JP2006149307A - New thermo-stable protease - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a protease derived from a super thermophilic bacterium Pyrococcus horikoshii and having thermostability and high specificity. <P>SOLUTION: A thermo-stable protease and its variant have properties of recognizing and definitely decomposing a hydrophobic amino acid sequence concerning to multimerization of membrane protein stomatin and are derived from Pyrococcus horikoshii. The variant contains an N-terminal side water-soluble domain and is activated as a dimer, and is a heat resistant protease which has a molecular weight of about 25 kDa (SDS-PAGE) and the optimum temperature of about 98°C or above and whose optimum pH is about 5 to about 6. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a novel protease having a property of specifically recognizing and limitedly degrading a hydrophobic amino acid sequence involved in multimerization of the membrane protein stomatin, and a production method thereof. Specifically, the present invention relates to a thermostable protease derived from the hyperthermophilic bacterium Pyroccoccus horikoshii.

Stomatin is a protein that exists on biological membranes of various organisms ranging from lower organisms such as bacteria to higher organisms such as animals, and forms multimers on the membrane. Stomatin is also known to be a protein that regulates the function of Na ⁺ channels involved in the taste of vertebrate neurons and the perception of physical stimuli. Recently, proteolytic processes are important for this regulatory mechanism. (MP Price, RJ Thompson, JO Eshcol, JA Wemmie and CJ Benson “Stomatin modulates gating of ASIC channels” (2004) J. Biol. Chem. In print; JP Green, B Fricke, MC Chetty, M. During, GF Preston and GW Stewart “Eukaryotic and prokaryotic stomatin: the proteolytic link” (2004) Blood Cells, Molecules, & Diseases, 32: 411-422; GW Stewart “Hemolytic disease due to membrane ion channel disorders ”(2004) Curr. Opin. Hematol, 11: 244-250). It is presumed that the C-terminal domain of stromatin is proteolytically released from the membrane and is involved in cell signaling. However, it is predicted that the protease involved in this process is a novel protease having a high substrate specificity for stomatin, but the identity and nature of the protease are unknown.

  As a thermostable protease derived from the genus Pyrococcus, a protease derived from Pyrococcus furiosus is known (Table 95/034645, Table 00/061711). Three types of enzymes have been isolated, and their molecular weight (SDS-PAGE) and optimum pH were 51 to 95 kDa and pH 8 to 10, respectively. The use of these proteases in detergents is also described.

Furthermore, genomic data of Pyrococcus horikoshi is disclosed in DNA Res. (1998), 5: 147-155 or MBGD (Microbial Genome Database; http://mbgd.genome.ad.jp/).
No. 95/034645 No. 00/061711 MPPrice et al., J. Biol. Chem. (2004), in press JPGreen et al., Blood Cells, Molecules, & Diseases (2004), 32: 411-422 GWStewart, Curr. Opin. Hematol (2004), 11: 244-250 DNA Res. (1998), 5: 147-155 MBGD (MicrobialGenome Database; http://mbgd.genome.ad.jp/)

  Since conventional proteolytic enzymes (ie proteases) are unstable at high temperatures, it has been necessary to carry out limited protein degradation at relatively low temperatures. For this reason, there is a demand for a protease that is stable to heat and has high substrate specificity. By performing limited protein degradation at high temperatures, there are many advantages such as improved reaction efficiency and removal of contaminating microorganisms. . The present invention has been made under such a technical background.

The inventors of the present invention have been searching for thermostable proteases that limit degradation of stromin, focusing on the finding that the membrane protein stromatin controls the function of the Na ⁺ channel, and that a novel protease plays an important role in this control mechanism. This time, the present inventors have found a gene having a serine protease motif and comprising a stromatin homolog and an operon in the genome of a certain hyperthermophilic archaeon Pyrococcus horikoshi to supply a novel thermostable protease. The functional analysis of this gene product was performed.

  Accordingly, an object of the present invention is to provide a protease that specifically recognizes and specifically degrades a hydrophobic amino acid sequence involved in stromin multimerization.

  Another object of the present invention is to provide a method for producing such proteases recombinantly.

  Yet another object of the present invention is to detect homologues or analogs in other living cells using DNA encoding such protease or a fragment thereof as a probe.

  In order to solve the above-mentioned problems, the present inventors focused on a hyperthermophilic archaeon Pyrococcus horikoshii that grows at 90 to 100 ° C., and presumed to exhibit the desired protease activity from the gene sequence. I found a gene to be made. Furthermore, an enzyme is produced from a gene of interest introduced recombinantly using microbial cells such as Escherichia coli, and the enzyme exists relatively stably at high temperature (above 98 ° C.) and multimerizes the membrane protein stromatin. The present invention was completed by finding a novel thermostable protease that specifically recognizes and specifically degrades the hydrophobic amino acid sequence involved in the protein.

  That is, this invention has the following structures and characteristics.

In the first aspect, the present invention provides the following properties:
(1) It is derived from the hyperthermophilic bacterium Pyrococcus horikoshi,
(2) The molecular weight measured by SDS-PAGE is about 25 kDa.
(3) the active form is a dimer,
(4) The optimum temperature is about 98 ° C. or higher.
(5) The optimum pH is about 5 to about 6.
(6) is an endo-type serine system, and (7) recognizes and degrades hydrophobic amino acid sequences involved in multimerization of the membrane protein stromatin.
Proteases having the following are provided:

  In an embodiment of the present invention, the protease comprises the amino acid sequence shown in SEQ ID NO: 1, or an amino acid sequence in which one or more amino acids are deleted, substituted, inserted or added in the amino acid sequence shown in SEQ ID NO: 1. In addition, it has the property of specifically recognizing and limiting the hydrophobic amino acid sequence involved in the multimerization of the membrane protein stromatin.

In the second aspect, the present invention also provides the following polypeptide (A) or (B) having protease activity:
(A) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1 or 4, or (B) an amino acid in which one or more amino acids are deleted, substituted, inserted or added in the amino acid sequence shown in SEQ ID NO: 1 or 4 A polypeptide having a protease activity comprising a sequence and specifically recognizing and limitedly degrading a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin,
DNA encoding is provided.

In the third aspect, the present invention further provides the following DNAs (C), (D) and (E):
(C) DNA comprising the base sequence represented by SEQ ID NO: 2 or 3,
(D) a hydrophobic amino acid sequence comprising a base sequence in which one or more bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 2 or 3, and involved in multimerization of membrane protein stromatin DNA encoding a protease that specifically recognizes and specifically degrades, and (E) hybridizes with the DNA of (C) or (D) under stringent conditions, and multimerizes the membrane protein stromatin DNA encoding a protease that specifically recognizes and restricts the hydrophobic amino acid sequence involved,
DNA selected from the group consisting of:

  In the fourth aspect, the present invention also includes a DNA comprising the base sequence represented by SEQ ID NO: 3.

