JP2006166789A - New method for diagnosing cancer - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To discover a gene exhibiting an extremely low expression level in a normal tissue and a high cancer-specific expression level to provide a new method for diagnosing cancer by using the gene. <P>SOLUTION: The genes encoding DKK4 [Homo sapiens dickkopf homolog 4 (Xenopus laevis)], NOHMA (Homo sapiens HORMA domain containing protein), CYP2W1 (Homo sapiens cytochrome P450, family 2, subfamily W, polypeptide 1) and APIN (Homo sapiens APin protein) have the cancer-specific expression levels, and enables the objective diagnosis of the cancer to be carried out by comparing the expression level with a normal level. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a novel method for diagnosing cancer, and particularly to a method for diagnosing cancer by comparing the expression level of a specific gene in gastric cancer and colorectal cancer with a normal level.

  Conventionally, pathomorphological diagnosis has been mainly used for diagnosis of cancer. The qualitative diagnosis of lesions by pathomorphological diagnosis, the extent of spread, determination of the presence of intravascular invasion and stump invasion are indispensable for selection and determination of post-treatment. However, lesions that show a form between benign and malignant are not uncommon, and there is a limit to the malignancy and prognostic analogy in the change in form. In order to compensate for such weaknesses of pathomorphological diagnosis, molecular biological analysis has been used, and various molecular markers for cancer have been developed.

  Carcinoembryonic antigen (hereinafter abbreviated as “CEA”) is already put to practical use as a marker for gastrointestinal cancers such as gastric cancer and colon cancer. CEA is widely used as a molecule that can be detected in blood for the diagnosis of adenocarcinoma including gastrointestinal cancer, but it is inappropriate for detecting early cancer in gastric cancer and colon cancer. It has been pointed out as a problem that liver cirrhosis and the like are detected in the blood and have many false positives (see, for example, Non-Patent Document 1 and Non-Patent Document 2).

  In addition to CEA, CA19-9 can be mentioned as a marker used in clinical practice. However, CA19-9 also has a low early cancer detection rate in gastric cancer and colon cancer, as in CEA. In addition, none of the markers are highly specific for gastrointestinal cancer.

  On the other hand, the gene found by the present inventors to be highly expressed in gastric cancer and colorectal cancer is a gene encoding Homo sapiens dickkopf homolog 4 (Xenopus laevis) (hereinafter abbreviated as “DKK4”), Homo sapiens. A gene encoding HORMA domain containing protein (hereinafter abbreviated as “NOHMA”), a gene encoding Homo sapiens cytochrome P450, family 2, subfamily W, polypeptide 1 (hereinafter abbreviated as “CYP2W1”) and Homo sapiens APin There are four types of genes encoding protein (hereinafter abbreviated as “APIN”).

  DKK4 (GenBank Ac No. NM_014420) was cloned in 1999 as a gene that negatively regulates the Wnt signal. It has been shown that when expressed in 293T cells, it is secreted extracellularly. In addition, the relation with cancer is not known at all (see Non-Patent Document 3).

  NOHMA (GenBank Ac No. NM_032132) is a protein having a HORMA domain and was identified in 1998. The HORMA domain is common to Hop1PCR, Rev7p, and MAD2. A molecule having a HORMA domain is assumed to be a molecule that directly binds to chromatin and controls DNA repair and cell cycle. Nothing is known about NOHMA except that it is a molecule having a HORMA domain (see Non-Patent Document 4).

  CYP2W1 (GenBank Ac No. NM — 017781) is one of the newly identified full length of 15000 human and mouse cDNAs in 2002. From the nucleotide sequence, it is assumed to be one of the cytochrome P450 genes, but details are not known at all (see Non-Patent Document 5). Many families of cytochrome P450 are known as drug metabolizing enzymes.

APIN (GenBank Ac No. NM — 07855) has been identified as a constituent molecule of amyloid deposition in calcifying epithelial odontogenic tumors. The significance in cancer cells is completely unknown (see Non-Patent Document 6).
Horie Y, Miura K, Matsui K, Yukimasa A, Ohi S, Hamamoto T, Kawasaki H. Marked elevation of plasma carcinoembryonic antigen and stomach carcinoma. Cancer .; 77 (10): 1991-7 (1996). Molnar IG, Vandevoorde JP, Gitnick GL.CEA levels in fluids bathing gastrointestinal tumors.Gastroenterology.; 70 (4): 513-5 (1976). Krupnik VE, Sharp JD, Jiang C, Robison K, Chickering TW, Amaravadi L, Brown DE, Guyot D, Mays G, Leiby K, Chang B, Duong T, Goodearl AD, Gearing DP, Sokol SY, McCarthy SA. Functional and structural diversity of the human Dickkopf gene family.Gene 238 (2), 301-13 (1999). Aravind L, Koonin EV.The HORMA domain: a common structural denominator in mitotic checkpoints, chromosome synapsis and DNA repair.Trends Biochem Sci 23 (8), 284-6 (1998). Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD, Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg B, Buetow KH, Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore T , Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin GM, Hong L, Stapleton M, Soares MB, Bonaldo MF, Casavant TL, Scheetz TE, Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P, Prange C, Raha SS, Loquellano NA, Peters GJ, Abramson RD, Mullahy SJ, Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne PH, Richards S, Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk SW, Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madan A, Young AC, Shevchenko Y, Bouffard GG , Blakesley RW, Touchman JW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Krzywinski MI, Skalska U, Smailus DE, Schnerch A, Schein JE, Jones SJ, Marra MA; Mammalian Gene Collection Program Team. Generation and ini tial analysis of more than 15,000 full-length human and mouse cDNA sequences.Proc Natl Acad Sci USA 99 (26), 16899-903 (2002). Solomon A, Murphy CL, Weaver K, Weiss DT, Hrncic R, Eulitz M, Donnell RL, Sletten K, Westermark G, Westermark P. Calcifying epithelial odontogenic (Pindborg) tumor-associated amyloid consists of a novel human protein.J Lab Clin Med. 142 (5), 348-55 (2003).

