JP2006345744A - New aromatic alcohol oxidase gene and method for producing aromatic carboxylic acid - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To obtain a gene encoding an enzyme to oxidize various aromatic alcohols and convert to aldehydes and provide a means for producing an aromatic carboxylic acid by using a recombinant microorganism having the gene transferred/expressed in the microorganism. <P>SOLUTION: The invention relates to an alcohol dehydrogenase gene of Rhodococcus erythropolis PR4 strain and a method for producing an aromatic carboxylic acid by using the gene. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a novel enzyme that oxidizes an aromatic alcohol and converts it into a carboxylic acid, a gene that encodes it, and a microorganism into which this gene has been introduced. The present invention also relates to a method for producing an aromatic carboxylic acid from an aromatic alcohol using a microorganism into which this gene has been introduced.

Conversion of benzyl alcohol to benzoic acid is carried out by two enzymes, aromatic alcohol dehydrogenase and aromatic aldehyde dehydrogenase (FIG. 2). Aromatic alcohol dehydrogenase is an enzyme that reversibly converts benzyl alcohol to benzaldehyde, and the XylB enzyme of the toluene metabolism system encoded by the TOL plasmid pWW0 of Pseudomonas putida is the best. It has been studied (Non-Patent Document 1). XylB depends its enzymatic activity in the NAD (P) ⁺ and zinc ions, not only benzyl alcohol o -, m -, p - methylbenzyl alcohol, o -, m -, p - methoxybenzyl alcohol also respectively as substrates To the aldehyde form. However, o - methylbenzyl alcohol and o - If the methoxybenzyl alcohol was used as a substrate, the conversion efficiency was poor (non-patent document 2). Recently, a gene encoding 4-nitrobenzyl alcohol dehydrogenase (NtnD), which does not depend on NAD (P) ⁺ and zinc ions and has low homology with XylB of the TOL plasmid, has been isolated from Pseudomonas TW3 strain (James, KD, Hughes, MA, and Williams, PA, Cloning and expression of ntnD , encoding a novel NAD (P) ⁺ -independent 4-nitrobenzyl alcohol dehydrogenase from Pseudomonas sp. Strain TW3. J. Bacteriol. 182, 3136- 3141, 2000). NtnD are benzyl alcohol, m -, p - nitrobenzyl alcohol, o -, m -, p - methylbenzyl alcohol, m - hydroxybenzyl alcohol, p - ethylbenzyl alcohol, 2,4, 3,4, 3 Each aldehyde was synthesized using 1,5-dimethylbenzyl alcohol as a substrate, but o -nitrobenzyl alcohol, o- , p -hydroxybenzyl alcohol and 2,5-dimethylbenzyl alcohol could not be converted. Furthermore, aryl ether-utilizing bacteria Acinetobacter (Acinetobacter) genus ADP1 aromatic isolated from strain alcohol (benzyl alcohol) dehydrogenase AreB has a XylB high homology of TOL plasmid pWW0, o -, m -, p - methyl benzyl alcohol, o -, m -, p -. activity against hydroxy benzyl alcohol has been reported (Jones, RM, Collier, LS , Neidle, EL, and Williams, PA, areABC genes determine the catabolism of aryl esters in Acinetobacter sp ADP1, J. Bacteriol. 181, 4568-4575, 1999).

Aromatic aldehyde dehydrogenase catalyzes the reaction from benzaldehyde to benzoic acid. The most well-known one is the XylC enzyme encoded by the TOL plasmid pWW0, whose enzyme activity depends on NAD (P) ⁺ (Non-patent Document 1). In addition, xylB and xylC genes were isolated from Acinetobacter calcoaceticus NCIB 8250, and the amino acid sequences encoded by them were highly homologous to XylB and XylC of TOL plasmids, and the substrate specificity was almost the same. (Gillooly, DJ, Robertson, AG, and Fewson, CA, Molecular characterization of benzyl alcohol dehydrogenase and benzaldehyde dehydrogenase II of Acinetobacter calcoaceticus . Biochem. J. 330, 1375-1381, 1998). Aldehyde dehydrogenase PhnN isolated from 1,4-dimethylnaphthalene-utilizing bacterium Sphingomonas sp. 14DN61 has a wide substrate specificity and has the ability to convert various aromatic aldehydes to carboxylic acids. (Peng, X., Maruyama, T., Shindo, K., Kanoh, K., Ikenaga, H., and Misawa, N., International Congress on Biocatalysis, Hamburg 2004, Book of Abstracts, p. 227, 2004) . PhnN is not only a monocyclic aldehyde such as benzaldehyde, but also a polycyclic aldehyde such as 2-naphthyl aldehyde, which can be converted into each carboxylic acid with a very wide substrate specificity. It is an enzyme.

