JP2006187247A - New immunocyte control/differentiation factor gene search method utilizing transduction of gene into pax5-defected pro cell b, and utilization of the method for function elucidation and immunotherapy of rac1 and erk5 - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new immunocyte control/differentiation factor gene search method utilizing the transduction of a gene into a Pax5-defected pro cell B, and to provide a utilization for the function elucidation and immunotherapy of Rac1 and ERK5 by the method. <P>SOLUTION: This new immunocyte control/differentiation factor gene search method utilizing the transduction of a gene into a Pax5-defected pro cell B is established to obtain a new cell T reconstruction test system, and the function of Rac1, ERK5 and the like are elucidated by the utilization of the test system. Thereby, the method can be utilized for the immunotherapy. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention introduces various function-unknown genes into Pax5-deficient pro-B cells (Rolink, AG et al., 1999, Nature 401: 603-606) into RAG2-deficient animals such as RAG2-deficient mice with T cell differentiation disorders. The present invention relates to a novel T cell reconstitution test system established by injecting expressed cells, a novel T cell differentiation gene, a novel functional gene such as Rac1 and ERK5 and the use thereof for immunotherapy.

  Regarding a novel immune cell control / differentiation factor gene search method using Pax5-deficient pro-B cells and gene introduction into Pax5-deficient pro-B cells, no prior patent document could be found. There is no prior patent document on the elucidation of the functions of Rac1 and ERK5 using Pax5-deficient pro-B cells and the novel immune cell control / differentiation factor gene search method using gene transfer to Pax5-deficient pro-B cells and use for immunotherapy. It was.

  A novel immune cell control / differentiation factor gene search method using gene transfer into Pax5-deficient pro-B cells, and elucidation of the functions of Rac1 and ERK5 using it and its use for immunotherapy are the subject of the present invention.

  The present invention relates to a novel immune cell control / differentiation factor gene search method in which a gene with unknown function is introduced into Pax5-deficient pro-B cells and the expressed cells are injected into RAG2-deficient animals. There are no particular restrictions on animals, but it is preferable to use mouse-derived Pax5-deficient pro-B cells. In addition, a novel T cell reconstitution test system prepared by introducing a gene with unknown function into Pax5-deficient pro-B cells and injecting the expressed cells into RAG2-deficient animals is also included in the scope of the present invention. Although there is no particular limitation, it is preferable to use mouse-derived Pax5-deficient pro-B cells. It was elucidated by using a novel immune cell control / differentiation factor gene search method using gene transfer into Pax5-deficient pro-B cells obtained using the novel T cell reconstitution test system according to claim 3 or 4. Using Rac1 and ERK5 having a novel function, a novel immune cell control / differentiation factor gene search method using gene transfer into Pax5-deficient pro-B cells can be used for immunotherapy.

  RAG2-deficient mice lack the differentiation function of T cells and B cells of immunocompetent cells, and are pro-B cells derived from Pax5-deficient mice (cultured cells with properties similar to hematopoietic stem cells. Introduced into RAG2-deficient mice cells with various functions unknown genes introduced into RAG2-deficient mice (with the ability to differentiate into all hematopoietic cells other than B cells) Established. Using this test system, the functions of regulatory factors such as Rac1 and ERK5 in T cell differentiation were elucidated.

  Using a novel immune cell control / differentiation factor gene search method using gene transfer to Pax5-deficient pro-B cells, the Rac1 gene is changed from CD4 / CD8 double positive cells in the thymus of T cells to CD4 or CD8 positive cells (especially It was clarified that it is necessary for positive selection to CD4). In the future, this method will be useful as a technique for searching for target genes for therapeutic agents for immune dysfunction and autoimmune diseases, and the genes found this time can be targets for therapeutic agents for immune dysfunction.

  ERK5 phosphorylates the transcription factors MEF2C and MEF2D, but MEF2D is expressed not only in the nerve and vascular system but also in thymocytes, and the expression of Nur77 plays a central role in the negative selection of T cells. It is adjusting. Therefore, ERK5 may play an important role not only in the circulatory system but also in the selection process of immature T cells. Negative selection is an important process that eliminates autoreactive T cells and may be involved in the pathogenesis of autoimmune diseases such as dilated cardiomyopathy. In the present invention, the function of ERK5 was examined focusing on the differentiation process of T cells, particularly negative selection. In the thymus overexpressing the dominant-incapable ERK5 gene, mature CD4 T cells and CD4 / CD8 double positive cells after selection increased. ERK5 is a member of the fourth MAP kinase cascade following ERK, JNK, and p38, and is known to be important for right ventricle formation, angiogenesis, and vascular smooth muscle differentiation. These results suggested that ERK5 is involved in negative selection signaling in the thymus.

  According to the present invention, a novel immune cell control / differentiation factor gene search method using gene transfer into Pax5-deficient pro-B cells, and the elucidation of the functions of Rac1 and ERK5 using the method and use for immunotherapy have become possible.

In order to study the function of Rac1 in T cell development, a newly developed test system using Pax5-deficient pro-B cells (Rolink, AGet al., 1999, Nature 401: 603-606) Using. Pax5 is a B-lineage specific gene such as BLNK (Schebesta, M. et al., 2002, Immunity 17: 473-485, Schebesta, M. et al., 2002, Curr Opin Immunol 14: 216-223). Transcription of non-B-lymphoid genes such as Notch-1 (Souabni, A. et al., 2002, Immunity 17: 781-793) By repressing, Pax5 functions as a critical transcription factor for B-lineage commitment. Pro B cells deficient in Pax5 lack the ability to differentiate into B cells, but Pax5 deficient pro B cells remain uncommitted, RAG ^{− / −} mice (Nutt, SL et al., 1999, Nature 401: 556-562, Schaniel, C. et al., 2002, Blood 99: 472-478), T cells, NK cells, macrophages, granulocytes, dendritic cells ( Multiple lineage of hematopoietic cells including dendritic cells and erythrocytes can be reconstituted. Since Pax5 ^{− / −} pro B cells can be cultured in vitro for a long time without loss of pluripotency, these cells are freshly prepared blood stem cells for analysis of T cell differentiation It has a great advantage over The inventors introduced a Rac1 mutant gene into Pax5 ^{− / −} pro B cells, selected with puromycin, sorted cells with high expression of GFP (Green Fluorescent Protein), and used for many tests. Cryopreserved as a stock. Instead of individual cell clones, transduced cell lines were used to avoid artifacts due to the destruction of certain genes due to retroviral insertions. As shown in FIG. 1, CD45.2 ⁺ Pax5 ^{− / −} pro B-derived thymocytes were completely developed in CD45.1 ⁺ RAG2 ^{− / −} thymus 3-4 weeks after injection.

