JP2005524410A - Nucleic acids, polypeptides and methods for apoptosis regulation - Google Patents

Abstract

The present invention relates to isolated and / or purified rat apoptosis-specific eukaryotic translation initiation factor-5A (eIF-5A) and deoxyhypusine synthase (DHS) nucleic acids and polypeptides. The present invention also relates to methods of modulating apoptosis using apoptosis-specific eIF-5A and DHS, and apoptosis-specific eIF-5A and DHS antisense oligonucleotides and expression vectors useful in such methods. .

Description

TECHNICAL FIELD OF THE INVENTION The present invention relates to nucleic acids and polypeptides of apoptosis-specific eukaryotic translation initiation factor-5A (eIF-5A) and deoxyhypusine synthase (DHS), and apoptosis-specific eIF-5A and DHS. Relates to a method of modulating apoptosis in cells using.

BACKGROUND OF THE INVENTION Apoptosis is a genetically programmed cellular event characterized by well-defined morphological features such as cell shrinkage, chromatin condensation, nuclear fragmentation and membrane foam. Kerr et al., Br. J. Cancer, 26: 239-257 (1972); Wyllie et al., Int. Rev. Cytol, 68: 251-306 (1980). This plays an important role in normal tissue development and homeostasis, and deficiencies in the apoptotic program are thought to be responsible for a wide range of human disorders, from neurodegenerative and autoimmune system disorders to neoplasms. Thompson, Science, 267: 1456-1462 (1995); Mullauer et al., Mutat. Res, 488: 211-231 (2001). Although the morphological characteristics of apoptotic cells are well characterized, the molecular pathways that regulate this process are just beginning to be elucidated.

  A group of proteins that are thought to play an important role in apoptosis is a family of cysteine proteases called caspases, which appear to be necessary for most pathways of apoptosis. Creagh and Martin, Biochem. Soc. Trans, 29: 696-701 (2001); Dales et al., Leuk Lymphoma, 41: 247-253 (2001). Caspases cause apoptosis in response to apoptotic stimuli by cleaving various cellular proteins, resulting in classical apoptotic signs, including cell shrinkage, membrane foam and DNA fragmentation. Chang and Yang, Microbiol. Mol. Biol. Rev., 64: 821-846 (2000).

  Pro-apoptotic proteins such as Bax or Bak also play an important role in the apoptotic pathway by releasing caspase-activating molecules such as mitochondrial cytochrome c, thereby promoting cell death by apoptosis. Martinou and Green, Nat. Rev. Mol. Cell. Biol., 2: 63-67 (2001); Zou et al., Cell, 90: 405-413 (1997). Anti-apoptotic proteins such as Bcl-2 promote cell survival by antagonizing the activity of the pro-apoptotic proteins Bax and Bak. Tsujimoto, Genes Cells, 3: 697-707 (1998); Kroemer, Nature Med., 3: 614-620 (1997). The Bax: Bcl-2 ratio is believed to be one of the ways to determine cell fate; excess Bax promotes apoptosis and excess Bcl-2 promotes cell survival. Salomons et al., Int. J. Cancer, 71: 959-965 (1997); Wallace-Brodeur and Lowe, Cell Mol. Life Sci., 55: 64-75 (1999).

  Another important protein associated with apoptosis is that encoded by the tumor suppressor gene p53. This protein is a transcription factor that regulates cell growth and induces apoptosis in damaged and genetically unstable cells, possibly through up-regulation of Bax. Bold et al., Surgical Oncology, 6: 133-142 (1997); Ronen et al., 1996; Schuler and Green, Biochem. Soc. Trans., 29: 684-688 (2001); Ryan et al., Curr. Opin. Cell Biol. 13: 332-337 (2001); Zornig et al., Biochem. Biophys. Acta, 1551: F1-F37 (2001).