  As described above, there is a problem that the tumor markers that are put into practical use are not highly specific for gastric cancer and colon cancer, and there are many false positives. It has also been pointed out that it is inappropriate for detecting early cancer. Therefore, development of a highly specific tumor marker capable of early detection of gastric cancer and colon cancer is strongly desired.

  The present invention has been made in view of the above problems, and its purpose is to find a tumor marker that has a very low expression level in normal tissues and has high specificity for gastrointestinal cancers such as gastric cancer and colon cancer, It is an object of the present invention to provide a novel diagnostic method for cancer using this.

  In order to solve the above problems, the present inventors comprehensively analyzed genes expressed in gastric cancer tissues obtained by surgery using a SAGE (Serial analysis of gene expression) method, and expressed them in normal tissues. By comparing with the level, a gene having a specifically high expression level in gastric cancer was identified. Furthermore, the present inventors have found that these genes are specifically expressed at a high level in colorectal cancer, and have completed the present invention.

That is, the method according to the present invention is a method for diagnosing cancer using a sample derived from a subject, wherein the base sequence represented by SEQ ID NO: 1, 3, 5 or 7 or a portion thereof in the sample derived from the subject. A polynucleotide measuring step for measuring at least one level of the polynucleotide containing the sequence, and a comparison step for comparing the level of the polynucleotide with a normal level. It has been clarified by the present inventors that the polynucleotide is expressed at a high level in cancer tissue. Therefore, by comparing the level of the polynucleotide and the normal level in the sample derived from the subject, it is possible to easily and objectively diagnose whether the subject has cancer.

  In the polynucleotide measurement step, it is preferable to use at least one polynucleotide having the base sequence represented by any one of SEQ ID NOs: 9 to 16. These polynucleotides are the polynucleotides used by the inventors to actually measure the above-mentioned polynucleotide levels, and it has been confirmed that they can be used in the method of the present invention.

  The method according to the present invention is a method for diagnosing cancer using a sample derived from a subject, wherein the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 8 or a portion thereof in the sample derived from the subject. It comprises a polypeptide measurement step for measuring at least one level of a polypeptide comprising a sequence, and a comparison step for comparing the level of the polypeptide with a normal level. If the expression level of the gene is measured as the polypeptide level encoded by the gene and compared with the normal level, it can be easily and objectively diagnosed whether the subject has cancer.

  In the polypeptide measurement step, an antibody that specifically binds to at least one of the polypeptides consisting of the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 8, or a partial sequence thereof can be used.

  The method of the present invention is preferably used for diagnosis of gastric cancer or colorectal cancer.

  The device according to the present invention is a device for diagnosing cancer using a sample derived from a subject, and at least a polynucleotide comprising the base sequence shown in SEQ ID NO: 1, 3, 5 or 7 or a partial sequence thereof. A polynucleotide that specifically hybridizes with one is immobilized on a support. The polynucleotide immobilized on the support is preferably at least one of the polynucleotides having the base sequence shown in any one of SEQ ID NOs: 9 to 16. The device according to the present invention has an antibody that specifically binds to at least one of the amino acid sequences shown in SEQ ID NOs: 2, 4, 6 and 8, or a polypeptide comprising a partial sequence thereof, immobilized on a support. It may be.

  By using the instrument configured as described above, the method of the present invention can be easily carried out.

  The kit according to the present invention is a kit for diagnosing cancer using a sample derived from a subject, and comprises a polynucleotide comprising the base sequence shown in SEQ ID NO: 1, 3, 5 or 7 or a partial sequence thereof. It is characterized by that. The polynucleotide is preferably at least one of the polynucleotides having the base sequence shown in any one of SEQ ID NOs: 9 to 16. The polynucleotide is preferably used as a primer for RT-PCR or real-time RT-PCR.