  As described above, aromatic alcohol dehydrogenase and aromatic aldehyde dehydrogenase are enzymes that convert aromatic alcohol and aromatic aldehyde to aromatic aldehyde and aromatic carboxylic acid, respectively. By the action of these two enzymes, aromatic alcohols such as benzyl alcohol are converted to carboxylic acids.

Harayama, S., Rekik, M., Wubbolts, M., Rose, K., Leppik, RA, and Timmis, K. N, Characterization of five genes in the upper-pathway operon of TOL plasmid pWW0 from Pseudomonas putida and identification of the gene products. J. Bacteriol. 171, 5048-5055, 1989 Shaw, J. P., Schwager, F., and Harayama, S., Substrate-specificity of benzyl alcohol dehydrogenase and benzaldehyde dehydrogenase encoded by TOL plasmid pWW0. Metabolic and mechanistic implications. Biochem. J. 283, 789-794, 1992

  An object of the present invention is to obtain a gene encoding an enzyme that oxidizes various aromatic alcohols and converts them into aldehydes. Still another object is to provide a method for producing various aromatic carboxylic acids using a recombinant microorganism into which this gene has been introduced and expressed.

As a result of intensive studies to achieve the above problems, the present inventors have found that aromatic alcohol dehydrogenase genes derived from the toluene-utilizing bacterium Rhodococcus erythropolis PR4 have various aromatic aldehydes such as Benzaldehyde and its substitutes, as well as hydroxymethylnaphthalene and its substitutes, were found to be novel enzymes that convert the respective aldehydes. Furthermore, the present inventors have clarified that Escherichia coli expressing an aromatic aldehyde dehydrogenase gene together with the aromatic alcohol dehydrogenase gene can convert the above various aromatic aldehydes into respective carboxylic acids, thereby completing the present invention. It came to.

  That is, the present invention provides the following (1) to (6).

(1) Peptides shown in the following (a), (b), or (c):
(A) a peptide comprising the amino acid sequence of SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6,
(B) a peptide comprising an amino acid sequence in which one or more amino acids are added, deleted or substituted in the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6, and having an aromatic alcohol dehydrogenase activity;
(C) a peptide derived from a bacterium encoded by DNA that hybridizes under stringent conditions with DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 or DNA complementary thereto, A peptide having aromatic alcohol dehydrogenase activity.

(2) A gene encoding the peptide according to (1).

(3) A microorganism obtained by introducing the gene according to (2), which can convert an aromatic alcohol into an aromatic carboxylic acid.

(4) The microorganism according to (3), wherein the microorganism is Escherichia coli.

(5) Production of an aromatic carboxylic acid, wherein the microorganism according to (3) or (4) is cultured in a medium containing an aromatic alcohol to obtain an aromatic carboxylic acid from the culture or the cells. Law.

