic activity of the polypeptides of the invention may also be desirable in cases such as reocclusion after balloon angioplasty.

  The antagonist / agonist can also be used to prevent the growth of scar tissue during wound healing.

  The antagonist / agonist can also be used to treat, prevent, and / or diagnose the diseases described herein.

  Accordingly, the present invention relates to diseases associated with overexpression of the polynucleotide of the present invention by administering to a patient (a) an antisense molecule against the polynucleotide of the present invention and / or (b) a ribozyme against the polynucleotide of the present invention. A method of treating or preventing a disorder and / or condition, such as, but not limited to, the diseases, disorders and / or conditions listed herein.

  The following section describes the materials and methods utilized in the present invention.

Materials and methods
A. Identification of human MGAT3 by bioinformatics analysis Using the Saccharomyces cerevisiae Sc DGAT2 sequence (accession number YOR245C, Lardizabal, KD et al. (2001) J. Biol. Chem. , 276 (42): 38862-9) On the other hand, a comprehensive BLAST search was performed. The resulting sequence was used to capture existing ESTs. Next, the coding sequence of the candidate gene was predicted using the EST information and the Genscan program. These candidates were further screened using the following criteria: That is, the gene product must 1) be novel, 2) encode a 30-40 kDa protein, 3) contain at least one transmembrane region, but do not contain a signal sequence, 4 ) The amino acid sequence must be highly conserved with Sc DGAT2. Tissue expression patterns of candidate genes that met all these criteria were profiled using TaqMan ™ quantitative PCR.

  As shown in FIG. 8, one candidate gene (named MGAT3) that was found to be highly expressed in the small intestine was selected and examined in more detail. In order to perform a sequence comparison between MGAT3 and its related proteins, the sequence identity and sequence similarity were calculated using Gap in the GCG program. Multiple sequence alignment was performed using the ClustalW algorithm in the VectorNTI program.

  Map the MGAT3 cDNA sequence (SEQ ID NO: 1) to the human genome (NCBI human genome version 29) using the Mega-Blast / Sim4 method in the Biotique Local Integration System (BLIS) program to map the human MGAT3 chromosome localization did.

B. Cloning of human MGAT3 cDNA An antisense oligo (named Oligo A) with biotin at the 5 'end and the following sequence was designed using the predicted sequence obtained by bioinformatics analysis: 5'-biotin-GCCCACTGCTTCTAGATGCTGCTTCTGCAAGGTTTTGGAAGTGGTTGGGGGCTGCAGGGTTGTGGCAACTCCCATTGCAG-3 '(SEQ ID NO: 15). To enrich for single-stranded cDNA that hybridizes to this sequence, 0.2 ng of oligo A in 50% formamide in several single-stranded covalently closed cDNA libraries (Life Technologies, Rockville, Md.) ) And 6 μg of the mixture. The mixture was heated 2 min at 95 ° C., 50% _{formamide, 0.75M NaCl, 0.02M NaP0 4 (} pH7.2), in 2.5mM EDTA, 0.1% SDS, was 26 hours hybridized at 42 ° C.. Incubate oligo A / cDNA hybrid with streptavidin magnet in buffer containing 10 mM Tris-HCI (pH 7.5), 0.5 M NaCl, 1 mM EDTA for 60 minutes with agitation every 5 minutes did. The beads were removed from the solution using a magnet and washed 3 times at 45 ° C. in 200 μl 0.1 × SSPE, 0.1% SDS. Concentrated single-stranded cDNA was released from the oligo A / streptavidin magnetic bead complex by incubating with 0.1N NaOH for 10 minutes. The released single stranded cDNA was ethanol precipitated and converted to double stranded by PCR using the following oligo pairs:
Forward: 5'-GAGCTTCTGCAATGGGAGTT-3 '(SEQ ID NO: 16)
Reverse: 5′-TGAGCACATATTGGTAGGCG-3 ′ (SEQ ID NO: 17).