The effect of constitutively active Rac1 mutants on T cell development has been reported by Cantrell, DA, 2003, Immunol Rev 192: 122-130, Gomez, M. et al. , 2000, Nat Immunol 1: 348-352, Gomez, M. et al., 2001, Immunity 15: 703-713), but loss-of-function in T cell development. No studies of Rac1 mutants have been reported yet. Constitutively active Rac1 transgenic mice show a transition from positive selection to negative selection (Gomez, M. et al., 2001, Immunity 15: 703-713), and T in Vav ^{− / −} mice. Restoration of the T cell defect in Vav ^-/- mice, in RAG ^-/- mice, generation of DP cells in RAG ^-/- mice and activity This suggests that type Rac1 promotes TCR signaling. In the present invention, we could directly show that Rac1 is required for positive selection in an in vitro model system (FIG. 4) and also for in vivo T cell reconstitution (FIG. 2). . Surprisingly, Rac1 was not required for pre-TCR signaling, but this is a DP cell generation in thymocytes (dnRac1 expressing thymocytes) expressing dnRac1 (double negative Rac1). By observation that thymocytes expressing dnRac1 were not affected. This result is in marked contrast to RhoA, another Rho family small GTPase, which is shown to be involved in DN (dominant negative) to DP transition ( Henning,
SWet al., 1997, Embo J 16: 2397-2407, Costello, PSet al., 2000, J Exp Med 192: 77-85,
Cleverley, S. et al., 1999, Curr Biol 9: 657-660).

It was found that the presence of dnRac1 does not inhibit early ERK activation (FIG. 5a). The need for ERK activation in positive selection is already well established (Alberola-Ila, J. et al., 1995, Nature 373: 620-623; Alberola-Ila, J. et al., 2003 , Immunol Rev 191: 79-96), and recently PAK1, which is a major target downstream of Rac1, is activated by ERK (Slack-Davis, JKet al., 2003, J Cell Biol 162: 281-291, Eblen, STet). al., 2002, Mol Cell Biol 22: 6023-6033). However, normal ERK activation in dnRac1-DPK indicates that TCR-mediated activation of ERK is independent of Rac1. Therefore, the inhibitory effect of dnRac1 on positive selection cannot simply be attributed to inhibition of ERK activation.

Rac1 is generally recognized as a key molecule in the actin reconstitution process (Tapon, N. et ai., 1997, Curr Opin Cell Biol 9: 86-92). Therefore, it is not surprising that the introduction of dnRac1 inhibits TCR-mediated actin polymerization (FIG. 5c). Dominant negative WASP transgenic mice;
Zhang, J. et al., 2002, Proc Natl Acad Sci USA 99: 2240-2245) is completely consistent with the requirement for actin polymerization during positive selection (abrogation) Despite being consistent, the role of actin cytoskeletal reorganization in T cell development remains unclear.
According to the present invention, it was shown that actin polymerization is required for positive selection in the DPK system by using an inhibitor of actin polymerization, Latrunculin A (FIG. 6d). Therefore, the lack of differentiation of dnRac1-DPK cells can be partially attributed to defects in TCR (T cell receptor) mediated actin reorganization) . Recently, TCR-mediated Rac activation and immunological synapse formation have been shown to be due to DOCK2 (Sanui, T. et al., 2003, Immunity 19: 119-129). It was. The Impaired positive selection observed in DOCK2-deficient mice (Sanui, T. et al., 2003, Immunity 19: 119-129) is actin cytoskeletal reorganization. It is consistent with the findings of the present invention that it is essential for positive selection via.

In the present invention, an increase in TCR-mediated apoptosis was observed in DP thymocytes (FIG. 3) and DPK cells (FIG. 4c) expressing dnRac1. The balance between TCR-mediated induction of pro-apoptotic and anti-apoptotic mediators is a key factor that distinguishes positive and negative selections. TCR stimulation of DP thymocytes induces orphan transcription factors Nur77 and Nor1 (Cheng, LE et al., 1997, Embo J 16: 1865-1875) and Bim (Szegezdi, E. et al., 2003, J Immunol 170: 3577-3854, Bouillet, P. et al., 2002, Nature 415: 922-926)) and Fas-L (Weih, F. et al., 1996, Proc Natl Acad Sci USA 93: 5533-5538) Inducing negative expression (Calnan, BJ et al., 1995, Immunity 3: 273-282, Zhou, T. et al., 1996, J Exp Med 183: 1879-1892) by inducing expression Plays. Induction of the Nur77 gene is positively controlled by MEF2, and Cabin1 (Youn, HD) via histone deacetylation
et al., 2000, Immunity 13: 85-94)) and HDAC7 (Dequiedt, F. et al., 2003, Immunity 18: 687-698)). TCR signaling releases these repressors from MEF2 to activate Nur77 transcription. In the DPK system, no effect of dnRac1 on the induction of these pro-apoptotic mediators was observed (FIG. 6). In fact, compared to control cells, dnRac1-DPK had even lower TCR-mediated Nur77 (TCR-mediated Nur77) induction. From these results, the increase in apoptosis in activated dnRac1-DPK cells is due to increased expression of pro-apoptotic mediators.

  In contrast, dnRac1 expression did not affect the expression of anti-apoptotic mediator Bcl-2 (FIG. 6, left panel). Furthermore, forced expression of Bcl-2 was able to restore antigen-induced apoptosis of defective CD4-SP generation and dnRac1-expressing DPK (FIG. 7). From these results, the involvement of Rac1 in the Bcl-2 mediated survival response is considered critical for the positive selection of thymocytes. Rac2-deficient mast cells have been shown to be defective in Akt activation and Bcl-xL expression, leading to impaired survival (Yang, FC et al., 2000, Immunity 12: 557-568). Thus, involvement of the Rac protein in mediating cell survival may be a more general phenomenon. In DP thymocytes, one anti-apoptotic signal is Akt-dependent Nur77 phosphorylation (Pekarsky, Y. et al., 2001, Proc Natl Acad Sci USA 98: 3690-3694, Masuyama, N. et al., 2001 , J Biol Chem 276: 32799-32805). Exclusion of Nur77 from the nucleus. In dnRac1-DPK cells, the state of phosphorylation of Nur77 has not been investigated, but it is unlikely that Rac1 is involved in the regulation of Nur77 phosphorylation. Tkt-mediated activation of Akt (TCR-mediated activation of Akt) depends on PI3-kinase, and the generation of CD4-SP cells in the in vitro differentiation system of DPK consists of PI3-Kinase inhibitors, Resistant to wortmannin and Ly294002.