  The individual morphological features that characterize cells undergoing apoptosis have created many ways to assess the onset and progression of apoptosis. One feature of such apoptotic cells that can be used for their detection is the flippase that results in the externalization of phosphatidylserine, a phospholipid normally localized to the inner leaflet of the plasma membrane. Activation. Fadok et al., J. Immunol., 149: 4029-4035 (1992). Apoptotic cells that produce outwardly transported phosphatidylserine can be detected by staining with Annexin V, a phosphatidylserine-binding protein conjugated to a fluorescent dye. Characteristic DNA fragmentation that occurs during the apoptotic process can be detected by labeling the exposed 3′-OH end of the DNA fragment with fluorescein-labeled deoxynucleotides. Fluorescent dyes that bind to nucleic acids, such as Hoescht 33258, can be used to detect chromatin condensation and nuclear fragmentation in apoptotic cells. The degree of apoptosis within a cell population can also be estimated by the degree of proteolytic activity of caspases present in cell extracts.

  Like genetically defined processes, apoptosis can be disrupted by mutation, as can other developmental programs. Changes in the apoptotic pathway are thought to play an important role in many disease processes, including cancer. Wyllie et al., Int. Rev. Cytol., 68: 251-306 (1980); Thompson, Science, 267: 1456-1462 (1995); Sen and D'Incalci, FEBS Letters, 307: 122-127 (1992); McDonnell et al., Seminars in Cancer and Biology, 6: 53-60 (1995). Cancer development and progression studies have traditionally focused on cell proliferation. However, the important role that apoptosis plays in tumorigenesis has recently become apparent. Indeed, since the regulation of apoptosis is constantly altered in some way in tumor cells, much currently known about apoptosis is being studied using tumor models. Bold et al., Surgical Oncology, 6: 133-142 (1997).

  Apoptosis can be triggered during tumor development by various signals. Extracellular signals include growth factor or survival factor depletion, hypoxia and ionizing radiation. Internal signals that can trigger apoptosis include DNA damage, telomere shortening, and oncogenic mutations that result in inappropriate proliferation signals. Lowe & Lin, Carcinogenesis, 21: 485-495 (2000). Ionizing radiation and almost all cytotoxic chemotherapeutic agents used to treat malignancies are thought to act to induce cell death by triggering the intrinsic apoptotic mechanism. Rowan and Fisher, Leukemia, 11: 457-465 (1997); Kerr et al., Cancer, 73: 2013-2026 (1994); Martin and Schwartz, Oncology Research, 9: 1-5 (1997).

  There is evidence to suggest that early in cancer progression, tumor cells are sensitive to agents that induce apoptosis (eg, ionizing radiation or chemotherapeutic agents). However, as the tumor progresses, these cells develop resistance to apoptotic stimuli. Naik et al., Genes and Development, 10: 2105-2116 (1996). This may explain why early stage cancer responds better to treatment than more advanced lesions. The ability to develop resistance to chemotherapy and radiation therapy for late stage cancers appears to be linked to alterations in the apoptotic pathway that limit the ability of tumor cells to respond to apoptotic stimuli. Reed et al., Journal of Cellular Biology, 60: 23-32 (1996); Meyn et al., Cancer Metastasis Reviewws, 15: 119-131 (1996); Hannun, Blood, 89: 1845-1853 (1997); Reed, Toxicology Letters 82-83: 155-158 (1995); Hickman, European Journal of Cancer, 32A: 921-926 (1996). Resistance to chemotherapy has been correlated with overexpression of the anti-apoptotic gene bcl-2 and deletion or mutation of the pro-apoptotic bax gene, respectively, in chronic lymphocytic leukemia and colon cancer.

  The ability to successfully establish disseminated metastasis of tumor cells also appears to be involved in altering the apoptotic pathway. Bold et al., Surgical Oncology, 6: 133-142 (1997). For example, mutations in the tumor suppressor gene p53 appear to occur in 70% of tumors. Evan et al., Curr. Opin. Cell Biol., 7: 825-834 (1995). Mutations that inactivate p53 limit a cell's ability to induce apoptosis in response to DNA damage, making it more susceptible to further mutations. Ko and Prives, Genes and Development, 10: 1054-1072 (1996).