(6) The aromatic alcohol is 1,4-dihydroxymethylnaphthalene, 2-hydroxymethyl-6-methylnaphthalene, 1-hydroxymethylnaphthalene, 2-hydroxymethylnaphthalene, benzyl alcohol, 2-methylbenzyl alcohol, 3-methyl Benzyl alcohol, 4-methylbenzyl alcohol, 2-hydroxybenzyl alcohol, 4-hydroxybenzyl alcohol, 3-methoxybenzyl alcohol, 4-methoxybenzyl alcohol, 3-chlorobenzyl alcohol, or vanillyl alcohol, the aromatic alcohol Aromatic carboxylic acids produced from 4-hydroxymethyl-1-naphthoic acid, 6-methyl-2-naphthoic acid, 1-naphthoic acid, 2-naphthoic acid, benzoic acid, 2-methylbenzoic acid, 3-methyl, respectively. Benzoic acid, 4-methylbenzoic acid, 2-hydroxybenzoic acid, 4-hydroxy The method for producing an aromatic carboxylic acid according to (5), which is cibenzoic acid, 3-methoxybenzoic acid, 4-methoxybenzoic acid, 3-chlorobenzoic acid, or cinnamic acid.

  The present invention provides a novel means for producing aromatic carboxylic acids. Aromatic carboxylic acids are used as raw materials and fragrances for pharmaceuticals, and the present invention is useful for the production thereof.

  The present invention will be described in detail below.

  First, the peptide of the present invention will be described.

  The peptides of the present invention include the peptides shown in the following (a), (b), or (c).

(A) A peptide comprising the amino acid sequence described in SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 (b) One or more amino acids are added to the amino acid sequence described in SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6. A peptide comprising a deleted or substituted amino acid sequence and having aromatic compound dehydrogenase activity (c) a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 or a DNA complementary thereto A peptide derived from a bacterium encoded by DNA that hybridizes under stringent conditions and having aromatic alcohol dehydrogenase activity (a) is included in Rhodococcus erythropolis PR4 strain Three types of aromatic alcohol dehydrogenase genes (gene number: 052-0446M, 010-0034N) 049-0049M) an aromatic alcohol dehydrogenase encoded. These three peptides are 1,4-dihydroxymethylnaphthalene, 2-hydroxymethyl-6-methylnaphthalene, 1-hydroxymethylnaphthalene, 2-hydroxymethylnaphthalene, benzyl alcohol, 2-methylbenzyl alcohol, 3-methylbenzyl Produces aromatic aldehydes as substrates for alcohol, 4-methylbenzyl alcohol, 2-hydroxybenzyl alcohol, 4-hydroxybenzyl alcohol, 3-methoxybenzyl alcohol, 4-methoxybenzyl alcohol, 3-chlorobenzyl alcohol, and vanillyl alcohol . Further, the peptide consisting of the amino acid sequence described in SEQ ID NO: 6 uses xylene-α, α′-diol as a substrate in addition to the aromatic alcohol, and the peptide consisting of the amino acid sequence described in SEQ ID NO: 5 other than the aromatic alcohol. 3-hydroxybenzyl alcohol is used as a substrate to produce aromatic aldehydes.

  The peptide of (b) is a peptide in which a mutation is introduced into the peptide of (a) so as not to lose the same aromatic alcohol dehydrogenase activity as that of the peptide of (a). Such mutations include artificial mutations in addition to mutations that occur in nature. Examples of means for causing artificial mutation include site-directed mutagenesis (Nucleic Acids Res. 10, 6487-6500, 1982), but are not limited thereto. The number of mutated amino acids is not limited as long as the activity described above is not lost, but is usually within 30 amino acids, preferably within 20 amino acids, more preferably within 10 amino acids, most preferably Preferably it is within 5 amino acids.

  The peptide (c) is a peptide having the same aromatic alcohol dehydrogenase activity as the peptide (a) obtained by utilizing hybridization between DNAs. The “stringent conditions” in the protein of (c) refer to conditions under which only specific hybridization occurs and non-specific hybridization does not occur. Such conditions are usually conditions such as hybridization at 37 ° C. and washing treatment at 37 ° C. with a buffer containing 1 × SSC and 0.1% SDS, preferably hybridization at 42 ° C. and 0.5 × Conditions such as washing at 42 ° C. with a buffer containing SSC and 0.1% SDS, more preferably hybridization at 65 ° C. and washing at 65 ° C. with a buffer containing 0.2 × SSC and 0.1% SDS This is the condition. DNA obtained by hybridization usually has high homology with the DNA represented by the nucleotide sequence described in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. High homology refers to homology of 60% or more, preferably 75% or more, more preferably 90% or more.