  Bcl-2 is a major anti-apoptotic molecule and its expression increased immediately after positive selection (Punt, J.A. et al., 1996, J Exp Med 184: 2091-2099). Furthermore, TCR stimulation is known to induce Bcl-2 in vitro (Groves, T. et al., 1997, J Immunol 158: 65-75). In the 5 'regulatory region of the Bcl-2 gene, two promoter regions have been identified, and NF-kB (Catz, SD et al., 2001, Oncogene 20: 7342-7351) It has been shown to bind to one of the promoter regions. According to other studies, the Bcl-2 gene has been identified as NFAT4 (Oukka, M. et al., 1998, Immunity 9: 295-304) and NF-kB2 (Viatour, P. et al., 2003, Leukemia 17: 1349-1356). ) Showed positively regulated. Thus, Rac1 may be involved in TCR-mediated activation of NF-AT or NF-kB. Consistent with this idea, Rac1 activates NFAT4 in FcR-mediated signal transduction in mast cells (Turner, H. et al., 1998, J Exp Med 188: 527-537). Was shown to be involved.

  The present invention showed that Rac1 is required for positive selection but not for b-selection. Using an in vitro positive selection model system, Rac1 is a TCR-mediated actin cytoskeletal reorganization and induction of anti-apoptotic protein Bcl-2 It was shown to be critical in protein Bcl-2). The Rac1-dependent pathway of Bcl-2 induction can be a critical process for positive selection by preventing TCR-mediated apoptosis.

Pro-B cells were established from bone marrow of 2-week-old Pax5 knockout mice (Urbanek, P. et al., 1994, Cell 79: 901-912) and contained 2% FCS, 0.03% primatone and IL-7 The cells were cultured on ST2 stromal cells in IMDM medium (Nutt, SL et al., 1999, Nature 401: 556-562). 10 million transduced Pax5 ^{− / −} pro B cells were irradiated with 4 Gy of C57BL / 6-CD45.1-RAG2 ^{− / −} mice (Shinkai, Y. et al., 1992, Cell 68: 855- 867) was injected into the vein through the tail vein. After 3-4 weeks, flow cytometric analysis was performed.

  The retrovirus vector is prepared as follows. The dominant negative (N17) human Rac1 cDNA was cloned into the pEGFP-C1 (CloneTech) vector. For preparation of pMX-puro-dnRac1GFP, EGFP-Rac1N17 chimeric cDNA was cloned into the Not I site of pMXs-puro (Kitamura, T., 1998, Int J Hematol 67: 351-359) by PCR. The pMXs-PREP retroviral vector was prepared by combining the ClaI fragment of the marmot presequence (Zufferey, R., 1999, J Virol 73: 2886-2892) and the SalI fragment of the puromycin resistance gene, respectively. It was inserted into the ClaI and SalI sites of pMXs-IRES-GFP (Kitamura, T, 1998, Int J Hematol 67: 351-359). Rac1N17 cDNA cloned by PCR was inserted into pMXs-PREP to prepare pMXs-PREP-dnRac1.

Supernatant containing retrovirus from pMXs-puro-dnRac1GFP transfected with vector (pMX-puro-GFP) or Plat-E packaging cells (Morita, S., 2000, Gene Ther 7: 1063-1066) Was concentrated and used for pro-B cell infection. VSV pseudo-typed viruses were used for infection of DPK cells. Retrovirally transduced cells are selected with 1-2.5mg / ml puromycin, without single cell cloning using the cell sorter FACSVantage SE (Becton Dickinson). Cells with high GFP intensity (GFP ^hi cells) were electronically sorted.

  Human Bcl-2 cDNA amplified by PCR was inserted into a pMX-based retroviral vector pMI.2 having an IRES-human CD2 cassette. The supernatants containing the retroviruses from pMI.2-Bcl2 were used to establish Bcl2-DPK and dnRac1, Bcl2-DPK, respectively, control-DPK (pMXs-PREP) and dnRac1-DPK (pMXs-PREP-dnRac1) Was used to transduce.

The DPK differentiation assay was performed according to the literature description (Kaye, J. et al., 1992, Cell 71: 423-435) with some modifications. Briefly, placed DC-I which were irradiated for 9 × 10 ⁵ in each well of 6-well plates ^{(E k and ICAM-1 transfected} murine fibroblast), only the last 2 hours of culture time 100 ng / ml SEA (Toxin Technology, Sarasota, FL) was pre-cultured for 24 hours in the absence, and further 4.5 × 10 ⁵ DPK cells were added and cultured at 37 ° C. for 3 days. After completion of the culture, the cells are collected, stained with anti-CD4-PE (GK1.5) antibody and anti-CD8a-Biotin (53-6.7) antibody, and then subjected to streptavidin-true red for flow cytometry. ). All antibodies and stains are from Pharmingen (Palo Alto, CA).

  DPK cells were incubated with 10 mg / ml anti-CD3e antibody at 4 ° C. and then cross-linked with anti-hamster secondary antibody at 37 ° C. After incubation for the specified time, cells were lysed and Western blots were performed using anti-phospho-ERK antibody and anti-ERK antibody (Transduction Lab, Palo Alto, Calif.).

  DPK cells were added on coverslips coated with 10 mg / ml anti-CD3e antibody and anti-CD28 monoclonal antibody, respectively, followed by incubation at 37 ° C. for 15 minutes. After removing the supernatant, the cells were fixed with 4% paraformaldehyde, followed by treatment with phalloidin-Alexa594 (Molecular Pro-Be, Eugene, OR) after treatment with 0.3% saponin.

Thymocytes or DPK cells are FITC conjugated anti-CD45.2 (clone 104), PE conjugated anti-CD4 (GK1.5), anti-CD5 (53-7.3), Biotin-conjugated anti-CD8a
(53-6.7), anti-TCRb (597-H57), AnnexinV, anti-CD69 (H1.2F3), anti-CD45.1 (A20) and APC conjugated anti-CD8a (53-6.7) Stained with antibody. Stained cells were two laser-FACScalibur (Becton for 4 color FACS analysis.
Dickinson, Palo Alto, CA).

  RNA was isolated from the cells using RNeasy kit (Qiagen, Hilden, Germany), and real-time PCR was performed using QuantiTect SYBR Green RT-PCR Kit (Qiagen). Bcl-2a (5'cctgtggatgactgagtacct3 '/ 5'gagcagggtcttcagagaca3') and Nor1 (5'aagggcttcttcaagagaac3 '/ 5'tgaaatctgcagtactgacatc3') were used as primers for real-time PCR.