  The double stranded cDNA was then introduced into E. coli DH12S cells. Transformants with the correct expected size were sequenced. The sequence fidelity was confirmed by comparison with the human genome sequence, and one clone (named human MGAT3) with a sequence expected to contain the entire open reading frame was selected for further investigation.

C. TaqMan (TM) quantitative PCR analysis of human MGAT3
Total RNA was isolated using the TriZol protocol (Invitrogen) and quantified with OD260. For any of the experiments described here, the rRNA 18s and 28s bands were evaluated by denaturing gel electrophoresis to ensure RNA integrity. Primers and probes for real-time PCR were obtained from ABI. First, human MGAT3 sequences were aligned with related genes found in GenBank to identify regions with significantly different sequences. Next, human HGAT3 primers and probes were designed using ABI Primer Express software to amplify small replicons (150 base pairs or less). In addition, in order to ensure target specificity, all primer sequences and primer sequences were searched against the Genbank database. The oligo sequence is:
Forward primer: ACTCTGGCCCTTCTCTGTTTTTT (SEQ ID NO: 18)
Reverse primer: AACGCCTTCCACCTTGGTT (SEQ ID NO: 19)
Probe: TCCCAGTCCACATAGAGCCACACCAAG (SEQ ID NO: 20).

Samples were heated to 72 ° C. for 2 hours and then cooled to 55 ° C. for 30 minutes to anneal 100 ng DNase treated total RNA to 2.5 μM reverse primer in the presence of 5.5 mM MgCl ₂ . MuLv reverse transcriptase (1.25 U / μl) and dNTPs (500 μM each) were added to the reaction solution at 37 ° C. for 30 minutes. The sample was then heated to 90 ° C. for 5 minutes to denature the enzyme. Quantitative sequence detection was performed on the ABI PRISM 7700 by adding 2.5 μM forward and reverse primers, 2.0 μM probe, 500 μM dNTPs, buffer and 5 U AmpliTaq Gold ™ to the reverse transcribed reaction mixture. . Next, the PCR reaction solution was kept at 94 ° C. for 12 hours and then subjected to 40 cycles of 94 ° C. for 15 seconds and 60 ° C. for 30 seconds. After this was done, the threshold cycle (Ct) of the lowest expressing tissue was used as a baseline for expression. All other tissue expression levels were expressed as relative amounts to the tissue by calculating the difference in Ct values. The magnification of the difference between the baseline and other tissues is calculated as 2ΔCt.

D. Expression of recombinant human MGAT3 in insect cells The predicted coding sequence of human MGAT3 is fused with the NH ₂ terminal FLAG epitope (MG DYKDDDDG (SEQ ID NO: 21) epitope underlined) and Bac-to-Bac ™ kit (Life Technologies) Was expressed in Spodoptera frugiperda (Sf9) insect cells by using according to the manufacturer's instructions. As a control, recombinant FLAG-human-DGAT2 was similarly expressed. In general, cells were infected with virus (MOI> 3) for 2 days. After harvesting, the cells are washed with PBS and then probed sonicator in homogenization buffer (10 mM Tris-HCl, pH 7.4, 250 mM sucrose, 1 × protease inhibitor cocktail [Roche]). Homogenized using. Membrane fractions (100,000 × g pellet) were stored at −80 ° C. until used for enzyme assay. For immunoblot analysis, 2 μg of membrane protein was loaded onto SDS-PAGE and probed with anti-FLAG M2 IgG (Sigma).

E. MGAT enzyme assay
With modifications to the Coleman protocol (Coleman, RA (1992) Methods Enzymol. 209: 98-104), MGAT activity was assayed in a final volume of 200 μl at 37 ° C. for 5-10 minutes. Each reaction contained 10 μl of membrane protein in assay buffer (100 mM Tris-HCl (pH 7.5), 5 mM MgCl ₂ , 1.25 mg / ml BSA, 250 mM sucrose, 800 μM phosphatidylcholine liposomes). In general, 50 μM acylcoenzyme A and 200 μM sn-2-monoacylglycerol (delivered in acetone, final acetone concentration <2%) were used. The reaction was initiated by the addition of protein and stopped by the addition of chloroform / methanol (2/1, v / v). The extracted lipids were dried and separated by thin layer chromatography (TLC) with hexane / ethyl acetate / acetic acid (85/15 / 0.5, v / v / v).