  By introducing a gene encoding the peptide of the present invention, a microorganism capable of converting an aromatic alcohol into an aromatic carboxylic acid can be produced.

The microorganism to be gene-transferred is not particularly limited, but Escherichia coli is preferable. In addition, since aromatic alcohol dehydrogenase and aromatic aldehyde dehydrogenase are required to produce aromatic carboxylic acid from aromatic alcohol, if the microorganism to be introduced does not produce aromatic aldehyde dehydrogenase, aromatic An aldehyde dehydrogenase gene is also introduced. Aromatic aldehyde dehydrogenase gene to be introduced at this time is not particularly limited, for example, XylC genes contained in the TOL plasmid pWW0 Pseudomonas putida, XylC gene possessed by Acinetobacter calcoaceticus NCIB 8250, phnN gene possessed by the genus Sphingomonas 14DN61 strain And so on.

  An aromatic carboxylic acid can be produced by culturing such a microorganism in a medium containing an aromatic alcohol and collecting the aromatic carboxylic acid from the culture or the cells. The medium to be used is not particularly limited as long as it contains an aromatic alcohol that can be used as a substrate by microorganisms. For example, 1,4-dihydroxymethylnaphthalene, 2-hydroxymethyl-6-methylnaphthalene, 1-hydroxymethylnaphthalene 2-hydroxymethylnaphthalene, benzyl alcohol, 2-methylbenzyl alcohol, 3-methylbenzyl alcohol, 4-methylbenzyl alcohol, 2-hydroxybenzyl alcohol, 4-hydroxybenzyl alcohol, 3-methoxybenzyl alcohol, 4-methoxybenzyl A medium containing at least one selected from the group consisting of alcohol, 3-chlorobenzyl alcohol, and vanillyl alcohol can be used. In addition, when using a microorganism into which a gene encoding a peptide consisting of the amino acid sequence set forth in SEQ ID NO: 6 or a peptide having the same enzyme activity is used, a medium containing xylene-α, α′-diol may be used. When using a microorganism into which a gene encoding a peptide consisting of the amino acid sequence shown in SEQ ID NO: 5 or a peptide having the same enzyme activity is used, a medium containing 3-hydroxybenzyl alcohol may be used. In the present invention, the “aromatic alcohol” refers to a substance having an aromatic ring and having at least one hydroxyl group (preferably a hydroxymethyl group) bonded to carbon other than carbon constituting the aromatic ring.

  Hereinafter, the present invention will be described in more detail with reference to examples.

[Example 1] Gene manipulation experiment Normal gene manipulation experiments such as plasmid preparation, restriction enzyme treatment, ligation reaction, transformation and the like were performed by Sambrook et al. In Molecular Cloning (Sambrook, J., Fritsch, EF, and Maniatis, T. et al. , 1989, “Molecular cloning -a laboratory manual”, 2nd edition, or Sambrook, J., Russell, DW, 2001, "Molecular cloning -a laboratory manual", Third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) or the method shown in the reagent protocol.

[Example 2] Conversion of toluene by Rhodococcus erythropolis PR4 strain Rhodococcus erythropolis PR4 strain used as MBIC 01337 was distributed by Marine Biotechnology Research Institute. This strain has been deposited with the National Institute for Product Evaluation Technology (reception number: NITE AP-90, date of receipt: June 14, 2005). The R. erythropolis PR4 strain was cultured in TSB (Tryptic Soy Broth, DIFCO) medium containing 1 mM toluene or benzyl alcohol for 2 days. To 100 μl of this culture solution, 150 μl of ethyl acetate and 10 μl of 3N hydrochloric acid were added, vortexed, centrifuged at 15,000 rpm for 5 minutes, and the ethyl acetate phase of the supernatant was recovered and dried. Next, it was trimethylsilylated with a trimethylsilylating agent (GL Science Co., Ltd.) to obtain a sample for gas chromatography-mass spectroscopy (GC-MS). GC-MS used QP5050A (manufactured by Shimadzu Corporation), and DB-5 column (30 × 0.25 mm, manufactured by J & W Scientific) was used as the column. The column temperature was initially maintained at 50 ° C. for 5 minutes, then increased to 300 ° C. at a rate of 10 ° C./minute, and maintained at 300 ° C. for 4 minutes (measurement conditions for a total of 34 minutes per sample). The injection temperature and detection temperature were 300 ° C.