  The kit according to the present invention may comprise an antibody that specifically binds to at least one of the amino acid sequences shown in SEQ ID NOs: 2, 4, 6 and 8, or a polypeptide comprising a partial sequence thereof.

  By using the kit having the above structure, the method of the present invention can be easily carried out.

  By using the method according to the present invention, it is possible to diagnose cancer based on objective molecular criteria. For example, it is possible to make a diagnosis based on molecular criteria for a cancer that is difficult to diagnose with a pathomorphological diagnosis, and contribute to elucidation of the mechanism of the cancer.

  Moreover, although there is a problem that there are many false positives in the diagnosis by the conventional marker, the method according to the present invention has a high specificity and thus has an effect that there are few false positives. Furthermore, although it has been difficult to detect early stage cancers with conventional markers, the use of the method according to the present invention has the effect that early stage cancers can be detected with high sensitivity.

  An embodiment of the present invention will be described as follows. Note that the present invention is not limited to this.

(1) Method for diagnosing cancer The present inventors have used the SAGE (Serial analysis of gene expression) method to cover genes expressed in four cases of gastric cancer tissues including one case of early gastric cancer obtained by surgery. Analysis and comparison with expression levels in normal tissues identified gastric cancer specific gene candidates. Furthermore, with respect to these candidate genes, the expression levels in 9 gastric cancer tissues (different from the above 4 cases) including 3 cases of early gastric cancer obtained by surgery and 9 colorectal cancer tissues were analyzed in detail. Four genes with low expression levels in tissues and high expression levels in gastric cancer and colon cancer were identified.

  The four genes are DKK4, NOHMA, CYP2W1 and APIN. As already mentioned, all of these genes have been cloned, and the base sequence of cDNA (mRNA) is registered in GenBank (DKK4: NM — 014420, NOHMA: NM — 032132, CYP2W1: NM — 017881, APIN: NM — 017855). However, there has been no report in the past that the above four types of genes have high expression levels specifically for cancer, and the finding that the above four types of genes have low expression levels in normal tissues and high expression levels in cancer tissues. Was found for the first time by the present inventors. That is, it has been clarified that the above four genes are cancer-specific genes with high expression levels, and that the transcription products and translation products of the genes can be used as tumor markers.

  SEQ ID NO: 1 shows the base sequence of DKK4 cDNA, and SEQ ID NO: 2 shows the amino acid sequence of the protein encoded by DKK4. SEQ ID NO: 3 shows the nucleotide sequence of NOHMA cDNA, and SEQ ID NO: 4 shows the amino acid sequence of the protein encoded by NOHMA. SEQ ID NO: 5 shows the base sequence of CYP2W1 cDNA, and SEQ ID NO: 6 shows the amino acid sequence of the protein encoded by CYP2W1. SEQ ID NO: 7 shows the nucleotide sequence of the cDNA of APIN, and SEQ ID NO: 8 shows the amino acid sequence of the protein encoded by APIN.

  The method of the present invention uses a sample derived from a subject to measure the expression level of at least one of DKK4, NOHMA, CYP2W1 or APIN in the sample, and compares this level with a normal level to diagnose cancer. Is the method.

  The subject is not particularly limited and widely includes animals in general, but is preferably a human. When the subject is a human, not only a cancer patient or a patient suspected of having cancer, but also a healthy person can be the subject.

  The sample derived from the non-analyte is not particularly limited as long as it is obtained from the non-analyte. For example, blood, urine, feces, sputum, ascites, peritoneal lavage fluid, biopsy tissue, surgically removed specimen, and the like can be mentioned.

  The expression level of a gene can be determined by measuring the amount of its transcription product (mRNA) or its translation product (protein).

  The normal level means the expression level of the same gene in a normal healthy individual (a healthy person). The normal level is preferably measured using the same normal cells, tissues and body fluids as the sample derived from the non-analyte to be compared. The normal level is more preferably the average level of a normal healthy individual population.

  Diagnosing cancer means determining whether or not the subject has cancer.

  Further, the type of cancer to be diagnosed is not particularly limited, but is preferably gastrointestinal cancer, and particularly preferably gastric cancer or colon cancer.

  In one embodiment, the method of the present invention is a method for diagnosing cancer using a sample derived from a subject, wherein the base sequence represented by SEQ ID NO: 1, 3, 5 or 7 or What is necessary is just to include the polynucleotide measurement process which measures the level of at least 1 of the polynucleotide containing the partial sequence, and the comparison process which compares the level of the said polynucleotide with a normal level. The polynucleotide includes both DNA and RNA.

  In the present embodiment, in the polynucleotide measurement step, the level of at least one mRNA of the above four genes, that is, DKK4, NOHMA, CYP2W1, or APIN may be measured.