Triacylglycerol (TAG), diacylglycerol (DAG), monoacylglycerol (MAG), free fatty acid (FFA) and other lipids were verified with a lipid preparation (Sigma) after staining with iodine vapor. Enzyme specific activity was traced by measuring the incorporation of [ ¹⁴ C] oleoyl-CoA (20,000 dpm / nmol) or sn-2- [ ³ H] monooleoylglycerol (20,000 dpm / nmol). The chromatogram was also analyzed using STORM PhosphoImager.

Bioinformatics and cDNA cloning of MGAT3 By using the above “Materials and Methods”, the cDNA of MGAT3 has the polynucleotide sequence shown in FIG. 1 and SEQ ID NO: 1, and the 341 amino acids shown in FIG. 1 and SEQ ID NO: 2. It was found to encode a protein.

Hydrophobic analysis (Figure 3) suggests that the predicted MGAT3 protein contains up to 5 potential transmembrane domains, but does not contain a classical signal sequence at its NH ₂ terminus. MGAT3 was found to be homologous to members of the DGAT2 gene family (Figure 2). Sequence comparison shows that MGAT3 has 49% identity and 60% similarity to DGAT2, and 44% identity and 51% similarity to MGAT1. Therefore, MGAT3 is a new member of the DGAT2 gene family (see Cases, S. et al. (2001) J. Biol. Chem. , 276 (42): 38870-6) for a discussion of the DGAT2 gene family) .

Expression of Recombinant Human MGAT3 in Insect Sf9 Cells Using the “Materials and Methods” described above, recombinant human MGAT3 was expressed in insect Sf9 cells. In order to facilitate the detection of MGAT3 heterologous protein, one copy of the FLAG epitope was fused to the NH ₂ terminus in a reading frame. When three independent MGAT3 recombinant baculovirus strains were established, preliminary results indicated that they all expressed the same protein. We decided to select one at random and conduct further testing.

When infected with recombinant MGAT3 virus, the Sf9 cell membrane extract produced a 36 kDa band detected by anti-FLAG IgG on the SDS-PAGE gel (FIG. 4A, lane 2). The size of this protein is consistent with the expected molecular weight of human MGAT3. This band is absent from the wild type virus and is different from human DGAT2 (Figure 4, lanes 1 and 3). An MGAT assay using radioactive [ ¹⁴ C] oleoyl-CoA as a tracer was performed using a small fraction of membrane. The TLC chromatogram shows that when exogenous 2-monooleoyl glyceryl is added, the recombinant MGAT3 membrane produces two bands corresponding to 1,2- and 1,3-diacylglycerol (DAG) ( Figure 4B, lane 5). These DAG products were not observed when membranes infected with wild type virus or DGAT2 virus were used (FIG. 4B, lane 4 and lane 6).

  Both MGAT3 and DGAT2 membranes added from the outside produced a triacylglycerol (TAG) band (FIG. 4B, lane 5 and lane 6). However, wild type virus failed to generate any TAG-labeled band (Figure 4B, lane 4). A possible explanation is that endogenous insect cell membrane proteins have background levels of MGAT activity and recombinant DGAT2 can generate TAG using its DAG product as a substrate. In order to verify the possibility that MGAT3 also has DGAT activity, exogenous DAG was directly assayed in lanes 7-9 (FIG. 4B). In fact, like DGAT2, the MGAT3 membrane was able to acylate DAG and generate TAG directly.

