JP2006131559A - Nitrogen-containing heterocyclic compound - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To obtain a compound having ACC (acetyl-CaA carboxylase) inhibiting activity, useful for prevention and treatment of obesity, diabetes mellitus, hypertension, hyperlipidemia, cardiac incompetence, diabetic cardiomyopathy, metabolic syndromes, sarcopenia, or the like, and excellent in medicinal effect, working time, specificity, low toxicity, or the like. <P>SOLUTION: This compound is represented by formula (I). [E is a (substituted) cyclic group (excluding a spiro ring, and in the case the cyclic group is a monocyclic group, the cyclic group has at least two (substituted) cyclic groups as the substituting group.), D and G are each independently carbonyl group or sulfonyl group, ring P is a (substituted) nitrogen containing five or six membered non-aromatic heterocyclic ring, ring Q is a (substituted) aromatic ring or a (substituted) non-aromatic ring (containing at least two heteroatoms in the ring), A and L are each independently C, CH or N, J is a (substituted) hydrocarbon group, hydroxy group, a heterocyclic group or amine group.]. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention has an inhibitory action on acetyl-CoA carboxylase (sometimes abbreviated as ACC in the present specification), and is obesity, diabetes, hypertension, hyperlipidemia, heart failure, diabetic cardiomyopathy, metabolic syndrome Further, the present invention relates to a nitrogen-containing heterocyclic compound useful for prevention / treatment of sarcopenia and the like.

  ACC is an enzyme that converts acetyl-CoA to malonyl-CoA and catalyzes a rate-limiting reaction in fatty acid metabolism. Malonyl-CoA, the product of the ACC catalytic reaction, inhibits mitochondrial fatty acid oxidation by feedback inhibition of carnitine palmitoyltransferase-1 (CPT-1). Thus, ACC plays a key role in controlling the balance of carbohydrate and fatty acid utilization in the liver and skeletal muscle, and in controlling insulin sensitivity in the liver, skeletal muscle, and adipose tissue.

  Decreased malonyl-CoA levels due to ACC inhibition are increased fatty acid utilization, decreased secretion of TG-rich lipoprotein (VLDL) by the liver, regulation of insulin secretion by the pancreas, and insulin sensitivity in the liver, skeletal muscle, and adipose tissue Can be improved.

  In addition, chronic administration of a compound having an ACC inhibitory action by promoting fatty acid utilization and suppressing de novo fatty acid synthesis drastically reduces the TG content of liver and adipose tissue in obese subjects consuming a low fat diet, It can selectively reduce body fat.

  Therefore, a compound having an ACC inhibitory action is extremely useful for the prevention and treatment of metabolic syndrome, obesity, hypertension, diabetes, cardiovascular diseases associated with atherosclerosis, and the like.

On the other hand, the following compounds have been reported as nitrogen-containing heterocyclic compounds.
(1) It has a small conductance type Ca ²⁺ -dependent potassium channel blocking action and is useful as a therapeutic agent for gastrointestinal motility dysfunction, learning memory impairment, etc.

[Wherein, ring A represents an optionally substituted benzene ring; R ¹⁰ represents a hydrogen atom or the like; R ² represents a hydrogen atom or an optionally substituted heterocyclic group; B represents N or CH; R ³ represents an optionally substituted amino group, an optionally substituted nitrogen-containing aliphatic heterocyclic group; Y represents CH ₂ or CO. ]
The compound represented by (refer patent document 1).

(2) A compound having an ACC inhibitory effect and useful as a therapeutic agent for metabolic syndrome, arteriosclerosis, diabetes, obesity and the like:

[Wherein, AB represents N—CH and CH—N; K represents (CH ₂ ) _r (r represents an integer of 2-4); m and n each represent an integer of 1-3; D represents CO or SO ₂ ; E represents an optionally substituted 2-4 ring or the like; G represents CO, SO ₂ or CR ⁷ R ⁸ (R ⁷ and R ⁸ each represent a hydrogen atom or the like. J represents OR ¹ , NR ² R ³ , CR ⁴ R ⁵ R ⁶ (R ¹ , R ² , R ³ , R ⁴ , R ⁵ and R ⁶ each represents a hydrogen atom or the like). ]
The compound represented by (refer patent document 2).

(3) It has a tryptase inhibitory action and is useful as a therapeutic agent for inflammatory diseases, myocardial infarction, diabetic retinopathy, etc.

[Wherein, Ar is aryl, heteroaryl (the bonding position of —CR ¹ R ² NH ₂ on Ar is a beta position relative to the bonding position of the containing ring group); R ¹ and R ² are each hydrogen; Atom, lower alkyl; R ³ represents aryl, heteroaryl, etc .; R ⁴ represents a hydrogen atom, acyl, etc .; n represents an integer of 0-4. ]
The compound represented by (refer patent document 3).

(4) Useful as a circulatory organ agent having platelet aggregation inhibitory action, vasodilatory action, antihyperlipidemic action, etc.

[Wherein Ar represents an optionally substituted phenyl, naphthyl, quinolyl, indolyl, etc .; X represents CO, SO ₂ ; Q represents O, a single bond; Z represents C _1-3 alkylene, —C (R ⁵ ) (R ⁶ ) — (R ⁵ and R ⁶ each represents alkyl); R ⁴ represents OH, NH (CH ₂ ) _m COOH (m represents an integer of 1-3). ]
The compound represented by (refer patent document 4).

(5) It has a calmodulin antagonistic action and is useful as a vasodilator, a cerebral circulation improving agent, an angina pectoris, and a blood pressure lowering agent.

[Wherein, R represents a hydrogen atom and lower alkyl; R ¹ and R ² represent a hydrogen atom, respectively; Z represents N (R ³ ) (R ⁴ ) (R ³ and R ⁴ represent a hydrogen atom, A heterocyclic ring (which may be substituted with lower alkyl, acyl, phenyl (which may be substituted with halogen, lower alkyl, etc.), etc.). ]
(Refer patent document 5).

(6) Formula useful as a therapeutic agent for rheumatoid arthritis:

Wherein X ¹ is NH ₂ , OH; X ² is CO, COO, CONH, SO ₂ ; R ¹ is alkyl, optionally substituted aryl, optionally substituted heteroaryl, etc .; R ² is a hydrogen atom, alkyl, optionally substituted aryl; R ³ is alkyl, optionally substituted aryl, optionally substituted heteroaryl, etc., or — (CH ₂ ) _{m ′} -A '(M' represents an integer of 1-4; A 'represents halogen or the like). ]
(Refer patent document 6).

(7) TNF production secretion inhibitory action, retroviral long term repeat transcription activation inhibitory action, useful as a therapeutic agent for septic shock, osteoarthritis, non-insulin dependent diabetes, atherosclerosis, etc. :

[Wherein X ¹ is NH ₂ , OH; X ² is CO, COO, CONH, SO ₂ ; R ¹ is alkyl, optionally substituted aryl, optionally substituted heteroaryl, etc .; R ² is a hydrogen atom, alkyl, optionally substituted aryl; R ³ is alkyl, optionally substituted aryl, optionally substituted heteroaryl, etc., or — (CH ₂ ) _{m ′} -A '(M' represents an integer of 1-4; A 'represents halogen or the like), and R ² and R ³ represent an optionally substituted quinazoline or an optionally substituted pyridopyrimidine together with a pyrimidine ring. It may be formed. ]
(Refer to patent documents 7 and 8).

JP 2003-252871 A (Pamphlet of International Publication No. 02/79189) International Publication No. 03/072197 Pamphlet International Publication No. 01/90101 Pamphlet International Publication No. 93/12086 Pamphlet Japanese Patent Laid-Open No. 2-184681 JP 2003-95951 A US Pat. No. 5,948,786 International Publication No. 97/38992 Pamphlet

  However, there are no reports on the compounds of the present invention.

  Has ACC inhibitory action, is useful for prevention and treatment of obesity, diabetes, hypertension, hyperlipidemia, heart failure, diabetic cardiomyopathy, metabolic syndrome, sarcopenia, etc. Development of a compound having excellent properties in terms of properties and low toxicity is desired.

  The present inventors have a chemical structure characterized by a cyclic amine to which an aromatic ring or a non-aromatic heterocycle containing two or more heteroatoms is bonded.

[Where:
E represents an optionally substituted cyclic group (provided that the cyclic group is not a spirocyclic group. When the cyclic group is a monocyclic group, the cyclic group may be substituted as a substituent. Having at least two good cyclic groups);
D and G independently represent a carbonyl group or a sulfonyl group;
Ring P represents an optionally substituted nitrogen-containing 5- or 6-membered non-aromatic heterocyclic ring;
Ring Q is an optionally substituted aromatic ring or an optionally substituted non-aromatic heterocycle (wherein the non-aromatic heterocycle contains 2 or more heteroatoms);
A and L independently represent C, CH or N;
J represents a hydrocarbon group which may be substituted, a hydroxy group which may be substituted, a heterocyclic group which may be substituted or an amino group which may be substituted. ]
Or a salt thereof (excluding “4- [1- (9-anthrylcarbonyl) piperidin-4-yl] -2- (morpholin-4-ylcarbonyl) morpholine”) [hereinafter, a compound Sometimes referred to as (I). For the first time, it has an excellent ACC inhibitory action and is useful for the prevention and treatment of obesity, diabetes, hypertension, hyperlipidemia, heart failure, diabetic cardiomyopathy, metabolic syndrome, sarcopenia, etc. I found it. Based on this knowledge, the present inventors have conducted intensive studies and completed the present invention. That is, the present invention
(1) Compound (I);
(2) Compound (I), wherein E is an optionally substituted aromatic ring group;
(3) prodrugs of compound (I);
(4) A medicament comprising compound (I) or a prodrug thereof;
(5) An acetyl-CoA carboxylase inhibitor comprising compound (I) or a prodrug thereof;
(6) The medicament according to (4), which is a prophylactic / therapeutic agent for obesity, diabetes, hypertension, hyperlipidemia, heart failure, diabetic cardiomyopathy, metabolic syndrome or sarcopenia;
And so on.

  The compound of the present invention has an ACC inhibitory action and is useful for the prevention and treatment of obesity, diabetes, hypertension, hyperlipidemia, heart failure, diabetic cardiomyopathy, metabolic syndrome, sarcopenia and the like.

Hereinafter, the definition of each symbol in formula (I) will be described in detail.
In the present specification, “halogen atom” means fluorine, chlorine, bromine and iodine unless otherwise specified.
Examples of the “hydrocarbon group” of the “optionally substituted hydrocarbon group” represented by J include C _1-10 alkyl group, C _2-10 alkenyl group, C _2-10 alkynyl group, C _{3− 10} cycloalkyl group, C _3-10 cycloalkenyl group, C _4-10 cycloalkadienyl group, C _6-14 aromatic hydrocarbon group, C _7-13 aralkyl group, C _8-13 aromatic hydrocarbon alkenyl group And C _3-10 cycloalkyl-C _1-6 alkyl group.

Here, examples of the C _1-10 alkyl group include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, 1-ethylpropyl, hexyl, isohexyl, 1 , 1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 2-ethylbutyl, heptyl, octyl, nonyl, decyl and the like.
Examples of the C _2-10 alkenyl group include ethenyl, 1-propenyl, 2-propenyl, 2-methyl-1-propenyl, 1-butenyl, 2-butenyl, 3-butenyl, 3-methyl-2-butenyl, 1 -Pentenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl, 4-methyl-3-pentenyl, 1-hexenyl, 3-hexenyl, 5-hexenyl, 1-heptenyl, 1-octenyl and the like can be mentioned.
Examples of the C _2-10 alkynyl group include ethynyl, 1-propynyl, 2-propynyl, 1-butynyl, 2-butynyl, 3-butynyl, 1-pentynyl, 2-pentynyl, 3-pentynyl, 4-pentynyl, 1 -Hexynyl, 2-hexynyl, 3-hexynyl, 4-hexynyl, 5-hexynyl, 1-heptynyl, 1-octynyl and the like.

Examples of the C _3-10 cycloalkyl group include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, bicyclo [2.2.1] heptyl, bicyclo [2.2.2] octyl, and bicyclo [3. 2.1] octyl, bicyclo [3.2.2] nonyl, bicyclo [3.3.1] nonyl, bicyclo [4.2.1] nonyl, bicyclo [4.3.1] decyl, adamantyl and the like. Can be mentioned.
Examples of the C _3-10 cycloalkenyl group include 2-cyclopenten-1-yl, 3-cyclopenten-1-yl, 2-cyclohexen-1-yl, 3-cyclohexen-1-yl and the like.
Examples of the C _4-10 cycloalkadienyl group include 2,4-cyclopentadien-1-yl, 2,4-cyclohexadien-1-yl, 2,5-cyclohexadien-1-yl, and the like. .
Examples of the C _6-14 aromatic hydrocarbon group include phenyl, naphthyl, anthryl, phenanthryl, acenaphthylenyl, biphenylyl and the like. Of these, phenyl, 1-naphthyl, 2-naphthyl and the like are preferable.
Examples of the C _7-13 aralkyl group include benzyl, phenethyl, naphthylmethyl, biphenylylmethyl and the like.
Examples of the C _8-13 aromatic hydrocarbon alkenyl group include styryl and the like.
Examples of the C _3-10 cycloalkyl-C _1-6 alkyl group include cyclohexylmethyl and the like.

Wherein the C _1-10 alkyl group, C _2-10 alkenyl and C _2-10 alkynyl group may have 1 to 3 substituents at substitutable positions.
As such a substituent, for example,
(1) C _3-10 cycloalkyl group (eg, cyclopropyl, cyclohexyl);
(2) C _1-6 alkyl group (eg, methyl, ethyl) optionally substituted with 1 to 3 halogen atoms, hydroxy group, C _1-6 alkoxy group (eg, methoxy, ethoxy) and halogen atom A C _6-14 aromatic hydrocarbon group (eg, phenyl, naphthyl) _optionally substituted by 1 to 3 substituents selected from:
(3) C _1-6 alkyl group (eg, methyl, ethyl) optionally substituted with 1 to 3 halogen atoms, hydroxy group, C _1-6 alkoxy group (eg, methoxy, ethoxy) and halogen atom An aromatic heterocyclic group which may be substituted with 1 to 3 substituents selected from (for example, thienyl, furyl, pyridyl, oxazolyl, thiazolyl, tetrazolyl, oxadiazolyl, pyrazinyl, quinolyl, indolyl);
(4) C _1-6 alkyl group (eg, methyl, ethyl) optionally substituted with 1 to 3 halogen atoms, hydroxy group, C _1-6 alkoxy group (eg, methoxy, ethoxy), oxo group And a non-aromatic heterocyclic group optionally substituted with 1 to 3 substituents selected from halogen atoms (eg, tetrahydrofuryl, morpholinyl, thiomorpholinyl, piperidinyl, pyrrolidinyl, piperazinyl, dioxolyl, dioxolanyl, 1,3- Dihydro-2-benzofuranyl, thiazolidienyl);
(5) C _1-6 alkyl group (eg, methyl, ethyl), C _1-6 alkyl-carbonyl group (eg, acetyl, isobutanoyl, isopentanoyl) and C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl) Amino group optionally mono- or di-substituted with a substituent selected from ethoxycarbonyl, propoxycarbonyl, tert-butoxycarbonyl);
(6) C _1-6 alkylsulfonylamino group (eg, methylsulfonylamino);
(7) amidino group;
(8) a C _1-6 alkyl-carbonyl group (eg, acetyl, isobutanoyl, isopentanoyl) optionally substituted by 1 to 3 halogen atoms;
(9) a C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, tert-butoxycarbonyl) optionally substituted by 1 to 3 halogen atoms;
(10) a C _1-6 alkylsulfonyl group (eg, methylsulfonyl) optionally substituted by 1 to 3 halogen atoms;
(11) a carbamoyl group which may be mono- or di-substituted with a C _1-6 alkyl group (eg, methyl, ethyl) optionally substituted with 1 to 3 halogen atoms;
(12) a thiocarbamoyl group optionally mono- or disubstituted with a C _1-6 alkyl group (eg, methyl, ethyl) optionally substituted with 1 to 3 halogen atoms;
(13) a sulfamoyl group optionally mono- or disubstituted with a C _1-6 alkyl group (eg, methyl, ethyl) optionally substituted with 1 to 3 halogen atoms;
(14) carboxyl group;
(15) hydroxy group;
(16) a C _1-6 alkoxy group (eg, methoxy, ethoxy) optionally substituted with 1 to 3 halogen atoms;
(17) a C _2-6 alkenyloxy group (eg, ethenyloxy) optionally substituted by 1 to 3 halogen atoms;
(18) C _3-10 cycloalkyloxy group (eg, cyclohexyloxy);
(19) C _7-13 aralkyloxy group (eg, benzyloxy);
(20) C _6-14 aromatic hydrocarbon oxy group (eg, phenyloxy, naphthyloxy);
(21) C _1-6 alkyl-carbonyloxy group (eg, acetyloxy, tert-butylcarbonyloxy);
(22) a thiol group;
(23) a C _1-6 alkylthio group (eg, methylthio, ethylthio) optionally substituted by 1 to 3 halogen atoms;
(24) C _7-13 aralkylthio group (e.g., benzylthio);
(25) C _6-14 aromatic hydrocarbon thio group (eg, phenylthio, naphthylthio);
(26) a sulfo group;
(27) a cyano group;
(28) an azido group;
(29) a nitro group;
(30) Nitroso group;
(31) a halogen atom;
(32) C _1-6 alkylsulfinyl group (eg, methylsulfinyl);
Etc.