  In the fifth aspect, the present invention also provides a polypeptide having a protease activity that specifically recognizes and specifically degrades a hydrophobic amino acid sequence that is encoded by the DNA and that is involved in multimerization of the membrane protein stromatin. provide.

  In that embodiment, the present invention also includes a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 4.

In the sixth aspect, the present invention also provides an expression vector comprising the DNA.
In the seventh aspect, the present invention also provides a host cell transformed with the above expression vector.

  The present invention also includes, in the eighth aspect, culturing the host cell and recovering a protease that specifically recognizes and specifically degrades a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin, Protease production methods are provided.

  In the ninth aspect, the present invention further provides a complementary strand of DNA comprising the base sequence shown in SEQ ID NO: 2 or 3, or a base sequence of 30 to 50 bases or more, preferably 100 bases or more in the base sequence. A nucleic acid encoding an endogenous protease that specifically recognizes and specifically degrades a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin in a biological cell by using as a probe Provide a detection method.

In that embodiment, the biological cell is a mammalian cell, including a human.
In a further embodiment, the probe is labeled.

  The term “DNA” as used herein means double-stranded DNA unless otherwise specified.

  The term “nucleic acid” as used herein refers to genomic DNA, mRNA or cDNA unless otherwise specified.

  As used herein, the term “base sequence” is synonymous with nucleotide sequence and may be used interchangeably.

  The protease of the present invention is a heat-resistant protease having an optimum temperature of 98 ° C. or more, and has a property of recognizing and limitedly decomposing a sequence rich in hydrophobic amino acids. Because of these characteristics, the protease of the present invention can be used as a catalyst in the production of foods, pharmaceuticals and the like that require thermal stability. Alternatively, a system for artificially controlling the function of the target membrane protein can be constructed by inserting the recognition sequence of the protease of the present invention into an arbitrary membrane protein and cleaving with the protease of the present invention. The system is thought to be useful for elucidating the relationship between membrane protein functions and diseases.

  The present invention will be described in further detail.

  The present invention provides a thermostable protease obtainable from a sulfur-metabolizing thermophilic archaeon Pyrococcus horikoshi, a nucleic acid encoding the same, and a homolog, analog or variant thereof. Specifically, a thermostable serine protease having a novel substrate specificity (SEQ ID NO: 4), a DNA encoding the same (hereinafter referred to as “PH1510”; SEQ ID NO: 3), an N-terminal water-soluble domain (MBGD database) A thermostable protease (hereinafter referred to as “1510-N”; SEQ ID NO: 1), a DNA encoding the same (SEQ ID NO: 2), and Homologues, analogs or variants of these enzymes and DNA are provided.

  As used herein, “homologues” and “analogs” are functions that are the same or similar to the protease or nucleic acid of the present invention inherent in other species (prokaryotes and eukaryotes) other than Pyrococcus horikoshi. In particular, it refers to homologues and analogues with limited degradation of the membrane protein stromatin.

As used herein, “variant” includes a mutation of at least one amino acid residue or nucleotide in the amino acid sequence shown in SEQ ID NO: 1 or 4 or the base sequence shown in SEQ ID NO: 2 or 3. It refers to a derivative and has the property of allowing limited degradation of the membrane protein stromatin, like the protease of the present invention.

One of the proteases of the present invention has the following properties.
(1) It is derived from the hyperthermophilic bacterium Pyrococcus horikoshi,
(2) The molecular weight measured by SDS-PAGE is about 25 kDa.
(3) the active form is a dimer,
(4) The optimum temperature is about 98 ° C. or higher.
(5) The optimum pH is about 5 to about 6.
(6) Recognize and limitedly degrade hydrophobic amino acid sequences that are endo-serine and (7) are involved in multimerization of the membrane protein stromatin.

  Casein and a stromatin C-terminal domain (corresponding to residues 189 to 266 of Pyrococcus horikoshi PH1511 described in the MBGD database, hereinafter referred to as 1511-C) are used as substrates. As a result of examining the substrate specificity of the protease of the present invention, the sequence recognized by this enzyme is rich in hydrophobic (and aromatic) amino acids, the P1 site (-1 site of the cleavage point) is leucine, and the P4 site is valine. Or a sequence that is leucine (see Table I of Example 12 (5)). Serine proteases exhibiting such substrate specificity have not been reported so far and are therefore considered to be novel enzymes. From such knowledge, the protease of the present invention has as one of its features recognition and limited degradation of a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin.

Stomatin exists as a membrane protein in all living organisms from bacteria to mammals, and is known to control the function of the Na ⁺ channel. In addition, it has been proposed that stromatin forms a multimer on a biological membrane, and its C-terminal domain is limitedly proteolyzed and released, and is involved in signal transduction related to perception. Therefore, since the protease of the present invention cleaves the C-terminal domain of stromatin in a limited manner, it is useful for the functional analysis of stromatin and the detection of native stromatin-degrading enzyme in mammals including humans.

  The protease and DNA of the present invention can be determined in amino acid sequence and base sequence by isolating and sequencing a clone containing the gene of interest from a Pyrococcus horikoshi genomic DNA library or cDNA library. Alternatively, it is possible to determine the target enzyme by searching and estimating a gene having a serine protease motif from the database information on the genome sequence of Pyrococcus horikoshi, preparing an expression product, and measuring the activity. . Thus, the present inventors have found a full-length thermostable protease consisting of the amino acid sequence shown in SEQ ID NO: 4 or encoded by the base sequence shown in SEQ ID NO: 3. The sequence recognized by this enzyme is a sequence rich in hydrophobic (and aromatic) amino acids, the P1 site (-1 site at the cleavage point) is leucine, and the P4 site is valine or leucine.

  Furthermore, the present inventors produced a mutant (presumed molecular weight 25,398 Da) comprising the amino acid sequence shown in SEQ ID NO: 1 consisting of the N-terminal water-soluble domain of the above full-length protease, which is heat-resistant. And having the same protease activity as above. In the amino acid sequence of this protease, Ser2 to Asp222 are derived from Pyrococcus holikosi, and are sequences corresponding to Ser16 to Asp236 of the intact protease sequence of SEQ ID NO: 4. The fact that this mutant has protease activity indicates that the active center is present in the N-terminal domain of the intact protease. Moreover, according to SDS-PAGE analysis, the molecular weight of the active protein is about 45 kDa, and therefore this protein is considered to express the activity as a dimer (see lane 1 in FIG. 4B). Therefore, the variant containing the amino acid sequence shown in SEQ ID NO: 1 is also included in the present invention.

  Furthermore, in order to search for the active residue of the protease of the present invention, various Ala substitutes at the candidate catalyst residues were prepared, and the relative activity with respect to the wild-type enzyme was measured. As a result, the active centers were S97 and K138 catalytic. It was thought to be an endo-type serine protease composed of dyad (see FIG. 7B).