  To quantitatively assess recombinant MGAT3 activity, labeled DAG and TAG bands were excised from the TLC sheet and subjected to liquid scintillation counting (FIG. 5B). Concomitant with the appearance of MGAT3-specific bands detected by anti-FLAG IgG (FIG. 5A), specific activities expressed in Sf9 cell membranes are up to 22.8 nmol / min / mg for DAG and 9.3 nmol / for TAG. Rise to min / mg. Over the entire time course, wild-type virus infection resulted in background levels of activity of 0.5 nmol / min / mg for DAG and 0.2 nmol / min / mg for TAG.

  These results demonstrate that MGAT3 cDNA encodes a membrane protein with dual MGAT and DGAT activity.

Characterization of the enzymatic characteristics of recombinant human MGAT3 Using the "Materials and Methods" described above, the enzymatic characteristics of recombinant human MGAT3 were characterized. In order to optimize the MGAT assay conditions, the substrate concentration was titrated (Figure 6). The optimal concentration of oleoyl-CoA is 50 μM (FIG. 6A), and the optimal concentration of 2-monooleoylglycerol is 200 μM. As the concentration of 2-monooleoylglycerol further increased, DAG synthesis continued to increase until the concentration reached 1 mM, but TAG synthesis decreased.

  To assess MAG stereoisomer specificity, sn-1-monooleoylglycerol (1-MAG), sn-2-monooleoylglycerol (2-MAG) and sn-3-monopalmitoylglycerol (3- MAG) was assayed (FIG. 7A). The results show that MGAT3 prefers 2-MAG as a substrate for synthesizing DAG (compare lane 5 in FIG. 7A with lane 2 and lane 8). No matter what type of MAG was used, the amount of synthesized TAG did not change. The background MGAT activity of the endogenous insect cell membrane may not have stereospecificity with respect to MAG. When background levels of DAG are produced, the DGAT activity encoded by MGAT3 uses it to generate TAG.

  To directly verify this possibility, DGAT2 virus was also used in parallel for infection of Sf9 cells for comparison (FIG. 7A, lanes 3, 6 and 9). In fact, the recombinant DGAT2 membrane was able to synthesize similar amounts of TAG using three different MAG stereoisomers. Furthermore, the amount of TAG synthesized by recombinant DGAT2 was equivalent to that by MGAT3.

To assess substrate optimality for acyl-CoA, radioactive sn-2- [ ³ H] monooleoyl glycerol was used as a tracer and various acyl-CoAs were used. As shown in FIG. 7B, palmitoyl-CoA (C16: 0) and oleoyl-CoA (C18: 1) are the best substrates for MGAT3.

Tissue expression profile of human MGAT3 Using the “Materials and Methods” described above, the tissue expression profile of human MGAT3 was analyzed. As shown in FIG. 8, analysis of human MGAT3 by TaqMan ™ quantitative PCR reveals that this gene is selectively expressed in the digestive system. The tissue with the highest expression level was the ileum, and its transcript was found to be about 45,000 times higher than that observed in most tissues other than the gastrointestinal tract. The tissue with the second highest expression level constitutes the rest of the lower GI: jejunum, duodenum, colon, cecum and rectum. Transcripts are not found especially in the stomach and esophagus and trachea.

  The only other non-GI related tissue that shows appreciable expression is the liver. These data indicate that MGAT3 is an unacceptable MGAT gene whose expression causes high levels of intestinal MGAT enzyme activity.

  The relative steady state expression level of MGAT3 was compared between RNA isolated from Crohn's disease ileum and RNA isolated from normal controls (Figure 9). These data demonstrate that steady state levels of MGAT3 expression are significantly lower in ileal RNA obtained from patients with Crohn's disease than those isolated from normal individuals.

Chromosomal localization of human MGAT3
The MGAT3 gene is located on human chromosome 7Q22.1 (Figure 10). This region contains susceptibility loci for both Crohn's disease and ulcerative colitis (Satsangi, J. et al. (1996) Nat. Genet. , 14 (2): 199-202).

