JP2006141356A - Hematopoietic stem cell derived from es cell - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a hematopoietic stem cell strain capable of differentiating to lymphocyte. <P>SOLUTION: The hematopoietic stem cell strain, B-2 cell strain with a self-replication potency and capable of differentiating to lymphocyte ES (from embryonic stem) cells of mouse is isolated. The cell is proliferative in the presence of bFGF, and differentiating to each of erythrocyte, macrophage and lymphocyte cell by culturing under a differentiation inducing condition. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a hematopoietic stem cell line derived from ES cells.

  Hematopoietic stem cells are vital stem cells that continue to produce and supply all blood cells while maintaining themselves by self-replication throughout the life of an organism. Stem cell transplantation using this property is a fundamental treatment for serious diseases such as leukemia. However, since the technology for purely culturing hematopoietic stem cells is not yet completed, a shortage of donor cells for transplantation has become a major bottleneck. Current culture and amplification of hematopoietic stem cells is mainly by co-culture with stromal cells, and hematopoietic stem cells can be cultured and maintained for a short period of time. In addition, the absolute number of hematopoietic stem cells cannot always be sufficiently amplified.

  Accordingly, it has been aimed to establish a method for continuing to proliferate hematopoietic stem cells in culture and finally establishing a hematopoietic stem cell line, but it has not been successful to date. In the past, leukemia cell lines that showed pluripotency have been used as models of hematopoietic stem cell lines. However, since they are originally abnormal cells, the scope of application was extremely limited. Recently, it has been reported that hematopoietic stem cell lines have been obtained by artificially manipulating genes that affect proliferation and differentiation. However, changing the expression of genes that affect proliferation and differentiation has a high possibility of altering the properties of stem cells themselves, and it is still difficult to immediately apply them to normal hematopoietic stem cells. Therefore, so far, hematopoietic stem cell lines are cell lines obtained by artificially manipulating genes involved in proliferation and differentiation, and are insufficient as a model for normal hematopoietic stem cells. In addition, most of the hematopoietic stem cell lines obtained so far could differentiate into erythrocytes, granulocytes, macrophages, etc., but they could not differentiate into lymphocytes.

Japanese Patent Application Laid-Open No. 10-113171 Schickwann Tsai, Stephen Bartelmez, Ema Sitnika, and Steven Collins. (1994). Genes and Development 8: 2831-2841. Perpetua Pinto do O, Asa Kolterud and Leif Carlsson. (1998). EMBO J. 17: 5744-5756. Rita C.R.Perlingeiro, Michael Kyba, and George Q. Daley. (2001) .Development 128: 4597-4604

  An object of the present invention is to provide a hematopoietic stem cell line that can be differentiated into lymphocytes without genetic modification. The hematopoietic stem cell line is a cell that closely resembles a more normal hematopoietic stem cell because it is unlikely that the original properties of the cell have changed due to genetic modification and is not a cancerous cell.

That is, the present invention has the following aspects:
1. Hematopoietic stem cell line derived from mouse ES cells;
2. A hematopoietic stem cell line derived from mouse ES cells and capable of self-replication in the presence of bFGF;
3. 3. The hematopoietic stem cell line according to 1 or 2 above, which can differentiate into any of erythrocytes, granulocytes, macrophages, B lymphocytes and NK cells;
4). During culture under proliferative culture conditions, c-kit, CD34, FMS-like tyrosine kinase 3 / fetal liver kinase 2 (Flt3 / Flk2), PgP-1, heat stable antigen (HSA), GATA2, From PU.1, T cell acute leukemia gene 1 / stem cell leukemia gene (Tal1 / SCL), angiopoietin-1, acute myeloid leukemia gene 1 (AML-1), terminal deoxynucleotidyl transferase (TdT), Ikaros and Vasa The hematopoietic stem cell line according to any one of the above 1 to 3, further characterized in that expression of a gene encoding one or more proteins selected from the group consisting of:
5. All of c-kit, CD34, Flt3 / Flk2, PgP-1, HSA, GATA2, PU.1, Tal1 / SCL, Angiopoietin-1, AML-1, TdT, Ikaros and Vasa in culture under growth culture conditions The hematopoietic stem cell line according to any one of the above 1 to 4, further characterized in that expression of a gene encoding the protein is recognized;
6). The hematopoietic stem cell line according to any one of 1 to 5 above, which has a receipt number FERM AP-20276;
7). Differentiated B lymphocytes obtained by culturing the hematopoietic stem cell line according to any one of the above 1 to 6 under differentiation-inducing conditions;
8). 7. The B lymphocyte according to 7 above, wherein the B lymphocyte is a group consisting of B220 gene, β major globin gene, Ikaros gene, λ5 gene, Rag-1 gene and Pax-5 gene compared to the hematopoietic stem cell line before differentiation induction. B lymphocytes characterized in that induction of expression of at least one or more selected genes is observed;
9. 9. B lymphocyte according to 8 above, characterized in that expression induction of all genes of B220 gene, Ikaros gene, λ5 gene, Rag-1 gene and Pax-5 gene is observed; A method for differentiating the hematopoietic stem cell line according to any one of the above 1 to 6 into B lymphocytes;
About.