  In this experiment, mutants with almost no activity change due to substitution were also observed. For example, even when amino acid residues such as D61, S94, H107, C120, R156, D188, and D236 were substituted with Ala, the activity of the mutant was almost the same as that of the wild type. From this, it was found that mutations of amino acid residues that do not change the higher order structure of the active center composed of S97 and K138 do not affect protease activity.

  Therefore, the present invention includes an amino acid sequence in which one or more, preferably one or several amino acids are deleted, substituted, inserted or added in the amino acid sequence shown in SEQ ID NO: 1 or 4, and the membrane protein stromatin A protease having the property of specifically recognizing and limitedly decomposing a hydrophobic amino acid sequence involved in multimerization is also included.

  As used herein, the term “1 or several” refers to 1 to 15, 1 to 10, 1 to 7, 1 to 5, or 1 to 3.

  Examples of substitution of amino acid residues include substitution between amino acids having similar properties such as charge, hydrophobicity, and functionality. Examples of substitution between charged (ie basic or acidic) amino acids are substitution of lysine and arginine, substitution of glutamic acid and aspartic acid and the like. An example of substitution between hydrophobic amino acids is substitution between amino acids such as leucine, isoleucine and alanine. Examples of substitutions between functionally similar amino acids are substitutions between serine and threonine, phenylalanine, tyrosine and tryptophan aromatic amino acids. Furthermore, deletion, insertion or addition of amino acid residues is possible in regions that do not significantly affect the higher order structure of the enzyme protein, such as the N-terminal or C-terminal region.

  For the production of mutants, for example, site-directed mutagenesis by PCR, oligonucleotide-specific mutagenesis, etc. can be used (FM Ausbel et al., Short Protocols in Molecular Biology (Third Edition), Current Protocols in Molecular Biology, Unit 8.1-8.5, 1995).

  The protease of the present invention further has 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, or 98% or more identity with the amino acid sequence shown in SEQ ID NO: 1 or 4. A polypeptide having a protease activity that consists of an amino acid sequence and that recognizes and specifically degrades a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin is also included.

  The% identity of two amino acid sequences aligns the sequences for optimal comparison purposes, compares the amino acids at corresponding positions, and is a function of the number of identical positions shared by the two sequences, ie% identity = Calculated by the number of identical positions / the total number of positions. Comparison of two sequences can be accomplished using known methods, such as mathematical algorithms such as the NBLAST and XBLAST programs (Altschul et al., Nucleic Acids Res. (1997) 25: 3389-3402), the ALIGN program (Myers and Miller, CABIOS (1989) ) And other programs. Another algorithm for sequence analysis is ADVANCE and ADAM described in Torellis and Robotti, Comput.Appl.Biosci. (1994) 10: 3-5, Pearson and Lipman, PNAS (1988) 85: 2444- Including FASTA described in 2448.

  Such a homologous polypeptide is, for example, the base shown in SEQ ID NO: 2 for genomic DNA, mRNA or cDNA from various biological sources such as eukaryotic organisms (eg yeast, mammals including humans). Hybridization is performed using radioactive or fluorescently labeled DNA consisting of a sequence or a fragment thereof (for example, 30 to 50 bases or more) as a probe, a clone having hybridized DNA is selected, sequenced, and necessary Can be obtained by a method comprising amplifying DNA by PCR, inserting the DNA into an appropriate expression vector, preparing a transformed host, and culturing it. Hybridization can be performed by a conventionally known technique such as Southern hybridization, Northern hybridization, in situ hybridization, or microarray.

The present invention further provides DNA encoding the protease or polypeptide of the present invention. Specifically, the DNA of the present invention comprises
(A) DNA encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1 or 4,
(B) includes an amino acid sequence in which one or more, for example, one or several amino acids are deleted, substituted, inserted or added in the amino acid sequence shown in SEQ ID NO: 1 or 4, and for multimerization of membrane protein stromatin DNA encoding a polypeptide having protease activity that specifically recognizes and specifically degrades the hydrophobic amino acid sequence involved,
(C) DNA comprising the base sequence represented by SEQ ID NO: 2 or 3,
(D) One or more, for example, 1 to 45, 1 to 30, 1 to 21, 1 to 15 or 1 to 9 bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 2 or 3. And a DNA encoding a protease that specifically recognizes and specifically degrades a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin, and
(E) Protease that hybridizes with the DNA of (C) or (D) under stringent conditions and specifically recognizes and specifically degrades a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin DNA encoding
(F) From an amino acid sequence having 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, or 98% or more identity with the amino acid sequence shown in SEQ ID NO: 1 or 4 And a DNA encoding a polypeptide having a protease activity that recognizes and limitedly degrades a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin,
Selected from the group consisting of

  “Stringent conditions” refers to low, medium or high stringency conditions, preferably high stringency conditions, which differ in temperature, ionic strength, wash conditions, and the like. High stringency conditions include, for example, 50% formamide, 5x Denhart solution, 5xSSPE, 0.2% SDS, hybridization at 42 ° C, followed by washing at 0.1xSSPE, 0.1% SDS, 65 ° C. . Low stringency conditions consist of, for example, 10% formamide, 5 × Denhart solution, 6 × SSPE, 0.2% SDS, hybridization at 42 ° C. followed by washing at 1 × SSPE, 0.2% SDS, 50 ° C. (See, eg, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, 1989; Ausubel et al., Supra, Unit 2.10, 6.3)

  The protease or polypeptide of the present invention can be produced using a conventionally known gene recombination technique. Specifically, in this method, after incorporating the above DNA into an expression vector, a prokaryotic or eukaryotic cell is transformed or transfected using this vector, and the resulting transformed host cell is cultured. Obtaining the protease or polypeptide of the present invention from cultured cells or culture supernatant.

  That is, the present invention provides an expression vector containing the above DNA and a host cell transformed with the expression vector.

  The present invention further provides a method for producing a protease, comprising culturing the host cell and recovering a protease that specifically recognizes and specifically degrades a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin. .

Expression vectors include plasmids, viruses, cosmids and the like. Vectors include prokaryotic or eukaryotic vectors such as pMAL, pTYB vectors (above, Daiichi Kagaku), PAUR123 (Takara Shuzo), pET, pBAC, pTri-Ex1 vectors (above, Novagen, Inc.), pCruz ^TM vector (Cosmo Bio), pHB6, pVB6, pBX, pHM6, pVM6, pMH, pSV40 / SEAP, pCMV / SEAP vector (above, Roche Diagnostics), pcDNA-3 (Invitrogen), T7 vector (Rosenberg et al., Gene (1987), 56: 125).