  The method for measuring the mRNA level is not particularly limited as long as it can measure a specific mRNA level, and can be appropriately selected from known methods. For example, it is a polynucleotide comprising a part of the base sequence of mRNA of any of the four genes or cDNA thereof or a part of their complementary base sequence, which binds site-specifically to any of the mRNAs or cDNAs of the four genes ( And a method using a primer or probe containing a polynucleotide to be hybridized. As long as the primer or probe forms a site-specific base pair with any one of the mRNAs of the four genes or its cDNA, various modifications for measuring and detecting mRNA may be used. .

  As a polynucleotide used as said primer and / or probe, the polynucleotide which consists of a base sequence shown by any one of sequence number 9-16 can be mentioned, for example. These polynucleotides are primers used when the present inventors actually performed real-time RT-PCR, and have been demonstrated to specifically amplify the target mRNA. Specifically, DKK4 can be amplified by using a primer set that combines polynucleotides consisting of the nucleotide sequences shown in SEQ ID NO: 9 and SEQ ID NO: 10, and the nucleotide sequences shown in SEQ ID NO: 11 and SEQ ID NO: 12 NOHMA can be amplified by using a primer set that combines polynucleotides consisting of: CYP2W1 is amplified by using a primer set that combines polynucleotides consisting of the nucleotide sequences shown in SEQ ID NO: 13 and SEQ ID NO: 14 APIN can be amplified by using a primer set in which polynucleotides comprising the nucleotide sequences shown in SEQ ID NO: 15 and SEQ ID NO: 16 are combined. It is well known to those skilled in the art that a polynucleotide that can be used as a primer for specifically amplifying a target mRNA (cDNA) can be used as a probe for specifically detecting the mRNA (cDNA).

  Known methods for measuring mRNA using a primer or probe containing a polynucleotide that specifically binds to the mRNA or cDNA described above include, for example, RT-PCR, real-time RT-PCR, competitive PCR, in Examples include Situ hybridization method, in situ PCR method, DNA array method and the like.

  For example, the RT-PCR method is a method in which cDNA is synthesized from total RNA or mRNA prepared from a sample using reverse transcriptase, and the target region is amplified by PCR using this cDNA as a template. Furthermore, the real-time RT-PCR method is a method for monitoring and analyzing in real time the production process of an amplification product using a real-time monitoring reagent when PCR amplification of a target region is performed using cDNA as a template. Examples of the real-time monitoring reagent include SYBR (registered trademark: Molecular Probes) Green, TaqMan (registered trademark: Applied Biosystems) probe, and the like.

  For example, in the DNA array method, at least one cDNA of DKK4, NOHMA, CYP2W1 or APIN or a partial sequence thereof is immobilized on a support and incubated with mRNA or cDNA prepared from a sample. In this case, the mRNA or cDNA in the sample can be detected by detecting the hybridization between the DNA immobilized on the support and the mRNA or cDNA prepared from the sample by fluorescently labeling the mRNA or cDNA. .

  In the comparison step, the mRNA level in the sample measured in the polynucleotide measurement step may be compared with the normal level. As described above, the normal level is preferably measured by the same method using the same normal cells, tissues, and body fluid as the sample derived from the non-analyte to be compared. As for the normal level, a sample derived from a normal healthy individual may be simultaneously measured, or data accumulated as background data may be used. When the mRNA level in the sample derived from the subject is higher than the normal level, it can be determined that the subject has cancer. When the level is higher than the normal level, the level is at least 2 times higher, preferably 5 times higher.

  In another embodiment, the method of the present invention is a method for diagnosing cancer using a sample derived from a subject, and the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 8 in the sample derived from the subject. Alternatively, any method may be used as long as it includes a polypeptide measurement step for measuring at least one level of a polypeptide comprising the partial sequence, and a comparison step for comparing the level of the polypeptide with a normal level.

  That is, in the present embodiment, in the polypeptide measurement step, the protein level encoded by at least one of DKK4, NOHMA, CYP2W1, or APIN may be measured.

The method for measuring the expression level of the protein is not particularly limited as long as it is a method capable of measuring a specific protein level, and can be appropriately selected from known methods. For example, a method using an antibody that specifically binds to a protein encoded by at least one of the four genes can be mentioned. The antibody may be a polyclonal antibody or a monoclonal antibody. Further, it may be a complete antibody molecule or an antibody fragment (for example, Fab fragment, F (ab ′) ₂ fragment, etc.) that can specifically bind.

  Known methods for measuring protein levels using antibodies include, for example, radioimmunoassay (RIA), ELISA (solid phase enzyme immunoassay), Western blotting, immunoprecipitation, immunohistochemistry, antibody array method, etc. Can be mentioned. Among these, the ELISA method is preferable from the viewpoint of better sensitivity and simplicity.

  In the comparison step, the protein level in the sample measured in the polypeptide measurement step may be compared with the normal level. As described above, the normal level is preferably measured by the same method using the same normal cells, tissues, and body fluids as the sample derived from the non-analyte to be compared. As for the normal level, a sample derived from a normal healthy individual may be simultaneously measured, or data accumulated as background data may be used. When the protein level in the sample derived from the subject is higher than the normal level, it can be determined that the subject has cancer. When the level is higher than the normal level, the level is at least 2 times higher, preferably 5 times higher.