Pax5 is a master transcription factor for B cell development, and cultured pro-B cells derived from Pax5-deficient mice are irradiated with sub-lethal doses of RAG2 ^{− / −} mice (Rolink, AGet al., 1999, Nature 401: 603-606; Nutt, SLet al., 1999, Nature 401: 556-56; Schaniel, C., L. et al., 2002, Blood 99: 472-478). It has been shown to reconstitute normal hematopoietic cells other than B cells. RAG2 ^{− / −} mice (Shinkai, Y. et al., 1992, having CD45.1 as a background for discriminating cultured Pax5-deficient pro-B cells from host cells and injected cells. Cell 68: 855-867). As shown in FIG. 1a, CD45.2 positive, CD45.1 negative Pax5 ^{- / -} pro-B-derived thymocytes ^{(CD45.2 positive CD45.1 negative Pax5 - /} - pro-B-derived thymocytes) are injected It occurred normally after 4 weeks. The total number of reconstituted thymocytes varied from 30 million to 150 million, depending on the number of pro-B cells inoculated and the reconstitution period. However, a slight increase in pro-B cell-derived CD4 and CD single positive (hereinafter abbreviated as SP) cells was consistently observed compared to normal thymocytes (FIG. 1a).

In order to examine the function of Rac1 in T cell development, a mutant Rac1 gene was introduced into Pax5 ^{− / −} pro B cells. A pMXs-puro retrovirus vector (Kitamura, T) was prepared by fusing a sequence encoding EGFP to the N-terminus of dominant negative Rac1 (N17) cDNA (dominant negative Rac1 (N17) cDNA; hereinafter, dominant negative abbreviated as dn). , 1998, Int J Hematol 67: 351-359). When the dnRac1-GFP virus was transduced into Pax5 ^-/- pro B cells, the fusion protein was localized in the cell membrane, whereas the GFP (green fluorescent protein) vector transduced cells were homogeneously diffused. Green fluorescence was seen (left panel in FIG. 1b). Thymocytes were collected from mice 3 to 4 weeks after injection of transduced pro-B cells and stained with various cell surface antigens. When the thymocytes derived from dnRac1-GFP Pax5 ^{− / −} pro B cells were observed with a microscope, GFP fluorescence localized in the cell membrane was detected (lower right panel in FIG. 1b). There were some test-specific changes in the population of GFP-positive cells in the thymus, probably due to the gene silencing effect. However, the CD4 / CD8 profile of dnRac1-GFP-expressing thymocytes (dnRac1-GFP-expressing thymocytes) was completely different from the profile of thymocytes expressing only the GFP vector (GFP vector-expressing thymocytes). Thymocytes expressing dnRac1 contain only a few CD4-SP and CD8-SP cells, indicating that thymocyte development is strictly suppressed at the DP stage. (FIG. 2a). There is a correlation between the expression level of GFP and the severity of positive selection suppression, which is the same as expected for competitive dominant negative inhibitors (FIG. 2b). Interestingly, the development of DP cells from CD4 CD8 DN (CD4 CD8 double negative) cells is suppressed, indicating that Rac1 does not absolutely require β-selection. It was. DP-TCR ^hi cells are also severely reduced in dn-Rac1 expressing thymocytes (FIG. 2c), and in the early stages of the positive selection process, dn-Rac1 Has been shown to block positive selections.

Next, TCR-mediated apoptosis of dn-Rac1-expressing thymus
I examined apoptosis). Vector control and dnRac1-GFP transduced Pax5 ^{- / -} pro-B cells ^{(dnRac1-GFP transduced Pax5 - /} - pro-B cells) to RAG2 ^{- / -} injected into mice, the reconstituted thymus cells TCR media Rays Ted apoptosis Were tested in vitro. As shown in FIG. 3, even in the absence of stimulation, dnRac1-expressing thymocytes show an increase in apoptosis as determined by Annexin V staining, and also depend on stimulation of DP thymocytes. Sexual apoptosis was also increased in the presence of dn-Rac1.

  Use an in vitro model experiment system for CD4-SP differentiation to analyze the detailed function of Rac in TCR-mediated signal transduction during positive selection during positive selection Decided. DPK is a naturally occurring DP thymus from an AND-TCR transgenic mouse (Kaye, J. et al., 1992, Cell 71: 423-435, Kaye, J. et al., 1989, Nature 341: 746-749). It is a lymphoma (thymic lymphoma) cell. This cell line has been shown to differentiate into CD4-SP cells when cultured in vitro with antigen loaded APC (Kaye, J. et al., 1992, Cell 71: 423). -435). Also, positive selection of immature thymocytes (Shao, H. et al., 1997, J Exp Med 185: 731-744; Shao, H. et al., 1997, J Immunol 159: 5773-5776 Ochoa-Garay, J. et al., 1998, J Immunol 160: 3835-3843). The dominant negative (N17) Rac1 gene was introduced into the newly established pMXs-PREP retroviral vector by PCR cloning. This pMXs-PREP retroviral vector incorporates an IRES-GFP cassette and mRNA stabilization element (wPRE) sequence for efficient gene expression (Tahara-Hanaoka, S. et al., 2002, Exp Hematol 30: 11-17). DPK into which pMX-PREP-dnRac1 was introduced had some increase in cell size, but the expression levels of CD4, CD8 and TCR are distinct from cells infected with the control vector (pMXs-PREP) (Fig. 4a). It was possible. As shown in FIG. 4b, DPK cells transduced with the control vector gradually decreased CD8 expression, and almost 80% of the cells differentiated into CD4-SP cells 3 days after antigen stimulation. In contrast, in dnRac1-DPK (FIG. 4b), CD4-SP cells were almost completely lost. At the same time, the number of Annexin V positive apoptotic cells in TCR stimulation was dramatically increased in dnRac1-DPK compared to the control DPK cells (FIG. 4c). Similar results were obtained with the trypan blue dye exclusion method to determine cell viability. Taken together, these results clearly demonstrate that dnRac1 expression in DP thymus leads to suppression of positive selection and increased TCR-induced apoptosis in both in vivo and in vitro test systems. It was.

  To investigate the function of Rac1 in TCR-dependent signal transduction during positive selection, DPK cells were stimulated with beads coated with anti-CD3e monoclonal antibody to activate ERK and ERK1. It was evaluated by phosphorylation of 2 (Fig. 5a). The dnRac1 mutant had no effect on ERK activation, and activation of ERK by TCR stimulation was independent of Rac1. Also, TCR-mediated upregulation of CD69 and CD5 in dnRac1-DPK cells was also indistinguishable from that seen in control DPK cells (FIG. 5b).

  Next, we tested TCR-dependent actin polymerization in dnRac1-DPK because it is widely known that Rac plays a critical role in cytoskeletal reorganization. is there. At 15 minutes after TCR stimulation, control DPK cells showed accumulation of actin polymerization by phalloidin staining, whereas TCR-dependent actin polymerization was discarded in dnRac1-DPK (FIG. 5c). FIG. 5c). Control DPK cells, as detected by phalloidin staining, could not directly determine the requirement for actin reorganization during thymogenesis. Therefore, the effect of an inhibitor of actin polymerization on the differentiation of DPK cells was examined. Latrunculin A, an inhibitor of actin polymerization (Spector, I., 1983, Science 219: 493-495), is a CD4-SP induced by antigen in the DPK in vitro differentiation system. Cell development was completely blocked (FIG. 5b). These results indicate that in dnRac1-DPK cells, defects in actin polymerization are at least part of the positive selection inhibition mechanism.