  Apoptosis is therefore closely linked to the development and progression of neoplastic malignant transformation and metastasis, and a better understanding of the associated apoptotic pathway is a new possibility for cancer treatment by modulating the apoptotic pathway through gene therapy approaches. Can lead to certain targets. Bold et al., Surgical Oncology, 6: 133-142 (1997).

  Deoxyhypusine synthase (DHS) and hypusin-containing eukaryotic translation initiation factor-5A (eIF-5A) are known to play important roles in many cellular processes, including cell proliferation and differentiation . A unique amino acid, hypusin, has been found in all tested eukaryotes and archaea, but not in eubacteria, and eIF-5A is the only known hypusin-containing protein. Park, J. Biol. Chem., 263: 7447-7449 (1988); Schumann and Klink, System. Appl. Microbiol., 11: 103-107 (1989); Bartig et al., System. Appl. Microbiol, 13: 112 -116 (1990); Gordon et al., J. Biol. Chem., 262: 16585-16589 (1987a). Active eIF-5A is formed in two post-translational steps: the first step is specific lysine of the precursor eIF-5A of the 4-aminobutyl part of spermidine catalyzed by deoxyhypusine synthase Formation of a deoxyhypusine residue by transfer of a 4-aminobutyl group to the α-amino group; the second step involves hydroxylating this 4-aminobutyl moiety with deoxyhypusine hydroxylase to produce hypusine. ing.

  The amino acid sequence of eIF-5A is well conserved among species, and there is strict conservation of the amino acid sequence surrounding the hypsin residue of eIF-5A, indicating that this modification is important for survival. Suggests. Park et al., Biofactors, 4: 95-104 (1993). This assumption further suggests that inactivation of both isoforms of eIF-5A observed to date in yeast, or inactivation of the DHS gene that catalyzes the first step of their activation, blocks cell division. This is supported by the findings. Schnier et al., Mol. Cell. Biol., 11: 3105-3114 (1991); Sasaki et al., FEBS Lett., 384: 151-154 (1996); Park et al., J. Biol. Chem., 273: 1677-1683 (1998). However, depletion of eIF-5A protein in yeast results in only a slight decrease in total protein synthesis, which is necessary for translation of a specific subset of mRNA rather than total synthesis of protein Suggests that. Kang et al., “Effect of initiation factor eIF-5A depletion on cell proliferation and protein synthesis”, Tuite, M. (edit), Protein Synthesis and Targeting in Yeast, NATO Series H, (1993). The latest finding that ligands that bind to eIF-5A share a highly conserved part also supports the importance of eIF-5A. Xu and Chen, J. Biol. Chem., 276: 2555-2561 (2001). In addition, the modified eIF-5A hypusine residue was essential for sequence-specific binding to RNA, and binding was found not to provide protection from ribonucleases.

  The first cDNA of eIF-5A was cloned from humans by Smit-McBride et al. in 1989, and since then eIF-5A cDNA or gene has been found in various true species including yeast, rat, chicken embryo, alfalfa, and tomato. It has been cloned from nuclei. Smit-McBride et al., J. Biol. Chem., 264: 1578-1583 (1989a); Schnier et al. (1991) (yeast); Sano, A., Imahori, M. et al. (Edit), “Polyamines, Basic and Clinical Aspects ", VNU Science Press, Netherlands, 81-88 (1995) (rat); Rinaudo and Park, FASEB J., 6: A453 (1992) (chick embryo); Pay et al., Plant Mol. Biol., 17 : 927-929 (1991) (alfalfa); Wang et al., J. Biol. Chem., 276: 17541-17549 (2001) (tomato).

  In addition, intracellular depletion of eIF-5A results in significant accumulation of specific mRNA in the nucleus, which is responsible for shuttle transport of a specific class of mRNA from the nucleus to the cytoplasm. Suggest that it is possible. Liu and Tartakoff, “Molecular Biology of the Cell” Addendum, 8: 426a (1997). Summary No.2476 of the 37th American Society for Cell Biology Annual Meeting. Accumulation of eIF-5A into nuclear pore-associated nuclear filaments and its interaction with common nuclear transport receptors further suggests that eIF-5A is a shuttle transport of nucleoplasm rather than polysome components This suggests that it is a protein. Rosorius et al., J. Cell Science, 112: 2369-2380 (1999).