(2) Instrument for diagnosing cancer The instrument according to the present invention is an instrument for diagnosing cancer using a sample derived from a subject, and the nucleotide sequence shown in SEQ ID NO: 1, 3, 5 or 7 Alternatively, it may be an instrument in which a polynucleotide that specifically hybridizes with at least one of the polynucleotides containing the partial sequence is immobilized on a support. More specifically, a polynucleotide comprising a part of the nucleotide sequence of DKK4, NOHMA, CYP2W1 or APIN, or the cDNA base sequence thereof, or a complementary base sequence thereof, comprising any one of the mRNAs of the above four genes or Examples thereof include a DNA array (DNA chip) in which a polynucleotide that specifically hybridizes to cDNA is immobilized on a support.

  The polynucleotide immobilized on the support is not particularly limited as long as it specifically hybridizes to mRNA or cDNA of any of the four genes. For example, the polynucleotide which consists of a base sequence shown by any one of sequence number 9-16 can be mentioned. These polynucleotides are polynucleotides used by the present inventors as primers for specifically amplifying the target mRNA, and it is possible for those skilled in the art to use these polynucleotides as probes for specifically detecting the mRNA. It is well known. In addition, if a polynucleotide that specifically hybridizes to mRNA or cDNA of any of the four genes is immobilized on a support, the other polynucleotides are immobilized on the same support. It may be.

  The support is not particularly limited as long as the polynucleotide can be immobilized, and may be any shape or material. In general, for example, inorganic materials such as glass and silicon wafers, natural polymers such as paper, synthetic polymers such as nitrocellulose and nylon, synthetic polymers and natural polymers are used as the support material. And the like.

  The instrument according to the present invention can be produced using a known DNA array production method. For example, a cDNA array can be prepared by preparing a polynucleotide solution consisting of cDNA (full length sequence or partial sequence) and spotting it on a support with a spotter or the like. The polynucleotide to be immobilized may be a synthetic oligonucleotide having a cDNA base sequence. It is also possible to use a so-called affiliometric DNA chip technique for synthesizing DNA on a substrate.

  A known technique designed to detect gene expression can be suitably applied to the instrument according to the present invention. For example, cDNA or cRNA prepared from total RNA or mRNA of cells or tissues can be used as the sample. More specifically, cDNA or cRNA is fluorescently labeled, hybridized with a polynucleotide immobilized on a support, and the intensity of the hybridization is measured using fluorescence as an index to determine the expression level of the gene. Can be evaluated. In addition, if cDNA and cRNA prepared from two types of samples are labeled with fluorescent substances that emit different colors, and hybridized to polynucleotides on the same support, the color tone and fluorescence intensity are measured, Differences in gene expression can be assessed.

  In another embodiment, the device according to the present invention is a device for diagnosing cancer using a sample derived from a subject, the amino acid sequence shown in SEQ ID NOs: 2, 4, 6 and 8, or the amino acid sequence thereof Any device may be used as long as an antibody that specifically binds to at least one of the polypeptides comprising the partial sequence is immobilized on the support. More specifically, an antibody array or ELISA plate on which an antibody that specifically binds to a protein encoded by at least one of DKK4, NOHMA, CYP2W1 or APIN is immobilized on a support is mentioned. In addition, if an antibody that specifically binds to a protein encoded by at least one of the above four genes is immobilized on a support, antibodies other than these are immobilized on the same support It may be.

  The support is not particularly limited as long as it can immobilize an antibody, that is, a protein, and may have any shape or material. As a support material, generally, for example, inorganic materials such as glass and silicon wafer, natural polymers such as paper, synthetic polymers such as nitrocellulose, nylon and polystyrene, synthetic polymers and natural polymers The gel body using can be mentioned.

  A known technique designed to detect a protein (polypeptide) using an antibody can be suitably applied to the instrument according to the present invention. For example, Cyphergen Biosystems sells biological chips as one type of protein chip. This has a carbonyldiimidazole or epoxy active group on the surface of a substrate (support), and the user can freely fix and use the target protein or antibody. This can be applied to the production of the instrument according to the present invention.

(3) Kit The kit according to the present invention is a kit for diagnosing cancer using a sample derived from a subject, and includes the base sequence shown in SEQ ID NO: 1, 3, 5 or 7 or a partial sequence thereof. What is necessary is just to provide a polynucleotide. Examples of the polynucleotide containing the base sequence shown in SEQ ID NO: 1, 3, 5 or 7 or a partial sequence thereof include primers and probes used for measuring at least one mRNA of DKK4, NOHMA, CYP2W1 or APIN. Can be mentioned.