  In addition to the DNA sequence of the present invention, the vector can contain expression control sequences such as a promoter, enhancer, terminator, initiation codon, splice signal, stop codon, replication origin, selectable marker, polylinker and the like.

Promoters include constitutive promoters or inducible promoters. When cloning in a bacterial system, inducible promoters such as pL, plac, ptrp, ptac (ptrp-lac hybrid promoter) of bacteriophage λ, and when cloning in a mammalian system, for example, ubiquitin promoter, TK promoter, metallothionein promoter, Examples include mammalian virus-derived promoters such as retrovirus terminal repeats, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter and the like.

  Selectable markers include drug resistance markers such as ampicillin, kanamycin, neomycin, teracycline, chloramphenicol, G418, hygromycin, methotrexate, and other auxotrophic markers such as URA3.

Host cells include prokaryotic cells such as bacteria, eg, E. coli, Bacillus bacteria (eg, Bacillus brevis), eukaryotic cells, eg, yeast (eg, Saccharomyces cerevisiae), insect cells (eg, Sf9 cells), mammals including human cells. Cells (eg, human fetal kidney cells such as HEK293 cells, human neural progenitor cells, BHK21 cells, Chinese hamster ovary (CHO) cells) and the like.

  The vector of the present invention can be obtained by using known transformation or transfection techniques such as the calcium phosphate method, the calcium chloride method, DEAE-dextran-mediated transfection, lipofection, electroporation (electroporation method), microinjection, etc. In a host cell, preferably a competent host cell.

  The transformed host cell is cultured in an appropriate medium under conditions such that the protease or polypeptide of the present invention is expressed and produced, and the expression product is recovered from the host cell or the culture supernatant, and if necessary. Subject to the purification process.

  When the target protein is produced in the cells, after completion of the culture, the cells are separated by centrifugation, suspended in an aqueous buffer solution, and using means such as an ultrasonic crusher, Daunomil, Mount Gaurin homogenizer, French press, etc. After disrupting the cells and obtaining a cell extract, the target protein is recovered and purified.

When the target protein is secreted extracellularly, this method is preferred in the present invention, but the protein is recovered from the culture medium and purified. For extracellular secretion, a signal sequence (or leader sequence) is linked to the 5 ′ end of the DNA sequence of the present invention. The signal sequence plays a role of protein transport to the cell membrane after protein biosynthesis, is cleaved by intracellular signal peptidase, and the mature protein is secreted outside the cell.

In order to facilitate the purification of the protease or polypeptide of the present invention, it can also be produced as a fusion protein with an artificial sequence such as a histidine tag. The histidine tag is, for example, a column composed of six histidine chains and packed with a metal affinity resin bound with nickel or cobalt (for example, BD TALON ^™ Single Step Column (BD Biosciences), Nexus TMAC Resin (Valen Bioteck), His It is adsorbed on Bind metalchelation resin (Novagen) and eluted by increasing the buffer salt concentration. The histidine tag is generally bound to the N-terminus or C-terminus of the target protein. Accordingly, if a DNA encoding a histidine tag is linked to the DNA sequence of the present invention and expressed, a histidine tag fusion protein can be obtained. Alternatively, a histidine tag fusion protein can also be obtained by inserting the DNA of the present invention into a histidine tag-introduced expression plasmid such as pET21b (Novagen).

  The protease or polypeptide of the present invention can also be produced using a cell-free protein expression system. For this purpose, protein synthesis can be carried out using a commercially available expression system, for example the RTS100 E. coli HY kit (Roche Diagnostics), according to the attached instruction manual. As the expression system, known cell-free protein synthesis systems such as Escherichia coli, germ, rabbit reticulocytes, that is, cell extracts for cell-free protein expression are used. In this expression system, a synthesis reaction solution containing a semipermeable membrane is prepared by mixing a synthesis reaction solution containing all kinds of substrate amino acids necessary for the synthesis of ribosome, mRNA and target protein with an energy source containing ATP and GTP. The synthesis reaction is carried out in a tank (for example, see Japanese Patent Application No. 2004-329178).

  Since the polypeptide (PH1510) containing the amino acid sequence shown in SEQ ID NO: 4 is a membrane protein, it may be degraded in the production of membrane protein using living cells. To produce an intact polypeptide without degradation, it is advantageous to use a cell-free protein expression system.

  The protease or polypeptide of the present invention can be purified by concentration using ultrafiltration membrane, ion exchange chromatography, hydrophobic chromatography, dye adsorption chromatography, gel filtration chromatography, affinity chromatography, and HPLC chromatography, ammonium sulfate, etc. Conventional techniques such as salting out by heat treatment, heat treatment and the like can be appropriately combined.

  The purified proteases or polypeptides of the invention can be identified by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and proteolytic activity assays. SDS-PAGE and assay procedures are described in detail in Example 11 below, and can be performed according to the procedures described therein.

  The present invention further uses, as a probe, a complementary strand of DNA containing the base sequence shown in SEQ ID NO: 2 or 3 or a base sequence of 30 to 50 bases or more, preferably 100 bases or more in the base sequence, Provided is a method for detecting a nucleic acid comprising detecting in a biological cell a nucleic acid encoding an endogenous protease that specifically recognizes and specifically degrades a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin. .

Stomatin is present in the cell membranes of all organisms, and the identity between organisms is estimated to be about 50% or more. From the present study by the present inventors, it has been found that stromin forms a complex with an endogenous protease similar to the protease of the present invention in vivo, and through the formation of such a complex, Is considered to be involved in the regulation of Na ⁺ channel function (MP Price et al., J. Biol. Chem. (2004), in press). Since the protease of the present invention has the property of complexing with stromatin and limited degradation of the C-terminal domain of stromatin, by using the complementary strand of the DNA of the present invention or a fragment thereof as a probe, Homologs or analogs can be detected.

Detection can be performed by well-known hybridization techniques such as Southern hybridization, Northern hybridization, in situ hybridization, microarray (eg, GeneChip ^™ , manufactured by Affymetrix), etc. (by Hiroki Nakayama et al., Cell Engineering Supplement, Biotechnology) Experimental Illustrated, Basics of Gene Analysis, Shujunsha, 1995; Supervised by Masaaki Matsumura et al., Cell Engineering Separate Volume, DNA Microarray and Latest PCR Method, Shujunsha, 2000).

  Biological cells include bacteria, fungi, yeast, insect cells, mammals, etc., preferably mammalian cells, particularly human cells and mouse cells.

  Usually, the probe is preferably labeled. Examples of the label include radioactive labeling with radioactive isotopes of elements such as P and S, rhodamine, fluorescamine, derivatives thereof, and fluorescent labeling with fluorescent dyes such as Cy3 and Cy5. For example, labeling includes methods such as nick translation, random prime methods, end labels, and the like.