The analysis results are shown in FIG. When cultured in a medium containing toluene, peaks of product I and product II were detected (FIG. 1A). These were identified as benzyl alcohol and benzoic acid, respectively. When cultured in a medium containing benzyl alcohol, the peak of product II was detected in addition to the peak of benzyl alcohol (FIG. 1B). Product II was identified as benzoic acid. The above results suggest that the R. erythropolis PR4 strain has a toluene metabolic pathway as shown in Fig. 2 and has a monooxygenase, alcohol dehydrogenase and aldehyde dehydrogenase genes for degrading toluene. It was done.

[Example 3] Preparation of chromosomal DNA from Rhodococcus erythropolis PR4
R. erythropolis PR4 strain was cultured in 300 ml Tryptic Soy Broth (TSB) medium (Difco) at 30 ° C. for one day. After collecting the cells, they were washed twice with STE buffer (100 mM NaCl, 10 mM Tris / HCl, 1 mM EDTA, pH 8.0), heat-treated at 68 ° C. for 15 minutes, and then 5 mg / ml lysozyme (Sigma) and 100 μg / ml RNase (Sigma) -containing solution I (50 mM glucose, 25 mM Tris · HCl, 10 mM EDTA, pH 8.0). After incubating at 37 ° C. for 1 hour, Protenase K (Sigma) was added to 10 mg / ml and incubated at 37 ° C. for 10 minutes. Further, N-lauroyl sarcosine / Na was added to a final concentration of 1%, and the mixture was gently and thoroughly mixed by inversion, followed by incubation at 37 ° C. for 3 hours. After several phenol / chloroform extractions, slowly add 2 volumes of ethanol, wind up the precipitated chromosomal DNA with a glass rod, rinse with 70% ethanol, and then add 2 ml of TE buffer. It was dissolved in (10 mM Tris · HCl, 1 mM EDTA, pH 8.0) to obtain a chromosomal DNA solution.

[Example 4] Acquisition of alcohol dehydrogenase gene ( xylB ) by PCR
From the genome information of R. erythropolis PR4 strain, three alcohol dehydrogenase genes showing similarity to the xylB gene known so far were found (gene numbers: 052-0446M, 010-0034N, 049-0049M). PCR was performed to clone these genes. A fragment containing the entire DNA sequence of 052-0446M was amplified with primers (5′GTGAAAACACGGCGCCATGT3 ′ (SEQ ID NO: 7) and 5′CGACGCGATCGACTCGCAAT 3 ′ (SEQ ID NO: 8)), inserted into the vector pT7Blue of Novagen, and the plasmid pT7- 0446M was built. A fragment containing the entire region DNA sequence of 010-0034N was amplified with primers (5'ACGACGAATTCCTTGTTGTT3 '(SEQ ID NO: 9) and 5' CGGCAACCGAAATAGCTAGT3 '(SEQ ID NO: 10)) and inserted into pT7Blue to construct plasmid pT7-0034N . A fragment containing the entire region DNA sequence of 049-0049M was amplified with primers (5′TGATTCGCGCCGAACAGAAT3 ′ (SEQ ID NO: 11) and 5 ′ GAATGAGACATTTCGCCCCT3 ′ (SEQ ID NO: 12), and inserted into pT7Blue to construct plasmid pT7-0049M. The base sequences of 052-0446M, 010-0034N, and 049-0049M are shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively, and the amino acid sequences of peptides encoded by these genes are shown in SEQ ID NO: 4, It is shown in SEQ ID NO: 5 and SEQ ID NO: 6.