In addition, the C _3-10 cycloalkyl group, the C _3-10 cycloalkenyl group, the C _4-10 cycloalkadienyl group, the C _6-14 aromatic hydrocarbon group, the C ₇ exemplified as the “hydrocarbon group”. _-13 aralkyl group, C _8-13 aromatic hydrocarbon alkenyl group and C _3-10 cycloalkyl-C _1-6 alkyl group may have 1 to 3 substituents at substitutable positions. .
As such a substituent, for example,
(1) Substituents exemplified as substituents in the aforementioned C _1-10 alkyl group and the like;
(2) a halogen atom, a carboxyl group, C _1-6 alkoxy - carbonyl group (e.g., methoxycarbonyl, ethoxycarbonyl) to 1 selected from and carbamoyl groups optionally substituted with 1-3 substituents C _1-6 An alkyl group (eg, methyl, ethyl);
(3) C _2-6 optionally substituted by 1 to 3 substituents selected from a halogen atom, a carboxyl group, a C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl) and a carbamoyl group An alkenyl group (eg, ethenyl, 1-propenyl);
(4) substituted with 1 to 3 substituents selected from a C _1-6 alkyl group, a hydroxy group, a C _1-6 alkoxy group and a halogen atom which may be substituted with 1 to 3 halogen atoms An _optionally substituted C _7-13 aralkyl group (eg, benzyl);
(5) an oxo group;
Etc.

Examples of the “optionally substituted hydroxy group” represented by J include, for example, a C _1-10 alkyl group, a C _2-10 alkenyl group, a C _3-10 cycloalkyl group, C _3-10 cycloalkenyl group, C _6-14 aromatic hydrocarbon group, C _7-13 aralkyl group, C _8-13 aromatic hydrocarbon alkenyl group, C _1-6 alkyl-carbonyl group (eg, acetyl, isobutanoyl, An isopentanoyl), a 5- or 6-membered aromatic heterocyclic group, a hydroxy group which may be substituted with a substituent selected from a condensed aromatic heterocyclic group and the like.
Here, C _1-10 alkyl group, C _2-10 alkenyl group, C _3-10 cycloalkyl group, C _3-10 cycloalkenyl group, C _6-14 aromatic hydrocarbon group, C _7-13 aralkyl group and Examples of the C _8-13 aromatic hydrocarbon alkenyl group include those exemplified as the “hydrocarbon group” in the “optionally substituted hydrocarbon group” represented by J above.
Examples of the 5- or 6-membered aromatic heterocyclic group include 5 or 6 of the “aromatic heterocyclic group” exemplified as the “heterocyclic group” in the “optionally substituted heterocyclic group” represented by J described later. What is a member ring group is mentioned. Of these, furyl, thienyl, thiazolyl, oxazolyl, imidazolyl, triazolyl, pyrazolyl, pyrimidinyl and the like are preferable.
The condensed aromatic heterocyclic group is a condensed ring group among the “aromatic heterocyclic groups” exemplified as the “heterocyclic group” in the “optionally substituted heterocyclic group” represented by J described later. Is mentioned. Of these, indolyl and the like are preferable.

The C _1-10 alkyl group, C _2-10 alkenyl group, C _3-10 cycloalkyl group, C _3-10 cycloalkenyl group, C _6-14 aromatic hydrocarbon group, C _7-13 aralkyl group, C _{8 -13} aromatic hydrocarbon alkenyl group, C _1-6 alkyl-carbonyl group, 5- or 6-membered aromatic heterocyclic group and condensed aromatic heterocyclic group each have 1 to 3 substituents at substitutable positions. You may have. As such a substituent, for example,
(1) a halogen atom;
(2) hydroxy group;
(3) a cyano group;
(4) C ₁ which may be substituted with one or two substituents selected from a halogen atom, a carboxyl group, a C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl, tert-butoxycarbonyl) and a carbamoyl group _-6 alkyl groups;
(5) a C _1-6 alkoxy group which may be substituted with one or two substituents selected from a halogen atom, a carboxyl group and a C _1-6 alkoxy-carbonyl group (eg, tert-butoxycarbonyl);
(6) C _1-6 alkylthio group (eg, methylthio, ethylthio);
(7) C _1-6 alkyl-carbonyl group (eg, acetyl, isobutanoyl, isopentanoyl);
(8) carboxyl group;
(9) C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl);
(10) a carbamoyl group which may be mono- or di-substituted with a C _1-10 alkyl group (eg, methyl, ethyl, propyl, isopropyl, neopentyl);
(11) an amino group which may be mono- or di-substituted with a C _1-10 alkyl group (eg, methyl, ethyl, propyl, isopropyl, neopentyl);
(12) a C _1-6 alkyl-carbonylamino group (eg, acetylamino);
(13) 1 to 3 substituents selected from a C _1-6 alkyl group (eg, methyl, ethyl), a carboxyl group, a C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl) and a carbamoyl group An aromatic heterocyclic group optionally substituted by (eg, furyl, thienyl, oxazolyl, thiazolyl, isoxazolyl, tetrazolyl, oxadiazolyl, thiadiazolyl, pyridyl);
(14) a C _1-6 alkylsulfinyl group (eg, methylsulfinyl);
(15) C _1-6 alkylsulfonyl group (eg, methylsulfonyl);
Etc.

Examples of the “heterocyclic group” in the “optionally substituted heterocyclic group” represented by J include “aromatic heterocyclic group” and “non-aromatic heterocyclic group”.
Examples of the aromatic heterocyclic group include 5- to 7-membered monocyclic aromatic heterocycles containing 1 to 4 heteroatoms selected from oxygen atoms, sulfur atoms and nitrogen atoms in addition to carbon atoms as ring constituent atoms. Examples thereof include a cyclic group and a condensed aromatic heterocyclic group. Examples of the condensed aromatic heterocyclic group include these 5- to 7-membered monocyclic aromatic heterocyclic groups, 5- or 6-membered rings containing 1 to 2 nitrogen atoms, and 1 sulfur atom. And a group in which one or two 5-membered rings or benzene rings are condensed.
As preferable examples of the aromatic heterocyclic group,
Furyl (eg, 2-furyl, 3-furyl), thienyl (eg, 2-thienyl, 3-thienyl), pyridyl (eg, 2-pyridyl, 3-pyridyl, 4-pyridyl), pyrimidinyl (eg, 2-pyrimidinyl) 4-pyrimidinyl, 5-pyrimidinyl, 6-pyrimidinyl), pyridazinyl (eg, 3-pyridazinyl, 4-pyridazinyl), pyrazinyl (eg, 2-pyrazinyl), pyrrolyl (eg, 1-pyrrolyl, 2-pyrrolyl, 3- Pyrrolyl), imidazolyl (eg, 1-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl), pyrazolyl (eg, 1-pyrazolyl, 3-pyrazolyl, 4-pyrazolyl), thiazolyl (eg, 2-thiazolyl, 4 -Thiazolyl, 5-thiazolyl), isothiazolyl (eg, 4-isothiazolyl), oxazolyl (eg, 2) Oxazolyl, 4-oxazolyl, 5-oxazolyl), isoxazolyl, oxadiazolyl (eg, 1,2,4-oxadiazol-5-yl, 1,3,4-oxadiazol-2-yl), thiadiazolyl (eg, 1,3,4-thiadiazol-2-yl), triazolyl (eg, 1,2,4-triazol-1-yl, 1,2,4-triazol-3-yl, 1,2,3-triazole-1) -Yl, 1,2,3-triazol-2-yl, 1,2,3-triazol-4-yl), tetrazolyl (eg, tetrazol-1-yl, tetrazol-5-yl), triazinyl (eg, 1 , 2,4-triazol-1-yl, 1,2,4-triazol-3-yl) and the like;
Quinolyl (eg, 2-quinolyl, 3-quinolyl, 4-quinolyl, 6-quinolyl), isoquinolyl (eg, 3-isoquinolyl), quinazolyl (eg, 2-quinazolyl, 4-quinazolyl), quinoxalyl (eg, 2-quinoxalyl) , 6-quinoxalyl), benzofuryl (eg, 2-benzofuryl, 3-benzofuryl), benzothienyl (eg, 2-benzothienyl, 3-benzothienyl), benzoxazolyl (eg, 2-benzoxazolyl), Benzisoxazolyl (eg, 7-benzisoxazolyl), benzothiazolyl (eg, 2-benzothiazolyl), benzimidazolyl (eg, benzimidazol-1-yl, benzimidazol-2-yl, benzimidazol-5- Yl), benzotriazolyl (eg, 1H-1,2,3-benzotriazole- -Yl), indolyl (eg, indol-1-yl, indol-2-yl, indol-3-yl, indol-5-yl), indazolyl (eg, 1H-indazol-3-yl), pyrrolopyrazinyl (eg, 1H-pyrrolo [2,3-b] pyrazin-2-yl, 1H-pyrrolo [2,3-b] pyrazin-6-yl), imidazopyridinyl (eg, 1H-imidazo [4,5-b] Pyridin-2-yl, 1H-imidazo [4,5-c] pyridin-2-yl, 2H-imidazo [1,2-a] pyridin-3-yl), imidazopyrazinyl (eg, 1H-imidazo [ 4,5-b] pyrazin-2-yl), pyrazolopyridinyl (eg, 1H-pyrazolo [4,3-c] pyridin-3-yl), pyrazolothienyl (eg, 2H-pyrazolo [3,4- b] Thiophen-2-yl), pyrazolotriazinyl (eg, pyrazolo [5,1-c] [1,2,4] triazin-3-yl) Aromatic heterocyclic group; and the like.

Examples of the non-aromatic heterocyclic group include a 5- to 7-membered monocyclic non-aromatic group containing 1 to 4 heteroatoms selected from an oxygen atom, a sulfur atom and a nitrogen atom in addition to a carbon atom as a ring-constituting atom. Examples include heterocyclic groups and fused non-aromatic heterocyclic groups. Examples of the fused non-aromatic heterocyclic group include these 5- to 7-membered monocyclic non-aromatic heterocyclic groups, 5- or 6-membered rings containing 1 to 2 nitrogen atoms, and one sulfur atom. And groups having 1 to 2 condensed 5-membered rings or benzene rings.
Suitable examples of the non-aromatic heterocyclic group include pyrrolidinyl (eg, 1-pyrrolidinyl), piperidinyl (eg, piperidino), morpholinyl (eg, morpholino), thiomorpholinyl (eg, thiomorpholino), piperazinyl (eg, 1-pyrrolidinyl). Piperazinyl), hexamethyleneiminyl (eg, hexamethyleneimin-1-yl), oxazolidinyl (eg, oxazolidine-3-yl), thiazolidinyl (eg, thiazolidin-3-yl), imidazolidinyl (eg, imidazolidin-3- Yl), dihydroisoindolyl (eg, 1,3-dihydro-2H-isoindol-2-yl), dioxolyl (eg, 1,3-dioxol-4-yl), dioxolanyl (eg, 1,3-dioxolane) -4-yl), dihydrooxadiazolyl (eg, 4,5-dihydro-1,2,4- Oxadiazol-3-yl), 2-thioxo-1,3-oxazolidine-5-yl, tetrahydropyranyl (eg, 4-tetrahydropyranyl), 4,5,6,7-tetrahydro-1-benzofuranyl (eg, 4,5,6,7-tetrahydro-1-benzofuran-3-yl), indanyl (eg, indan-5-yl), chromenyl (eg, 4H-chromen-2-yl, 2H-chromen-3-yl) , Dihydroisoquinolinyl (eg, 1,2-dihydroisoquinolin-4-yl), tetrahydroisoquinolinyl (eg, 1,2,3,4-tetrahydroisoquinolin-4-yl), dihydrophthalazinyl ( Examples, 1,4-dihydrophthalazin-4-yl), pyrazolidinyl (eg, pyrazolidin-1-yl), tetrahydroquinolinyl (eg, 1,2,3,4-tetrahydro) Quinolin-4-yl) and the like.
The “heterocyclic group” in the “optionally substituted heterocyclic group” represented by J may have 1 to 3 substituents at substitutable positions. Examples of such a substituent include a substituent that the C _3-10 cycloalkyl group exemplified as the “hydrocarbon group” of the “optionally substituted hydrocarbon group” represented by J may have. What was illustrated as a group is mentioned.
The “optionally substituted heterocyclic group” represented by J is 1 selected from a C _1-6 alkyl group and a C _3-10 cycloalkyl group _optionally substituted with 1 to 3 halogen atoms. Or a nitrogen-containing non-aromatic heterocyclic group (eg, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl) which may be substituted with two substituents, etc. Is preferred.

Examples of the “optionally substituted amino group” represented by J include a C _1-10 alkyl group, a C _2-10 alkenyl group, a C _3-10 cycloalkyl group, C Substituted with 1 or 2 substituents selected from _3-10 cycloalkenyl group, C _6-14 aromatic hydrocarbon group, C _7-13 aralkyl group, C _8-13 aromatic hydrocarbon alkenyl group, etc. A good amino group can be mentioned.
Here, C _1-10 alkyl group, C _2-10 alkenyl group, C _3-10 cycloalkyl group, C _3-10 cycloalkenyl group, C _6-14 aromatic hydrocarbon group, C _7-13 aralkyl group and Examples of the C _8-13 aromatic hydrocarbon alkenyl group include those exemplified as the “hydrocarbon group” in the “optionally substituted hydrocarbon group” represented by J above.

These C _1-10 alkyl group, C _2-10 alkenyl group, C _3-10 cycloalkyl group, C _3-10 cycloalkenyl group, C _6-14 aromatic hydrocarbon group, C _7-13 aralkyl group and C _{8 The -13} aromatic hydrocarbon alkenyl group may have 1 to 3 substituents at substitutable positions. As such a substituent, for example,
A halogen atom;
A C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl);
A C _1-6 alkyl-carbonyl group;
A cyano group;
A carbamoyl group optionally mono- or disubstituted with a C _1-10 alkyl group (eg, methyl, ethyl, propyl, isopropyl, neopentyl);
A hydroxy group;
Carboxyl group;
Etc.

The “optionally substituted amino group” represented by J is preferably a C _1-6 alkyl group (eg, methyl, ethyl, propyl, isopropyl) optionally substituted with 1 to 3 halogen atoms. And an amino group which may be mono- or di-substituted with a substituent selected from a C _3-10 cycloalkyl group (eg, cyclopentyl, cyclohexyl, adamantyl).

J is preferably an “optionally substituted amino group” and an “optionally substituted heterocyclic group”.
1) an amino group which may be mono- or di-substituted with a substituent selected from a C _1-6 alkyl group and a C _3-10 cycloalkyl group which may be substituted with 1 to 3 halogen atoms;
2) A nitrogen-containing non-substituted group optionally substituted with 1 or 2 substituents selected from a C _1-6 alkyl group and a C _3-10 cycloalkyl group optionally substituted with 1 to 3 halogen atoms Aromatic heterocyclic groups (eg, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl) and the like are preferable.

  Examples of the “cyclic group” in the “optionally substituted cyclic group” represented by E include an aromatic hydrocarbon group, a non-aromatic cyclic hydrocarbon group, a heterocyclic group, and the like.

Examples of the aromatic hydrocarbon group include C _6-14 aromatic hydrocarbon groups. Here, the C _6-14 aromatic hydrocarbon group, such as exemplified C _6-14 aromatic hydrocarbon group as "hydrocarbon group" of the "optionally substituted hydrocarbon group" represented by J Is mentioned. As the C _6-14 aromatic hydrocarbon group, anthryl (eg, 9-anthryl), naphthyl (eg, 1-naphthyl, 2-naphthyl) and the like are preferable.

Examples of the non-aromatic cyclic hydrocarbon group include a C _3-10 cycloalkyl group, a C _3-10 cycloalkenyl group, and a C _4-10 cycloalkadienyl group, which may be condensed with a benzene ring, respectively. Can be mentioned. Here, the C _3-10 cycloalkyl group, the C _3-10 cycloalkenyl group, and the C _4-10 cycloalkadienyl group are each represented by the “optionally substituted hydrocarbon group” represented by J above. What was illustrated as a "hydrocarbon group" is mentioned.
Non-aromatic cyclic hydrocarbon groups include indanyl (eg, 1-indanyl), tetrahydronaphthyl (eg, 1,2,3,4-tetrahydronaphthalen-1-yl), fluorenyl (eg, 9-fluorenyl) and the like. Can be mentioned.

  Examples of the heterocyclic group include those exemplified as the “heterocyclic group” in the “heterocyclic group optionally having substituents” represented by J.

  The “cyclic group” in the “optionally substituted cyclic group” represented by E does not include a spiro ring group.

The “cyclic group” in the “optionally substituted cyclic group” represented by E is preferably an aromatic ring group (aromatic hydrocarbon group, aromatic heterocyclic group).
Anthryl, naphthyl, pyridyl, pyrimidinyl, thiazolyl, isothiazolyl, quinolyl, isoquinolyl, quinoxalyl, benzofuranyl, benzisoxazolyl, benzimidazolyl, benzotriazolyl, indolyl, imidazopyridinyl, pyrazolopyridinyl, pyrazolothienyl, pyra Zolotriazinyl and the like are preferable.

The “cyclic group” in the “optionally substituted cyclic group” represented by E may have 1 to 3 substituents at substitutable positions.
As such a substituent, for example, the substituent that the C _3-10 cycloalkyl group exemplified as the “hydrocarbon group” in the “optionally substituted hydrocarbon group” represented by J may have What was illustrated as a group is mentioned.

The substituent is preferably (1) a C _1-6 alkyl group (eg, methyl, ethyl, isopropyl) optionally substituted with 1 to 3 halogen atoms;
(2) hydroxy group;
(3) a C _1-6 alkoxy group (eg, methoxy, ethoxy) optionally substituted by 1 to 3 halogen atoms;
(4) C _3-10 cycloalkyl group (eg, cyclohexyl);
(5) halogen atom;
(6) C _1-6 alkyl group (eg, methyl, ethyl) optionally substituted with 1 to 3 halogen atoms, hydroxy group, C _1-6 alkoxy group (eg, methoxy, ethoxy) and halogen atom A C _6-14 aromatic hydrocarbon group (eg, phenyl) _optionally substituted with 1 to 3 substituents selected from:
(7) C _1-6 alkyl group (eg, methyl, ethyl) optionally substituted with 1 to 3 halogen atoms, hydroxy group, C _1-6 alkoxy group (eg, methoxy, ethoxy) and halogen atom A C _7-13 aralkyl group (eg, benzyl) _optionally substituted by 1 to 3 substituents selected from:
(8) C _1-6 alkyl group (eg, methyl, ethyl) optionally substituted with 1 to 3 halogen atoms, hydroxy group, C _1-6 alkoxy group (eg, methoxy, ethoxy) and halogen atom An aromatic heterocyclic group (eg, pyridyl, thienyl, furyl) optionally substituted by 1 to 3 substituents selected from:
Etc.