  The nucleic acid in the method of the present invention is genomic DNA, mRNA or cDNA. If desired, the nucleic acid may be amplified by polymerase chain reaction (PCR). PCR consists of DNA denaturation, annealing, and extension reactions. Denaturation is a stage where double-stranded DNA is usually treated at 94 ° C. for 15 seconds to 1 minute to dissociate into single-stranded DNA, and annealing is performed on template DNA. The primer is annealed, usually consisting of 55 ° C, 30 seconds to 1 minute treatment conditions. The extension is performed by adding a thermostable polymerase such as Taq under the conditions of the primer extension usually 72 ° C, 30 seconds-10 minutes. DNA amplification is carried out usually by repeating 25 to 40 cycles as one cycle. The primer usually has a length of 15 to 30 bases. The PCR technique is described in, for example, the Protein Nucleic Acid Extra Number, Forefront of PCR Method (1996), Vol. 41, No. 5, Kyoritsu Shuppan, and PCR can be performed by referring to the disclosure.

  The present invention will be further described in the following examples, but the present invention is not limited to these examples.

Culture of bacteria Sulfur metabolism Thermophilic archaeon Pyrococcus, Horikoshi (registration number JCM9974) was cultured by the following method.

13.5 g salt, 4 g Na ₂ SO ₄ , 0.7 g KCl, 0.2 g NaHCO ₃ , 0.1 g KBr, 30 mg H ₃ BO ₃ , 10 g MgCl ₂ .6H ₂ O, 1.5 g CaCl ₂ 25 mg SrCl ₂ , 1.0 ml resalin solution (0.2 g / L), 1.0 g yeast extract and 5 g bactopeptone were dissolved in 1 L, and the pH of this solution was adjusted to 6.8 and pasteurized under pressure. Next, elemental sulfur sterilized by dry heat was added to 0.2%, and the medium was saturated with argon to make anaerobic, and then JCM9974 was inoculated. Whether or not the medium became anaerobic was confirmed by adding a Na ₂ S solution and confirming that the pink color of the resazurin solution with Na ₂ S was not colored in the culture medium. This culture solution was cultured at 95 ° C. for 2 to 4 days, and then centrifuged to collect bacteria.

Chromosomal DNA preparation
The chromosomal DNA of JCM9974 was prepared by the following method.

  After culturing, the cells were collected by centrifugation at 5000 rpm for 10 minutes. The cells were washed twice with 10 mM Tris (pH 7.5) 1 mM EDTA solution and then enclosed in an InCert Agarose (FMC) block. Chromosomal DNA was separated and prepared in the Agarose block by treating this block in 1% N-lauroylsarcosine, 1 mg / ml protease K solution.

Preparation of library clone containing chromosomal DNA The chromosomal DNA obtained in Example 2 was partially decomposed with the restriction enzyme HindIII, and then a fragment of about 40 kb was prepared by agarose gel electrophoresis. This DNA fragment was ligated with Bac vectors pBAC108L and pFOS1 that had been completely degraded by the restriction enzyme HindIII using T4 ligase. When the former vector was used, DNA after completion of binding was immediately introduced into E. coli by electroporation. When the latter vector pFOS1 is used, the DNA after completion of binding is packed into λ phage particles in a test tube with GIGA Pack Gold (manufactured by Stratagene), and the DNA is transferred into E. coli by infecting the particles with E. coli. Introduced. The E. coli population resistant to the antibiotic chloramphenicol obtained by these methods was used as BAC and Fosmid libraries. A clone suitable for covering the chromosome of JCM9974 was selected from the library, and the clones were aligned.

Determination of the base sequence of each BAC or Fosmid clone The base sequences of the aligned BAC or Fosmid clones were sequentially determined by the following method.

  Each BAC or Fosmid clone DNA recovered from E. coli was fragmented by sonication, and 1 kb and 2 kb long DNA fragments were recovered by agarose gel electrophoresis. 500 shotgun clones were prepared for each BAC or Fosmid clone in which this fragment was inserted into the HincII restriction enzyme site of plasmid vector pUC118. The base sequence of each shotgun clone was determined using an automatic base sequence reader 373 or 377 manufactured by PerkinElmer, ABI. The base sequence obtained from each shotgun clone was ligated and edited using the base sequence automatic linking software Sequencher, and the entire base sequence of each BAC or Fosmid clone was determined.

Identification of PH1510 gene The base sequence of each BAC or Fosmid clone determined in Example 4 was analyzed using a large computer. As a result, the PH1510 gene was found to be a stomatin homolog (PH1511) on the genome of Pyrococcus horikoshi. ) And an operon and a serine protease motif. The PH1510 gene and amino acid sequence are shown as SEQ ID NOS: 3 and 4, respectively.

Construction of expression plasmid
(1) pET21b / 1510-N
By computer-based information analysis, four transmembrane regions were predicted in the C-terminal domain (corresponding to residues 237 to 441) of the gene (PH1510) having a serine protease motif. Furthermore, production of the full-length PH1510 gene in Escherichia coli was attempted, but due to this transmembrane region, deletion products were easily produced, and the productivity of the full-length product was low. Therefore, a partial gene encoding an N-terminal water-soluble domain (corresponding to residues 16 to 236) was inserted into an expression plasmid to prepare the water-soluble domain 1510-N.

The construction method of the expression plasmid is described below.
First, DNA primers were synthesized for the purpose of constructing restriction enzyme (NdeI and XhoI) sites before and after the structural gene region (1510-N), and restriction enzyme sites were introduced before and after the gene by PCR.

Upper primer-1510-N
TGACTGGTG CATATG TCCCCAATTCTAGCAAAAAA (underlined indicates NdeI site; SEQ ID NO: 5)
Lower primer-1510-N
GGGTTT CTCGAG ATCCGTGATGTAACTTATTAG (underlined indicates XhoI site; SEQ ID NO: 6)
After the PCR reaction, the structure gene was purified after complete digestion with restriction enzymes (NdeI and XhoI) (37 ° C., 2 hours).

  pET21b (Novagen) was cleaved and purified with restriction enzymes NdeI and XhoI, and then ligated by reacting with the above structural gene and T4 ligase at 16 ° C. for 2 hours. A part of the ligated DNA was introduced into E. coli-XL2-BlueMRF ′ competent cells to obtain transformant colonies. The plasmid was purified from the obtained colonies by the alkaline method to obtain an expression plasmid, pET21b / 1510-N. Using this expression plasmid, 1510-N is produced as a fusion protein with a histidine tag added to the C-terminus.

(2) pET21b / 1511-C
Among the membrane protein stromatin (encoded by PH1511), a gene (1511--corresponding to residues 189 to 266) that is involved in the multimerization and that serves as a substrate for the enzyme 1510-N The construction method of the expression plasmid of C) is described below.