  Massive apoptosis in stimulated dnRac1-DPK cells is due to either increased death effectors or decreased expression of anti-apoptotic proteins, and TCR ligation on DP thymocytes is Induction of death effectors such as Nor1 (Cheng, LE, 1997, Embo J 16: 1865-1875), plus Bcl-2 and Bcl-xL (Groves, T., M. et al , 1997, J Immunol 158: 65-75). To end this, we looked at the TCR-dependent induction of these molecules in the DPK system. Real-time RT-PCR analysis showed a 2-3-fold increase in Bcl-2 mRNA in TCR-stimulated control DPK cells, but in dnRac1-DPK cells No stimulus-dependent induction of Bcl-2 was observed (FIG. 6, left panel). In contrast, Nor1's TCR-dependent induction in dnRac1-DPK was comparable to control cells (FIG. 6, right panel). These results indicate that TCR-induced apoptosis in dnRac1-DPK cells is due to incorrect induction of anti-apoptotic molecule Bcl-2, and death effecter molecules ) Was not due to an increase in induction.

  If the defective positive selection observed in dnRac1-DPK is mainly due to massive apoptosis due to insufficient induction of Bcl-2, then dnRac1- Overexpression of Bcl-2 in DPK will repair this defect. For this purpose, Bcl-2 cDNA was introduced into dnRac1-DPK cells using a retrovirus. As shown in FIG. 7, the introduction of Bcl-2 enhanced the stimulation-dependent generation of CD4-SP. More importantly, however, the introduction of Bcl-2 almost completely rescued CD4-SP generation in dnRac1-DPK (upper panels in FIGS. 7a and 7b). At the same time, the stimulus-dependent apoptosis observed with dnRac1-DPK was also rescued by introduction of Bcl-2 (FIG. 7b lower panel). This result indicates that defective CD4 generation in dnRac1-DPK is mainly due to the lack of TCR-dependent Bcl-2 upregulation. ing.

  Next, the best mode for carrying out the invention regarding ERK5 will be described. ERK5 is a member of the fourth MAP kinase cascade following ERK, JNK, and p38, and is known to be important for right ventricle formation, angiogenesis and vascular smooth muscle differentiation. ERK5 phosphorylates the transcription factors MEF2C and MEF2D, but MEF2D is expressed not only in the nerve and vasculature but also in thymocytes, and expresses Nur77, which plays a central role in the negative selection of T cells. It is adjusting. Therefore, it was considered that ERK5 may play an important role not only in the cardiovascular system but also in the process of selecting immature T cells. Negative selection is an important process that eliminates autoreactive T cells and may be involved in the pathogenesis of autoimmune diseases such as dilated cardiomyopathy. In the present invention, focusing on the differentiation process of T cells, particularly negative selection, the novel function of ERK5 was examined.

  A new T cell reconstruction experiment system using Pax5-deficient pro-B cells was established, and functional analysis of T cell differentiation of ERK5 was performed using this experiment system. In the thymus overexpressing the dominant-incapable ERK5 gene, mature CD4 T cells and CD4 / CD8 double positive cells after selection increased. These results indicated that ERK5 is involved in negative selection signaling in the thymus.

  ERK5 phosphorylates the transcription factors MEF2C and MEF2D, but MEF2D is expressed not only in the nerve and vasculature but also in thymocytes, and is responsible for the expression of Nur77, which plays a central role in T cell negative selection It is adjusting. Therefore, ERK5 may play an important role not only in the cardiovascular system but also in the selection process of immature T cells. Negative selection is an important process that eliminates autoreactive T cells and may be involved in the pathogenesis of autoimmune diseases such as dilated cardiomyopathy. In the present invention, the function of ERK5 was examined focusing on the differentiation process of T cells, particularly negative selection. In the thymus overexpressing the incapable ERK5 gene, mature CD4 T cells and CD4 / CD8 double positive cells after selection increased. ERK5 is a member of the fourth MAP kinase cascade following ERK, JNK, and p38, and is known to be important for right ventricle formation, angiogenesis, and vascular vascular smooth muscle differentiation. These results indicated that ERK5 is involved in negative selection signaling in the thymus.

  What does it mean that the expression of dnERK5 increased the percentage of mature CD4 single positive cells and increased the number of double positive cells that highly express TCRb, CD69, CD2, CD5, and LFA-1? TCRb, CD69, CD2, CD5, and LFA-1 are molecules that are known to increase in expression after double positive cells are selected and differentiated, and are used as differentiation markers. This result therefore means that the expression of dnERK5 increased the number of double positive cells after undergoing selection. The increase in the number of mature CD4T cells and the number of double positive cells after selection means that cells that would otherwise have been excluded by negative selection escaped negative selection due to overexpression of dnERK5 and survived. Show.

  A new T cell reconstruction experiment system using Pax5-deficient pro-B cells was established, and functional analysis of T cell differentiation of ERK5 was performed using this experiment system. In the thymus overexpressing the dominant-incapable ERK5 gene, mature CD4 T cells and DP cells after selection increased. These results indicated that ERK5 is involved in negative selection signaling in the thymus.

  The construction of the pMXs-PREP-dnERK5 vector is described. Since the ERK5 knockout mouse became embryonic lethal due to dysplasia of the cardiovascular system, analysis was performed using the mutant gene dnERK5, which is known to work as a dominant-incapable form in vivo. dnERK5 lacks 139 amino acid residues in the N-terminal part of ERK5 (Yan et al. Molecular cloning of mouse ERK5 / BMK1 splice variants and characterization of ERK5 functional domains. J. Biol. Chem. 276 (14), 10870-10878, 2001), and formed by alternative splicing in vivo. dnERK5 lacks the GTP binding site, has no phosphorylation activity, and does not interact with MEK5 located upstream of ERK. PCR cloning of the dnERK5 gene was performed to obtain a retroviral vector pMXs-PREP-dnERK5 (FIG. 8). The pMXs-PREP vector is a pMX vector in which an IRES-GFP site is incorporated, and dnERK5 and GFP are simultaneously expressed as separate proteins from a single mRNA. Therefore, the expression of dnERK5 mRNA can be confirmed by monitoring the fluorescence of GFP. In addition, drug selection is possible using the PRE region and puromycin resistance gene for mRNA stabilization.