When the “cyclic group” of the “optionally substituted cyclic group” represented by E is a monocyclic group, it has at least two optionally substituted cyclic groups. The “cyclic group” of the “optionally substituted cyclic group” as the substituent and the substituent include the “cyclic group” of the “optionally substituted cyclic group” and the “ Examples of the substituent of the “cyclic group” include the substituents exemplified above.
E is preferably
(1) pyridyl having at least two substituents selected from C _6-14 aromatic hydrocarbon groups (preferably phenyl);
(2) C _1-6 alkyl group _optionally substituted with 1 to 3 halogen atoms (eg, methyl, ethyl, isopropyl), C _{1- optionally} substituted with 1 to 3 halogen atoms ₆ anthryl or naphthyl optionally substituted with 1 to 3 substituents selected from alkoxy groups (eg, methoxy, ethoxy) and halogen atoms; or (3) i) substituted with 1 to 3 halogen atoms An optionally substituted C _1-6 alkyl group (eg, methyl, ethyl, isopropyl), ii) a hydroxy group, iii) a C _1-6 alkoxy group optionally substituted with 1 to 3 halogen atoms (eg, , Methoxy, ethoxy), halogen atom, C _1-6 alkyl group optionally substituted with 1 to 3 halogen atoms (eg, methyl, ethyl), hydroxy group, C _1-6 alkoxy group (eg, methoxy) , Ethoxy) 1 to 3 substituents C _6-14 aromatic substituted with optionally substituted hydrocarbon group selected from finely halogen atom (e.g., phenyl) and vi) optionally substituted with 1 to 3 halogen atoms It may be substituted with 1 to 3 substituents selected from a good C _1-6 alkyl group (eg, methyl, ethyl), a hydroxy group, a C _1-6 alkoxy group (eg, methoxy, ethoxy) and a halogen atom. Quinolyl, isoquinolyl, quinoxalyl, benzofuryl, benzisoxazolyl, benz, each of which may be substituted with 1 to 3 substituents selected from good aromatic heterocyclic groups (eg, pyridyl, thienyl, furyl), etc. And imidazolyl, benzotriazolyl, indolyl, imidazolpyridinyl, pyrazolopyridinyl or pyrazolothienyl.

  Ring P is an “optionally substituted nitrogen-containing 5- or 6-membered non-aromatic heterocyclic ring”, and the “nitrogen-containing 5- or 6-membered non-aromatic heterocyclic ring” includes a nitrogen atom that is a constituent atom thereof. In addition to being substituted with ED-, it may be further substituted. Examples of the “nitrogen-containing 5- or 6-membered non-aromatic heterocycle” in the “optionally substituted nitrogen-containing 5- or 6-membered non-aromatic heterocycle” include, for example, at least one ring atom other than a carbon atom. 5 or 6-membered monocyclic non-aromatic heterocycle and condensed non-aromatic heterocycle, which may further contain 1 to 2 heteroatoms selected from oxygen, sulfur and nitrogen atoms A ring is mentioned. Examples of the fused non-aromatic heterocycle include, for example, these 5- or 6-membered monocyclic non-aromatic heterocycles, 6-membered rings containing 1 to 2 nitrogen atoms, and 5-membered members containing 1 sulfur atom. Examples thereof include a ring or a ring condensed with a benzene ring.

  Suitable examples of the “nitrogen-containing 5- or 6-membered non-aromatic heterocycle” include pyrrolidine, piperidine, morpholine, thiomorpholine, piperazine, oxazolidine, thiazolidine, imidazolidine, oxazolidine, thiazolidine, dihydroisoindole, oxadiazole Among them, piperidine, piperazine and the like are preferable.

In the “optionally substituted nitrogen-containing 5- or 6-membered non-aromatic heterocycle” represented by ring P, 1 to 3 “nitrogen-containing 5- or 6-membered non-aromatic heterocycle” are substituted at substitutable positions ( It may preferably have 1 or 2 substituents. Examples of such a substituent include those exemplified as the substituent in the C _3-10 cycloalkyl group exemplified as the “hydrocarbon group” in the “optionally substituted hydrocarbon group” represented by J above. Can be mentioned.

  As the ring P, piperidine, piperazine and the like are preferable.

  Ring Q is an “optionally substituted aromatic ring” or “optionally substituted non-aromatic heterocyclic ring” formed together with A and L, and the “aromatic ring” and the The “non-aromatic heterocyclic ring” may be further substituted in addition to the fact that L as the ring-constituting group is substituted with JG-.

Examples of the “aromatic ring” in the “optionally substituted aromatic ring” include aromatic hydrocarbons and aromatic heterocycles. Here, as the aromatic hydrocarbon and aromatic heterocycle, the “aromatic hydrocarbon group” exemplified as “cyclic group” in the “optionally substituted cyclic group” represented by E, and represented by J above Rings respectively corresponding to the “aromatic heterocyclic group” exemplified as the “heterocyclic group” in the “heterocyclic group optionally having substituents” mentioned above.
As the “aromatic ring” in the “optionally substituted aromatic ring” represented by ring Q, benzene and the like are preferable.

  Examples of the “non-aromatic heterocyclic ring” in the “optionally substituted non-aromatic heterocyclic ring” include, for example, the “heterocyclic group” in the “optionally substituted heterocyclic group” represented by J above. Examples of the ring corresponding to the exemplified “non-aromatic heterocyclic group” include those containing two or more heteroatoms, such as morpholine, thiomorpholine, piperazine, oxazolidine, thiazolidine, imidazolidine, oxazolidine, thiazolidine, etc. Is mentioned.

  As the “non-aromatic heterocycle” in the “optionally substituted non-aromatic heterocycle” represented by ring Q, morpholine, piperazine and the like are preferable.

The “aromatic ring” in the “optionally substituted aromatic ring” represented by the ring Q and the “non-aromatic ring heterocycle” in the “optionally substituted non-aromatic ring heterocycle” have 1 at the substitutable position. Or may have 3 substituents.
Examples of such a substituent include those exemplified as the substituent in the C _3-10 cycloalkyl group exemplified as the “hydrocarbon group” in the “optionally substituted hydrocarbon group” represented by J above. Can be mentioned.
The substituent is preferably a C _1-6 alkyl-carbonyl group (eg, acetyl, isobutanoyl, isopentanoyl) which may be substituted with 1 to 3 halogen atoms.

Ring Q is preferably morpholine, piperazine, benzene, or the like, each of which may be substituted with a C _1-6 alkyl-carbonyl group which may be substituted with 1 to 3 halogen atoms.

As A, N and C are preferable.
L is preferably CH or C.
G is preferably a carbonyl group.
D is preferably a carbonyl group.

  Compound (I) does not include “4- [1- (9-anthrylcarbonyl) piperidin-4-yl] -2- (morpholin-4-ylcarbonyl) morpholine”.

Preferable examples of compound (I) include the following compounds.
E
(1) pyridyl having at least two substituents selected from C _6-14 aromatic hydrocarbon groups (preferably phenyl);
(2) C _1-6 alkyl group _optionally substituted with 1 to 3 halogen atoms (eg, methyl, ethyl, isopropyl), C _{1- optionally} substituted with 1 to 3 halogen atoms ₆ anthryl or naphthyl optionally substituted with 1 to 3 substituents selected from alkoxy groups (eg, methoxy, ethoxy) and halogen atoms; or (3) i) substituted with 1 to 3 halogen atoms An optionally substituted C _1-6 alkyl group (eg, methyl, ethyl, isopropyl), ii) a hydroxy group, iii) a C _1-6 alkoxy group optionally substituted with 1 to 3 halogen atoms (eg, , Methoxy, ethoxy), halogen atom, C _1-6 alkyl group optionally substituted with 1 to 3 halogen atoms (eg, methyl, ethyl), hydroxy group, C _1-6 alkoxy group (eg, methoxy) , Ethoxy) 1 to 3 substituents C _6-14 aromatic substituted with optionally substituted hydrocarbon group selected from finely halogen atom (e.g., phenyl) and vi) optionally substituted with 1 to 3 halogen atoms It may be substituted with 1 to 3 substituents selected from a good C _1-6 alkyl group (eg, methyl, ethyl), a hydroxy group, a C _1-6 alkoxy group (eg, methoxy, ethoxy) and a halogen atom. Quinolyl, isoquinolyl, quinoxalyl, benzofuryl, benzisoxazolyl, benzimidazolyl, each optionally substituted with 1 to 3 substituents selected from a good aromatic heterocyclic group (eg, pyridyl, thienyl, furyl) , Benzotriazolyl, indolyl, imidazopyridinyl, pyrazolopyridinyl or pyrazolothienyl;
D is a carbonyl group;
G is a carbonyl group;
Ring P is piperidine or piperazine;
Morpholine, piperazine or benzene, wherein ring Q is each optionally substituted with a C _1-6 alkyl-carbonyl group optionally substituted with 1 to 3 halogen atoms;
A is C or N;
L is CH or C;
J
1) an amino group which may be mono- or di-substituted with a substituent selected from a C _1-6 alkyl group and a C _3-10 cycloalkyl group which may be substituted with 1 to 3 halogen atoms; or
2) A nitrogen-containing non-substituted group optionally substituted with 1 or 2 substituents selected from a C _1-6 alkyl group and a C _3-10 cycloalkyl group optionally substituted with 1 to 3 halogen atoms Aromatic heterocyclic groups (eg, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl);
A compound that is

As the salt of compound (I), a pharmacologically acceptable salt is preferable. Examples of such a salt include a salt with an inorganic base, a salt with an organic base, a salt with an inorganic acid, and an organic acid. And salts with basic or acidic amino acids.
Preferable examples of the salt with an inorganic base include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt and magnesium salt; aluminum salt; ammonium salt and the like.
Preferable examples of the salt with an organic base include trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, tromethamine [tris (hydroxymethyl) methylamine], tert-butylamine, cyclohexylamine, benzylamine, And salts with dicyclohexylamine, N, N-dibenzylethylenediamine and the like.
Preferable examples of the salt with inorganic acid include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like.
Preferable examples of salts with organic acids include formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid , Salts with p-toluenesulfonic acid and the like.
Preferable examples of the salt with basic amino acid include salts with arginine, lysine, ornithine and the like.
Preferable examples of the salt with acidic amino acid include salts with aspartic acid, glutamic acid and the like.
Among the above-mentioned salts, salts with inorganic acids and organic acids are preferable, and hydrochlorides, trifluoroacetates, fumarates and the like are more preferable.

A prodrug of compound (I) is a compound that is converted into compound (I) by a reaction with an enzyme, gastric acid, or the like under physiological conditions in vivo, that is, compound (I) that is enzymatically oxidized, reduced, hydrolyzed, etc. A compound that changes to compound (I) upon hydrolysis by gastric acid or the like. Compound (I) prodrugs include compounds in which the amino group of compound (I) is acylated, alkylated and phosphorylated (eg, the amino group of compound (I) is eicosanoylated, alanylated, pentylaminocarbonylated) , (5-methyl-2-oxo-1,3-dioxolen-4-yl) methoxycarbonylation, tetrahydrofuranylation, pyrrolidylmethylation, pivaloyloxymethylation, tert-butylated compounds, etc.); Compounds in which the hydroxyl group of compound (I) is acylated, alkylated, phosphorylated, borated (eg, hydroxyl group of compound (I) is acetylated, palmitoylated, propanoylated, pivaloylated, succinylated, fumarylated, alanyl Compound, dimethylaminomethylcarbonylated compound, etc.); the carboxyl group of compound (I) is esterified, Mido compound (e.g., carboxyl group of compound (I) is ethyl esterified, phenyl esterified, carboxymethyl esterified, dimethylaminomethyl esterified, pivaloyloxymethyl esterified, ethoxycarbonyloxyethyl esterified, Phthalidyl esterification, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methyl esterification, cyclohexyloxycarbonylethyl esterification, methylamidated compounds, and the like). These compounds can be produced from compound (I) by a method known per se.
In addition, the prodrug of compound (I) is a compound that changes to compound (I) under physiological conditions as described in Hirokawa Shoten 1990, “Drug Development”, Volume 7, Molecular Design, pages 163 to 198. It may be.
Compound (I) may be labeled with an isotope (eg, ³ H, ¹⁴ C, ³⁵ S, ¹²⁵ I, etc.).
Furthermore, compound (I) may be an anhydride or a hydrate.

Compound (I) or a prodrug thereof (hereinafter sometimes simply referred to as the compound of the present invention) has low toxicity and should be used as it is or mixed with a pharmacologically acceptable carrier to form a pharmaceutical composition. Thus, it can be used as a preventive or therapeutic agent for various diseases described below for mammals (eg, humans, mice, rats, rabbits, dogs, cats, cows, horses, pigs, monkeys, etc.).
Here, as the pharmacologically acceptable carrier, various organic or inorganic carrier substances commonly used as pharmaceutical materials are used, and excipients, lubricants, binders, disintegrants in solid preparations; solvents in liquid preparations , Solubilizing agents, suspending agents, isotonic agents, buffers, soothing agents and the like. Further, if necessary, preparation additives such as preservatives, antioxidants, colorants, sweeteners and the like can be used.

Preferable examples of excipients include lactose, sucrose, D-mannitol, D-sorbitol, starch, pregelatinized starch, dextrin, crystalline cellulose, low-substituted hydroxypropylcellulose, sodium carboxymethylcellulose, gum arabic, pullulan, light Anhydrous silicic acid, synthetic aluminum silicate, magnesium aluminate metasilicate and the like can be mentioned.
Preferable examples of the lubricant include magnesium stearate, calcium stearate, talc, colloidal silica and the like.
Preferable examples of the binder include pregelatinized starch, sucrose, gelatin, gum arabic, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, crystalline cellulose, sucrose, D-mannitol, trehalose, dextrin, pullulan, hydroxypropylcellulose, hydroxy Examples thereof include propylmethylcellulose and polyvinylpyrrolidone.
Preferable examples of the disintegrant include lactose, sucrose, starch, carboxymethyl cellulose, carboxymethyl cellulose calcium, croscarmellose sodium, carboxymethyl starch sodium, light anhydrous silicic acid, low substituted hydroxypropyl cellulose and the like.

Preferable examples of the solvent include water for injection, physiological saline, Ringer's solution, alcohol, propylene glycol, polyethylene glycol, sesame oil, corn oil, olive oil, cottonseed oil and the like.
Preferable examples of solubilizers include polyethylene glycol, propylene glycol, D-mannitol, trehalose, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate, sodium salicylate, sodium acetate. Etc.
Suitable examples of the suspending agent include surfactants such as stearyltriethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, glyceryl monostearate; for example, polyvinyl alcohol, Examples include hydrophilic polymers such as polyvinylpyrrolidone, sodium carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose; polysorbates, polyoxyethylene hydrogenated castor oil, and the like.

Preferable examples of the tonicity agent include sodium chloride, glycerin, D-mannitol, D-sorbitol, glucose and the like.
Preferable examples of the buffer include buffers such as phosphate, acetate, carbonate and citrate.
Preferable examples of the soothing agent include benzyl alcohol.
Preferable examples of the preservative include p-hydroxybenzoates, chlorobutanol, benzyl alcohol, phenethyl alcohol, dehydroacetic acid, sorbic acid and the like.
Preferable examples of the antioxidant include sulfite and ascorbate.
Suitable examples of the colorant include water-soluble edible tar dyes (eg, edible dyes such as edible red Nos. 2 and 3, edible yellows Nos. 4 and 5, and edible blue Nos. 1 and 2), water-insoluble lake dyes (E.g., an aluminum salt of the water-soluble edible tar dye), natural dyes (e.g., [beta] -carotene, chlorophyll, bengara, etc.).
Preferable examples of the sweetening agent include saccharin sodium, dipotassium glycyrrhizinate, aspartame, stevia and the like.

Examples of the dosage form of the pharmaceutical composition include tablets (including sublingual tablets and orally disintegrating tablets), capsules (including soft capsules and microcapsules), granules, powders, troches, syrups, emulsions, Oral preparations such as suspensions; and injections (eg, subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections, infusions, etc.), external preparations (eg, transdermal preparations, ointments, etc.) ), Suppositories (eg, rectal suppositories, vaginal suppositories, etc.), pellets, nasal preparations, pulmonary preparations (inhalants), ophthalmic preparations and the like, and these are oral or parenteral, respectively. Safe administration.
These preparations may be controlled-release preparations such as immediate-release preparations or sustained-release preparations (eg, sustained-release microcapsules).
The pharmaceutical composition can be produced by a method commonly used in the field of pharmaceutical technology, for example, a method described in the Japanese Pharmacopoeia. Below, the specific manufacturing method of a formulation is explained in full detail.
The content of the compound of the present invention in the pharmaceutical composition varies depending on the dosage form, the dose of the compound of the present invention, etc., but is, for example, about 0.1 to 100% by weight.

When producing an oral preparation, it may be coated for the purpose of taste masking, enteric properties or sustainability, if necessary.
Examples of the coating base used for coating include sugar coating base, water-soluble film coating base, enteric film coating base, sustained-release film coating base, and the like.