  First, DNA primers were synthesized for the purpose of constructing restriction enzyme (NdeI and XhoI) sites before and after the structural gene region (1511-C), and restriction enzyme sites were introduced before and after the gene by PCR.

Upper primer-1511-C
GCTGAAAGGGAGAGG CATATG AGGATAACGCTAGCTG (underlined indicates NdeI site; SEQ ID NO: 7)
Lower primer-1511-C
GGGTTT CTCGAG CTTTTCTTCTTCCTTCTTCTTCATGT (Underline indicates XhoI site; SEQ ID NO: 8)

  After the PCR reaction, the structure gene was purified after complete digestion with restriction enzymes (NdeI and XhoI) (37 ° C., 2 hours).

pET21b (Novagen) was cleaved with restriction enzymes NdeI and XhoI, purified, and then reacted with the above structural gene and T4 ligase at 16 ° C. for 2 hours for ligation. A part of the ligated DNA was introduced into E. coli-XL2-BlueMRF ′ competent cells to obtain transformant colonies. The plasmid was purified from the obtained colonies by the alkaline method to obtain an expression plasmid, pET21b / 1511-C. Using this expression plasmid, 1511-C was produced as a fusion protein with a histidine tag added to the C-terminus.

Recombinant Gene Expression Competent cells of E. coli BL21 (DE3) CodonPlus RIL, Novagen) were thawed and transferred to two falcon tubes, each 0.1 ml. Into this, 0.005 ml of the above expression plasmid solution was added separately and left on ice for 30 minutes, followed by heat shock at 42 ° C. for 30 seconds, SOC medium (16 g of bactotryptone, 10 g of yeast extract, NaCl 5 g / l). ) 0.9ml was added and cultured with shaking at 37 degrees for 1 hour. Then, sprinkle an appropriate amount on a 2YT agar plate containing ampicillin and incubate overnight at 37 ° C. Transformants E. coli BL21 (DE3) CodonPlus RIL / pET21b / 1510-N and E. coli BL21 (DE3) CodonPlus RIL / pET21b / 1511-C was obtained.

  The transformant (E. coli BL21 (DE3) CodonPlus RIL / pET21b / 1510-N) was cultured at 30 ° C. in 2YT medium (2 liters) containing ampicillin until the absorption at 660 nm reached 0.4, and then IPTG (Isopropyl- β-D-thiogalactopyranoside) was added to 0.2 mM, and the mixture was cultured at 30 ° C. for 12 hours. After incubation, the cells were collected by centrifugation (6,000 rpm, 20 min) and stored at -20 ° C.

  Transformants (E. coli BL21 (DE3) CodonPlus RIL / pET21b / 1511-C) were cultured at 37 ° C. in 2YT medium (2 liters) containing ampicillin until the absorption at 660 nm reached 0.4, and then IPTG (Isopropyl- β-D-thiogalactopyranoside) was added to 1 mM, and the mixture was cultured at 37 ° C. for 4 hours. After incubation, the cells were collected by centrifugation (6,000 rpm, 20 min) and stored at -20 ° C.

A purified suspension of the enzyme 1510-N of the present invention was added to 50 ml of 50 mM Tris-HCl buffer (pH 7.5) to obtain a suspension. This Tris-HCl buffer contains 0.15M NaCl, 1.5% dodesyl-β-maltoside (DDM, Anatrace, Maumee, OH), 1 tablet protease inhibitor (Complete EDTA-free, manufactured by Roche), 0.5 mg DNase I (Sigma) is added in advance. The resulting suspension was sonicated and the supernatant was obtained by centrifugation (15,000 xg, 20 minutes). This supernatant was suspended on a Ni-column (Novagen, His-Bind metal chelation resin) equilibrated with 0.3 M NaCl, 0.1% DDM, and 5 mM imidazole. After washing with a buffer containing 30 mM imidazole, the target protein was 500 mM. Elute with buffer containing imidazole. The recovered protein was concentrated with Centriprep-10 or Centricon-10 (Amicon) and stored at 4 ° C. Protein concentration was measured with Coomassie protein assay reagent (Pierce).

The purification method of the substrate 1511-C is the same as the purification method of the enzyme 1510-N of Example 8, but differs in that DDM is not contained in the buffer solution. Further purification after the Ni-column was performed on an anion exchange Q Sepharose column equilibrated with 50 mM Tris-HCl buffer (pH 8.5) and eluted with a 0-0.5 M NaCl gradient. The target protein was stored at 4 ° C.

Generation of 1510-N mutant gene and expression / purification of mutant protein Overlapping PCR method allows alanine mutant genes of candidate catalytic residues, namely D61 (GCG), T62 (GCC), S94 (GCA), S97 (GCT) H107 (GCG), C120 (GCC), K138 (GCG), R156 (GCG), D168 (GCC), D188 (GCG), and D236 (GCG) were prepared.

  Since these amino acid residue numbers are the residue numbers encoded by the gene PH1510, the number obtained by subtracting 14 is the amino acid residue number in FIG. Moreover, the alanine codon after conversion is shown in () attached.

  Furthermore, the construction of the expression vector of the produced mutant gene, expression in E. coli, and purification of the target protein were performed in the same manner as the wild type (1510-N) gene.

Enzyme reaction conditions (1) Activity staining Enzyme samples were mixed with 0.8% sodium lauroylsarcosine, 10% glycerol, 1% 2-mercaptoethanol, and then mixed with 10% polyacrylamide-SDS-gel containing 0.2% casein. Electrophoresis was performed. After the electrophoresis is completed, cut the left and right sides of the gel run in duplicate, in half.
One side was stained with Coomassie Brilliant Blue R250 (CBBR250). The other half was washed with 50 mM phosphate buffer (pH 7.5) containing 2.5% Triton X-100 for 1 hour, and then at 80 ° C. in 50 mM phosphate buffer (pH 7.5) for proteolytic reaction. Warmed for hours. After cooling, the gel was stained with 0.1% amide black staining solution containing 30% methanol and 10% acetic acid. Proteolytic activity is observed as a clear zone due to casein degradation.
(2) Quantification of proteolytic activity The proteolytic activity was measured by hydrolysis of fluorescently labeled casein (bovine-derived casein fluorescein isothiocyanate (FITC-casein), Sigma). The standard reaction solution contains the substrate FITC-casein and the enzyme in 20 μl of 20 mM MES-Na buffer (pH 6.0). After warming the reaction solution at 80 ° C for several minutes, stop the reaction by storing in ice, add SDS-sample buffer so that the final concentration is 0.5% SDS, 10% glycerol, 1% 2-mercaptoethanol, Warmed at 98 ° C. for 5 minutes. This sample (14 μl) was electrophoresed on a 10% polyacrylamide-SDS-gel. Thereafter, degradation products on the gel were visualized and quantified with an excitation light filter (488 nm) and an emission filter (530 nm) using a fluoroimager 585 (Molecular Dynamics, Inc., CA). Proteolytic activity was calculated by the following formula.
R = P / (S + P)
(Where R is the degradation rate, S is the amount of undegraded casein band, and P is the amount of all degradation products that appear at the bottom of the casein band before degradation.)