  For sorting of cells that highly express the transgene, cells infected with dnERK5-expressing retrovirus were selected with puromycin, and cells that highly expressed GFP were sorted using FACS Vantage (Becton Dickenson). This is because the pMXs-PREP vector has a correlation that the stronger the fluorescence of GFP, the more mRNA of the target gene is expressed. The FACS Vantage sorting uses a water droplet charging method. The principle of the water droplet charging method will be described below. The jet stream ejected from the nozzle of the machine is dropped by water droplets from a position 2 to 3 mm away from the laser irradiation part due to the vibration generated by the ultrasonic generator installed at the top of the nozzle. The formation of water droplets can be observed in a stationary state on a video monitor by irradiation with a strobe lamp synchronized with vibration. To sort cells whose scattered light and fluorescence are detected by laser light irradiation, add a positive or negative charge to the entire water stream just before the water stream splits into water droplets, and add water droplets containing the target cells in the set area. Or make it negatively charged. In the middle of dropping, the charged water droplets are attracted to two deflecting plates having a potential difference of 5000 V, and the direction is bent left and right and falls. Water droplets that do not contain uncharged cells, or water droplets that contain cells other than the target, fall vertically and are discarded. In this method, water droplets can be charged positively and negatively, so that two types of cell groups can be sorted simultaneously. As a result of sorting, the ratio of cells that highly expressed GFP was 25% before sorting and 75% after sorting, and high expressing cells were obtained (FIG. 9).

The establishment of a new thymus reconstruction system is as follows. Pax5 gene-deficient pro-B cells are cultured cells having properties similar to hematopoietic stem cells (Nutt et al. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature. 401 (6753), 556-562, 1999. ) Has the ability to differentiate into all hematopoietic cells other than B cells by transfer to RAG2 gene-deficient mice (Rolink et al. Long-term in vivo reconstitution of T-cell development by Pax5-deficient B-cell progenitors. Nature. 401 (6753), 603-606, 1999). RAG2 gene-deficient mice express CD45.1 as a cell surface antigen, while Pax5 gene-deficient pro-B cells express CD45.2. Therefore, by analyzing the cell surface antigen of the thymus by flow cytometry, it is possible to distinguish whether the thymocytes are reconstructed or are native to the RAG2 gene-deficient mouse (FIG. 10).
When thymic cells of RAG2 gene-deficient mice are gated on CD45.1 positive cells (93%) and analyzed for CD4 and CD8 expression, almost all cells (96%) are CD4 / CD8 double negative cells. I understand that. When Pax5 gene-deficient pro-B cells were intravenously injected into this mouse and the thymus was removed 3 weeks later and the expression of each molecule of CD45.1 and CD45.2 was analyzed, almost all (98%) cells were CD45. 2 is positive. When CD4 and CD8 expression in CD45.2 positive cells was analyzed, CD4 / CD8 double negative cells (wild type 1%, 4% after reconstruction), CD4 / CD8 double positive cells (wild type) as in wild type B6 mice. 87%, 79% after reconstitution), CD4 single positive cells (10% wild type, 14% after reconstitution), CD8 single positive cells (2% wild type, 3% reconstitution). Therefore, in the thymus reconstruction experiment system using Pax5 gene-deficient pro-B cells, the thymus is reconstructed in 3 weeks, and the reconstructed thymocytes are derived from Pax5 gene-deficient pro-B cells.

The increase in the proportion of mature CD4 single positive T cells in dnERK5-expressing thymocytes is described. The cells expressing high GFP were gated, and the expression profiles of CD4 / CD8 were analyzed for the cells in the gate. The proportion of mature CD4 single positive T cells reconstituted from dnERK5-expressing cells was 70%, an increase compared to 41% of controls. (Fig. 11)
The proportion of CD4 / CD8 double positive T cells was 15%, which was reduced compared to 44% of the control. The proportion of CD8 single positive T cells was 8%, which was almost the same as 6% of the control.

  In dnERK5-expressing double positive cells, it is shown below that there are many cells with advanced differentiation. Among the reconstructed thymocytes, expression of various differentiation markers was analyzed in CD4 / CD8 double positive cells (FIG. 12). The percentage of TCRb high-expressing cells reconstructed from dnERK5-expressing cells was 37%, an increase compared to 10% of the control. The proportion of cells expressing high CD69 was 36%, an increase compared to 13% of the control. The percentage of CD2 highly expressing cells was 70%, an increase compared to 57% of the control. The percentage of cells expressing high CD5 was 67%, which was higher than 43% of the control. The ratio of LFA-1 highly expressing cells was 71%, which was higher than 48% of the control. From the above results, it was shown that in the 3.5 dnERK5-expressing double positive cells, there are many well-differentiated cells.

  What does it mean that the expression of dnERK5 increased the percentage of mature CD4 single positive cells and increased the number of double positive cells that highly express TCRb, CD69, CD2, CD5, and LFA-1? TCRb, CD69, CD2, CD5, and LFA-1 are molecules that are known to increase in expression after selection of double positive cells and advancement of differentiation, and are used as differentiation markers. This result therefore means that the expression of dnERK5 increased the number of double positive cells after undergoing selection. The increase in the number of mature CD4 T cells and the number of double positive cells after selection indicates that cells that would otherwise have been excluded by negative selection escaped selection and survived by overexpression of dnERK5. Yes.

  A new T cell reconstruction experiment system using Pax5-deficient pro-B cells was established, and functional analysis of T cell differentiation of ERK5 was performed using this experiment system. In the thymus overexpressing the dominant-incapable ERK5 gene, mature CD4 T cells and DP cells after selection increased. These results indicated that ERK5 is involved in negative selection signaling in the thymus.

Viral production packaging cells Plat-E (Morita et al., 7 (12) 1063-1066, 2000) are cultured with RPMI1640 (GIBCO BRL), 10% FCS (Nichirei), 1% Penicillin / Streptomycin (GIBCO BRL) , 100 mM Non-Essential amino acid solution (GIBCO BRL), 10 mM HEPES (GIBCO BRL), 1 mM Sodium Pyruvate (GIBCO BRL), 55 mM 2-ME (GIBCO BRL), 1 mg / ml Puromycin (SIGMA), 10 mg / ml Blastcidin S Was used. ST2 is a feeder cell of Pax5 gene-deficient pro-B cells. IMDM (GIBCO BRL), 10% FCS (Nichirei), 1% Penicillin / Streptomycin (GIBCO BRL), 100 mM Non-Essential amino acid solution (GIBCO BRL) , 1 mM Sodium Pyruvate (GIBCO BRL) and 55 mM 2-ME (GIBCO BRL) were added. Pax5 gene-deficient pro-B cells were cultured by adding Pax5 gene-deficient pro-B cells to a cell culture dish in which ST2 cells irradiated with 3000R radiation had been seeded in advance. IMDM (GIBCO BRL) plus 2% FCS (Hyclone), 1% Penicillin / Streptomycin (GIBCO BRL), 100 mM Non-Essential amino acid solution (GIBCO BRL), 10 mM HEPES (GIBCO BRL), 0.03% Primatone, 2% J558- A medium having a composition to which IL7 sup was added was used. All cells were cultured in a CO ₂ incubator (5% CO ₂ /95% air, 37 ° C.).