As the sugar coating base, sucrose is used, and one or more selected from talc, precipitated calcium carbonate, gelatin, gum arabic, pullulan, carnauba wax and the like may be used in combination.
Examples of the water-soluble film coating base include cellulose polymers such as hydroxypropylcellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, and methylhydroxyethylcellulose; polyvinyl acetal diethylaminoacetate, aminoalkyl methacrylate copolymer E [Eudragit E (trade name) Synthetic polymers such as polyvinyl pyrrolidone; polysaccharides such as pullulan.
Examples of enteric film coating bases include cellulose polymers such as hydroxypropylmethylcellulose phthalate, hydroxypropylmethylcellulose acetate succinate, carboxymethylethylcellulose, and cellulose acetate phthalate; methacrylic acid copolymer L [Eudragit L (trade name) , Rohm Pharma Co., Ltd.], acrylic polymer such as methacrylic acid copolymer LD [Eudragit L-30D55 (trade name), Rohm Pharma Co., Ltd.], methacrylic acid copolymer S [Eudragit S (trade name), Rohm Pharma Co., Ltd.] A natural product such as shellac.
Examples of the sustained-release film coating base include cellulose polymers such as ethyl cellulose; aminoalkyl methacrylate copolymer RS [Eudragit RS (trade name), Rohm Pharma Co., Ltd.], ethyl acrylate-methyl methacrylate copolymer suspension Acrylic polymers such as suspensions (Eudragit NE (trade name), Rohm Pharma) are listed.
Two or more of the coating bases described above may be mixed and used at an appropriate ratio. Moreover, you may use light-shielding agents, such as a titanium oxide, ferric oxide, etc. in the case of coating.

The compound of the present invention has low toxicity (eg, acute toxicity, chronic toxicity, genotoxicity, reproductive toxicity, cardiotoxicity, carcinogenicity), few side effects, and mammals (eg, humans, cows, horses, dogs, cats, It can be used as a prophylactic or therapeutic agent for various diseases or a diagnostic agent for monkeys, mice, rats, etc. (especially humans).
The compound of the present invention has an excellent ACC (acetyl-CoA carboxylase) inhibitory action. Examples of ACC include liver, adipose tissue, pancreas-specific isozyme (ACC1); muscle-specific isozyme (ACC2);

  The compound of the present invention has obesity, diabetes (eg, type 1 diabetes, type 2 diabetes, gestational diabetes, etc.), hyperlipidemia (eg, hypertriglyceridemia, hypercholesterolemia, hypoHDLemia, postprandial hyperlipidemia) Etc.), hypertension, heart failure, diabetic cardiomyopathy, metabolic syndrome, sarcopenia and the like.

Regarding the criteria for determining diabetes, a new criterion was reported in 1999 by the Japan Diabetes Society.
According to this report, diabetes is a fasting blood glucose level (glucose concentration in venous plasma) of 126 mg / dl or higher, and a 75 g oral glucose tolerance test (75 gOGTT) 2-hour value (glucose concentration in venous plasma) of 200 mg / dl or higher. This is a state in which the blood glucose level (glucose concentration in venous plasma) is at least 200 mg / dl as needed. In addition, the above-mentioned diabetes does not apply, and “fasting blood glucose level (glucose concentration in venous plasma) is less than 110 mg / dl or 75 g oral glucose tolerance test (75 gOGTT) 2 hour value (glucose concentration in venous plasma) is 140 mg / dl. A state that is not “a state indicating less than dl” (normal type) is referred to as a “boundary type”.

As for the criteria for determining diabetes, new criteria were reported from ADA (American Diabetes Association) in 1997 and from WHO in 1998.
According to these reports, diabetes is a fasting blood glucose level (glucose concentration in venous plasma) of 126 mg / dl or more, and a 2-hour value of 75 g oral glucose tolerance test (glucose concentration in venous plasma) is 200 mg / dl. This is a state showing dl or more.

  According to the above report, glucose intolerance is a fasting blood glucose level (glucose concentration in venous plasma) of less than 126 mg / dl and a 75 g oral glucose tolerance test 2 hour value (glucose concentration in venous plasma). Is a state showing 140 mg / dl or more and less than 200 mg / dl. Furthermore, according to the report of ADA, the state where the fasting blood glucose level (glucose concentration in venous plasma) is 110 mg / dl or more and less than 126 mg / dl is called IFG (Impaired Fasting Glucose). On the other hand, according to the report of WHO, the IFG (Impaired Fasting Glucose) is a state in which the 75 g oral glucose tolerance test 2 hour value (glucose concentration in venous plasma) is less than 140 mg / dl as IFG (Impaired Fasting Glycemia). Call.

  The compound of the present invention is also used as a prophylactic / therapeutic agent for diabetes, borderline type, impaired glucose tolerance, IFG (Impaired Fasting Glucose) and IFG (Impaired Fasting Glycemia) determined by the above-mentioned new criteria. Furthermore, the compound of the present invention can also prevent progression from borderline type, impaired glucose tolerance, IFG (Impaired Fasting Glucose) or IFG (Impaired Fasting Glycemia) to diabetes.

The compound of the present invention can be used, for example, for diabetic complications [eg, neuropathy, nephropathy, retinopathy, cataract, macrovascular disorder, osteopenia, diabetic hyperosmotic coma, infection (eg, respiratory infection, Urinary tract infection, digestive tract infection, skin soft tissue infection, lower limb infection, etc.), diabetic gangrene, xerostomia, hearing loss, cerebrovascular disorder, peripheral blood flow disorder, etc.], osteoporosis, cachexia ( Eg, cancer cachexia, tuberculosis cachex, diabetic cachexia, bloody cachexia, endocrine cachexia, infectious cachexia or acquired immunodeficiency syndrome), fatty liver, multiple Cystic ovary syndrome, kidney disease (eg, diabetic nephropathy, glomerulonephritis, glomerulosclerosis, nephrotic syndrome, hypertensive nephropathy, end-stage renal disease, etc.), muscular dystrophy, myocardial infarction, angina, cerebrovascular disorder (Eg, cerebral infarction, stroke), Alzheimer's disease, -Kinson's disease, anxiety, dementia, insulin resistance syndrome, syndrome X, hyperinsulinemia, hyperinsulinemia, sensory disturbance in hyperinsulinemia, tumor (eg leukemia, breast cancer, prostate cancer, skin cancer, etc.), irritable bowel syndrome , Acute or chronic diarrhea, inflammatory diseases (eg, rheumatoid arthritis, osteoarthritis, osteoarthritis, low back pain, gout, surgery or post-traumatic inflammation, swelling, neuralgia, sore throat, cystitis, hepatitis (non- Alcoholic steatohepatitis), pneumonia, pancreatitis, enteritis, inflammatory bowel disease (including inflammatory bowel disease), ulcerative colitis, gastric mucosal damage (including gastric mucosal damage caused by aspirin)) It can also be used as a prophylactic / therapeutic agent for small intestinal mucosal damage, malabsorption, testicular dysfunction, visceral obesity syndrome, sarcopenia and the like.
The compound of the present invention is also used for secondary prevention and suppression of progression of the various diseases described above (eg, cardiovascular events such as myocardial infarction).

  The dose of the compound of the present invention varies depending on the administration subject, administration route, target disease, symptom, and the like. For example, when administered orally to an adult diabetic patient, the dose is usually about 0.01 to 100 mg / kg body weight. It is preferably 0.05 to 30 mg / kg body weight, more preferably 0.1 to 10 mg / kg body weight, and it is desirable to administer this amount once to three times a day.

The compound of the present invention is used for the purpose of enhancing the action of the compound or reducing the dose of the compound, etc., for treating diabetes, treating diabetic complications, antihyperlipidemic agent, antihypertensive agent, antiobesity agent, diuresis It can be used in combination with a drug such as an agent or an antithrombotic drug (hereinafter abbreviated as a concomitant drug). In this case, the administration time of the compound of the present invention and the concomitant drug is not limited, and these may be administered simultaneously to the administration subject, or may be administered with a time difference. Further, the compound of the present invention and the concomitant drug may be administered as two types of preparations containing each active ingredient, or may be administered as a single preparation containing both active ingredients.
The dose of the concomitant drug can be appropriately selected based on the clinically used dose. The compounding ratio of the compound of the present invention and the concomitant drug can be appropriately selected depending on the administration subject, administration route, target disease, symptom, combination and the like. For example, when the administration subject is a human, 0.01 to 100 parts by weight of the concomitant drug may be used per 1 part by weight of the compound of the present invention.

Examples of diabetes therapeutic agents include insulin preparations (eg, animal insulin preparations extracted from bovine and porcine pancreas; human insulin preparations synthesized by genetic engineering using Escherichia coli or yeast; insulin zinc; protamine insulin zinc; Insulin fragment or derivative (eg, INS-1 etc.), oral insulin preparation), insulin resistance improving agent (eg, pioglitazone or a salt thereof (preferably hydrochloride), rosiglitazone or a salt thereof (preferably maleate) , Reglixane (JTT-501), GI-262570, Netoglitazone (MCC-555), DRF-2593, BM-13.1258, KRP-297, R-119702, Riboglitazone (CS- [0111], FK-614, compounds described in WO99 / 58510 (eg (E) -4- [4- (5-methyl-2-phenyl-4-oxazolylmethoxy) benzyloxyimino] -4-pheny Butyric acid), compounds described in WO01 / 38325, Tesaglitazar (AZ-242), Ragaglitazar (NN-622), Muraglitazar (BMS-298585), ONO-5816, BM-13-1258 LM-4156, MBX-102, LY-519818, MX-6054, LY-510929, Balaglitazone (NN-2344), T-131 or a salt thereof, THR-0921), PPARγ agonist, PPARγ antagonist, PPARγ / α dual agonist, α-glucosidase inhibitor (eg, voglibose, acarbose, miglitol, emiglitate), biguanide (eg, phenformin, metformin, buformin or salts thereof (eg, hydrochloride, fumarate, succinic acid) Salt)), insulin secretagogues [sulfonylureas (eg, tolbutamide, glibenclamide, gliclazide, chlorpropamide, tolazamide, acetohexami ), Repaglinide, senaglinide, nateglinide, mitiglinide or its calcium salt hydrate], GPR40 agonist, GLP-1 receptor agonist [eg, GLP-1, GLP-1MR agent, NN -2211, AC-2993 (exendin-4), BIM-51077, Aib (8,35) hGLP-1 (7,37) NH ₂ , CJC-1131], amylin agonist (eg, pramlintide), phosphotyrosine phosphatase Inhibitor (eg, sodium vanadate), dipeptidyl peptidase IV inhibitor (eg, NVP-DPP-278, PT-100, P32 / 98, LAF-237, P93 / 01, TS-021, MK-431, BMS -477118 etc.), β3 agonist (eg, AJ-9679, AZ40140 etc.), gluconeogenesis inhibitor (eg, glycogen phosphorylase inhibitor, glucose-6-phosphatase inhibitor, Glucagon antagonists), SGLT (sodium-glucose cotransporter) inhibitors (eg, T-1095), 11β-hydroxysteroid dehydrogenase inhibitors (eg, BVT-3498), adiponectin or agonists thereof, IKK inhibitors (eg, AS -2868), leptin sensitizers, somatostatin receptor agonists (eg, compounds described in WO01 / 25228, WO03 / 42204, WO98 / 44921, WO98 / 45285 and WO99 / 22735), glucokinase activators (eg, Ro-28-1675).

Examples of the therapeutic agent for diabetic complications include aldose reductase inhibitors (eg, tolrestat, epalrestat, zenarestat, zopolrestat, minalrestat, fidarestat, CT-112), neurotrophic factors and their increasing agents (eg, NGF). , NT-3, BDNF, neurotrophin production / secretion promoter (for example, 4- (4-chlorophenyl) -2- (2-methyl-1-imidazolyl) -5- [3- ( 2-methylphenoxy) propyl] oxazole)), nerve regeneration promoter (eg, Y-128), PKC inhibitor (eg, ruboxistaurin mesylate (LY-333531)), AGE inhibitor (eg, ALT946, pimagedin, pyratoxatin, N-phenacylthiazolium bromide (ALT766), ALT -711, EXO-226, pyridoline (Pyridorin), pyridoxamine), active oxygen scavengers (eg, thioctic acid), cerebral vasodilators (eg, tiapride, mexiletine), somatostatin receptor agonists (eg, BIM23190), apoptosis Signal regulating kinase-1 (ASK-1) inhibitors.
Antihyperlipidemic agents include, for example, statin compounds (eg, pravastatin, simvastatin, lovastatin, atorvastatin, fluvastatin, itavastatin, rosuvastatin, pitavastatin or their salts (eg, sodium salt, calcium salt)), squalene synthesis Enzyme inhibitors (eg, compounds described in WO 97/10224, such as N-[[(3R, 5S) -1- (3-acetoxy-2,2-dimethylpropyl) -7-chloro-5- (2, 3-dimethoxyphenyl) -2-oxo-1,2,3,5-tetrahydro-4,1-benzoxazepin-3-yl] acetyl] piperidine-4-acetic acid), fibrate compounds (eg, bezafibrate, Clofibrate, simfibrate, clinofibrate), ACAT inhibitors (eg, Avasimibe, Eflucimibe), anion exchange resins (eg, cofionate) Restyramine), probucol, nicotinic acid drugs (eg, nicomol, niceritrol), ethyl icosapentate, plant sterols (eg, soysterol, gamma oryzanol) .

Examples of the antihypertensive agent include angiotensin converting enzyme inhibitors (eg, captopril, enalapril, delapril), angiotensin II antagonists (eg, candesartan cilexetil, losartan, eprosartan, valsartan, telmisartan, irbesartan, tasosartan, 1-[[2 ' -(2,5-Dihydro-5-oxo-4H-1,2,4-oxadiazol-3-yl) biphenyl-4-yl] methyl] -2-ethoxy-1H-benzimidazole-7-carboxylic acid ), Calcium antagonists (eg, manidipine, nifedipine, amlodipine, efonidipine, nicardipine), potassium channel openers (eg, lebucromacarim, L-27152, AL 0671, NIP-121), clonidine.
Anti-obesity agents include, for example, central anti-obesity agents (eg, dexfenfluramine, fenfluramine, phentermine, sibutramine, ampepramon, dexamphetamine, mazindol, phenylpropanolamine, clobenzorex; MCH receptor antagonist (Eg, SB-568849; SNAP-7941; compounds included in WO01 / 82925 and WO01 / 87834); neuropeptide Y antagonists (eg, CP-422935); cannabinoid receptor antagonists (eg, SR-141716, SR -147778); ghrelin antagonist; 11β-hydroxysteroid dehydrogenase inhibitor (eg, BVT-3498)), pancreatic lipase inhibitor (eg, orlistat, ATL-962), β3 agonist (eg, AJ-9677, AZ40140), Peptide appetite suppressant (eg, leptin, CNTF (ciliary neurotrophic factor)), cholecystokinin agonist (eg, lynchtrypto, FPL-15849), intake Inhibitors (eg, P-57) are mentioned.

  Examples of diuretics include xanthine derivatives (eg, sodium salicylate theobromine, calcium salicylate theobromine), thiazide preparations (eg, etiazide, cyclopenthiazide, trichloromethiazide, hydrochlorothiazide, hydroflumethiazide, benchylhydrochlorothiazide, pentfurizide, polythiazide. , Methiclotiazide), anti-aldosterone preparations (eg, spironolactone, triamterene), carbonic anhydrase inhibitors (eg, acetazolamide), chlorobenzenesulfonamide preparations (eg, chlorthalidone, mefluside, indapamide), azosemide, isosorbide, ethacrynic acid, Piretanide, bumetanide, furosemide.

  Examples of the antithrombotic agent include heparin (eg, heparin sodium, heparin calcium, dalteparin sodium), warfarin (eg, warfarin potassium), antithrombin drug (eg, aragatroban), Thrombolytic drugs (eg, urokinase, tisokinase, alteplase, nateplase, monteplase, pamitepase), platelet aggregation inhibitors (eg, ticlopidine hydrochloride) ), Cilostazol, ethyl icosapentate, beraprost sodium, sarpogrelate hydrochloride, and the like.

Hereafter, the manufacturing method of compound (I) is demonstrated. Compound (I) can be produced, for example, by the [Production method] described in detail below or a method analogous thereto.
In the following [Production method], the compounds used as raw material compounds may each be used as a salt. As such salt, those exemplified as the salt of compound (I) can be used.
In the following production methods, when performing alkylation reaction, hydrolysis reaction, amination reaction, esterification reaction, amidation reaction, esterification reaction, etherification reaction, oxidation reaction, reduction reaction, etc., these reactions are: This is performed according to a method known per se. Such methods include, for example, Organic Functional Group PREPARATIONS 2nd edition, Academic Press, Inc., 1989; Comprehensive Organic Transformation (Comprehensive Organic Transformation). VCH Publishers Inc. , 1989, and the like.