  The kit according to the present invention is a kit for diagnosing cancer using a sample derived from a subject, and is a polypeptide comprising the amino acid sequence shown in SEQ ID NOs: 2, 4, 6 and 8, or a partial sequence thereof. An antibody that specifically binds to at least one of the above may be provided.

  In one embodiment, the kit can constitute an RT-PCR kit or a real-time RT-PCR kit. Moreover, it can also be set as the kit which can select either RT-PCR or real-time RT-PCR by a user's selection. The kit preferably includes at least one of a primer set for amplifying DKK4, a primer set for amplifying NOHMA, a primer set for amplifying CYP2W1, and a primer set for amplifying APIN. . It is particularly preferable that all four types of primer sets are provided.

  The components of the kit other than the primer set are not particularly limited. For example, reagents for preparing RNA from tissues or cells, reverse transcriptase, buffers used for reverse transcription, heat-resistant DNA polymerase, PCR reagents, It is preferable to provide a real-time PCR reagent, a PCR tube, a PCR plate, and the like. Moreover, in addition to the above primer set, a primer set other than the above may be included.

  As another embodiment, this kit can constitute a DNA array kit. It is preferable that the kit is equipped with the instrument (DNA array) according to the present invention. The components of the kit other than the DNA array are not particularly limited. For example, reagents for preparing RNA from tissues or cells, reverse transcriptase, buffers for reverse transcription, reagents for fluorescently labeling cDNA, high It is preferable to provide a hybridization reagent.

  As yet another embodiment, the kit can constitute an ELISA kit. The kit includes an antibody that specifically binds to a protein encoded by DKK4, an antibody that specifically binds to a protein encoded by NOHMA, an antibody that specifically binds to a protein encoded by CYP2W1, and a protein that specifically binds to APIN. Preferably at least one of the antibodies is provided. It is particularly preferred that all four types of antibodies are provided. Moreover, it is preferable that the said antibody is contained in the kit in the state fix | immobilized (solid-phased) previously in the plate for ELISA.

  The components of the kit other than the ELISA plate are not particularly limited. For example, the kit preferably includes a labeled secondary antibody, a coloring reagent, a washing buffer, and the like. In addition to the above antibodies, antibodies against other proteins may be included.

  The present invention is not limited to the above-described embodiments, and various modifications can be made within the scope of the claims, and the embodiments can be obtained by appropriately combining technical means disclosed in different embodiments. The form is also included in the technical scope of the present invention.

  EXAMPLES Hereinafter, although this invention is demonstrated further in detail using an Example, this invention is not limited to these Examples. Unless otherwise specified, methods necessary for general gene recombination, such as nucleic acid extraction, cleavage, ligation, E. coli transformation, and gene sequencing, are commercially available reagents and equipment used for each operation. The basic instructions were followed in accordance with the instructions attached to the above, and experimental documents (for example, “Molecular Cloning, a Laboratory Manual, 3rd Ed (Sambrook et al. (2001), Cold Spring Harbor Laboratory Press)”).

(1) Identification of gastric cancer-specific gene candidates by SAGE method For early gastric cancer surgically excised at Hiroshima University Hospital (1 case (W226T)) and advanced gastric cancer 3 cases (W246T, S219T, P208T), using SAGE method Expression was comprehensively analyzed.

  That is, reverse transcription reaction was performed using mRNA (5 μg) prepared from each cancer tissue as a material and biotin-labeled oligo dT primer to synthesize first strand and second strand. Next, the fragment was cleaved with a restriction enzyme NlaIII that recognizes and cleaves CATG, and the 3'-side fragment was recovered using avidin-coated magnetic beads. After binding the linker by ligase, the fragment was cleaved with restriction enzyme BsmFI that recognizes and cleaves 10 to 12 bases 3 ′ from CATG, and the 5 ′ fragment was recovered using avidin-coated magnetic beads. Two molecules of the obtained fragment were ligated using ligase and amplified by PCR using a primer having a linker base sequence as a template.

  After the amplification product was purified on a gel, several fragments were ligated in series by ligase. Fragments of 500 bp or more were recovered by electrophoresis, incorporated into pZero and transformed into E. coli DH10B. Escherichia coli was cultured in an LB medium containing the antibiotic zeocin, a plasmid was extracted from the grown colonies, and the nucleotide sequence of the incorporated fragment was determined. The nucleotide sequence information was converted into gene expression information using SAGE2000 software.

  About 140,000 tags were obtained from the analysis of a total of about 10,000 clones obtained from the gastric cancer tissues of the above four cases, and a number of cancer-related genes were newly identified.

  In order to identify genes specifically expressed in gastric cancer, 12 types of normal tissues (cerebral white matter, cerebellum, thalamus, etc.) that can be used in “SAGEmap”, a SAGE database of NCBI (National Biotechnology Information Center) The SAGE library (kidney, leukocyte, colon, stomach, heart, liver, lung, spinal cord, peritoneum) and the SAGE library of the above 4 cases of gastric cancer were compared on a computer.