Methods for Making N-Terminal Deletion Mutants and C-Terminal Deletion Mutants As described elsewhere herein, the present invention relates to N-terminal deletion mutations corresponding to MGAT3 polypeptides of the present invention. And any combination of N-terminal and C-terminal deletions thereof. Several methods are available to those skilled in the art for generating such mutants. Such methods can include a combination of PCR amplification and gene cloning methods. Those skilled in the field of molecular biology will make use of what is described or referred to herein and / or other techniques known in the art as standard methods. Although a mutant can be easily produced, a representative method is described below.

Exemplary PCR amplification conditions are shown below, but those skilled in the art will appreciate that other conditions may be required for efficient amplification. A 100 μl PCR reaction mixture can be prepared using 10 ng of template DNA (MGAT3 cDNA clone), 4 types of dNTP 200 μM, 1 μM primer, 0.25 U Taq DNA polymerase (PE), and standard Taq DNA polymerase buffer. Typical PCR cycling conditions are as follows:
20-25 cycles:
45 seconds, 93 ° C
2 minutes, 50 ° C
2 minutes, 72 ° C
1 Cycle:
10 minutes, 72 ° C.

  After the final extension step of PCR, 5U Klenow fragment can be added and incubated at 30 degrees for 15 minutes.

  After digesting the fragment with NotI and SalI restriction enzymes, the fragment could be cloned into an appropriate expression and / or cloning vector (eg, pSort1) that had been similarly digested. Those skilled in the art will appreciate that other plasmids can be substituted as well, and that other plasmids may be desirable. The digested fragment and vector are then ligated with DNA ligase and used to transform competent E. coli by the methods described herein and / or other methods known in the art. .

The 5 ′ primer sequence for amplifying any other N-terminal deletion mutant can be determined with reference to the following formula:
(S + (X × 3))-((S + (X × 3)) + 25)
[Wherein “S” corresponds to the nucleotide position of the start codon of the MGAT3 gene (SEQ ID NO: 1) and “X” corresponds to the most N-terminal amino acid of the intended N-terminal deletion mutant]. The first term will give the starting 5 ′ nucleotide position of the 5 ′ primer and the second term will give the terminal 3 ′ nucleotide position of the 5 ′ primer corresponding to the sense strand of SEQ ID NO: 1. Once the corresponding nucleotide position of the primer is determined, the final nucleotide sequence can be generated, for example, by adding an applicable restriction enzyme site at the 5 'end of the sequence. As mentioned herein, it may be desirable to add other sequences (eg, Kozak sequences) to the 5 ′ primer.

The 3 ′ primer sequence for amplifying any other N-terminal deletion mutant can be determined with reference to the following formula:
(S + (X × 3)) − ((S + (X × 3)) − 25)
[Wherein “S” corresponds to the nucleotide position of the start codon of the MGAT3 gene (SEQ ID NO: 1) and “X” corresponds to the most C-terminal amino acid of the intended N-terminal deletion mutant]. The first term will give the starting 5 'nucleotide position of the 3' primer and the second term will give the 3 'nucleotide position of the 3' primer corresponding to the antisense strand of SEQ ID NO: 1. Once the corresponding nucleotide position of the primer is determined, the final nucleotide sequence can be generated, for example, by adding an applicable restriction enzyme site at the 5 'end of the sequence. As mentioned herein, it may be desirable to add other sequences (eg, stop codon sequences, etc.) to the 3 ′ primer. One skilled in the art will appreciate that the above nucleotide position modifications may be required to optimize PCR amplification.

  The same general formula as above can also be used to identify 5 'and 3' primer sequences for amplifying any C-terminal deletion mutant of the invention. In addition, the same general formula as above is also used to identify the 5 ′ and 3 ′ primer sequences for amplifying the deletion mutants of the present invention with a combined N-terminal deletion and C-terminal deletion. be able to. One skilled in the art will appreciate that the above nucleotide position modifications may be required to optimize PCR amplification.