[Production method]
Compound (I) is produced, for example, by the following amidation reaction.
(Amidation reaction)

[The symbols in the formula are as defined above]
The “amidation reaction” includes the following “method using a dehydration condensing agent” and “method using a reactive derivative of carboxylic acid or sulfonic acid”.

i) Method using dehydrating condensing agent Compound (III), 1 to 5 equivalents of compound (II), and 1 to 2 equivalents of dehydrating condensing agent are reacted in an inert solvent. If necessary, the reaction may be performed in the presence of 1 to 1.5 equivalents of 1-hydroxybenzotriazole (HOBt), a catalytic amount to 5 equivalents of a base and the like.
Examples of the “dehydration condensing agent” include dicyclohexylcarbodiimide (DCC), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (EDC · HCl), and the like. Among these, EDC · HCl is preferable.
Examples of the “inert solvent” include nitrile solvents, amide solvents, halogenated hydrocarbon solvents, ether solvents, and the like. These may be used as a mixture of two or more at an appropriate ratio.
Here, as the nitrile solvent, for example, acetonitrile, propionitrile and the like are used. Of these, acetonitrile is preferable.
As the amide solvent, for example, N, N-dimethylformamide (DMF), N, N-dimethylacetamide, N-methylpyrrolidone and the like are used. Of these, DMF is preferable.
Examples of the halogenated hydrocarbon solvent include dichloromethane, chloroform, 1,2-dichloroethane, carbon tetrachloride and the like. Of these, dichloromethane is preferred.
Examples of the ether solvent include diethyl ether, tetrahydrofuran (THF), 1,4-dioxane, 1,2-dimethoxyethane, and the like. Of these, THF is preferable.
As the above “base”,
1) For example, alkali metal or alkaline earth metal hydrides (eg, lithium hydride, sodium hydride, potassium hydride, calcium hydride), alkali metal or alkaline earth metal amides (eg, lithium amide, Sodium amide, lithium diisopropylamide, lithium dicyclohexylamide, lithium hexamethyldisilazide, sodium hexamethyldisilazide, potassium hexamethyldisilazide), alkali metal or alkaline earth metal lower (C _1-6 ) alkoxide ( Strong bases such as eg sodium methoxide, sodium ethoxide, potassium tert-butoxide);
2) For example, alkali metal or alkaline earth metal hydroxides (eg, sodium hydroxide, potassium hydroxide, lithium hydroxide, barium hydroxide), alkali metal or alkaline earth metal carbonates (eg, sodium carbonate) , Potassium carbonate, cesium carbonate), inorganic bases such as alkali metal bicarbonates (eg, sodium bicarbonate, potassium bicarbonate); and 3) amines such as, for example, triethylamine, diisopropylethylamine, N-methylmorpholine; , Pyridine, 4-dimethylaminopyridine, DBU (1,8-diazabicyclo [5.4.0] undes-7-ene), DBN (1,5-diazabicyclo [4.3.0] non-5-ene) , Organic bases such as basic heterocyclic compounds such as imidazole and 2,6-lutidine .
Of these bases, triethylamine, 4-dimethylaminopyridine and the like are preferable.
The reaction temperature is usually room temperature (in the present specification, room temperature means a temperature of 1 to 30 ° C.). The reaction time is, for example, 1 to 24 hours.

ii) Method using a reactive derivative of carboxylic acid or sulfonic acid The reactive derivative of compound (II) is reacted with 1 to 5 equivalents (preferably 1 to 3 equivalents) of compound (III) in an inert solvent. . If necessary, the reaction may be carried out in the presence of 1 to 10 equivalents, preferably 1 to 3 equivalents of a base.
Examples of the “reactive derivative” of compound (II) include acid halides (eg, acid chloride, acid bromide), mixed acid anhydrides (eg, C _1-6 alkyl-carboxylic acid, C _6-10 aryl-carboxylic acid). Acid or acid anhydride with C _1-6 alkyl carbonate), active ester (eg, ester with optionally substituted phenol, HOBt or N-hydroxysuccinimide) and the like.
Examples of the “substituent” in the above “optionally substituted phenol” include, for example, a halogen atom, a nitro group, an optionally halogenated C _1-6 alkyl group, and an optionally halogenated atom. A _C1-6 alkoxy group is mentioned. The number of substituents is, for example, 1 to 5.
Here, as the "C _1-6 alkyl group which may be halogenated", for example, 1 to 5, preferably 1 to 3 C _1-6 alkyl group which may have a halogen atom (Eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl). Specific examples include methyl, chloromethyl, difluoromethyl, trichloromethyl, trifluoromethyl, ethyl, 2-bromoethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, propyl, 3,3,3-trifluoro Propyl, isopropyl, butyl, 4,4,4-trifluorobutyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, 5,5,5-trifluoropentyl, hexyl, 6,6,6- And trifluorohexyl.
As the "optionally halogenated C _1-6 optionally alkoxy group", for example, 1 to 5, preferably 1 to 3 halogen atoms a C _1-6 alkoxy group which may have a (e.g. Methoxy, ethoxy, propoxy, butoxy, pentyloxy, hexyloxy) and the like. Specific examples include, for example, methoxy, difluoromethoxy, trifluoromethoxy, ethoxy, 2,2,2-trifluoroethoxy, propoxy, isopropoxy, butoxy, 4,4,4-trifluorobutoxy, isobutoxy, sec-butoxy , Pentyloxy, isopentyloxy, hexyloxy and the like.
Specific examples of “optionally substituted phenol” include phenol, pentachlorophenol, pentafluorophenol, p-nitrophenol, and the like.
The reactive derivative is preferably an acid halide.
Examples of the “inert solvent” include ether solvents, halogenated hydrocarbon solvents, aromatic solvents, aliphatic hydrocarbon solvents, nitrile solvents, amide solvents, ketone solvents, sulfoxide solvents, Water etc. are mentioned. These may be used as a mixture of two or more at an appropriate ratio. Of these, acetonitrile, THF, dichloromethane, chloroform and the like are preferable.
Here, as the ether solvent, the halogenated hydrocarbon solvent, the nitrile solvent, and the amide solvent, those exemplified in the aforementioned “method using a dehydration condensing agent” are used.
As the aromatic solvent, for example, benzene, toluene, xylene, pyridine and the like are used.
As the aliphatic hydrocarbon solvent, for example, hexane, pentane, cyclohexane or the like is used.
As the ketone solvent, for example, acetone, methyl ethyl ketone, or the like is used.
As the sulfoxide solvent, for example, dimethyl sulfoxide (DMSO) is used.
As the “base”, those similar to the above-mentioned “method using a dehydration condensing agent” are used, and preferably sodium hydride, potassium carbonate, sodium carbonate, sodium hydroxide, potassium hydroxide, sodium bicarbonate, Potassium hydrogen carbonate, triethylamine, pyridine and the like.
The reaction temperature is usually −20 ° C. to 50 ° C., preferably room temperature.
The reaction time is usually 5 minutes to 40 hours, preferably 30 minutes to 18 hours.
In the above production method, compound (III) used as a raw material compound can be produced by a method known per se, for example, the method described in WO03 / 72197 pamphlet or a method analogous thereto. Compound (II) can be produced by a method known per se.

  In the compound (I) thus obtained, the functional group in the molecule can be converted to the target functional group by combining a chemical reaction known per se. Here, examples of the chemical reaction include an oxidation reaction, a reduction reaction, an alkylation reaction, a hydrolysis reaction, an amination reaction, an esterification reaction, an aryl coupling reaction, and a deprotection reaction.

In the above production method, when the raw material compound has an amino group, a carboxy group, a hydroxy group, or a carbonyl group as a substituent, a protective group generally used in peptide chemistry or the like may be introduced into these groups. The target compound can be obtained by removing the protecting group as necessary after the reaction.
Examples of the protecting group for the amino group include a formyl group, a C _1-6 alkyl-carbonyl group (eg, acetyl, propionyl), a C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl). ), Benzoyl group, C _7-10 aralkyl-carbonyl group (eg, benzylcarbonyl), C _7-14 aralkyloxy-carbonyl group (eg, benzyloxycarbonyl, 9-fluorenylmethoxycarbonyl), trityl group, phthaloyl group N, N-dimethylaminomethylene group, substituted silyl group (eg, trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert-butyldimethylsilyl, tert-butyldiethylsilyl), C _2-6 alkenyl group (eg, 1-allyl) ) And the like. These groups may be substituted with 1 to 3 substituents selected from a halogen atom, a C _1-6 alkoxy group (eg, methoxy, ethoxy, propoxy) and a nitro group.
Examples of the protecting group for the carboxy group include a C _1-6 alkyl group (eg, methyl, ethyl, propyl, isopropyl, butyl, tert-butyl), a C _7-11 aralkyl group (eg, benzyl), a phenyl group, and trityl. Group, substituted silyl group (eg, trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert-butyldimethylsilyl, tert-butyldiethylsilyl), C _2-6 alkenyl group (eg, 1-allyl) and the like. These groups may be substituted with 1 to 3 substituents selected from a halogen atom, a C _1-6 alkoxy group (eg, methoxy, ethoxy, propoxy) and a nitro group.
Examples of the protecting group for the hydroxy group include a C _1-6 alkyl group (eg, methyl, ethyl, propyl, isopropyl, butyl, tert-butyl), a phenyl group, a trityl group, and a C _7-10 aralkyl group (eg, benzyl). ), Formyl group, C _1-6 alkyl-carbonyl group (eg, acetyl, propionyl), benzoyl group, C _7-10 aralkyl-carbonyl group (eg, benzylcarbonyl), 2-tetrahydropyranyl group, 2-tetrahydrofuranyl Group, substituted silyl (eg, trimethylsilyl, triethylsilyl, dimethylphenylsilyl, tert-butyldimethylsilyl, tert-butyldiethylsilyl), C _2-6 alkenyl group (eg, 1-allyl) and the like. These groups are 1 to 3 selected from a halogen atom, C _1-6 alkyl (eg, methyl, ethyl, n-propyl), C _1-6 alkoxy (eg, methoxy, ethoxy, propoxy) or a nitro group. It may be substituted with a substituent.
Examples of the protecting group for the carbonyl group include cyclic acetals (eg, 1,3-dioxane), acyclic acetals (eg, di-C _1-6 alkylacetal) and the like.
The protecting group removal method described above can be carried out according to a method known per se, for example, the method described in Protective Groups in Organic Synthesis, published by John Wiley and Sons (1980). . Specifically, acid, base, ultraviolet light, hydrazine, phenylhydrazine, sodium N-methyldithiocarbamate, tetrabutylammonium fluoride, palladium acetate, trialkylsilyl halide (for example, trimethylsilyl iodide, trimethylsilyl bromide, etc.) The method used, the reduction method, etc. are used.

  Compound (I) obtained by the above production method can be isolated and purified by known means, for example, solvent extraction, liquid conversion, phase transfer, crystallization, recrystallization, chromatography and the like.

When compound (I) contains optical isomers, stereoisomers, positional isomers, and rotational isomers, these are also included as compound (I), and are synthesized by a known synthesis method and separation method, respectively. Can be obtained as a single product. For example, when compound (I) has an optical isomer, the optical isomer resolved from the compound is also encompassed in compound (I).
Here, the optical isomer can be produced by a method known per se.

Compound (I) may be a crystal.
Crystals of compound (I) (hereinafter sometimes abbreviated as crystals of the present invention) can be produced by crystallization by applying a crystallization method known per se to compound (I).

In the present specification, the melting point is measured using, for example, a micro melting point measuring device (Yanako, MP-500D type or Buchi, B-545 type) or DSC (differential scanning calorimetry) apparatus (SEIKO, EXSTAR6000). Mean melting point.
In general, the melting point may vary depending on the measurement equipment, measurement conditions, and the like. The crystal in the present specification may be a crystal exhibiting a value different from the melting point described in the present specification as long as it is within a normal error range.
The crystal of the present invention is excellent in physicochemical properties (eg, melting point, solubility, stability, etc.) and biological properties (eg, pharmacokinetics (absorbability, distribution, metabolism, excretion), drug efficacy, etc.), and pharmaceuticals. As extremely useful.

The present invention will be described in more detail with reference to the following Reference Examples, Examples, Experimental Examples and Formulation Examples, which are not intended to limit the present invention, and may be changed without departing from the scope of the present invention. Also good.
In addition, the symbol in a reference example and an Example has the following meaning.
s: singlet, d: doublet, t: triplet, q: quartet, m: multiplet, br: broad, J: coupling constant,
In the Reference Examples and Examples,% indicates% by weight unless otherwise specified.

Reference example 1
1-Benzyl 4-tert-butyl 2- (morpholin-4-ylcarbonyl) piperazine-1,4-dicarboxylate

1-[(Benzyloxy) carbonyl] -4- (tert-butoxycarbonyl) piperazine-2-carboxylic acid (2.95 g, 8.10 mmol), morpholine (0.847 ml, 9.71 mmol) and HOBt (1.24 g, 8.10 mmol) DMF in (10 ml) ^{solution, EDC. HCl (1.55 g,} 8.10 mmol) under ice-cooling, followed by stirring at room temperature for 16 hours. The reaction solution was dissolved in ethyl acetate, washed with 0.5N hydrochloric acid, aqueous potassium carbonate solution and saturated brine, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was passed through NH-silica gel column chromatography (developing solvent; ethyl acetate) to give the title compound (3.51 g, quantitative) as an oil. Proceed to the next step without further purification.

Reference example 2
Benzyl 2- (morpholin-4-ylcarbonyl) piperazine-1-carboxylate

  1-benzyl 4-tert-butyl 2- (morpholin-4-ylcarbonyl) piperazine-1,4-dicarboxylate (3.51 g, 8.10 mmol) obtained in Reference Example 1 was added to 4N hydrogen chloride-ethyl acetate (40 ml), and after 2 hours, the solvent was distilled off under reduced pressure. The residue was dissolved in water, basified with potassium carbonate, and extracted with ethyl acetate. The extract was washed with saturated brine and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give the title compound (2.51 g, yield 92.9%) as an oil. Proceed to the next step without further purification.

Reference example 3
Benzyl 4- [1- (tert-butoxycarbonyl) piperidin-4-yl] -2- (morpholin-4-ylcarbonyl) piperazine-1-carboxylate

Benzyl 2- (morpholin-4-ylcarbonyl) piperazine-1-carboxylate (2.51 g, 7.53 mmol), tert-butyl 4-oxopiperidine-1-carboxylate (1.53 g, 7.53 mmol) obtained in Reference Example 2 ) And acetic acid (0.431 ml, 7.53 mmol) in THF (30 ml) were added sodium triacetoxyborohydride (2.39 g, 11.3 mmol), and the mixture was stirred at room temperature for 16 hours, and then the solvent was evaporated under reduced pressure. Ethyl acetate was added to the residue, washed with aqueous potassium carbonate solution and saturated brine, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (developing solvent; hexane-ethyl acetate = 1: 1 to ethyl acetate) to give 1.73 g (yield 44.5%) of the title compound as an oil. Obtained as a thing.
EI (pos) 517.2 [M + H] ⁺

Reference example 4
tert-Butyl 4- [3- (morpholin-4-ylcarbonyl) piperazin-1-yl] piperidine-1-carboxylate

  Benzyl 4- [1- (tert-butoxycarbonyl) piperidin-4-yl] -2- (morpholin-4-ylcarbonyl) piperazine-1-carboxylate (1.72 g, 3.32 mmol) obtained in Reference Example 3 THF (20 ml) was added to 10% palladium carbon (50% water-containing product, 1 g), and the mixture was stirred at room temperature for 16 hours in a hydrogen atmosphere. The reaction mixture was filtered through celite, and the solvent was evaporated under reduced pressure to give the title compound (1.27 g, quantitative) as an oil. Proceed to the next step without further purification.

Reference Example 5
tert-butyl 4- [3- (morpholin-4-ylcarbonyl) -4- (trifluoroacetyl) piperazin-1-yl] piperidine-1-carboxylate

Dissolve tert-butyl 4- [3- (morpholin-4-ylcarbonyl) piperazin-1-yl] piperidine-1-carboxylate (1.27 g, 3.32 mmol) obtained in Reference Example 4 in THF (20 ml). Triethylamine (0.693 ml, 4.98 mmol) and trifluoroacetic anhydride (0.563 ml, 3.99 mmol) were added under ice-cooling, and the mixture was stirred at room temperature for 3 hours, and the solvent was evaporated under reduced pressure. Ethyl acetate was added to the residue, washed with aqueous sodium hydrogen carbonate solution and saturated brine, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give 1.31 g (yield 82.4%) of the title compound as an oil.
EI (pos) 479.2 [M + H] ⁺

Reference Example 6
4-{[4- (Piperidin-4-yl) -1- (trifluoroacetyl) piperazin-2-yl] carbonyl} morpholine dihydrochloride

  Tert-Butyl 4- [3- (morpholin-4-ylcarbonyl) -4- (trifluoroacetyl) piperazin-1-yl] piperidine-1-carboxylate (1.31 g, 2.74 mmol) obtained in Reference Example 5 4N hydrogen chloride-ethyl acetate (15 ml) was added. The reaction mixture was stirred for 2 hours, and the solvent was evaporated under reduced pressure to give the title compound (1.22 g, yield 98.2%) as an oil. Proceed to the next step without further purification.

Reference Example 7
1-Benzyl 4-tert-butyl 2-[(diethylamino) carbonyl] piperazine-1,4-dicarboxylate

  1-[(Benzyloxy) carbonyl] -4- (tert-butoxycarbonyl) piperazine-2-carboxylic acid (5.26 g, 14.4 mmol) and diethylamine (1.79 ml, 17.3 mmol) were used as in Reference Example 1. By performing the operation, 1.78 g (yield 29.4%) of the title compound was obtained as an oily substance. Proceed to the next step without further purification.

Reference Example 8
Benzyl 2-[(diethylamino) carbonyl] piperazine-1-carboxylate

  Using 1-benzyl 4-tert-butyl 2-[(diethylamino) carbonyl] piperazine-1,4-dicarboxylate (1.78 g, 4.24 mmol) obtained in Reference Example 7, the same procedure as in Reference Example 2 was performed. To give 1.14 g (yield 83.5%) of the title compound as an oil. Proceed to the next step without further purification.

Reference Example 9
Benzyl 4- [1- (tert-butoxycarbonyl) piperidin-4-yl] -2-[(diethylamino) carbonyl] piperazine-1-carboxylate

  Benzyl 2-[(diethylamino) carbonyl] piperazine-1-carboxylate (582 mg, 1.82 mmol) and tert-butyl 4-oxopiperidine-1-carboxylate (399 mg, 2.00 mmol) obtained in Reference Example 8 Using the same procedure as in Reference Example 3, the title compound (916 mg, yield 99.9%) was obtained as an oil. Proceed to the next step without further purification.

Reference Example 10
tert-butyl 4- {3-[(diethylamino) carbonyl] piperazin-1-yl} piperidine-1-carboxylate

  Using the benzyl 4- [1- (tert-butoxycarbonyl) piperidin-4-yl] -2-[(diethylamino) carbonyl] piperazine-1-carboxylate (916 mg, 1.82 mmol) obtained in Reference Example 9 The title compound was obtained in the same manner as in Reference Example 4 to give the title compound (515 mg, yield 76.7%) as an oil. Proceed to the next step without further purification.

Reference Example 11
tert-butyl 4- [3-[(diethylamino) carbonyl] -4- (trifluoroacetyl) piperazin-1-yl] piperidine-1-carboxylate

  Using tert-butyl 4- {3-[(diethylamino) carbonyl] piperazin-1-yl} piperidine-1-carboxylate (515 mg, 1.40 mmol) obtained in Reference Example 10, the same as in Reference Example 5 By the operation, 584 mg (yield 90.0%) of the title compound was obtained as an oily substance. Proceed to the next step without further purification.