  Furthermore, the present invention shows that the expression induction of Mac-1 and Gr-1 genes and TER119 gene is observed by culturing for 10 days under differentiation-inducing conditions, and that the B220 gene is cultivated by culturing for 30 days under differentiation-inducing conditions. Induced expression, B220 gene, Ikaros gene, λ5 gene, recombination activating gene 1 (Rag-1) and paired box gene 5 (Pax-5) by culturing for 30 days under differentiation-inducing conditions The expression of at least one or more genes selected from the group consisting of the group consisting of: Ikaros gene, λ5 gene, Rag-1 gene and Pax-5 gene by culturing under differentiation-inducing conditions for 30 days It is characterized by any one of expression induction being observed and NK1.1 expression induction being observed by culturing for 10 days under NK cell differentiation induction conditions. Also it includes the serial hematopoietic stem cell lines.

  The present invention provides a hematopoietic stem cell line that can also differentiate into lymphocytes. The hematopoietic stem cell line of the present invention is very useful as a research tool related to hematopoietic stem cells because it has the property of being capable of self-replication and also capable of differentiating into lymphocytes. Since the hematopoietic stem cell of the present invention is further established without genetic modification, its properties are considered to be very similar to normal hematopoietic stem cells, and it is due to artificial genetic modification or canceration, etc. The hematopoietic stem cell of the present invention is very reliable as a research tool for hematopoietic stem cells without having the possibility of deviating from the properties of normal hematopoietic stem cells.

  The present invention relates to a hematopoietic stem cell line derived from mouse ES cells. The stem cell line can self-replicate and can differentiate into lymphocytes.

The present inventors obtained the above hematopoietic stem cell line by the following method.
H-1 ES cells established from C3H mouse blastocysts were proliferated in an undifferentiated state by co-culture with mouse embryo fibroblasts that had lost their proliferation ability by mitomycin C treatment. The medium used was a DMEM medium supplemented with 20% fetal calf serum, 1000 units of LIF, and 100 μM of 2 mercaptoethanol. When H-1 ES cells are cultured in the absence of LIF and mouse fetal fibroblasts, differentiation is induced. 10 μg / ml transferrin, 10 μg / ml insulin, 10% fetal calf serum, 100 μM 2 mercaptoethanol was added to DME / F12 medium and cultured for 7 days to differentiate into various cells. Thereafter, the cells were dissociated by trypsin / EDTA treatment and seeded in a dish with a new culture solution. After standing for several hours, cells other than blood cells adhere to the dish. Collect floating cells and add IL-3, SCF, BFGF, and 2 mercapto to a semi-solid medium containing 1.2% methylcellulose. I added ethanol. After 2 weeks, some very small colonies consisting of around 10 cells were formed. After subcultured twice under similar culture conditions, the cells were cultured in a liquid medium not containing methylcellulose. Thereafter, a medium in which 10 μg / ml transferrin, 10 μg / ml insulin, 10% fetal bovine serum, 10 ng / ml basic fibroblast growth factor (bFGF) was added to DME / F12 medium was used. Morphologically almost uniform small cells with protrusions grew smoothly. Those cells were seeded again in a semi-solid medium containing methylcellulose at a low cell density, and a single cell-derived cloned cell line was isolated. One of them is the B-2 stock. The B-2 cell line was obtained from the National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (1st, 1st, 1st, 1st East, Tsukuba City, Ibaraki Prefecture, Japan) as receipt number FERM AP-20276 in 2004. Deposited on October 28th.