  The expression of eIF-5A mRNA has been investigated in various human tissues and mammalian cell lines. For example, changes in eIF-5A expression have been observed in human fibroblasts after addition of serum following serum depletion. Pang and Chen, J. Cell Physio1, 160: 531-538 (1994). An age-related decrease in deoxyhypusine synthase activity and precursor eIF-5A abundance has also been observed in senescent fibroblasts, which may reflect the averaging of differential changes in isoforms About has not been determined. Chen and Chen, J. Cell Physiol., 170: 248-254 (1997b).

  Studies have shown that eIF-5A is a cellular target for viral proteins, such as human immunodeficiency virus type I Rev protein and human T cell leukemia virus type I Rex protein. Ruhl et al., J. Cell Biol., 123: 1309-1320 (1993); Katahira et al., J. Virol., 69: 3125-3133 (1995). Preliminary studies have shown that eIF-5A can target RNA by interacting with other RNA-binding proteins such as Rev, which means that these viral proteins are used for viral RNA processing. This suggests that eIF-5A can be mobilized. Liu et al., Biol. Signals, 6: 166-174 (1997).

  Deoxyhypusine synthase and eIF-5A have been found to play an important role in key cellular processes, including cell proliferation and senescence. For example, antisense reduction of deoxyhypusine synthase expression in plants results in delayed leaf and fruit senescence, suggesting that there are isoforms inducing eIF-5A senescence in plants . See WO 01/02592; PCT / US01 / 44505; US patent application 09 / 909,796. Inactivation of deoxyhypusine synthase or eIF-5A genes in yeast results in inhibition of cell division. Schnier et al., Mol. Cell. Biol., 11: 3105-3114 (1991); Sasaki et al., FEBS Lett., 384: 151-154 (1996); Park et al., J. Biol. Chem., 273: 1677-1683 (1998).

  Spermidine analogs have been successfully used in the inhibition of deoxyhypusine synthase in vitro as well as in the inhibition of hypusine formation in vivo, which is accompanied by inhibition of protein synthesis and cell proliferation. Jakus et al., J. Biol. Chem., 268: 13151-13159 (1993); Park et al., J Biol. Chem., 269: 27827-27832 (1994). Polyamines, particularly putrescine and spermidine, themselves appear to play an important role in cell proliferation and differentiation. Tabor and Tabor, Annu. Rev. Biochem., 53: 749-790 (1984); Pegg, Cancer Res., 48: 759-774 (1988). For example, a yeast mutant in which the polyamine biosynthetic pathway is blocked cannot grow unless an exogenous polyamine is provided. Cohn et al., J. Bacteriol., 134: 208-213 (1980).

  Polyamines have also been shown to protect cells from inducing apoptosis. For example, thymocyte apoptosis is blocked by exposure to spermidine and spermine, and the mechanism appears to be interference with endonuclease activation. Desiderio et al., Cell Growth Differ., 6: 505-513 (1995); Brune et al., Exp. Cell Res., 195: 323-329 (1991). In addition, exogenous polyamines have been shown to inhibit apoptosis in the unicellular parasite Trypanosoma cruzi in addition to B cell receptor-mediated apoptosis. Nitta et al., Exptl. Cell Res., 265: 174-183 (2001); Piacenza et al., Proc. Natl. Acad. Sci., USA, 98: 7301-7306 (2001). Low concentrations of spermine and spermidine have been observed to protect the brain from nerve damage during cerebral ischemia, in addition to reducing the number of neuronal loss during normal development of neonatal rats. Gilad et al., Brain Res., 348: 363-366 (1985); Gilad and Gilad, Exp. Neurol., 111: 349-355 (1991). Polyamines also inhibit aging, a form of programmed cell death in plant tissue. Spermine and putrescine have been shown to delay post-harvest senescence of carnation flowers and detached radish leaves. Wang and Baker, HortScience, 15: 805-806 (1980) (carnation flowers); Altman, Physiol. Plant., 54: 189-193 (1982) (detached radish leaves).