Furthermore, proteolytic activity was standardized by the following formula.
(% cleavage) = 100x (R _X -R ₀ ) / (1-R ₀ )
(Here, R _X is the R value after X minutes, and R ₀ is the R value at 0 minutes.)
The initial velocity was determined from the initial slope of the% cleavage value plot over time.

  The effect of inhibitors on the proteolytic activity of 1510-N was investigated using pepstatin, phenylmethylsulfonyl fluoride (PMSF), 3,4-dichloroisocoumarin (DCI) (all purchased from Sigma), and EDTA (Dojin Lab.). It was. The enzyme 1510-N of the present invention was incubated with each inhibitor at 37 ° C. for 20-60 minutes, and then its proteolytic activity was measured.

(3) Measurement of temperature dependence of optimum pH and activity The optimum pH is determined by using the substrate FITC-casein (0.5 μg) and the enzyme 1510-N (0.2 μg) at 50 mM concentration in each of Na acetate buffer and phosphate phosphate buffer. Solution, MES-Na buffer, Tris-HCl buffer, and glycine-NaOH buffer were reacted at 80 ° C. for measurement. The temperature dependence was measured by reacting the substrate FITC-casein (0.5 μg) and the enzyme 1510-N (0.1 μg) at each temperature in 20 mM MES-Na buffer (pH 6.0).

(4) N-terminal amino acid sequence analysis of degradation products Substrate α-casein and β-casein (both derived from bovine serum, Sigma) and substrate 1511-C were degraded by enzyme 1510-N. The reaction products were separated by SDS-PAGE and electrically transferred to a polyvinylidene difluoride membrane (Millipore). N-terminal sequence analysis of the reaction products was analyzed by requesting APRO Life Science Institute, Inc. (Japan) or Hokkaido System Science (Japan).

Properties of enzyme (1) Protein chemical properties of enzyme 1510-N and substrate 1511-C Enzyme 1510-N and substrate 1511-C are completely purified by the above purification process, and molecular weights of about 25 kDa and 10 kDa by SDS-PAGE Showed a single band (FIG. 3A). When the molecular weight in the native state was measured by gel filtration using purified 1511-C, it was eluted as a single peak near the exclusion limit and behaved as a tens of macromolecules. This strongly suggested that the 1511-C domain may contribute significantly to stromatin, ie, 1511 multimerization. 1510-N is composed of 230 amino acid residues, and the molecular weight predicted from the amino acid sequence is 25,398 Da. 1511-C is composed of 87 amino acid residues, and the molecular weight predicted from the amino acid sequence is 9,998 Da. In addition, the enzyme 1510-N mutant enzyme, D61A, H107A, D188A, D236A, S94A, S97A, C120A, D168A, T62A, K138A, R156A is also completely purified by the above purification process, and has a molecular weight of about 25 kDa by SDS-PAGE. A single band was shown (Figure 3B).

(2) shows activity staining results wildtype 1510-N and S97A, the result of the SDS-PAGE pattern and activity staining of the C120A mutant in FIG. As shown in FIGS. 4A and B lanes 1 and 3, the wild type 1510-N and the C120A mutant showed a transparent halo derived from casein degrading activity at the same position as the protein band. From this SDS-PAGE pattern, the molecular weight of the active protein was estimated to be 45 kDa, and the 1510-N molecule was thought to express the activity as a dimer. This was consistent with the fact that the enzyme behaves as a dimer in gel filtration. In addition, clear casein degradation activity was not detected in the S97A mutant. Furthermore, the Ser residue was conserved in all serine proteases at the position corresponding to S97, based on the results of juxtaposition of various serine proteases with different origins and the primary sequence of 1510-N. These results prove that 1510-N is a proteolytic enzyme. Moreover, it was shown that the S97 residue may constitute a reaction center.

(3) Detection of endo-type cleavage of 1510-N enzyme against FITC-casein and optimum reaction conditions As shown in Figure 5A, 1510-N acts on FITC-casein in an endo-type, with a main product of 20 kDa and a bottom. A small molecular weight FITC-peptide to be electrophoresed was produced. Moreover, as shown in FIG. 5B, the endo-type cleavage products increased with time. Furthermore, as shown in FIG. 6A, the optimum pH of this enzyme was 5-6. Further, as shown in FIG. 6B, the enzyme activity increased from 50 to 98 ° C. depending on the temperature, and the optimum temperature was considered to be 98 ° C. or higher.

(4) Search for active residues of 1510-N enzyme
An Ala-substituted product at a catalyst candidate residue of 1510-N enzyme was prepared, and the activity (% cleavage value) against FITC-casein was plotted against time (FIG. 7A). Further, based on FIG. 7A,% cleavage / time / enzyme values (% / min / μg) were calculated for four different enzyme amounts, and the average value was shown in FIG. 7B compared with the wild-type enzyme. From these results, the activities of S97A, K138A, D168A, and T62A were 0.08%, 1.2%, 3.2%, and 5.5% of the wild type, respectively. In addition, the only His residue substitution H107A present in the 1510-N molecule showed no decrease in activity. This indicated that the 1510-N enzyme is not a typical serine protease with catalytic triad (Ser, His, Asp). Based on the above, the 1510-N enzyme was considered to be an endo-type serine protease composed of a catalytic dyad with S97 and K138 as active centers. Furthermore, this fact was supported by experimental results in which PMSF and DCI, which are typical serine protease inhibitors, showed little inhibitory effect.

(5) Amino acid primary sequence specificity of 1510-N protease
In order to investigate the acid primary sequence specificity of 1510-N protease, some proteins were used as substrates. Among α-casein, β-casein, 1511-C, 1511-N (1511 N-terminal domain (69-234)), 1510-C (1510 C-terminal domain (371-441)) and α-casein 1511-C was a good substrate, and specific degradation products were detected (FIGS. 8A and B). From α-casein, α-13k (meaning a 13 kDa fragment derived from α-casein) and α-14k were obtained. From 1511-C, 1511-10k (meaning an apparent 10 kDa fragment derived from 1511-C) was obtained. In addition, the minor products α-20k and β-12k fragments were obtained from α-casein and β-casein, respectively. On the other hand, 1511-N and 1510-C were not decomposed at all. The N-terminal amino acid sequence of the specific degradation product obtained here was analyzed, and its substrate specificity is shown in Table 1.