Reference Example 12
N, N-diethyl-4- (piperidin-4-yl) -1- (trifluoroacetyl) piperazine-2-carboxamide

  Using tert-butyl 4- [3-[(diethylamino) carbonyl] -4- (trifluoroacetyl) piperazin-1-yl] piperidine-1-carboxylate (584 mg, 1.26 mmol) obtained in Reference Example 11 Then, by performing the same operation as in Reference Example 6, 550 mg (quantitative) of the title compound was obtained as an oil. Proceed to the next step without further purification.

Reference Example 13
tert-Butyl 3-[(diethylamino) carbonyl] -5-oxopiperazine-1-carboxylate

  By performing the same operation as in Reference Example 1 using 4- (tert-butoxycarbonyl) -6-oxopiperazine-2-carboxylic acid (800 mg, 3.28 mmol) and diethylamine (0.407 ml, 3.93 mmol), The title compound (301 mg, yield 30.7%) was obtained as an oil. Proceed to the next step without further purification.

Reference Example 14
N, N-diethyl-6-oxopiperazine-2-carboxamide hydrochloride

  Using tert-butyl 3-[(diethylamino) carbonyl] -5-oxopiperazine-1-carboxylate (301 mg, 1.01 mmol) obtained in Reference Example 13, the same operation as in Reference Example 6 was performed, and diisopropyl Trituration with ether gave 237 mg (quantitative) of the title compound. Proceed to the next step without further purification.

Reference Example 15
tert-Butyl 4- {3-[(diethylamino) carbonyl] -5-oxopiperazin-1-yl} piperidine-1-carboxylate

N, N-diethyl-6-oxopiperazine-2-carboxamide hydrochloride (237 mg, 1.01 mmol), tert-butyl 4-oxopiperidine-1-carboxylate (220 mg, 1.11 mmol) obtained in Reference Example 14 , Acetic acid (0.058 ml, 1.01 mmol) and triethylamine (0.168 ml, 1.21 mmol) in THF (5 ml) -methanol (5 ml) mixed solution was added sodium triacetoxyborohydride (320 mg, 1.51 mmol) at room temperature. Then, the solvent was distilled off under reduced pressure. Ethyl acetate was added to the residue, washed with aqueous potassium carbonate solution and saturated brine, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (developing solvent; hexane-ethyl acetate = 1: 1 to ethyl acetate-methanol = 5: 1) to give 87.6 mg (yield) of the title compound. 22.8%) as an oil.
EI (pos) 383.1 [M + H] ⁺

Reference Example 16
N, N-diethyl-6-oxo-4- (piperidin-4-yl) piperazine-2-carboxamide dihydrochloride

  Using the tert-butyl 4- {3-[(diethylamino) carbonyl] -5-oxopiperazin-1-yl} piperidine-1-carboxylate (87.6 mg, 0.229 mmol) obtained in Reference Example 15, The same operation as in No. 6 was performed, and powdered with diisopropyl ether to obtain 75.9 mg (yield 93.2%) of the title compound. Proceed to the next step without further purification.

Reference Example 17
Benzyl 2-[(diethylamino) carbonyl] morpholine-4-carboxylate

  Use 4-[(benzyloxy) carbonyl] morpholine-2-carboxylic acid (4.35 g, 16.4 mmol) and diethylamine (1.87 ml, 18.0 mmol) in the same manner as in Reference Example 1, and powder it with diisopropyl ether. As a result, 4.68 g (yield: 89.2%) of the title compound was obtained. Proceed to the next step without further purification.

Reference Example 18
N, N-diethylmorpholine-2-carboxamide

  Using the benzyl 2-[(diethylamino) carbonyl] morpholine-4-carboxylate (4.68 g, 14.6 mmol) obtained in Reference Example 17, the same operation as in Reference Example 4 was performed to give 2.39 g ( Yield 87.9%) was obtained. Proceed to the next step without further purification.

Reference Example 19
Benzyl 4- {2-[(diethylamino) carbonyl] morpholin-4-yl} piperidine-1-carboxylate hydrochloride

  Using N, N-diethylmorpholine-2-carboxamide (2.39 g, 12.8 mmol) obtained in Reference Example 18 and benzyl 4-oxopiperidine-1-carboxylate (3.29 g, 14.1 mmol), Reference Example 3 and The same operation was performed, 4N hydrogen chloride-ethyl acetate (3.2 ml) was added to the obtained oil, and powdered with diisopropyl ether to give 5.65 g (quantitative) of the title compound. Proceed to the next step without further purification.

Reference Example 20
N, N-diethyl-4- (piperidin-4-yl) morpholine-2-carboxamide hydrochloride

  Using benzyl 4- {2-[(diethylamino) carbonyl] morpholin-4-yl} piperidine-1-carboxylate hydrochloride (5.50 g, 12.5 mmol) obtained in Reference Example 19, the same as in Reference Example 4 By performing the operation, 3.32 g (yield: 87.0%) of the title compound was obtained. Proceed to the next step without further purification.

Reference Example 21
Benzyl 2-[(diisopropylamino) carbonyl] morpholine-4-carboxylate

A mixture of 4-[(benzyloxy) carbonyl] morpholine-2-carboxylic acid (2.60 g, 10.0 mmol) and thionyl chloride (12 ml) was heated to reflux for 3 hours, and then excess thionyl chloride was distilled off under reduced pressure. Ethyl acetate (25 ml) was added to the residue, diisopropylamine (1.21 g, 12.0 mmol) and triethylamine (1.51 g, 15.0 mmol) were added, and the mixture was stirred at room temperature for 1 hour. The reaction solution was washed with water and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was purified by silica gel column chromatography to give the title compound (2.36 g, yield 67.8%) as an oil.
EI (pos) 349 [M + H] ⁺

Reference Example 22
Benzyl 2-[(cyclopentylamino) carbonyl] morpholine-4-carboxylate

4-[(Benzyloxy) carbonyl] morpholine-2-carboxylic acid (2.60 g, 10.0 mmol) and cyclopentylamine (1.28 g, 15.0 mmol) were used in the same manner as in Reference Example 21, and ethyl acetate-hexane was used. To give 2.37 g (yield 71.4%) of the title compound.
EI (pos) 333 [M + H] ⁺

Reference Example 23
Benzyl 2-[(1-adamantylamino) carbonyl] morpholine-4-carboxylate

Using 4-[(benzyloxy) carbonyl] morpholine-2-carboxylic acid (2.60 g, 10.0 mmol) and 1-adamantanamine (2.27 g, 15.0 mmol), the same operation as in Reference Example 21 was carried out, and ethyl acetate Crystallization with -hexane gave 3.70 g (yield 92.9%) of the title compound.
EI (pos) 399 [M + H] ⁺

Reference Example 24
Benzyl 2-{[bis (2,2,2-trifluoroethyl) amino] carbonyl} morpholine-4-carboxylate

Operation similar to Reference Example 21 using 4-[(benzyloxy) carbonyl] morpholine-2-carboxylic acid (2.60 g, 10.0 mmol) and 2,2,2-trifluoroethylamine (2.71 g, 15.0 mmol) To give 0.89 g (yield 20.8%) of the title compound as an oil.
EI (pos) 429 [M + H] ⁺

Reference Example 25
Benzyl 2-{[cyclohexyl (methyl) amino] carbonyl} morpholine-4-carboxylate

By performing the same operation as in Reference Example 21 using 4-[(benzyloxy) carbonyl] morpholine-2-carboxylic acid (2.60 g, 10.0 mmol) and N-methylcyclohexaneamine (1.28 g, 15.0 mmol) The title compound (3.17 g, yield 88.0%) was obtained as an oil.
EI (pos) 361 [M + H] ⁺

Reference Example 26
Benzyl 2- (morpholin-4-ylcarbonyl) morpholine-4-carboxylate

By performing the same operation as in Reference Example 21 using 4-[(benzyloxy) carbonyl] morpholine-2-carboxylic acid (2.60 g, 10.0 mmol) and morpholine (1.30 g, 15.0 mmol), the title compound 2.70 g (yield 80.8%) was obtained as an oil.
EI (pos) 335 [M + H] ⁺

Reference Example 27
Benzyl 2-[(6-fluoro-2-methyl-3,4-dihydroquinolin-1 (2H) -yl) carbonyl] morpholine-4-carboxylate

Using 4-[(benzyloxy) carbonyl] morpholine-2-carboxylic acid (2.60 g, 10.0 mmol) and 6-fluoro-2-methyl-1,2,3,4-tetrahydroquinoline (1.81 g, 11.0 mmol) Then, the same operation as in Reference Example 21 was performed, and crystallization was performed with ethyl acetate-hexane to obtain 3.67 g (yield: 89.0%) of the title compound.
EI (pos) 413 [M + H] ⁺

Reference Example 28
Benzyl 2- (3,4-dihydroisoquinolin-2 (1H) -ylcarbonyl) morpholine-4-carboxylate

Similar to Reference Example 21, using 4-[(benzyloxy) carbonyl] morpholine-2-carboxylic acid (2.60 g, 10.0 mmol) and 1,2,3,4-tetrahydroisoquinoline (1.99 g, 15.0 mmol) By the operation, 3.16 g (yield: 83.1%) of the title compound was obtained as an oily substance.
EI (pos) 381 [M + H] ⁺

Reference Example 29
N, N-diisopropylmorpholine-2-carboxamide

  Using the benzyl 2-[(diisopropylamino) carbonyl] morpholine-4-carboxylate (2.37 g, 6.80 mmol) obtained in Reference Example 21, the same operation as in Reference Example 4 was performed to give 1.31 g of the title compound. (Yield 90.3%) was obtained as an oil. Proceed to the next step without further purification.

Reference Example 30
N-cyclopentylmorpholine-2-carboxamide

  Using the benzyl 2-[(cyclopentylamino) carbonyl] morpholine-4-carboxylate (2.37 g, 7.13 mmol) obtained in Reference Example 22, the title compound 1.22 g was prepared in the same manner as in Reference Example 4. (Yield 86.5%) was obtained as an oil. Proceed to the next step without further purification.

Reference Example 31
N- (1-adamantyl) morpholine-2-carboxamide

  The title compound was obtained by the same procedures as in Reference Example 4 using benzyl 2-[(1-adamantylamino) carbonyl] morpholine-4-carboxylate (3.70 g, 9.28 mmol) obtained in Reference Example 23. 2.35 g (95.9% yield) was obtained as an oil. Proceed to the next step without further purification.

Reference Example 32
N, N-bis (2,2,2-trifluoroethyl) morpholine-2-carboxamide

  The same as Reference Example 4 using benzyl 2-{[bis (2,2,2-trifluoroethyl) amino] carbonyl} morpholine-4-carboxylate (0.89 g, 2.07 mmol) obtained in Reference Example 24 By performing the above operations, 0.52 g (yield: 85.2%) of the title compound was obtained as an oil. Proceed to the next step without further purification.

Reference Example 33
N-cyclohexyl-N-methylmorpholine-2-carboxamide

  Using the benzyl 2-{[cyclohexyl (methyl) amino] carbonyl} morpholine-4-carboxylate (3.17 g, 8.79 mmol) obtained in Reference Example 25, the same procedure as in Reference Example 4 was performed to give the title. 1.69 g (yield 85.3%) of the compound was obtained as an oil. Proceed to the next step without further purification.

Reference Example 34
2- (morpholin-4-ylcarbonyl) morpholine

  Using the benzyl 2- (morpholin-4-ylcarbonyl) morpholine-4-carboxylate (2.70 g, 8.07 mmol) obtained in Reference Example 26, the same operation as in Reference Example 4 was performed to give the title compound 1.42. g (yield 88.2%) was obtained as an oil. Proceed to the next step without further purification.

Reference Example 35
6-Fluoro-2-methyl-1- (morpholin-2-ylcarbonyl) -1,2,3,4-tetrahydroquinoline

  The benzyl 2-[(6-fluoro-2-methyl-3,4-dihydroquinolin-1 (2H) -yl) carbonyl] morpholine-4-carboxylate (3.67 g, 8.09 mmol) obtained in Reference Example 27 was used. Using the same procedure as in Reference Example 4, the title compound (2.02 g, yield 81.8%) was obtained as an oil. Proceed to the next step without further purification.

Reference Example 36
2- (morpholin-2-ylcarbonyl) -1,2,3,4-tetrahydroisoquinoline

  Using benzyl 2- (3,4-dihydroisoquinolin-2 (1H) -ylcarbonyl) morpholine-4-carboxylate (3.16 g, 8.30 mmol) obtained in Reference Example 28, the same procedure as in Reference Example 4 was performed. To give 1.66 g (yield 81.4%) of the title compound as an oil. Proceed to the next step without further purification.

Reference Example 37
Benzyl 4- {2-[(diisopropylamino) carbonyl] morpholin-4-yl} piperidine-1-carboxylate

Using N, N-diisopropylmorpholine-2-carboxamide (1.31 g, 6.11 mmol) obtained in Reference Example 29 and benzyl 4-oxopiperidine-1-carboxylate (2.38 g, 10.2 mmol), Reference Example 3 and The same operation was performed to obtain 2.25 g (yield: 85.5%) of the title compound as an oil.
EI (pos) 432 [M + H] ⁺

Reference Example 38
tert-butyl 4- {2-[(cyclopentylamino) carbonyl] morpholin-4-yl} piperidine-1-carboxylate

Using N-cyclopentylmorpholine-2-carboxamide (1.22 g, 6.15 mmol) obtained in Reference Example 30 and tert-butyl 4-oxopiperidine-1-carboxylate (2.10 g, 10.5 mmol), Reference Example 3 and The same operation was performed, and crystallization was performed with ethyl acetate-hexane to obtain 1.73 g (yield 73.9%) of the title compound as a powder.
EI (pos) 382 [M + H] ⁺

Reference Example 39
tert-Butyl 4- {2-[(1-adamantylamino) carbonyl] morpholin-4-yl} piperidine-1-carboxylate

Using N- (1-adamantyl) morpholine-2-carboxamide (2.35 g, 8.88 mmol) obtained in Reference Example 31 and tert-butyl 4-oxopiperidine-1-carboxylate (2.70 g, 13.5 mmol), The same operation as in Reference Example 3 was performed, and crystallization was performed with ethyl acetate-hexane to obtain 2.59 g (yield: 64.6%) of the title compound as a powder.
EI (pos) 448 [M + H] ⁺

Reference Example 40
tert-butyl 4- (2-{[bis (2,2,2-trifluoroethyl) amino] carbonyl} morpholin-4-yl) piperidine-1-carboxylate

N, N-bis (2,2,2-trifluoroethyl) morpholine-2-carboxamide (0.52 g, 1.76 mmol) obtained in Reference Example 32 and tert-butyl 4-oxopiperidine-1-carboxylate (0.62 g, 3.11 mmol) was used in the same manner as in Reference Example 3 to give the title compound (0.60 g, yield 71.4%) as an oil.
EI (pos) 478 [M + H] ⁺

Reference Example 41
tert-butyl 4- (2-{[cyclohexyl (methyl) amino] carbonyl} morpholin-4-yl) piperidine-1-carboxylate

Using N-cyclohexyl-N-methylmorpholine-2-carboxamide (1.69 g, 7.46 mmol) obtained in Reference Example 33 and tert-butyl 4-oxopiperidine-1-carboxylate (2.62 g, 13.1 mmol), The same operation as in Reference Example 3 was performed, and crystallization was performed with ethyl acetate-hexane to obtain 2.05 g (yield: 67.2%) of the title compound as a powder.
EI (pos) 410 [M + H] ⁺

Reference Example 42
tert-butyl 4- [2- (morpholin-4-ylcarbonyl) morpholin-4-yl] piperidine-1-carboxylate

Using 2- (morpholin-4-ylcarbonyl) morpholine (1.42 g, 7.09 mmol) obtained in Reference Example 34 and tert-butyl 4-oxopiperidine-1-carboxylate (2.41 g, 12.1 mmol), The same operation as in Example 3 was performed to give the title compound (2.01 g, yield 74.1%) as an oil.
EI (pos) 384 [M + H] ⁺

Reference Example 43
tert-butyl 4- {2-[(6-fluoro-2-methyl-3,4-dihydroquinolin-1 (2H) -yl) carbonyl] morpholin-4-yl} piperidine-1-carboxylate

6-Fluoro-2-methyl-1- (morpholin-2-ylcarbonyl) -1,2,3,4-tetrahydroquinoline (2.02 g, 7.25 mmol) obtained in Reference Example 35 and tert-butyl 4-oxo The same operation as in Reference Example 3 was carried out using piperidine-1-carboxylate (2.65 g, 13.3 mmol), and crystallized with ethyl acetate-hexane to give 2.29 g (yield 68.5%) of the title compound as a powder. Got as.
EI (pos) 462 [M + H] ⁺

Reference Example 44
tert-butyl 4- [2- (3,4-dihydroisoquinolin-2 (1H) -ylcarbonyl) morpholin-4-yl] piperidine-1-carboxylate

2- (morpholin-2-ylcarbonyl) -1,2,3,4-tetrahydroisoquinoline (1.66 g, 6.73 mmol) and tert-butyl 4-oxopiperidine-1-carboxylate (2.48) obtained in Reference Example 36 g, 12.4 mmol) was used in the same manner as in Reference Example 3 to give the title compound (2.31 g, yield 79.9%) as an oil.
EI (pos) 430 [M + H] ⁺

Reference Example 45
N, N-diisopropyl-4- (piperidin-4-yl) morpholine-2-carboxamide dihydrochloride

Using benzyl 4- {2-[(diisopropylamino) carbonyl] morpholin-4-yl} piperidine-1-carboxylate (1.00 g, 2.31 mmol) obtained in Reference Example 37, the same procedure as in Reference Example 4 was performed. Went. 4N Hydrogen chloride-ethyl acetate was added to the obtained oil, and the resulting powder was washed with ethyl acetate to give the title compound (0.73 g, yield 84.9%).
¹ H NMR (DMSO-d ₆ ) δ1.12-1.34 (12H, m), 2.00 (2H, m), 2.32 (2H, m), 2.88 (2H, m), 3.14 (2H, m), 3.47- 3.33 (6H, m), 4.01-4.13 (3H, m), 4.82 (1H, d, J = 9.4 Hz), 9.00 (1H, d, J = 9.9 Hz), 9.38 (1H, d, J = 9.9 Hz) ), 12.05 (1H, br).
EI (pos) 298 [M + H] ⁺