  The following describes PCR cloning of the dnERK5 gene. The ERK5c gene (hereinafter referred to as dnERK5 gene) lacking the N-terminal part known to work as a dominant-incapable type was PCR cloned. The PCR amplification primers used for cloning were 5'-tttggatccgccaccatgtacccatacgatgttccagattacgctatggagagcgacctacac-3 'as the forward primer and 5'-tttggatccgccaccatgtacccatacgatgttccagattacgctattgaggaccggaccatggacc'cgctatggacacc. As a template DNA for PCR, plasmid pBluescriptII KS-ERK5 was used. Ex Taq DNA polymerase (TaKaRa), 10 × concentration buffer, and dNTP mixture (TaKaRa) were used for the PCR reaction. A total volume of 50 ml containing 1 ml each of 100 pmole / ml PCR primer, 5.0 ml of 10 × concentration buffer, 4 ml of 2.5 mM dNTP mixture, 0.5 ml of Ex Taq DNA polymerase and 100 ng of template DNA (pBluescriptII KS-ERK5) was used. PCR conditions were 95 ° C. for 2 minutes, followed by 20 cycles of 95 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. for 3 minutes, and a final extension time of 72 ° C. for 10 minutes. QIA quick PCR purification kit (QIAGEN) was used for purification of PCR products. This DNA fragment was subjected to restriction enzyme treatment using BamHI (TaKaRa), and ligated using pMXs-PREP vector similarly treated with BamHI and TaKaRa DNA Ligation Kit Ver. 2 (TaKaRa). Escherichia coli JM109 (Promega) was transformed with pMXs-PREP plasmid or pMXs-PREP-dnERK5 plasmid to obtain recombinant bacteria. Transformation was performed by the heat shock method. The clone into which the vector was introduced was cultured, and a plasmid was prepared using the QIAGEN Plasmid Maxi Kit (QIAGEN). The entire nucleotide sequence of the plasmid was confirmed using BigDye Terminator v3.1 (Applied Biosystems) and Dye EX Kit (QIAGEN).

The preparation of dnERK5-expressing retrovirus is as follows. The lipofection method was used as a method for introducing the pMXs-PREP plasmid or the pMXs-PREP-dnERK5 plasmid into the virus-producing packaging cell Plat-E. Pre-Poly-L-Lysine (SIGMA) in a dish that has been coated seeded Plat-E (5x10 ⁶ cells / 10 ml culture medium / 10cm dish ) was over-night culture. Serum-free medium for lipofection Opti-MEM (GIBCO BRL) 600 ml and lipofection reagent FuGene 6 (Roche) 18 ml were mixed and incubated at room temperature for 5 minutes. 6 mg of plasmid DNA pMXs-PREP-dnERK5 or 6 mg of pMXs-PREP was added to the mixed solution, incubated at room temperature for 15 minutes, and added to the culture supernatant of Plat-E that had been dispersed the day before. The medium was changed on the next day and two days after the lipofection, and the virus-containing culture supernatant was collected three days, four days, and five days later. The collected supernatant was centrifuged at 6,000 rpm for 16 hours at 4 ° C., and the pellet was resuspended in 1 ml PBS. This gave a high titer retrovirus solution.

Retroviral infection of cells, sorting of high-transgene-expressing cells was performed by incubating 1x10 ⁶ Pax5 gene-deficient pro B cells and 200 ml of high-titer retrovirus solution at 37 ° C for 1 hour, and 3000R radiation ST2 cells irradiated with were added to a cell culture dish prepared beforehand and cultured under normal conditions. After 16-24 hours, puromycin was added to 2.5 mg / ml and drug selection was performed. For 1 × 10 ⁷ cells after selection, cells that highly express GFP were sorted using FACS Vantage (Becton Dickenson).

Reconstruction of thymus using Pax5 gene-deficient pro-B cells was performed using a novel experimental system using Pax5 gene-deficient pro-B cells to test the function of ERK5 in T cell differentiation. Seven Pax5 gene-deficient pro-B cells (1 × 10 ⁷ cells) were suspended in 500-600 ml of PBS, passed through a 42 mm nylon mesh filter, and then injected intravenously into RAG2 gene-deficient mice. Mouse breeding, intravenous tail injection, and thymus extraction were in accordance with the Yamaguchi University animal experiment usage guidelines.

Thymocyte flow cytometric analysis was performed. Three weeks after intravenous injection of Pax5 gene-deficient pro-B cells into RAG2 gene-deficient mice, the reconstructed thymus was removed and CD45.1, CD45.2, CD4, CD8, TCRb, CD69, CD2, CD5 Then, flow cytometry analysis was performed for the expression of LFA-1. 1 × 10 ⁶ thymocytes were seeded per well in a 96-well round bottom plate, and the plate was centrifuged at 2,000 rpm for 1 minute at 4 ° C. Discard the supernatant by decantation and label each antibody with fluorescent dye or biotin (CD45.1-FITC, CD45.2-FITC, CD4-PE, CD8-biotin, CD8-APC, TCRb-biotin, CD69-biotin, CD2 -biotin, CD5-biotin, LFA-1-biotin) was added and incubated at 4 ° C. for 20 minutes in the dark. After incubation, FACS medium (1 × HBSS, BSA, sodium azide) was added and the plate was washed twice. 15 ml of Streptavidin-Red670 reagent was added and incubated for 10 minutes at room temperature, protected from light. After incubation, the plate was washed twice, and the resulting pellet was resuspended in 200 ml of FACS medium, passed through a 42 mm nylon mesh filter to remove cell clumps, and used for flow cytometry analysis. Flow cytometry analysis of the reconstituted thymocytes is possible with FACS Calibur (Becton Dickenson) capable of simultaneous three-color analysis of GFP or FITC, PE and TruRed, or four-color simultaneous analysis of GFP or FITC, PE, APC and TruRed A possible dual laser mounted FACS Calibur (Becton Dickenson) was used.