  The B-2 cell line expresses hematopoietic stem cell markers such as CD34 and c-kit and does not express any markers of differentiated blood cells (B220, TER119, Gr-1, Mac-1, CD4). B-2 cells have a very large cell nucleus, cytoplasm is relatively small and uniform, and granules and the like are not observed. Many cells have characteristic cytoplasmic processes and have unique morphological features.

  The cells obtained above contain 10% fetal bovine serum, 10 μg / ml transferrin, 10 μg / ml insulin, and 10 ng / ml bFGF in an appropriate animal cell culture medium, preferably DME / F12 (1: 1). It can grow on the added medium and can be subcultured while maintaining its self-replicating ability. The culture in such a medium is referred to as “culture under growth culture conditions” in the present specification.

  The cells obtained above are c-kit, CD34, FMS-like tyrosine kinase 3 / fetal liver kinase 2 (Flt3 / Flk2), PgP-1, HSA, GATA2, PU.1, T cell acute leukemia gene 1 / stem cell By detecting the expression of hematopoietic stem cell-specific marker genes such as murine leukemia gene (Tal1 / SCL), angiopoietin-1, acute myeloid leukemia gene 1 (AML-1), and terminal deoxynucleotidyltransferase (TdT) It is possible. one or more, preferably three selected from the group consisting of c-kit, CD34, Flt3 / Flk2, PgP-1, HSA, GATA2, PU.1, Tal1 / SCL, Angiopoietin-1, AML-1 and TdT As described above, it is preferable to detect five or more, particularly preferably all. Since c-kit, CD34, Flt3 / Flk2, PgP-1 and HSA are cell surface markers, their gene expression can be detected by analyzing the expression of the protein on the cell surface by FACS or the like. In this specification, “induction of gene expression” means that mRNA that is a transcription product of the gene is detected or increased, and protein that is the expression product of the gene is detected. It includes both being done and increasing. The presence of mRNA can be detected using methods known in the art, such as Northern blotting, RT-PCR, and quantitative RT-PCR. The presence of the protein encoded by the gene can be detected using various methods known in the art, such as immunochemical techniques such as Western blotting, but the protein to be detected is a protein present on the cell surface. Is particularly preferably detected by FACS using a specific antibody.

Similar to normal hematopoietic stem cells, the cells obtained above can be induced to differentiate into various types of blood cells by co-culture with appropriate stromal cells (eg, OP-9 cells). The culture of stromal cells and the co-culture of B-2 and stromal cells may be performed by adding 20% fetal calf serum to alpha MEM medium. Conditions such as cell density at this time can be appropriately determined by those skilled in the art. For example, 10 ⁴ cells per dish on a confluent monolayer of stromal cells in a culture dish having a diameter of 10 cm. B-2 cells should be seeded. Further, interleukin 7 (10 ng / ml), FLT-3 ligand (10 ng / ml), and 2 mercaptoethanol (100 μM) were added to the medium. When cultured for about 1 to 2 weeks, preferably about 10 days, differentiation into red blood cells and granulocytes is initiated. If the culture is continued for about 20 days or more, differentiation into B lymphocytes occurs. Here, the medium may be changed during culture at an appropriate interval (for example, every 3 days).

  Further, when interleukin 2 (10 ng / ml) is further added to the above differentiation induction medium and co-cultured with stromal cells in the same manner, differentiation into NK cells takes about 1 to 2 weeks, preferably about 10 days. Happens.