  That is, the SAGE library of the above 12 types of whole body normal tissues is downloaded from SAGEmap, and on the SAGE2000 software, the gene expression information of the 12 types of whole body normal tissues and the gene expression information of each of the 4 cases of gastric cancer are obtained. We compared sequentially. By this operation, a tag that was expressed only in gastric cancer and expressed three or more times in gastric cancer was selected. As a result, 24 types of tags from W226T, 15 types from W246T, 27 types from S219T, 13 types from P208T, and 54 types in total (25 types are duplicated) were selected and identified as gastric cancer-specific gene candidates.

(2) Measurement of expression level by real-time RT-PCR method It was examined in detail using the real-time RT-PCR method whether or not the 54 types of candidate genes are gastric cancer specific genes.

  As samples, 9 primary gastric cancers including 3 early gastric cancers surgically excised at Hiroshima University Hospital were used. As normal tissues, 14 types of normal tissue total RNAs purchased from Clontech (liver (catalog number 636531), kidney (catalog number 636529), heart (catalog number 636532), colon (catalog number 636553), cerebrum (catalog number 636530) ), Bone marrow (catalog number 636548), skeletal muscle (catalog number 636534), lung (catalog number 636524), small intestine (catalog number 636539), spleen (catalog number 636525), spinal cord (catalog number 636554), stomach (catalog number 636578) ), Pancreas (catalog number 636577), white blood cell (catalog number 636580)).

  CDNA was synthesized from the total RNA extracted from each of the above 9 cases of gastric cancer tissue and the above purchased normal RNA from each normal tissue according to a conventional method. In addition, specific primers for individual genes were designed for 54 types of candidate genes for gastric cancer specific genes. Real time RT-PCR was performed using the cDNA as a template and the specific primer. Real-time RT-PCR was performed on the ABI PRISM 7700 Sequence Detection System manufactured by Applied Biosystems using the SYBR Green PCR Core Reagents Kit.

The composition of the reaction solution, 10 × SYBR (R) Green PCR Buffer: 5μL, 25mM MgCl2 Solution: 6μL, 12.5mM dNTP Mix: 4μL, 5U / μL Ampli Taq Gold TM: 0.25μL, 1U / μL AmpErase (R): 0.5 μL, Forward primer: 0.5 μL, Reverse primer: 0.5 μL, Sample (cDNA derived from each tissue): 1 μL, and sterile distilled water: 32.25 μL. All but the primer, sample and sterilized distilled water are included in the SYBR Green PCR Core Reagents Kit. The reaction conditions were 50 ° C./2 minutes and 95 ° C./10 minutes, followed by 40 cycles of 95 ° C./15 seconds and 60 ° C./1 minute.

  As a result of real-time RT-PCR, the ratio of the gene expression level of the tissues with the highest expression in the 14 types of normal tissues and the gene expression level of the cases with the highest expression levels of the 9 cases of the gastric cancer tissues, with respect to 54 types of candidate genes A gene having a ratio of 10 or more was calculated as a gastric cancer specific gene. Among the genes satisfying these conditions, the condition that there is no literature on cancer specificity was added, and 4 genes of DKK4, NOHMA, CYP2W1 and APIN were selected.

Here, the primers used for the real-time RT-PCR are as follows.
(1) Primer set for DKK4 amplification
Forward 5 'CGCGATGAGAAGCCGTTC 3' (SEQ ID NO: 9)
Reverse 5 'GCATCTCGCTGGCACCTC 3' (SEQ ID NO: 10)
(2) NOHMA amplification primer set
Forward 5 'AAATCCTGAGGGACAAAGATGTAGA 3' (SEQ ID NO: 11)
Reverse 5 'TTTTTCCTGTTCTTCCATTTTAGTTTC 3' (SEQ ID NO: 12)
(3) CYP2W1 amplification primer set
Forward 5 'AAATGGAAACACTGACCCGG 3' (SEQ ID NO: 13)
Reverse 5 'GTGATTCGCCTGCCTCGGCC 3' (SEQ ID NO: 14)
(4) APIN amplification primer set
Forward 5 'TGCAGGAGTTTTCATGCCC 3' (SEQ ID NO: 15)
Reverse 5 'TTGGTCTACAGCAGAAGTGAAAACA 3' (SEQ ID NO: 16)
With respect to the above 4 genes of DKK4, NOHMA, CYP2W1 and APIN, the expression level in colorectal cancer was measured by a real-time RT-PCR method. Real-time RT-PCR was performed by the same procedure as that for gastric cancer except that 9 cases of colorectal cancer surgically excised at Hiroshima University Hospital were used as samples.

  The gene expression levels measured by real-time RT-PCR are shown in FIGS. 1 shows DKK4, FIG. 2 shows NOHMA, FIG. 3 shows CYP2W1, and FIG. 4 shows the expression level of APIN in normal tissue, stomach cancer tissue and colon cancer tissue. The expression level was expressed by calculating the relative expression level with the expression level in the normal stomach being 1.