Reference Example 46
N-cyclopentyl-4- (piperidin-4-yl) morpholine-2-carboxamide dihydrochloride

Similar to Reference Example 6 using tert-butyl 4- {2-[(cyclopentylamino) carbonyl] morpholin-4-yl} piperidine-1-carboxylate (1.73 g, 4.53 mmol) obtained in Reference Example 38 The obtained powder was washed with ethyl acetate to obtain 1.20 g (yield 76.9%) of the title compound.
¹ H NMR (DMSO-d ₆ ) δ 1.47 (4H, m), 1.63 (2H, m), 1.79 (2H, m), 1.98 (2H, m), 2.30 (2H, m), 2.88 (2H, m), 3.04 (2H, m), 3.43 (5H, m), 4.03 (3H, m), 4.50 (1H, d), 8.03 (1H, br), 8.87 (1H, br), 9.20 (1H, br ), 12.09 (1H, br).
EI (pos) 282 [M + H] ⁺

Reference Example 47
N- (1-adamantyl) -4- (piperidin-4-yl) morpholine-2-carboxamide dihydrochloride

Using tert-butyl 4- {2-[(1-adamantylamino) carbonyl] morpholin-4-yl} piperidine-1-carboxylate (2.59 g, 5.78 mmol) obtained in Reference Example 39, Reference Example 6 The title compound was washed with ethyl acetate to give the title compound (1.91 g, yield 81.9%).
¹ H NMR (DMSO-d ₆ ) δ1.62 (6H, m), 1.93 (6H, m), 2.01 (5H, m), 2.31 (2H, m), 2.86 (2H, m), 3.06 (2H, m), 3.44 (5H, m), 4.08 (2H, m), 4.45 (1H, d, J = 9.0 Hz), 7.23 (1H, s), 8.94 (1H, br), 9.33 (1H, br), 12.15 (1H, br).
EI (pos) 348 [M + H] ⁺

Reference Example 48
4- (Piperidin-4-yl) -N, N-bis (2,2,2-trifluoroethyl) morpholine-2-carboxamide dihydrochloride

Tert-Butyl 4- (2-{[bis (2,2,2-trifluoroethyl) amino] carbonyl} morpholin-4-yl) piperidine-1-carboxylate (0.60 g, 1.25 The same procedure as in Reference Example 6 was performed, and the resulting powder was washed with ethyl acetate to obtain 0.40 g (yield 76.8%) of the title compound.
EI (pos) 378 [M + H] ⁺

Reference Example 49
N-cyclohexyl-N-methyl-4- (piperidin-4-yl) morpholine-2-carboxamide dihydrochloride

Using tert-butyl 4- (2-{[cyclohexyl (methyl) amino] carbonyl} morpholin-4-yl) piperidine-1-carboxylate (2.05 g, 5.00 mmol) obtained in Reference Example 41, Reference Example The same operation as in No. 6 was performed, and the resulting powder was washed with ethyl acetate to give the title compound (1.63 g, yield 85.3%).
EI (pos) 310 [M + H] ⁺

Reference Example 50
2- (morpholin-4-ylcarbonyl) -4- (piperidin-4-yl) morpholine dihydrochloride

Using tert-butyl 4- [2- (morpholin-4-ylcarbonyl) morpholin-4-yl] piperidine-1-carboxylate (2.01 g, 5.24 mmol) obtained in Reference Example 42, The same operation was performed, and the resulting powder was washed with ethyl acetate to obtain 1.43 g (yield 76.9%) of the title compound.
EI (pos) 284 [M + H] ⁺

Reference Example 51
6-Fluoro-2-methyl-1-{[4- (piperidin-4-yl) morpholin-2-yl] carbonyl} -1,2,3,4-tetrahydroquinoline dihydrochloride

Tert-butyl 4- {2-[(6-fluoro-2-methyl-3,4-dihydroquinolin-1 (2H) -yl) carbonyl] morpholin-4-yl} piperidine-1 obtained in Reference Example 43 -Carboxylate (2.29 g, 4.96 mmol) was used in the same manner as in Reference Example 6, and the resulting powder was washed with ethyl acetate to give the title compound (2.00 g, yield 93.5%).
EI (pos) 362 [M + H] ⁺

Reference Example 52
2-{[4- (Piperidin-4-yl) morpholin-2-yl] carbonyl} -1,2,3,4-tetrahydroisoquinoline dihydrochloride

Tert-Butyl 4- [2- (3,4-dihydroisoquinolin-2 (1H) -ylcarbonyl) morpholin-4-yl] piperidine-1-carboxylate (2.31 g, 5.37 mmol) obtained in Reference Example 44 Was used for the same operation as in Reference Example 6, and the obtained powder was washed with ethyl acetate to give the title compound (1.73 g, yield 80.1%).
EI (pos) 330 [M + H] ⁺

Reference Example 53
1-Benzyl 4-tert-butyl 2-[(ethylamino) carbonyl] piperazine-1,4-dicarboxylate

Reference Example 1 using 1-[(benzyloxy) carbonyl] -4- (tert-butoxycarbonyl) piperazine-2-carboxylic acid (1.50 g, 4.12 mmol) and 70% aqueous ethylamine solution (0.319 ml, 4.94 mmol) The title compound (1.61 g, quantitative) was obtained as an oil by an operation similar to that described above.
EI (pos) 392 [M + H] ⁺

Reference Example 54
Benzyl 2-[(ethylamino) carbonyl] piperazine-1-carboxylate

  Using 1-benzyl 4-tert-butyl 2-[(ethylamino) carbonyl] piperazine-1,4-dicarboxylate (1.61 g, 4.12 mmol) obtained in Reference Example 53, the same as Reference Example 2 By the operation, 1.07 g (yield 89.5%) of the title compound was obtained as an oily substance. Proceed to the next step without further purification.

Reference Example 55
Benzyl 4- [1- (tert-butoxycarbonyl) piperidin-4-yl] -2-[(ethylamino) carbonyl] piperazine-1-carboxylate

Benzyl 2-[(ethylamino) carbonyl] piperazine-1-carboxylate (1.07 g, 3.67 mmol) and tert-butyl 4-oxopiperidine-1-carboxylate (805 mg, 4.04 mmol) obtained in Reference Example 54 The title compound was obtained in the same manner as in Reference Example 3 to give 1.37 g (yield 78.6%) of the title compound as an oil.
EI (pos) 475.3 [M + H] ⁺

Reference Example 56
tert-butyl 4- {3-[(ethylamino) carbonyl] piperazin-1-yl} piperidine-1-carboxylate

  Using benzyl 4- [1- (tert-butoxycarbonyl) piperidin-4-yl] -2-[(ethylamino) carbonyl] piperazine-1-carboxylate (1.36 g, 2.87 mmol) obtained in Reference Example 55 In the same manner as in Reference Example 4, the title compound (976 mg, quantitative) was obtained as an oil. Proceed to the next step without further purification.

Reference Example 57
tert-butyl 4- [3-[(ethylamino) carbonyl] -4- (trifluoroacetyl) piperazin-1-yl] piperidine-1-carboxylate

Same as Reference Example 5 using tert-butyl 4- {3-[(ethylamino) carbonyl] piperazin-1-yl} piperidine-1-carboxylate (976 mg, 2.87 mmol) obtained in Reference Example 56 To give the title compound (1.25 g, yield 99.9%) as an oil.
EI (pos) 437.3 [M + H] ⁺

Reference Example 58
N-ethyl-4- (piperidin-4-yl) -1- (trifluoroacetyl) piperazine-2-carboxamide

  The tert-butyl 4- [3-[(ethylamino) carbonyl] -4- (trifluoroacetyl) piperazin-1-yl] piperidine-1-carboxylate (1.24 g, 2.84 mmol) obtained in Reference Example 57 was used. The same operation as in Reference Example 6 was performed. Diisopropyl ether was added to the resulting oil to give 1.16 g (quantitative) of the title compound. Proceed to the next step without further purification.

Reference Example 59
N, N-diethyl-3- (pyridin-4-yl) benzamide

3-Bromo-N, N-diethylbenzamide (3.00 g, 11.7 mmol), pyridin-4-ylboronic acid (2.88 g, 23.4 mmol), 2N aqueous sodium carbonate solution (11.7 ml) in THF (120 ml) with nitrogen Tetrakistriphenylphosphine palladium (406 mg, 0.351 mmol) was added under an atmosphere, and the mixture was heated to reflux for 1 day. The reaction mixture was cooled to room temperature, ethyl acetate was added, the aqueous layer was separated, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the resulting residue was purified by silica gel column chromatography (developing solvent; hexane-ethyl acetate = 1: 1 to ethyl acetate) to give 2.05 g (yield 68.8%) of the title compound as an oil. Obtained as a thing.
EI (pos) 255.2 [M + H] ⁺

Reference Example 60
tert-butyl 4- {3-[(diethylamino) carbonyl] phenyl} piperidine-1-carboxylate

A suspension of N, N-diethyl-3- (pyridin-4-yl) benzamide (1.73 g, 6.80 mmol) obtained in Reference Example 59 and rhodium carbon (700 mg) in acetic acid (40 ml) was added at 0.5 MPa. The mixture was stirred at 80 ° C. for 5 hours under hydrogen atmosphere. After completion of the reaction, rhodium carbon was removed by filtration, and the filtrate was concentrated under reduced pressure. Di-tert-butyl dicarbonate (1.56 ml, 6.80 mmol) was added to a THF (50 ml) -water (50 ml) mixed solution of the obtained residue and potassium carbonate (2.82 g, 20.4 mmol), and the mixture was stirred for 16 hours. Ethyl acetate was added to the reaction solution, and the aqueous layer was separated. The aqueous layer was washed with 0.5N hydrochloric acid, aqueous potassium carbonate solution and saturated brine, and dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure, and the resulting residue was passed through silica gel column chromatography (developing solvent; hexane: ethyl acetate = 3: 1 to 1: 1) to give 1.23 g (yield 50.2%) of the title compound as an oil. Obtained as a thing.
EI (pos) 361.0 [M + H] ⁺

Reference Example 61
N, N-diethyl-3- (piperidin-4-yl) benzamide hydrochloride

  Perform the same operation as in Reference Example 6 using tert-butyl 4- {3-[(diethylamino) carbonyl] phenyl} piperidine-1-carboxylate (1.23 g, 3.41 mmol) obtained in Reference Example 60. Gave 906 mg (yield 89.7%) of the title compound. Proceed to the next step without further purification.

Reference Example 62
Benzyl 4- {3-[(diethylamino) carbonyl] -4-nitrophenyl} piperazine-1-carboxylate

DMSO of N, N-diethyl-5-fluoro-2-nitrobenzamide (5.60 g, 23.3 mmol), benzyl piperazine-1-carboxylate (9.00 ml, 46.6 mmol) and potassium carbonate (3.22 g, 23.3 mmol) (45 ml) The suspension was stirred at 60 ° C. for 1 hour. Ethyl acetate was added to the reaction mixture, washed with aqueous potassium carbonate solution and saturated brine, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was passed through silica gel column chromatography (developing solvent; hexane: ethyl acetate = 1: 1 to ethyl acetate) to give 9.21 g (yield 89.4%) of the title compound as an oil. Got as.
EI (pos) 441.2 [M + H] ⁺

Reference Example 63
Benzyl 4- {4-amino-3-[(diethylamino) carbonyl] phenyl} piperazine-1-carboxylate

  Zinc powder in 90% acetic acid (20 ml) solution of benzyl 4- {3-[(diethylamino) carbonyl] -4-nitrophenyl} piperazine-1-carboxylate (605 mg, 1.37 mmol) obtained in Reference Example 62 (4.49 g, 68.7 mmol) was added, and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was filtered and the filtrate was concentrated under reduced pressure. Ethyl acetate was added to the residue, washed with aqueous potassium carbonate solution and saturated brine, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give the title compound (564 mg, quantitative) as an oil. Proceed to the next step without further purification.

Reference Example 64
Benzyl 4- {3-[(ethylamino) carbonyl] phenyl} piperazine-1-carboxylate

Benzyl 4- {4-amino-3-[(diethylamino) carbonyl] phenyl} piperazine-1-carboxylate (564 mg, 1.37 mmol) obtained in Reference Example 63 was added to ethanol (7 ml) and sulfuric acid (2.3 ml). After being dissolved in sodium nitrite (190 mg, 2.75 mmol) was added and stirred for 3 hours. Copper powder (175 mg, 2.75 mmol) was added to the reaction solution, and the mixture was stirred for 2 hours. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure. Ethyl acetate was added to the residue, washed with aqueous potassium carbonate solution and saturated brine, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was passed through silica gel column chromatography (developing solvent; hexane: ethyl acetate = 1: 1 to ethyl acetate) to give 392 mg (yield 77.6%) of the title compound as an oil. Got as.
¹ H NMR (DMSO-d ₆ ) δ1.24 (3H, t, J = 6.0 Hz), 3.20 (4H, m), 3.48 (2H, m), 3.66 (4H, m), 5.17 (2H, s) , 6.13 (1H, m), 7.02 (1H, dd, J = 6.0, 3.0 Hz), 7.14 (1H, d, J = 6.0 Hz), 7.26-7.40 (7H, m).
EI (pos) 367.9 [M + H] ⁺

Reference Example 65
Benzyl 4- {3-[(diethylamino) carbonyl] phenyl} piperazine-1-carboxylate

To a solution of benzyl 4- {3-[(ethylamino) carbonyl] phenyl} piperazine-1-carboxylate (392 mg, 1.07 mmol) obtained in Reference Example 64 in THF (5 ml), 60% sodium hydride (64.0 mg, 1.60 mmol) and ethyl iodide (0.102 ml, 1.28 mmol) were added, and the mixture was stirred at 60 ° C. for 16 hours. Ethyl acetate was added to the reaction solution, washed with aqueous potassium carbonate solution and saturated brine, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was passed through silica gel column chromatography (developing solvent; hexane: ethyl acetate = 1: 1 to 1: 3) to give 205 mg (yield 48.6%) of the title compound as an oil. Obtained as a thing.
EI (pos) 396.0 [M + H] ⁺

Reference Example 66
N, N-diethyl-3- (piperazin-1-yl) benzamide

  By performing the same operation as in Reference Example 4 using benzyl 4- {3-[(diethylamino) carbonyl] phenyl} piperazine-1-carboxylate (205 mg, 0.518 mmol) obtained in Reference Example 65, 135 mg (quantitative) of the title compound were obtained. Proceed to the next step without further purification.

Example 1
4-{[4- [1- (9-anthrylcarbonyl) piperidin-4-yl] -1- (trifluoroacetyl) piperazin-2-yl] carbonyl} morpholine

4-{[4-Piperidin-4-yl-1- (trifluoroacetyl) piperazin-2-yl] carbonyl} morpholine dihydrochloride (206 mg, 0.456 mmol) obtained in Reference Example 6, anthracene-9- Add EDC ^. HCl (87.5 mg, 0.456 mmol) to a DMF (1 ml) solution of carboxylic acid (101 mg, 0.456 mmol), HOBt (70 mg, 0.456 mmol) and triethylamine (0.14 ml, 1.00 mmol) under ice cooling. And stirred at room temperature for 16 hours. The reaction solution was dissolved in ethyl acetate, washed with aqueous sodium hydrogen carbonate solution and saturated brine, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (developing solvent; hexane-ethyl acetate = 1: 1 to ethyl acetate) to give 226 mg (yield 85.0%) of the title compound as an oil. Obtained as a thing.
EI (pos) 583.2 [M + H] ⁺

Example 2
4-({4- [1- (9-anthrylcarbonyl) piperidin-4-yl] piperazin-2-yl} carbonyl) morpholine

4-{[4- [1- (9-anthrylcarbonyl) piperidin-4-yl] -1- (trifluoroacetyl) piperazin-2-yl] carbonyl} morpholine obtained in Example 1 (226 mg, Methanol (3 ml) and water (1 ml) were added to 0.388 mmol) and potassium carbonate (161 mg, 1.16 mmol), and the mixture was stirred for 16 hours. Ethyl acetate was added to the reaction mixture, washed with aqueous potassium carbonate solution and saturated brine, and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the obtained residue was triturated with diisopropyl ether-hexane (1: 1) to give the title compound (162 mg, yield 85.7%).
EI (pos) 487.1 [M + H] ⁺

Example 3
4- [1- (9-Anthrylcarbonyl) piperidin-4-yl] -N, N-diethyl-1- (trifluoroacetyl) piperazine-2-carboxamide

N, N-diethyl-4- (piperidin-4-yl) -1- (trifluoroacetyl) piperazine-2-carboxamide (550 mg, 1.26 mmol) obtained in Reference Example 12 and anthracene-9-carboxylic acid ( 307 mg, 1.38 mmol), and the same operation as in Example 1 was carried out to give 328 mg (yield 45.8%) of the title compound as an oil.
EI (pos) 569.1 [M + H] ⁺

Example 4
4- [1- (9-Anthrylcarbonyl) piperidin-4-yl] -N, N-diethylpiperazine-2-carboxamide

4- [1- (9-anthrylcarbonyl) piperidin-4-yl] -N, N-diethyl-1- (trifluoroacetyl) piperazine-2-carboxamide (306 mg, 0.538 mmol) obtained in Example 3 ) To give the title compound 234 mg (yield 92.1%) as an oil.
EI (pos) 473.1 [M + H] ⁺

Example 5
4- [1- (9-Anthrylcarbonyl) piperidin-4-yl] -N, N-diethyl-6-oxopiperazine-2-carboxamide

N, N-diethyl-6-oxo-4- (piperidin-4-yl) piperazine-2-carboxamide dihydrochloride (74.2 mg, 0.209 mmol) obtained in Reference Example 16 and anthracene-9-carboxylic acid (51.1 mg, 0.230 mmol), and the same operation as in Example 1 was performed to obtain an oily substance. Diisopropyl ether was added to the resulting oil to give 72.8 mg (yield 71.4%) of the title compound as a powder.
EI (pos) 487.2 [M + H] ⁺