  As a result, it was revealed that 1511-N was cleaved specifically at only one point. From the analysis results of α-13k, α-14k, and 1511-10k, which are the main products, the recognition sequence is rich in hydrophobic and aromatic amino acids, and the P1 site (-1 site of the cleavage point) is leucine and P4 site. Was revealed to be valine or leucine. A serine protease exhibiting such substrate specificity has not yet been reported and is a novel enzyme.

  Based on the above experimental facts, 1510-N is a novel thermostable protease that specifically recognizes the hydrophobic amino acid sequence of the membrane protein stromatin, ie, the domain (1511-C) involved in multimerization of 1511, and performs limited degradation It became clear that.

This shows the amino acid sequence of 1510-N (C-terminal histidine tag fusion protein) (SEQ ID NO: 1). This shows the base sequence (SEQ ID NO: 2) of 1510-N (C-terminal histidine tag fusion protein). The SDS-PAGE of the purified protein is shown. M represents a molecular weight standard (250, 150, 100, 75, 50, 37. 25, 20, 15, 10 kDa). A, lanes 1-4 are 1510-N (corresponding to residues 16-236 of PH1510 protein), 1510-C (corresponding to residues 371-441 of PH1510 protein), 1511-N (residual of PH1511 protein) Corresponding to groups 69-234), 1511-C (corresponding to residues 189-266 of the PH1511 protein), respectively. B, lanes 1 to 11 show Ala substitutions (D61A, H107A, D188A, D236A, S94A, S97A, C120A, D168A, T62A, K138A, R156A) of 1510-N, respectively. The results of CBBR250 staining (A) and protease activity staining (B) in SDS-PAGE of wild type 1510-N and S97A and C120A mutant enzymes are shown. Lanes 1 to 3 show the wild type and S97A and C120A mutant enzymes, respectively. M represents a molecular weight standard (75, 50, 37. 25 kDa). The time-dependent change of FITC-casein cleavage by 1510-N protease is shown. A shows the result of separating the degradation products of FITC-casein by SDS-PAGE and detecting with Fluorimager. The leftmost number indicates the molecular weight standard. FITC-casein is composed of FITC-α-casein (30 kDa) and FITC-β-casein (23 kDa). As the protease reaction progressed, a 20 kDa main product and a bottom small molecular weight FITC-peptide were observed. B is a graph in which the% cleavage value calculated from the result of FIG. A is plotted against time. It shows the temperature dependence of the optimum pH and activity of 1510-N protease. A indicates the optimum pH. The buffer used was Na acetate buffer (○), Na phosphate buffer (△), MES-Na buffer (+), Tris-HCl buffer (□), Glycine-NaOH buffer (×). is there. B shows the temperature dependence of the activity measured in 20 mMES-Na buffer (pH 6.0). The search for active residues of 1510-N protease is shown. A shows the activity of Ala-substituted product against FITC-casein (% cleavage value); wild type (◯), H107A (+), S97A (Δ). B shows a comparison of the specific activity of the wild type and the Ala-substituted product. The% cleavage / time / enzyme value (% / min / μg) of the Ala-substituted product calculated based on the results of FIG. A is shown in comparison with that of the wild-type enzyme. The endo-cleavage pattern of the substrate α-casein and 1511-C domain by 1510-N protease is shown. A shows the results of sampling the α-casein reaction product over time and analyzing by SDS-PAGE. M, S, E indicate molecular weight standards, substrate, enzyme 1510-N. The letters 13k and 14k with arrows indicate the molecular weight of each band. B shows the results of sampling the 1511-C reaction over time and analyzing by SDS-PAGE. M, S, E indicate molecular weight standards, substrate, enzyme 1510-N. The 10k letter with the arrow indicates the apparent molecular weight of the product 1511-10k band.

SEQ ID NO: 1: fusion protein.
Ser2-Asp222 is derived from Pyrococcus horikoshi.
His225-His230 is a histag.
SEQ ID NO: 2: nucleotide sequence encoding the fusion protein of SEQ ID NO: 1.
SEQ ID NOs: 5-8: Primers.

Claims (14)

A protease having the following properties (1) to (7).
(1) It is derived from a hyperthermophilic bacterium Pyrococcus horikoshi.
(2) The molecular weight measured by SDS-PAGE is about 25 kDa.
(3) The active form is a dimer.
(4) The optimum temperature is about 98 ° C or higher.
(5) The optimum pH is about 5 to about 6.
(6) Endo serine system.
(7) Recognize and degrade the hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin.   The protease according to claim 1, comprising the amino acid sequence shown in SEQ ID NO: 1.   Specific recognition of a hydrophobic amino acid sequence that includes an amino acid sequence in which one or more amino acids are deleted, substituted, inserted, or added in the amino acid sequence shown in SEQ ID NO: 1 and that is involved in multimerization of the membrane protein stromatin The protease according to claim 1, which has a property of limited degradation. A DNA encoding the polypeptide (A) or (B) having the following protease activity. (A) A polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1 or 4.
(B) a hydrophobic amino acid sequence comprising an amino acid sequence in which one or more amino acids are deleted, substituted, inserted or added in the amino acid sequence shown in SEQ ID NO: 1 or 4, and involved in multimerization of membrane protein stromatin A polypeptide having protease activity that specifically recognizes and specifically degrades. DNA selected from the group consisting of the following (C), (D) and (E).
(C) DNA comprising the base sequence shown in SEQ ID NO: 2 or 3.
(D) a hydrophobic amino acid sequence comprising a base sequence in which one or more bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 2 or 3, and involved in multimerization of membrane protein stromatin A DNA encoding a protease that specifically recognizes and specifically degrades.
(E) Protease that hybridizes with the DNA of (C) or (D) under stringent conditions and specifically recognizes and specifically degrades a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin DNA encoding   DNA containing the base sequence shown in SEQ ID NO: 3.   A polypeptide having protease activity that is specifically encoded by the DNA according to claim 4, 5 or 6, and that specifically recognizes and specifically degrades a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin.   The polypeptide of Claim 7 which consists of an amino acid sequence shown by sequence number 4.   An expression vector comprising the DNA according to claim 4, 5 or 6.   A host cell transformed with the expression vector according to claim 9.   A method for producing the protease, comprising culturing the host cell according to claim 10 and recovering a protease that specifically recognizes and specifically degrades a hydrophobic amino acid sequence involved in multimerization of the membrane protein stromatin.   A multimer of membrane protein stromatin in a biological cell using as a probe the complementary strand of DNA comprising the base sequence shown in SEQ ID NO: 2 or 3 or a continuous base sequence of 30-50 bases or more in the base sequence A method for detecting a nucleic acid comprising detecting a nucleic acid encoding an endogenous protease that specifically recognizes and specifically degrades a hydrophobic amino acid sequence involved in crystallization.   13. The method of claim 12, wherein the biological cell is a mammalian cell including a human.   The method according to claim 12 or 13, wherein the probe is labeled.