  The above differentiation into various cells can be confirmed by detecting the expression of known marker genes specific to each cell. As described above, the “detection of marker gene expression” includes both detection of mRNA that is a transcription product of the marker gene and detection of protein that is an expression product of the marker gene. In particular, it is convenient to detect a cell surface marker by FACS, and preferable cell surface markers for detection by FACS include TER119 for erythrocytes, Gr-1 for granulocytes, Mac-1, B for macrophages. Examples of lymphocytes include B220, and examples of NK cells include Nk1.1, but are not limited thereto. Various cell surface markers specific to various cells are known, and any marker may be detected. Detection by FACS may be performed by antibody staining according to a known method. The preferred markers for RT-PCR analysis include β major globin expressed in adult erythrocytes for erythrocytes, interleukin 7 receptor that is lymphocyte specific for lymphocytes, and recombination activating genes. 1 (Rag-1), B lymphocytes include paired box gene 5 (Pax-5) and λ5, NK cells include NK1.1 and the like, but are limited to these as well as the above FACS markers. However, those skilled in the art can appropriately select a known marker. In order to detect the gene expression of these specific markers by RT-PCR, it is necessary to design primers specific to each marker, which can also be achieved by methods known to those skilled in the art. RT-PCR conditions can also be easily set by those skilled in the art based on known techniques.

  For example, in the case of B-2 cells, FACS analysis revealed that hematopoietic stem cell markers c-kit, CD34, Flt3 / Flk2, PgP-1 and HSA were expressed before differentiation induction. Yes. On the other hand, Mac-1 as a macrophage marker, Gr-1 and TER119 genes as granulocyte markers, B220 gene as B lymphocyte marker, CD4 gene as T cell marker, and Nk1 as NK cell marker. The expression of one gene was not detected by FACS, indicating that it has a hematopoietic stem cell phenotype.

  Furthermore, when the expression of various marker genes in B-2 cells before differentiation induction was examined by RT-PCR, the expression of hematopoietic stem cell markers GATA-1, PU.1, Tall / SCL, AML-1 and TER119 was observed. Have been shown to have a phenotype of ES cell-derived hematopoietic stem cells.

  On the other hand, B-2 cells were differentiated under induction conditions, that is, in alpha MEM medium supplemented with 20% fetal calf serum containing interleukin 7 (10 ng / ml), FLT-3 ligand (10 ng / ml), and 2 mercaptoethanol (100 μM). When B-2 cells were co-cultured with OP-9 cells, the expression of Mac-1 gene, Gr-1 gene and TER119 gene was detected by FACS on the 10th day of co-culture, but B220 gene expression was Not detected by FACS. When such co-culture is performed for 30 days, the expression of B220 is remarkably detected by FACS.

  Furthermore, when the expression of various marker genes in B-2 cells induced to differentiate for 30 days under the same conditions as described above was examined by RT-PCR, λ5, Rag-1 and Pax- were compared to B-2 cells before differentiation induction. The gene expression of 5 is significantly increased. The above demonstrates that B-2 cells are a hematopoietic stem cell line that can differentiate into lymphocytes.

  In addition, B-2 cells were co-cultured with OP-9 cells under the conditions in which interleukin 2 (10 ng / ml) was added to the differentiation induction medium (referred to herein as “NK cell differentiation conditions”). In some cases, expression of NK1.1 is detected by FACS and RT-PCR on day 10 of co-culture. That is, it is demonstrated that B-2 cells are a hematopoietic stem cell line that can differentiate into NK cells.

  Blood cells differentiated from the B-2 cells obtained in this way can be isolated from the differentiated B-2 cell population using the cell sorter with various markers as indicators to differentiate into the desired cell type. . Such methods are known to those skilled in the art. The isolated cell can be used as a model cell of the cell type, and is highly useful in various studies.

  The cell line of the present invention is very similar to normal hematopoietic stem cells, and can be differentiated into lymphocytes. Therefore, the cell line of the present invention is also useful in analysis studies of differentiation processes into blood cells. high.

  For example, when lymphocyte cells are required, expression induction of at least one or more genes selected from the group consisting of Ikaros gene, λ5 gene, Rag-1 gene and Pax-5 gene is observed compared to before differentiation induction. It is better to isolate the corresponding cells using this as an index, but in this case, using a cell sorter, the cells labeled with the antibody against B220 protein are isolated using the expression of B220 gene, that is, the presence of B220 protein on the cell surface as an index. Is possible.

B-2 cell growth
DME / F12 medium supplemented with 10 μg / ml transferrin, 10 μg / ml insulin, 10% fetal calf serum, 10 ng / m1 basic fibroblast growth factor (bFGF) at 37 ° C., 5% CO ₂ Incubate in an environment. When cultured under such conditions, B-2 cells self-replicate and continue to proliferate. When the cells are subconfluent, dilute and subculture. In addition, medium exchange during culture is performed as appropriate.