A phylogenetic tree was created using amino sequences of proteins related to 052-0446M, 010-0034N, and 049-0049M (FIG. 3). The numbers in the figure are bootscrap values (1000 tests). In addition, “052-0446M_Rhodococcus PR4”, “010-0034N_Rhodococcus PR4”, and “049-0049M_Rhodococcus PR4” in the figure are encoded by the above-described alcohol dehydrogenase genes 052-0446M, 010-0034N, and 049-0049M, respectively. Represents a protein. “TerpD_Pseudomonas” in the figure is TerpD of the genus Pseudomonas (Peterson, JA, Lu, JY, Geisselsoder, J., Graham-Lorence, S., Carmona, C., Witney, F., Lorence, MC, Cytochrome P-450terp Isolation and purification of the protein and cloning and sequencing of its operon. J. Biol. Chem. Jul 15; 267 (20): 14193-14203. 1992.), “XylB_Rhodococcus TKN14” is XylB of Rhodococcus opacus TKN14 strain (MyrB_Pseudomonas) represents the alcohol dehydrogenase MyrB (Iurescia, S., Marconi, AM, Tofani, D., Gambacorta) of the Pseudomonas sp. M1 strain. , A., Paterno, A., Devirgiliis, C., van der Werf, MJ, Zennaro, E. Identification and sequencing of beta-myrcene catabolism genes from Pseudomonas sp. Strain M1. Appl. Environ. Microbiol. Jul; 65 ( 7): 2871-2876. 1999.), “XylB_TOL” is XylB (Shaw, JP, Rekik, M., Schwager, F) encoded by the TOL plasmid of Pseudononas putida strain mt-2 , and Harayama, S., Kinetic studies on benzyl alcohol dehydrogenase encoded by TOL plasmid pWW0, J. Biological Chemistry, 268, 10842-10850, 1993), “XylB_pWW0” is XylB encoded by Pseudononas putida TOL plasmid pWW0 (Harayama, S., Rekik, M., Wubbolts, M., Rose, K., Leppik, RA, and Timmis, K., Characterization of five genes in the upper-pathway operon of TOL plasmid pWW0 from Pseudomonas putida and identification 171 (9), 5048-5055, 1989), “AreB_Acineto” is Acinetobater sp. ADP1 strain AreB (Jones, RM, Collier, LS, Neidle, EL, Williams, PA , areABC genes determine the catabolism of aryl esters in Acinetobacter sp. Strain ADP1. J. Bacteriol. Aug; 181 (15): 4568-4575. 1999), “XylB_Acineto” represents XylB of Acinetobater calcoaceticus NCIB 8250, “ XylB_AcinetoII ”is an Acinetobacter calcoaceticus NCIB 8250 XylB (Gillooly, DJ, Robertson, AGS, and Fewson, CA, Molecular characterization of benzyl al cohol dehydrogenase and benzaldehyde dehydrogenase II of Acinetobacter calcoaceticus . Biochem. J. 330, 1375-1381, 1998), "ADH1_Man" is human alcohol dehydrogenase (Matsuo, Y., Yokoyama, S., Molecular structure of the human alcohol dehydrogenase 1 gene. FEBS Lett., 243, 57-60, 1989).

  The proteins encoded by 010-0034N and 049-0049M showed 46% homology (identity) with each other, forming a group. In addition, these proteins showed 42% to 46% homology with the XylB protein group of the xylene metabolic system of the TOL plasmid, which has been well studied so far. In contrast, the protein encoded by 052-0446M showed only 30% homology with the XylB protein group in the xylene metabolism system of the TOL plasmid. Based on the above results, the 052-0446M, 010-0034N, and 049-0049M genes analyzed this time are all novel genes having no more than 46% homology at the encoded amino acid sequence level. It became clear that there was.