Example 6
4- [1- (9-Anthrylcarbonyl) piperidin-4-yl] -N, N-diethylmorpholine-2-carboxamide

N, N-diethyl-4- (piperidin-4-yl) morpholine-2-carboxamide hydrochloride (200 mg, 0.654 mmol) and anthracene-9-carboxylic acid (160 mg, 0.719 mmol) obtained in Reference Example 20 The title compound was obtained in the same manner as in Example 1 to obtain 197 mg of the title compound (yield 63.5%).
EI (pos) 474.0 [M + H] ⁺

Example 7
4- [1- (2,6-Diphenylisonicotinoyl) piperidin-4-yl] -N, N-diethylmorpholine-2-carboxamide

N, N-diethyl-4- (piperidin-4-yl) morpholine-2-carboxamide hydrochloride (170 mg, 0.556 mmol) and 2,6-diphenylisonicotinic acid (168 mg, 0.556) obtained in Reference Example 20 The title compound was obtained in the same manner as in Example 1 to obtain 143 mg (yield: 48.8%).
EI (pos) 527.0 [M + H] ⁺

Example 8
N, N-diethyl-4- (1-{[2- (2-thienyl) quinolin-4-yl] carbonyl} piperidin-4-yl) morpholine-2-carboxamide

N, N-diethyl-4- (piperidin-4-yl) morpholine-2-carboxamide hydrochloride (195 mg, 0.638 mmol) and 2- (2-thienyl) quinoline-4-carboxylic acid obtained in Reference Example 20 (163 mg, 0.638 mmol) was used in the same manner as in Example 1 to obtain 296 mg (yield 91.6%) of the title compound.
EI (pos) 507.3 [M + H] ⁺

Example 9
4- [1- (9-Anthrylcarbonyl) piperidin-4-yl] -N-ethyl-1- (trifluoroacetyl) piperazine-2-carboxamide

N-ethyl-4- (piperidin-4-yl) -1- (trifluoroacetyl) piperazine-2-carboxamide (1.16 g, 2.84 mmol) obtained in Reference Example 58 and anthracene-9-carboxylic acid (631 mg , 2.84 mmol), and the same operation as in Example 1 was performed to give the title compound (856 mg, yield 55.6%) as an oil.
EI (pos) 541.3 [M + H] ⁺

Example 10
4- [1- (9-Anthrylcarbonyl) piperidin-4-yl] -N-ethylpiperazine-2-carboxamide

4- [1- (9-anthrylcarbonyl) piperidin-4-yl] -N-ethyl-1- (trifluoroacetyl) piperazine-2-carboxamide (855 mg, 1.58 mmol) obtained in Example 9 was used. Using the same procedure as in Example 2, the title compound (525 mg, yield 74.7%) was obtained as an oil.
EI (pos) 445.2 [M + H] ⁺

Example 11
3- [1- (9-Anthrylcarbonyl) piperidin-4-yl] -N, N-diethylbenzamide

Using N, N-diethyl-3- (piperidin-4-yl) benzamide hydrochloride (140 mg, 0.472 mmol) obtained in Reference Example 61 and anthracene-9-carboxylic acid (105 mg, 0.472 mmol), The same operation as in Example 1 was performed to obtain 139 mg (yield: 63.4%) of the title compound as an oil.
EI (pos) 465.0 [M + H] ⁺

Example 12
3- [4- (9-Anthrylcarbonyl) piperazin-1-yl] -N, N-diethylbenzamide

Using N, N-diethyl-3- (piperazin-1-yl) benzamide (135 mg, 0.517 mmol) and anthracene-9-carboxylic acid (115 mg, 0.517 mmol) obtained in Reference Example 66, an Example The same operation as in 1 was carried out to obtain 173 mg (yield 72.2%) of the title compound as an oil.
EI (pos) 466.0 [M + H] ⁺

  In Examples 13-182, the titles of the titles were obtained in the same manner as in Example 1 using the 8 types of amines (60.0 μmol) obtained in Reference Examples 45-52 and various carboxylic acids (65.0 μmol). The compound was obtained as a formate salt. These compounds are shown in Table 1 to Table 7. The compounds in the table are represented by the formula

In the table, the first stage is an example number, the second stage is yield (mg), the third stage is yield (%), the fourth stage is EI (pos) [M + H] ⁺ is shown respectively.

Experimental example 1
The ACC1 inhibitory action of the compound of the present invention was evaluated by the following method.
(1) Cloning of human ACC1 gene and preparation of recombinant baculovirus The human ACC1 gene was cloned by PCR using Primer 1 and Primer 2 shown below using a human liver cDNA library (Clontech) as a template. Primer1 and Primer2 were prepared by adding SalI and NotI restriction enzyme recognition sequences based on the information on the base sequence of the human ACC1 gene (Genbank Accession U19822).
Primer 1 5'AAAAGTCGACCCACCATGGATGAACCTTCTCCCTTGGCCC
Primer 2 5'AAAAGCGGCCGCCTACGTAGAAGGGGAGTCCATAGTG
PCR was performed using Pyrobest DNA polymerase (Takara Bio Inc.). The obtained PCR product was cloned into pT7 Blue vector (Novagen), and after confirming the nucleotide sequence, it was digested with restriction enzymes SalI and NotI. The obtained DNA fragment was inserted into pFAST-BacHTc (Invitrogen) digested with restriction enzymes SalI and NotI to prepare an expression plasmid ACC1 / pFAST-BacHTc.
Using the expression plasmid and BAC-TO-BAC Baculovirus Expression System (Invitrogen), recombinant baculovirus virus stock BAC-ACC1 was prepared.

(2) Preparation of ACC1 protein
SF-9 cells (Invitrogen) were added to insect cell culture medium (10% fetal bovine serum (Trace), 50 mg / L Gentamicin (Invitrogen), 0.1% Pluronic F-68 (Invitrogen) Sf-900IISFM medium (Invitrogen) Invitrogen)) 1 L was seeded at 1 × 10 ⁶ cells / mL, and cultured with shaking using 2 L Meyer at 27 ° C. and 100 rpm.
After 24 hours of culture, 10 mL of recombinant baculovirus BAC-ACC1 was added, and further cultured for 3 days. The culture solution was centrifuged at 1000 × g for 5 minutes to obtain virus-infected cells. The cells were washed with phosphate physiological buffer (Invitrogen) and centrifuged under the same conditions, and the resulting cells were stored frozen at -80 ° C.
After thawing the cryopreserved cells in ice, 25 mM HEPES buffer (pH 7.5) containing 10% Glycerol, 0.13 M NaCl, 1 mM EDTA, 25 mM Sodium β-Glycerophosphate, 1 mM Sodium Orthovanadate with Complete Protease Inhibitor (Boehringer) added. ) Suspended in 100 mL. The resulting suspension was homogenized three times using a Polytron homogenizer (Kinematica) at 20,000 rpm for 30 seconds. The obtained cell lysate was clarified by centrifugation at 185700 × g for 50 minutes, followed by filtration using a 0.45 μm filter. The filtrate was passed through a column packed with 12 mL of Ni-NTA Super Flow Gel (Qiagen) at a flow rate of about 5 mL / min. The column was washed with buffer A (50 mM HEPES (pH 7.5) containing 0.3 M NaCl), further washed with buffer A containing 20 mM Imidazole, and then eluted with buffer A containing 100 mM Imidazole. The eluate was concentrated with Vivapine 20 (Viva Science) having a molecular weight cut off of 30K. The resulting concentrated solution was dialyzed against 358 mL of Sephadex G-25 (Amersham Biosciences) equilibrated with 50 mM HEPES (pH 7.5) containing 10 mM MgCl ₂ , 2 mM Dithiothreitol, 10 mM Tripotassium Citrate, and 0.3 M NaCl. The dialyzed internal solution was concentrated with Vivaspin 20 (Vivascience) having a molecular weight cut off of 30K, and then the concentrated solution was filtered with a 0.22 μm filter to obtain ACC1. The obtained ACC1 was stored frozen at -80 ° C.

(3) Measurement of ACC1 inhibitory activity ACC1 (0.93 mg / ml) obtained in (2) above was used as a buffer for enzyme reaction (50 mM HEPES (pH 7.5), 10 mM MgCl ₂ , 10 mM Tripottasium Citrate, 2 mM Dithiothreitol, 0.75 mg / ml Fatty acid free BSA) was diluted to a concentration of 8 μg / ml, and 10 μl was added to each well of a 384 well assay plate (Nunc 265196).
Thereafter, in the same manner as in Experimental Example 2- (3) described later, the ACC1 inhibition rate (%) was determined, and the IC ₅₀ value was calculated.
The results are shown in [Table 8].

  As shown in Table 8, the compound of the present invention has an excellent ACC1 inhibitory action.

Experimental example 2
The ACC2 inhibitory action of the compound of the present invention was evaluated by the following method.
(1) Cloning of human ACC2 gene and preparation of recombinant baculovirus The human ACC2 gene was cloned by PCR using Primer 1 and Primer 2 shown below using a human skeletal muscle cDNA library (Clontech) as a template. Primer1 and Primer2 were prepared by adding SalI and XbaI restriction enzyme recognition sequences based on the information on the base sequence (Genbank Accession U89344) of the human ACC2 gene.
Primer 1 5'AAAAGTCGACCCACCATGGTCTTGCTTCTTTGTCTATCTTG
Primer 2 5'TTTTTCTAGATCAGGTAGAGGCCGGGCTGTCCATG
PCR was performed using Pyrobest DNA polymerase (Takara Bio Inc.). The obtained PCR product was cloned into pT7 Blue vector (Novagen), and after confirming the base sequence, digested with restriction enzymes SalI and XbaI. The obtained DNA fragment was inserted into pFAST-BacHTa (Invitrogen) digested with restriction enzymes SalI and XbaI to prepare an expression plasmid ACC2 / pFAST-BacHTa.
Using the expression plasmid as a template, a plasmid for expressing ACC2 from which the mitochondrial translocation sequence was removed was prepared by PCR using Primer 3 and Primer 4 shown below.
Primer 3 5'CCAGGTCGACCCGCCAACGGGACTGGGACACAAGG
Primer 4 5'CGCACTCTCAGTTTCCCGGATTCCC
PCR was performed using Pyrobest-DNA polymerase (Takara Bio Inc.). The obtained PCR product was cloned into pT7Blue vector (Novagen), and after confirming the nucleotide sequence, it was digested with restriction enzymes SalI and AflII. The obtained DNA fragment was inserted into pFAST-BacHTa (Invitrogen) digested with restriction enzymes SalI and AflII to prepare an expression plasmid ACC2mito7 / pFAST-BacHTa.
Using the expression plasmid and BAC-TO-BAC Baculovirus Expression System (Invitrogen), virus stock BAC-ACC2 (N terminal deletion (hereinafter referred to as Nd)) of recombinant baculovirus was prepared.

(2) Preparation of ACC2 (Nd) protein
SF-9 cells (Invitrogen) were added to insect cell culture medium (10% fetal bovine serum (Trace), 50 mg / L Gentamicin (Invitrogen), 0.1% Pluronic F-68 (Invitrogen) Sf-900IISFM medium (Invitrogen) Invitrogen)) 2 L was seeded at 0.5 × 10 ⁶ cells / mL, and cultured with shaking using a Wave bioreactor (Wave) at 27 ° C., 20 rpm, rocking angle 6 °, and oxygen concentration 30%.
On the fourth day of culture, 3 L of insect cell culture medium was added to make the rocking angle 8 °, and further culture was performed. On the fifth day of culture, 100 mL of recombinant baculovirus BAC-ACC2 (Nd) was added, 5 L of insect cell medium was further added, and the culture was performed for 3 days at an oscillation angle of 11 degrees. The culture solution was centrifuged at 1000 × g for 10 minutes to obtain virus-infected cells. The cells were washed with phosphate physiological buffer (Invitrogen) and centrifuged under the same conditions, and the resulting cells were stored frozen at -80 ° C.
After thawing the cryopreserved cells in ice, 25 mM HEPES buffer (pH 7.5) containing 10% Glycerol, 0.13 M NaCl, 1 mM EDTA, 25 mM Sodium β-Glycerophosphate, 1 mM Sodium Orthovanadate with Complete Protease Inhibitor (Boehringer) added. ) Suspended in 900 mL. The resulting suspension was homogenized three times using a Polytron homogenizer (Kinematica) at 20,000 rpm for 30 seconds. The obtained cell lysate was clarified by centrifugation at 31000 × g for 60 minutes, and then filtered using a 0.45 μm filter. The filtrate was passed through a column packed with 60 mL of Ni-NTA Super Flow Gel (Qiagen) at a flow rate of about 5 mL / min. The column was washed with buffer A (50 mM HEPES (pH 7.5) containing 0.3 M NaCl), further washed with buffer A containing 20 mM Imidazole, and then eluted with buffer A containing 100 mM Imidazole. The eluate was concentrated with Vivapine 20 (Viva Science) having a molecular weight cut off of 30K. The resulting concentrated solution was dialyzed against 50 mM HEPES (pH 7.5) containing 10 mM MgCl ₂ , 2 mM Dithiothreitol, 10 mM Tripotassium Citrate, 0.3 M NaCl. The dialyzed solution was filtered with a 0.22 μm filter to obtain ACC2 (Nd). The obtained ACC2 (Nd) was stored frozen at −80 ° C.

(3) Measurement of ACC2 inhibitory activity ACC2 (Nd) (1.1 mg / ml) obtained in (2) above was used as a buffer for enzyme reaction (50 mM HEPES (pH 7.5), 10 mM MgCl ₂ , 10 mM Tripottasium Citrate, 2 mM) Dithiothreitol, 0.75 mg / ml Fatty acid free BSA) was diluted to a concentration of 6.4 μg / ml, and 10 μl was added to each well of a 384 well assay plate (Nunc 265196). Next, 5 μl each of a test compound dissolved in dimethyl sulfoxide (DMSO) diluted with an enzyme reaction buffer was added to each well and incubated at 30 ° C. for 60 minutes. Next, 5 μl of a substrate solution (50 mM KHCO ₃ , 200 uM ATP, 200 uM Acetyl-CoA) was added to each well and reacted at 30 ° C. for 20 minutes (test compound addition group).
Moreover, except not adding a test compound, reaction similar to the above was performed (test compound non-addition group). Further, a reaction similar to the above was carried out except that the test compound and Acetyl-CoA were not added (control group).
The reaction was stopped by adding 5 μl of malachite green solution to each reaction solution thus obtained and stirring. The resulting reaction solution was allowed to stand at room temperature for 20 minutes, and then the absorbance (620 nm) was measured using wallac1420 (Perkin Elmer). The malachite green solution is a solution A (0.12% malachite green solution. Prepared with 5N H ₂ SO ₄ and stored at 4 ° C. protected from light), solution B (7.5% ammonium molybdate aqueous solution, prepared at the time of use) and solution C. (11% Tween 20 aqueous solution, stored at room temperature) was prepared by mixing at a ratio (volume ratio) of liquid A: liquid B: liquid C = 100: 25: 2.
Next, the ACC2 inhibition rate (%) is calculated using the following formula:
(1− (absorbance of test compound added group−absorbance of control group) ÷ (absorbance of no test compound added group−absorbance of control group)) × 100
IC ₅₀ value was calculated.
The results are shown in [Table 9].

  As shown in Table 9, the compound of the present invention has an excellent ACC2 inhibitory action.

Formulation Example 1 (Manufacture of capsules)
1) Compound of Example 1 30 mg
2) Fine powder cellulose 10 mg
3) Lactose 19 mg
4) Magnesium stearate 1 mg
60 mg total
1), 2), 3) and 4) are mixed and filled into gelatin capsules.

Formulation Example 2 (Manufacture of tablets)
1) 30 g of the compound of Example 1
2) Lactose 50 g
3) Corn starch 15 g
4) Carboxymethylcellulose calcium 44 g
5) Magnesium stearate 1 g
1000 tablets total 140 g
The total amount of 1), 2), and 3) and 30 g of 4) are kneaded with water, dried in a vacuum, and then sized. 14 g of 4) and 1 g of 5) are mixed with the sized powder, and tableted with a tableting machine. In this way, 1000 tablets containing 30 mg of the compound of Example 1 per tablet are obtained.

  The compound of the present invention has an ACC (acetyl-CoA carboxylase) inhibitory action, and is used for the prevention and treatment of obesity, diabetes, hypertension, hyperlipidemia, heart failure, diabetic cardiomyopathy, metabolic syndrome, sarcopenia, etc. Useful.

Claims (6)

formula

[Where:
E represents an optionally substituted cyclic group (provided that the cyclic group is not a spirocyclic group. When the cyclic group is a monocyclic group, the cyclic group may be substituted as a substituent. Having at least two good cyclic groups);
D and G independently represent a carbonyl group or a sulfonyl group;
Ring P represents an optionally substituted nitrogen-containing 5- or 6-membered non-aromatic heterocyclic ring;
Ring Q is an optionally substituted aromatic ring or an optionally substituted non-aromatic heterocycle (wherein the non-aromatic heterocycle contains 2 or more heteroatoms);
A and L independently represent C, CH or N;
J represents a hydrocarbon group which may be substituted, a hydroxy group which may be substituted, a heterocyclic group which may be substituted or an amino group which may be substituted. ]
Or a salt thereof (excluding “4- [1- (9-anthrylcarbonyl) piperidin-4-yl] -2- (morpholin-4-ylcarbonyl) morpholine”).   The compound according to claim 1, wherein E is an optionally substituted aromatic ring group.   A prodrug of the compound of claim 1.   A medicament comprising the compound according to claim 1 or a prodrug thereof.   An acetyl-CoA carboxylase inhibitor comprising the compound according to claim 1 or a prodrug thereof.   The medicament according to claim 4, which is a prophylactic / therapeutic agent for obesity, diabetes, hypertension, hyperlipidemia, heart failure, diabetic cardiomyopathy, metabolic syndrome or sarcopenia.