  Although the present invention has been described in terms of its specific embodiments, further modifications are possible, and the present application may be any variation, application or adaptation that is generally in accordance with the principles of the present invention (eg, technical fields related to the present invention). Deviations from the present specification as included in the scope of known or customary implementations, and deviations from the present specification that may apply to the basic features described above, as described in the claims herein. It will be understood that this includes deviations from the above. References mentioned herein are specifically incorporated herein in their entirety.

1A-B are diagrams showing the human MGAT3 cDNA sequence (SEQ ID NO: 1) and the predicted amino acid sequence of human MGAT3 (SEQ ID NO: 2). Expected open frame start and stop codons are italicized. MGAT3 also contains a putative glycerol phospholipid domain shown in bold in the vicinity of amino acids F152 to R239. FIG. 3 shows the alignment of the predicted human MGAT3 amino acid sequence (SEQ ID NO: 2) with the human MGAT1 amino acid sequence (SEQ ID NO: 23; GenBank accession number AF384163) and the human DGAT2 amino acid sequence (SEQ ID NO: 22; GenBank accession number AF384161). is there. This multiple sequence alignment was performed using the ClustalW algorithm in the VectorNTI program. Amino acids that are identical among all members are surrounded by black frames, and similar residues are shaded. It is a figure which shows the hydrophobicity analysis of anticipation human MGAT3. Analysis was performed using the Kyte-Doolittle algorithm (Kyte, J. and R.F. Doolittle (1982) J. Mol. Biol., 157 (1): 105-32). A positive score is proportional to the degree of hydrophobicity. It is a figure which shows expression of recombinant human MGAT3 in Sf9 insect cells. On day 0, Sf9 cells were prepared in 25 cm ² flasks at a density of 5 × 10 ⁶ cells / flask. On day 1, cells were infected with wild type baculovirus, MGAT3 recombinant virus or DGAT2 recombinant virus, respectively, with MOI> 3. On day 3, cells were collected and a membrane fraction (100,000 × g pellet) was prepared. A. Immunoblot with anti-FLAG IgG. Each 2 μg / lane of membrane protein was run on SDS-PAGE and the blot was probed with 2 μg / ml anti-FLAG IgG. B. TLC MGAT enzyme assay. Each 10 μg of membrane protein was subjected to MGAT enzyme assay at 37 ° C. for 6 minutes. 200 μM sn-2-monooleoylglycerol and 50 μM [ ¹⁴ C] oleoyl coenzyme A (20,000 dpm / nmol) were incubated with the membrane extract as foreign substrates. Lipid extracts were separated by TLC and their chromatograms were exposed to STORM PhosphoImager for 12 hours. DAG = diacylglycerol; TAG = triacylglycerol; FFA = free fatty acid; MAG = monoacylglycerol, expressed as a non-specific band ^** ; unknown substance = represented as a non-specific band, band ^* , whose chemical properties are unknown. It is a figure which shows the time passage of recombinant human MGAT3 expression. As in the case of FIG. 4, Sf9 cells were prepared and infected with wild type virus or recombinant MGAT3 virus. Membrane extracts were prepared from cells at various post infection times. Part of the membrane fraction was subjected to A) immunoblot analysis with anti-FLAG IgG or B) TLC enzyme assay. 