[Example 5] Construction of plasmids pPhnN-XylB0446M, pPhnN-XylB0034N and pPhnN-XylB0049M Since the alcohol dehydrogenase genes cloned this time are difficult to detect the activity of the enzyme encoded by them alone, each gene is placed upstream of the phnN gene. The arranged plasmid (pPhnN-XylB series) was prepared, and the enzyme activity was measured. The phnN gene is an aromatic aldehyde dehydrogenase gene isolated from the 1,4-dimethylnaphthalene-utilizing bacterium Sphingomonas sp. 14DN61 strain (Peng, X., Maruyama, T., Shindo, K., Kanoh, K., Ikenaga, H., and Misawa, N., International Congress on Biocatalysis, Hamburg 2004, Book of Abstracts, p. 227, 2004). The plasmid pPhnN (pNB2.18N) is a plasmid in which the 2.18-kb Not I- Bam HI fragment containing this phnN gene is inserted into the Not I- Bam HI site of pBluescript II SK +. E. coli with the plasmid pPhnN-XylB series (Fig. 4) prepared this time can be easily converted from aromatic aldehyde to carboxylic acid, and the activity of the xylB gene product can be evaluated by quantifying the amount of carboxylic acid produced. it is conceivable that. The plasmid was prepared as follows. A 1.1-kb Hin dIII- Kpn I fragment of plasmid pT7-0446 was inserted into Hin dIII- Kpn I of pPhnN to prepare pPhnN-XylB0446M. A 1.2-kb Bam HI- Hin dIII fragment of PT7-0034N was inserted into Bam HI- Hin dIII of pPhnN to prepare pPhnN-XylB0034N. A 1.1-kb Hin dIII- Kpn I fragment of pT7-0049M was inserted into Hin dIII- Kpn I of pPhnN to prepare pPhnN-XylB0049M.

[Example 6] Conversion activity of aromatic alcohol of Escherichia coli having xylB gene Escherichia coli JM101 containing plasmids pPhnN and pPhnN-XylB series was cultured in LB medium containing 10 ml of ampicillin 100 µg / ml at 30 ° C for 12 hours. After the cells were collected by centrifugation, ampicillin 100 μg / ml, 0.2% (w / v) glucose, 0.01% (w / v) thiamine, M9 medium containing 1 mM IPTG (Na ₂ HPO ₄ , 6 g / L; KH ₂ PO ₄ , 3 g / L; NaCl, 0.5 g / L; NH ₄ Cl, 1 g / L; MgSO4, 1 mM; CaCl ₂ , 0.1 mM; FeSO ₄ , 0.01 mM) 3 ml It was suspended in. The same number of substrate solutions as the number of substrates were prepared, and each substrate solution (100 mM DMSO solution) was added to each cell solution so that the final concentration of the substrate was 0.5 mM. The substrate solution containing the microbial cells was transferred to a stoppered test tube, and the lid was sealed and cultured at 30 ° C. for 2 days. 200 μl of each culture was mixed with an equal volume of methanol, centrifuged, and subjected to high performance liquid chromatography (HPLC) analysis. HPLC used Waters Alliance (made by Waters), and the column used the octadecyl silica reverse phase column (length: 10 cm, diameter: 4.6 mm, Waters). The flow rate was 1 ml / min. After sample injection, solvent A (0.1% phosphoric acid aqueous solution) was allowed to flow for 2 minutes, then a gradient up to 70% was applied with solvent B (0.1% phosphoric acid acetonitrile solution), and then 70% solvent B was allowed to flow for 5 minutes. . Detection was performed at a wavelength (max plot) showing a maximum value between 230 and 280 nm.

  The results are shown in Table 1.