Morphological analysis
When B-2 cells were observed under a microscope, the cells had a characteristic protrusion (upper left in FIG. 1). Obviously, the morphology of granulocytes, red blood cells and macrophages (upper right, lower left and lower right in FIG. 1, respectively) is different.

Induction of B-2 cell differentiation
B-2 cells can induce differentiation into various blood cells when co-cultured with OP-9 stromal cells. 104 ⁴ B-1 cells are seeded on a monolayer of OP-9 cells that have been cultured in alpha MEM medium with 20% fetal calf serum and have reached a confluent state. Add leukin 7 (10 ng / ml), FLT-3 ligand (10 ng / ml), and 2 mercaptoethanol (100 μM), and culture in a 37 ° C., 5% CO ₂ environment. Medium exchange during culture is performed as appropriate.

  Incubate for 10-30 days under the above conditions. The culture time required for differentiation differs depending on the cell type to be differentiated, and differentiation into erythrocytes, granulocytes and macrophages begins around 10 days, and differentiation into B lymphocytes and NK cells in 30 days or more. Differentiation was confirmed by detecting the expression of various blood cell specific markers by FACS or RT-PCR.

Analysis of expression of various markers by FACS First, B-2 cells not induced to differentiate were analyzed by FACS, and their phenotypes were examined.
All antibodies used are from Farmingen. Hematopoietic stem cell markers (c-kit, Flt3 / Flk2, PgP-1, HSA), vascular endothelial cell marker (CD31), macrophage marker (Mac-1), granulocyte marker (myeloid differentiation antigen Gr-1: Gr-1) The antibodies against B lymphocyte marker (B220), T cell marker (CD4) and NK cell marker (NK1.1) were labeled with FITC. Collect B-2 cells, add Fc receptor Block antibody (CD16 / CD32) (final concentration 5μg / ml) in phosphate buffer containing 3% fetal calf serum in 5 × 10 ⁵ cells, The reaction was allowed for 10 minutes. Thereafter, an antibody against each marker was reacted at a concentration of 10 μg / ml for 20 minutes. Thereafter, the cells were washed twice with a phosphate buffer, and 5 μg / ml of Propidium Iodide (PI) was added to cause a staining reaction for 10 minutes, and then analyzed by FACS. Antibodies against erythrocyte marker (TER119) and hematopoietic stem cell marker (CD34) labeled with biotin were used. After each antibody was reacted at a concentration of 10 μg / ml for 20 minutes, the cells were washed twice and then reacted with FITC-labeled avidin for another 20 minutes. The cells were washed again twice, added with 5 μg / ml PI, reacted for 10 minutes, and then analyzed by FACS. Cells differentiated by co-culture with OP-9 were detached from the dish by pipetting, reacted with the antibody in the same manner as described above, and subjected to FACS analysis. FACS analysis was performed on 5,000 cells that did not stain with PI. A purified antibody of the same isotype as each antibody was used as a negative control.

  The result is shown in FIG. The control is a cell not reacted with a specific antibody. c-kit, CD34, Flt3 / Flk2, PgP-1, HSA expression was significantly detected relative to the control, but for CD31, Mac-1, Gr-1, TER119, B220, CD4 and NK1.1 No increase in expression was observed compared to control cells.

  From this result, it was shown that the B-2 cell line before differentiation induction has a phenotype as a hematopoietic stem cell.

  Subsequently, FACS analysis was similarly performed on Mac-1, Gr-1 and TER119 for B-2 cells cultured for 10 days under conditions for differentiation induction. Induction of Mac-1, Gr-1 and TER119 expression was observed (upper left, upper right and lower left in FIG. 3). Furthermore, when the expression of B220 was examined for B-2 cells cultured for 30 days under conditions for induction of differentiation, significant expression induction was observed (FIG. 3, lower right).