FIG. 1 is a diagram relating to reconstitution of T cell differentiation by Pax5-deficient pro-B cell precursors. (A) Pro B cells derived from Pax5 ^{− / −} mice (CD45.2) were cultured in the presence of IL-7, and then transferred to CD45.1, RAG2 ^{− / −} mice irradiated with a sublethal dose of radiation. Four weeks after injection, thymocytes were analyzed by 4-color FACS. CD45.1 ^+, CD45.2 ^- (center of the figure) or CD45.1 ^-, CD45.2 ⁺ cells within the gate of (top and bottom) are shown (right panels). (B) Microscopic analysis of Pax5 ^{− / −} pro B cells (left panel) transduced with vector (pMXs-puro-GFP) or pMXs-puro-dnRac1 and the resulting pro B cell-derived thymocytes It is a figure which shows (right panel). FIG. 3 shows that positive selection is impaired in thymocytes expressing dn-Rac1. (A) CD4 and CD8 of thymocytes derived from vector or dnRac1-transduced Pax5 ^{− / −} pro B cells were stained. CD4 / CD8 profiles of GFP positive gated cells are shown. These profiles are representative of three independent trials. (B) Mouse thymocytes reconstituted with dnRac1 pro-B cells were divided into GFP negative, GFP low expression, and GFP high expression populations, and the CD4 / CD8 profiles of each group were shown. (C) TCR expression (left panel) of cells that were GFP positive and entered the gate of DP was shown (right panel). It is a figure which shows that TCR-induced apoptosis (TCR-induced apoptosis) increases in presence of dn-Rac1. dnRac1-GFP transduced with Pax5 ^{- / -} pro-B cell-derived thymocytes and control vector transduced with Pax5 ^{- / -} pro-B cell-derived thymocytes, various coated on the plate an antibody or 10 ng / Each was activated with ml PMA and 1 mg / ml A23187 for 6 hours. FIG. 3 shows Annexin V staining profiles of GFP positive and CD4 and CD8 double positive cells. It is a figure which shows that dominant negative Rac1 (Dominant negative Rac1) blocks the differentiation of CD4-SP, and increases the apoptosis of DPK cells. (A) GFP, FSC and TCRb expression in dnRac1-transduced DPK cells. (B) Vector (pMXs-PREP) and pMXs-PREP-dnRac1 transduced DPK cells were co-cultured with DC-I and 100 ng / ml SEA. Cells were collected at the specified incubation time and analyzed by flow cytometry. FIG. 4b shows the phenotype of GFP positive cells. (C) TCR activation induces apoptosis in the presence of dnRac1. DPK cells transduced with GFP-positive dnRac1 or control vector were collected at each designated incubation time and stained with Annexin V. The ratio of cells stained with Annexin V was plotted on the graph for each group. did. FIG. 4 shows that dnRac1 (dominant negative Rac1) does not inhibit TCR-dependent early MAPK activation but inhibits TCR-mediated actin polymerization. (A) It is a figure which shows that a DPK cell is activated by an anti-CD3e antibody. Cell lysates were prepared after the specified time (minutes) and analyzed by Western blot using anti-phospho-ERK or anti-ERK antibodies. (B) The expression levels of CD5 and CD69 on dnRac1-DPK cells after 16 hours of culture were analyzed by FACS. The number of cells after 16 hours of culturing in the presence of APC is indicated by a dotted line in the absence of SEA and by a solid line in the presence of SEA. (C) TCR mediated Actin polymerization is inhibited by dnRac1. DPK cells transduced with dnRac1 control vector or dnRac1 were cultured on a coverslip coated with anti-CD3 and CD28 monoclonal antibodies for 15 minutes, immobilized and permeabilized, and then detected to detect polymerized actin fibers. Stained with conjugated gated phalloidin. (D) It is a figure which shows that generation | occurrence | production (Generation) of CD4-SP cell is required for actin polymerization. DPK cells were co-cultured for 3 days with DC-I and SEA in the presence of the amount shown in FIG. 5d, Latruncullin A, an inhibitor of actin polymerization. It is a figure which shows the influence of dnRac1 in the expression of an apoptosis related gene cluster. Tcl-dependent upregulation of Bcl-2 was impaired in dnRac1-DPK. Changes in the expression of Bcl-2a and Nor1 were observed in quantitative real-time RT-PCR in DPK cells activated for 16 hours with anti-CD3 and anti-CD28 antibodies immobilized on plates. Determined by. Results were expressed as the ratio of the expression of the control housekeeping genes GAPDH and Bcl-2a or Nor1. FIG. 3 shows that overexpression of Bcl-2 rescues CD4-SP generation and TCR-mediated apoptosis in dnRac1-DPK. (A) DPK cells transduced with either vector (pMXs-PREP) or pMXs-PREP-dnRac1, pMI.2-Bcl2 and co-cultured with DC-I and 100 ng / ml SEA. Cells were harvested after 3 days and analyzed by flow cytometry. The CD4 and CD8 profiles of GFP ⁺ (upper two rows of the panel) and the CD4 and CD8 profiles of GFP ⁺ and hCD2 ⁺ cells (lower two rows of the panel) are shown. (B) The absolute number of viable CD4-SP (upper panel) and total cell number (lower panel) after the indicated incubation time was counted. The number of GFP positive cells was counted. It is a figure which shows construction of a dnERK5 retrovirus expression vector. It is a figure which shows the fractionation of the cell which highly expresses GFP by the sorting method. It is a figure regarding discrimination | determination of Pax5-deficient pro B cell and a RAG2 gene deletion mouse origin cell. It is a figure which shows the result of the flow cytometry analysis of a dnERK5 expression thymocyte. It is a figure which shows the expression of each differentiation marker in DP cell.

Claims (10)

  A novel immune cell control / differentiation factor gene search method, in which a function-unknown gene is introduced into Pax5-deficient pro-B cells and the expressed cells are injected into RAG2-deficient animals.   A novel immune cell control / differentiation factor gene search method in which a function-unknown gene is introduced into a Pax5-deficient mouse-derived pro-B cell and the expressed cell is injected into a RAG2-deficient mouse.   A novel T cell reconstitution test system prepared by introducing a gene of unknown function into Pax5-deficient pro-B cells and injecting the expressed cells into RAG2-deficient animals.   A novel T cell reconstitution test system prepared by introducing a gene with unknown function into a Pax5-deficient mouse-derived pro-B cell and injecting the expressed cell into a RAG2-deficient mouse.   It was elucidated by using a novel immune cell control / differentiation factor gene search method using gene transfer into Pax5-deficient pro-B cells obtained using the novel T cell reconstitution test system according to claim 3 or 4. Rac1 with new functions.   6. Rac1 according to claim 5, wherein Rac1 having a novel function is involved in positive selection signaling in the thymus during the process of differentiation of immature T cells.   6. Rac1 according to claim 5, characterized in that Rac1 having a novel function does not require thymic β-selection.   It was elucidated by using a novel immune cell control / differentiation factor gene search method using gene transfer into Pax5-deficient pro-B cells obtained using the novel T cell reconstitution test system according to claim 3 or 4. Rac1 with new functions.   8. ERK5 according to claim 7, wherein the novel function is involved in signaling of negative selection in the thymus during the process of differentiation of immature T cells.   Utilization of a novel immune cell control / differentiation factor gene search method for immunotherapy using gene transfer to Pax5-deficient pro-B cells.

Images