E. coli JM101 strains carrying plasmids pPhnN-XylB0049M, pPhnN-XylB0034N, and pPhnN-XylB0046M were able to synthesize aromatic carboxylic acids by converting many types of aromatic alcohols. For example, 1,4-dihydroxymethylnaphthalene to 4-hydroxymethyl-1-naphthoic acid, 2-hydroxymethyl-6-methylnaphthalene to 6-methyl-2-naphthoic acid, and 1-hydroxymethylnaphthalene to 1-naphthoic acid. Acid, 2-hydroxymethylnaphthalene to 2-naphthoic acid, benzyl alcohol to benzoic acid, 2-, 3-, 4-methylbenzyl alcohol to 2-, 3-, 4-methylbenzoic acid, 2- 4-hydroxybenzyl alcohol, 2-, 4-hydroxybenzoic acid, 3-, 4-methoxybenzyl alcohol, 3-, 4-methoxybenzoic acid, 3-chlorobenzyl alcohol, 3-chlorobenzoic acid, respectively. It was confirmed that cinnamic acid was produced from vanillyl alcohol. Since the amount of carboxylic acid produced is considerably higher than that of E. coli JM101 with the control plasmid pPhnN, it is clear that each XylB is a functioning result. In particular, it is noteworthy that alcohol compounds having a naphthalene skeleton, ie 1,4-dihydroxymethylnaphthalene, 2-hydroxymethyl-6-methylnaphthalene, 1-hydroxymethylnaphthalene and 2-hydroxymethylnaphthalene have high conversion activity. . On the other hand, among E. coli with three types of plasmids, xylene-α, α'-diol is only E. coli (pPhnN-XylB0049M) and 3-hydroxybenzyl alcohol is only E. coli (pPhnN-XylB0034N). Could be converted. The conversion activity for 2-methoxybenzyl alcohol was not confirmed in all three types of recombinant E. coli.

It is a figure which shows the analysis result by GC-MS of the toluene (A) and benzyl alcohol (B) metabolite of Rhodococcus erythropolis PR4 strain. It is the figure which showed the toluene metabolic pathway of Rhodococcus erythropolis PR4 strain. It is a figure which shows the phylogenetic tree of XylB and related enzyme. Plasmid pPhnN-XylB0446M, pPhnN-XylB0034N, illustrates the structure of pPhnN-XylB0049M (restriction enzymes: N, Not I; B, Bam HI; K, Kpn I; H, Hin dIII).

Claims (6)

Peptides shown in the following (a), (b), or (c):
(A) a peptide comprising the amino acid sequence of SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6,
(B) a peptide comprising an amino acid sequence in which one or more amino acids are added, deleted or substituted in the amino acid sequence shown in SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6, and having an aromatic alcohol dehydrogenase activity;
(C) a peptide derived from a bacterium encoded by DNA that hybridizes under stringent conditions with DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 or DNA complementary thereto, A peptide having aromatic alcohol dehydrogenase activity.   A gene encoding the peptide according to claim 1.   A microorganism obtained by introducing the gene according to claim 2, wherein the microorganism can convert an aromatic alcohol into an aromatic carboxylic acid.   The microorganism according to claim 3, wherein the microorganism is Escherichia coli.   A method for producing an aromatic carboxylic acid, comprising culturing the microorganism according to claim 3 or 4 in a medium containing an aromatic alcohol to obtain the aromatic carboxylic acid from the culture or the cells. Aromatic alcohol is 1,4-dihydroxymethylnaphthalene, 2-hydroxymethyl-6-methylnaphthalene, 1-hydroxymethylnaphthalene, 2-hydroxymethylnaphthalene, benzyl alcohol, 2-methylbenzyl alcohol, 3-methylbenzyl alcohol, 4-methylbenzyl alcohol, 2-hydroxybenzyl alcohol, 4-hydroxybenzyl alcohol, 3-methoxybenzyl alcohol, 4-methoxybenzyl alcohol, 3-chlorobenzyl alcohol, or vanillyl alcohol, which is produced from the aromatic alcohol Aromatic carboxylic acids are 4-hydroxymethyl-1-naphthoic acid, 6-methyl-2-naphthoic acid, 1-naphthoic acid, 2-naphthoic acid, benzoic acid, 2-methylbenzoic acid, 3-methylbenzoic acid, 4-methylbenzoic acid, 2-hydroxybenzoic acid, 4-hydroxybenzoic acid 6. The process for producing an aromatic carboxylic acid according to claim 5, wherein the process is aromatic acid, 3-methoxybenzoic acid, 4-methoxybenzoic acid, 3-chlorobenzoic acid, or cinnamic acid.

Images