RNA from RT-PCR analyzed cells was purified with TRIZOL reagent (GIBCO). SuperScript (trademark) Preamplification System (GIBCO) was used for the preparation of cDNA from RNA. PCR was performed under conditions of an annealing temperature of 63 ° C. and 30 cycles. PCR products were separated by electrophoresis using a 2% agarose gel and identified by staining with ethidium bromide. G3PDH was used as an internal control.

Each PCR primer used the following sequence:
GATA-2
CGGAATTCGACACACCACCCGATACCCACTAT (SEQ ID NO: 1)
CGGAATTCGCCTACGCCATGGCAGTCACCATGCT (SEQ ID NO: 2)
Tal1 / SCL
AACCGGGTGAAGAGGAGGCCCTCC (SEQ ID NO: 3)
AAGCACGTCCTGTAGAAGGTC (SEQ ID NO: 4)
Angiopoietin-1
CAGTGGCTGCAAAAACTTGA (SEQ ID NO: 5)
TCTGCACAGTCTCGAAATGG (SEQ ID NO: 6)
AML-1
CCAGCAAGCTGAGGAGCGGCG (SEQ ID NO: 7)
CGGATTTGTAAAGACGGTGA (SEQ ID NO: 8)
TdT
GAAGATGGGAACAACTCGAAGAG (SEQ ID NO: 9)
CAGGTGCTGGAACATTCTGGGAG (SEQ ID NO: 10)
Ikaros
GGAGGCACAAGTCTGTTGAT (SEQ ID NO: 11)
CATTTCACAGGCACGCCCATTCTCT (SEQ ID NO: 12)
Vasa
AGGTGATGAAAGAACTATGG (SEQ ID NO: 13)
TAATTCTTCCTCGTGTCAAC (SEQ ID NO: 14)
λ5
ATGAAGCTCAGAGTAGGACAGAC (SEQ ID NO: 15)
CTAAGAACACTCAGCAGGTGAC (SEQ ID NO: 16)
Rag-1
CCAAGCTGCAGACATTCTAGCACTC (SEQ ID NO: 17)
CAACATCTGCCTTCACGTCGATCC (SEQ ID NO: 18)
Pax-5
TCAGGACAGGACATGGAGGAG (SEQ ID NO: 19)
GATCCTGTTGATGGAGCTGACG (SEQ ID NO: 20)
PU.1
TGCTGTCCTTCATGTCGCCG (SEQ ID NO: 21)
TGGAAGGGTTTTCCCTCACC (SEQ ID NO: 22)
G3PDH
ACCACAGTCCATGCCATCAC (SEQ ID NO: 23)
TCCACCACCCTGTTGCTGTA (SEQ ID NO: 24).

  The results of detecting the expression of various marker genes for the B-2 cell line that has not been induced to differentiate are shown in FIG. Other cell lines (B-1, B-3, C-1 and A-6) obtained by the same method as B-2 and SIL6 / 1 which induced differentiation of A-6 were used as controls. .

  In the B-2 cell line, mRNAs for hematopoietic stem cell markers GATA-1, PU.1, Tall / SCL and AML-1 were significantly detected, and the B-2 cell line has a phenotype as a hematopoietic stem cell. (FIG. 4). Furthermore, angiopoietin-1 mRNA, a marker for fetal stem cells, was also detected. Interestingly, Vasa gene, whose expression was confirmed only in germ cells, was also expressed. This suggests that the first hematopoietic stem cells formed during the fetal development may be derived from germline cells.

  Next, FIG. 5 shows the results of detecting the expression of various marker genes in B-2 cells cultured for differentiation induction. As shown in FIG. 3, the expression of the red blood cell marker TER119, macrophage marker Mac-1, granulocyte marker Gr-1, and B lymphocyte marker B220 was confirmed by FACS. , Rag-1 and Pax-5 mRNA were confirmed by RT-PCR. TdT and Ikaros were also expressed in undifferentiated B-2 cells.

Differentiation into NK cells
When B-2 cells were co-cultured with OP-9 cells under the NK cell differentiation induction conditions in which interleukin 2 (10 ng / ml) was added to the differentiation induction medium, NK1.1 expression was detected by FACS analysis and RT-PCR analysis (FIG. 6).