200 μM sn-2-monooleoylglycerol and 50 μM [ ¹⁴ C] oleoyl coenzyme A (20,000 dpm / nnmol) as substrates were incubated with 10 μg membrane fraction for 6 minutes at 37 ° C. After TLC separation, DAG and TAG bands were excised from TLC and subjected to scintillation counting. Activity was expressed as nmol / min / mg protein. Values are the average of duplicate determinations, with a standard deviation of less than 10% of the average. FIG. 5 shows substrate concentration titration for recombinant human MGAT3. As in the case of FIG. 4, Sf9 cells were prepared and infected with wild type virus or recombinant MGAT3 virus. Cells were collected 2 days after infection, membrane fractions were prepared, and portions of the membrane were subjected to MGAT enzyme assay using various substrate concentrations. 200 μM sn-2-monooleoylglycerol and various amounts of [ ¹⁴ C] oleoyl coenzyme A (20,000 dpm / nmol) for A, and 50 μM [ ¹⁴ C] oleoyl coenzyme A (20,000 for B dpm / nmol) and various amounts of sn-2-monooleoylglycerol were incubated with 10 μg membrane fraction for 10 minutes at 37 ° C. Lipid bands corresponding to TAG and DAG were excised from the TLC sheet and counted with a scintillation counter. The activity was defined as a corrected value of the recombinant membrane minus the value of the wild type membrane. The assay was performed in duplicate. The standard deviation was less than 10% of the average. It is a figure which shows the substrate specificity of MGAT3. As in the case of FIG. 4, Sf9 cells were prepared and infected with wild type virus, recombinant MGAT3 virus or DGAT2 virus. To determine A) MAG stereoisomer specificity and B) fatty acyl-CoA selectivity, a portion (10 μg) of the membrane fraction was subjected to MGAT assay. For A, 50 μM [ ¹⁴ C] oleoyl coenzyme A (20,000 dpm / nmol) and 200 μM sn-1-monooleoyl (1-MAG), sn-2-monooleoylglycerol (2-MAG), or sn-3-monopalmitoylglycerol (3-MAG) and in the case of B 200 μM sn-2- [ ³ H] monooleoylglycerol (20,000 dpm / nmol) and 50 μM various acyl-CoA, 10 μg The membrane fraction was incubated for 10 minutes at 37 ° C. C2 = acetyl-CoA; M = malonyl-CoA; C4: 0 = butyryl-CoA; C12: 0 = lauroyl-CoA; C16: 0 = palmitoyl-CoA; C18: 0 = stearoyl-CoA; C20: 0 = arachidoyl- CoA; C18: 1 = oleoyl-CoA; C18: 2 = linoleoyl-CoA; C20: 4 = arachidonoyl-CoA. FIG. 2 shows TaqMan ™ quantitative PCR analysis of MGAT3 in various normal human tissues. FIG. 5 shows TaqMan ™ quantitative PCR analysis of MGAT3 expression in the ileum of Crohn's disease patients compared to normal human specimens. It is a figure which shows the chromosome localization of human MGAT3. The MGAT3 cDNA sequence (SEQ ID NO: 1) was mapped to the human genome (NCBI human genome version 29) using the Mega-Blast / Sim4 method of the Biotique Local Integration System (BLIS) program. The position of MGAT3 is shown in red brackets.