  As is clear from FIG. 1 to FIG. 4, the cases where the expression levels of 4 genes of DKK4, NOHMA, CYP2W1 and APIN were the highest in gastric cancer tissues compared to the expression level of the highest expression in normal tissues The expression level of was 10 times or more. In addition, compared to the expression level of the highest expression in normal tissues, the expression level of the case with the highest expression level in the colon cancer tissue is more than 10 times, confirming that it is a gene specific for colorectal cancer. It was done.

  On the other hand, since the expression level of the case with the highest expression level in the gastric cancer tissue was not 10 times or more compared to the expression level of the highest expression level in the normal tissue, the representative 4 excluded from the gastric cancer specific gene. The real-time RT-PCR results of the genes are shown in FIGS. FIG. 5 shows the expression level of IFRD1, FIG. 6 shows IL16, FIG. 7 shows the expression level of KIF4A, and FIG. 8 shows the expression level of LMO6 in normal tissue and gastric cancer tissue.

  As apparent from FIGS. 5 to 8, these genes had high expression levels in specific normal tissues, and were excluded from gastric cancer-specific genes.

  The present invention is used for diagnosing cancer, and can be used in the clinical test drug industry, reagent industry, medical device industry, and the like.

It is a graph which shows the result of having measured the expression level of DKK4 in a normal tissue, stomach cancer, and colon cancer by real-time RT-PCR method. It is a graph which shows the result of having measured the expression level of NOHMA in a normal tissue, stomach cancer, and colon cancer by real-time RT-PCR method. It is a graph which shows the result of having measured the expression level of CYP2W1 in a normal tissue, stomach cancer, and colon cancer by real-time RT-PCR method. It is a graph which shows the result of having measured the expression level of APIN in a normal tissue, gastric cancer, and colon cancer by real-time RT-PCR method. It is a graph which shows the result of having measured the expression level of IFRD1 in a normal tissue and gastric cancer by real-time RT-PCR method. It is a graph which shows the result of having measured the expression level of IL16 in a normal tissue and gastric cancer by real-time RT-PCR method. It is a graph which shows the result of having measured the expression level of KIF4A in a normal tissue and gastric cancer by real-time RT-PCR method. It is a graph which shows the result of having measured the expression level of LMO6 in a normal tissue and gastric cancer by real-time RT-PCR method.

Claims (12)

A method of diagnosing cancer using a sample derived from a subject,
A polynucleotide measurement step for measuring at least one level of a polynucleotide comprising the base sequence shown in SEQ ID NO: 1, 3, 5 or 7 or a partial sequence thereof in a sample derived from a subject, and normalizing the level of the polynucleotide A method comprising the step of comparing with the level.   2. The method according to claim 1, wherein in the polynucleotide measuring step, at least one polynucleotide comprising the nucleotide sequence represented by any one of SEQ ID NOs: 9 to 16 is used. A method of diagnosing cancer using a sample derived from a subject,
A polypeptide measurement step for measuring at least one level of a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 8 or a partial sequence thereof in a sample derived from a subject, and normalizing the level of the polypeptide A method comprising the step of comparing with the level.   The antibody that specifically binds to at least one of the polypeptides consisting of the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 8 or a partial sequence thereof is used in the polypeptide measurement step. 3. The method according to 3.   The method according to any one of claims 1 to 4, wherein the cancer is gastric cancer or colorectal cancer. An instrument for diagnosing cancer using a sample derived from a subject,
A device characterized in that a polynucleotide that specifically hybridizes with at least one of the polynucleotides comprising the base sequence shown in SEQ ID NO: 1, 3, 5 or 7 or a partial sequence thereof is immobilized on a support. .   The device according to claim 6, wherein the polynucleotide immobilized on the support is at least one of the polynucleotides comprising the nucleotide sequence shown in any one of SEQ ID NOs: 9 to 16. . An instrument for diagnosing cancer using a sample derived from a subject,
A device wherein an antibody that specifically binds to at least one of the polypeptides comprising the amino acid sequences shown in SEQ ID NOs: 2, 4, 6, and 8 or a partial sequence thereof is immobilized on a support. A kit for diagnosing cancer using a sample derived from a subject,
A kit comprising a polynucleotide comprising the base sequence shown in SEQ ID NO: 1, 3, 5 or 7 or a partial sequence thereof.   The kit according to claim 9, wherein the polynucleotide is at least one of polynucleotides having the base sequence shown in any one of SEQ ID NOs: 9 to 16.   The kit according to claim 9 or 10, wherein the polynucleotide is used as a primer for RT-PCR or real-time RT-PCR. A kit for diagnosing cancer using a sample derived from a subject,
A kit comprising an antibody that specifically binds to at least one of the polypeptides consisting of the amino acid sequences shown in SEQ ID NOs: 2, 4, 6 and 8, or a partial sequence thereof.

Images