When B-2 cells in culture under proliferative culture conditions were observed under a microscope, they had a form having unique protrusions (upper left in FIG. 1). For reference, the morphology of granulocytes, erythrocytes, and macrophages (upper right, lower left and lower right in FIG. 1, respectively) is shown. It is a result of FACS analysis by various cell-specific markers of B-2 cells in culture under proliferative culture conditions. The gray part is the result of cells not reacting with an antibody against the marker as a control. It is the result of the FACS analysis by Mac-1, Gr-1, TER119, B220 of the B-2 cell in culture under differentiation induction conditions. The culture period under differentiation-inducing conditions is as shown in the figure. The gray part is the result of cells prior to culture under differentiation-inducing conditions as a control. It is a detection result of mRNA of a marker by RT-PCR of B-2 cells before differentiation induction. B-1, B-3, C-1, and A-6 are separate and independent cell lines obtained in the same manner as B-2. SIL6 / 1 is a cell obtained by culturing A-6 under differentiation-inducing conditions. B-2 cells are co-cultured with OP-9 cells in the presence of interleukin 7 (10 ng / ml), Flt-3 ligand (10 ng / ml) and 2 mercaptoethanol (10 μM) for 30 days to differentiate into B lymphocytes It is the result of having detected expression of mRNA of a marker gene at the time of induction by RT-PCR. Undifferentiated B-2 cells (undifferentiated) and B-2 cells after differentiation induction (differentiation) were compared. B-2 cells were treated with OP-9 cells for 10 days in the presence of interleukin 2 (10 ng / ml), interleukin 7 (10 ng / ml), FLT-3 ligand (10 ng / ml), and 2 mercaptoethanol (100 μM). It is the result of detecting the expression of NK1.1 when co-cultured. The left panel shows the results detected by RT-PCR, and G3PDH was used as an internal control. Undifferentiated were B-2 cells that were not cultured under differentiation-inducing conditions, and bone marrow cells were used as a positive control. The right panel shows the detection of NK1.1 expression by FACS. The gray areas are those without antibody staining as a negative control, and the white areas are those of B-2 cells that have induced differentiation into NK cells. The white area is shifted to the right compared to the gray area.

Claims (10)

  Hematopoietic stem cell line derived from mouse ES cells   A hematopoietic stem cell line derived from mouse ES cells and capable of self-replication in the presence of bFGF.   The hematopoietic stem cell line according to claim 1 or 2, which can differentiate into any of erythrocytes, granulocytes, macrophages, B lymphocytes and NK cells.   During culture under proliferative culture conditions, c-kit, CD34, FMS-like tyrosine kinase 3 / fetal liver kinase 2 (Flt3 / Flk2), PgP-1, heat stable antigen (HSA), GATA2, From PU.1, T cell acute leukemia gene 1 / stem cell leukemia gene (Tal1 / SCL), angiopoietin-1, acute myeloid leukemia gene 1 (AML-1), terminal deoxynucleotidyl transferase (TdT), Ikaros and Vasa The hematopoietic stem cell line according to any one of claims 1 to 3, further characterized in that expression of a gene encoding one or more proteins selected from the group is recognized.   All of c-kit, CD34, Flt3 / Flk2, PgP-1, HSA, GATA2, PU.1, Tal1 / SCL, Angiopoietin-1, AML-1, TdT, Ikaros and Vasa in culture under growth culture conditions The hematopoietic stem cell line according to any one of claims 1 to 4, further characterized in that expression of a gene encoding the protein is recognized.   The hematopoietic stem cell line according to any one of claims 1 to 5, which has a receipt number FERM AP-20276.   A differentiated B lymphocyte obtained by culturing the hematopoietic stem cell line according to any one of claims 1 to 6 under differentiation-inducing conditions.   The B lymphocyte according to claim 7, comprising a B220 gene, a β major globin gene, an Ikaros gene, a λ5 gene, a Rag-1 gene, and a Pax-5 gene as compared with the hematopoietic stem cell line before differentiation induction. B lymphocytes characterized in that expression induction of at least one or more selected genes is observed.   The B lymphocyte according to claim 8, wherein expression induction of all genes of B220 gene, Ikaros gene, λ5 gene, Rag-1 gene and Pax-5 gene is observed.   A method for differentiating the hematopoietic stem cell line according to any one of claims 1 to 6 into B lymphocytes.

Images