Claims (16)

(A) a polynucleotide fragment of SEQ ID NO: 1, or a polynucleotide fragment of a cDNA sequence contained in at least one of ATCC accession numbers PTA-4454 or PTA-4803, which can hybridize to SEQ ID NO: 1,
(B) a polypeptide fragment of SEQ ID NO: 2, or a polypeptide fragment encoded by a cDNA sequence contained in at least one of ATCC accession numbers PTA-4454 or PTA-4803 and capable of hybridizing to SEQ ID NO: 1, A polynucleotide encoding,
(C) the polypeptide domain of SEQ ID NO: 2, or the polypeptide domain encoded by the cDNA sequence contained in at least one of ATCC accession numbers PTA-4454 or PTA-4803 and capable of hybridizing to SEQ ID NO: 1, A polynucleotide encoding,
(D) the polypeptide epitope of SEQ ID NO: 2, or the polypeptide epitope encoded by the cDNA sequence contained in at least one of ATCC accession numbers PTA-4454 or PTA-4803 and capable of hybridizing to SEQ ID NO: 1; A polynucleotide encoding,
(E) a polynucleotide encoding the polypeptide of SEQ ID NO: 2 having MGAT activity, or a cDNA sequence contained in at least one of ATCC accession numbers PTA-4454 or PTA-4803 and capable of hybridizing to SEQ ID NO: 1 ,
(F) a polynucleotide which is a variant of SEQ ID NO: 1,
(G) a polynucleotide which is an allelic variant of SEQ ID NO: 1,
(H) an isolated polynucleotide comprising nucleotides 171-1190 of SEQ ID NO: 1, wherein said nucleotide encodes a polypeptide corresponding to amino acids 2-341 of SEQ ID NO: 2 excluding the starting methionine;
(I) an isolated polynucleotide comprising nucleotides 168-1190 of SEQ ID NO: 1, wherein said nucleotide encodes a polypeptide corresponding to amino acids 1-341 of SEQ ID NO: 2 comprising the initiation codon;
(J) hybridizes under stringent conditions to any one of the polynucleotide corresponding to the complementary sequence (antisense) of SEQ ID NO: 1 and the polynucleotide described in (k) (a) to (j) A competent polynucleotide that does not hybridize under stringent conditions to a nucleic acid molecule having a nucleotide sequence of only A or T residues;
An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of:   A recombinant vector comprising the isolated nucleic acid molecule of claim 1.   A recombinant host cell comprising the recombinant vector of claim 2. (A) a polypeptide fragment of SEQ ID NO: 2, or the encoded sequence contained in at least one of ATCC accession numbers PTA-4454 or PTA-4803,
(B) a polypeptide fragment of SEQ ID NO: 2 having MGAT activity, or an encoded sequence included in at least one of ATCC accession numbers PTA-4454 or PTA-4803,
(C) the polypeptide main of SEQ ID NO: 2, or the encoded sequence contained in at least one of ATCC accession numbers PTA-4454 or PTA-4803,
(D) a polypeptide epitope of SEQ ID NO: 2, or an encoded sequence included in at least one of ATCC Accession Nos. PTA-4454 or PTA-4803,
(E) the full-length protein of SEQ ID NO: 2, or the encoded sequence contained in at least one of ATCC Accession Nos. PTA-4454 or PTA-4803,
(F) a polypeptide comprising amino acids 2 to 341 of SEQ ID NO: 2, wherein said amino acids 2 to 341 comprise a polypeptide of SEQ ID NO: 2 excluding the starting methionine, and (g) amino acids 1 to A polypeptide comprising 341,
An isolated polypeptide comprising an amino acid sequence selected from the group consisting of:   5. The isolated polypeptide of claim 4, wherein the full length protein comprises a deletion of a contiguous amino acid sequence from its C-terminus or N-terminus.   5. An isolated antibody that specifically binds to the isolated polypeptide of claim 4.   A recombinant host cell that expresses the isolated polypeptide of claim 4. A method for producing an isolated polypeptide comprising the steps of:
(A) culturing the recombinant host cell of claim 7 under conditions such that the polypeptide is expressed, and (b) recovering the polypeptide.   A polypeptide produced by claim 8.   A method for preventing, treating or ameliorating a medical condition comprising administering to a mammalian subject a therapeutically effective amount of the polypeptide of claim 4 or a modulator thereof.   11. The method of claim 10, wherein the medical condition is associated with abnormal MGAT3 activity.   11. The method of claim 10, wherein the medical condition is selected from the group consisting of obesity and gastrointestinal disorders.   13. The method of claim 12, wherein the gastrointestinal disorder is Crohn's disease. A method of diagnosing a pathological condition or susceptibility to a pathological condition in a subject comprising:
(A) determining the presence or absence of a mutation in the polynucleotide of claim 1, and (b) diagnosing a pathological condition or susceptibility to the pathological condition based on the presence or absence of the mutation . A method of diagnosing a pathological condition or susceptibility to a pathological condition in a subject comprising:
(A) determining the presence or expression level of the polypeptide of claim 4 in a gastrointestinal tissue sample; and (b) susceptibility to a pathological condition or pathological condition based on the presence or expression level of the polypeptide. Diagnosing the
Including methods.   A method of treating Crohn's disease comprising administering to a patient in need thereof an MGAT3 polypeptide or modulator thereof.

Images