  However, in other studies, induction of apoptosis has been observed in response to exogenous polyamines. For example, human breast cancer cell lines respond to polyamine analogs by inducing apoptosis, and excess putrescine has been shown to induce apoptosis in DH23A cells. McCloskey et al., Cancer Res., 55: 3233-3236 (1995); Tome et al., Biochem. J., 328: 847-854 (1997).

  The results of these experiments with polyamines collectively suggest that the presence of a specific isoform of eIF-5A plays a role in the induction of apoptosis. Specifically, this data is consistent with the view that there exists an apoptosis-specific isoform of eIF-5A that is activated by DHS. The fact that this DHS reaction requires spermidine is consistent with the finding that polyamines trigger the activation of caspases, which are important executors of apoptosis-related proteolysis. Stefanelli et al., Biochem. J., 347: 875-880 (2000); Stefanelli et al., FEBS Lett., 451: 95-98 (1999). In similar veins, inhibitors of polyamine synthesis can delay apoptosis. Das et al., Oncol. Res., 9, 565-572 (1997); Monti et al., Life Sci., 72: 799-806 (1998); Ray et al., Am. J. Physiol., 278: C480-C489 (2000) ); Packham and Cleveland, Mol. Cell Biol., 14: 5741-5747 (1994).

  The finding that exogenous polyamines both inhibit and promote apoptosis, depending on the level applied, they inhibit the DHS response, leading to activation of eIF-5A and consequently preventing apoptosis Can be explained either by the fact that it is possible, or by the fact that it can induce apoptosis due to toxicity reasons. The finding that low concentrations of exogenous polyamines block apoptosis in plant and animal systems is consistent with the fact that low concentrations of polyamines and their analogs act as competitive inhibitors of the DHS response. In fact, even exogenous spermidine, which is a substrate for DHS reactions, will interfere with the reaction through substrate inhibition. Jakus et al., J. Biol. Chem., 268: 13153-13159 (1993).

  However, all polyamines and their analogs are toxic at high concentrations and can induce apoptosis. This occurs instead of their ability to inhibit activation of a putative apoptotic-specific isoform of eIF-5A for two reasons: First, activated eIF-5A has a long half-life. Torrelio et al., Biochem. Biophys. Res. Commun., 145: 1335-1341 (1987); Dou and Chen, Biochim. Biophys. Acta., 1036: 128-137 (1990). Thus, depletion of activated apoptosis-specific eIF-5A resulting from inhibition of deoxyhypusine synthase activity does not occur in time to block apoptosis caused by toxic effects of spermidine. Secondly, polyamines are competitive inhibitors of the deoxyhypusine reaction and therefore probably will not completely block this reaction even at toxic concentrations.

  The present invention relates to the cloning of eIF-5A cDNA that is up-regulated just before apoptosis induction. This apoptosis-specific eIF-5A appears to act at the level of post-transcriptional regulation of downstream effectors and transcription factors associated with the apoptotic pathway, so it is probably a suitable target for apoptosis-induced pathologic intervention. I will. In particular, apoptosis-specific eIF-5A selectively promotes translocation of mRNAs encoding effectors and transcription factors downstream of apoptosis from the nucleus to the cytoplasm, where they appear to continue to be translated. The final decision to initiate apoptosis appears to be due to a complex interaction between internal and external pro- and anti-apoptotic signals. Lowe & Lin, Carcinogenesis, 21: 485-495 (2000). Despite its ability to promote translation of downstream apoptosis effectors and transcription factors, eIF-5A associated with apoptosis appears to tip the balance between these signals favorable for apoptosis.

  As explained earlier, it is well established that anticancer agents induce apoptosis and that alteration of the apoptotic pathway can attenuate drug-induced cell death. Schmitt and Lowe, J. Pathol., 187: 127-137 (1999). For example, many anticancer agents up-regulate p53, and tumor cells that have lost p53 develop resistance to these drugs. However, almost all chemotherapeutic agents can induce apoptosis independent of p53 when doses are sufficient, which does not completely block the pathway to apoptosis, even in drug-resistant tumors It is shown that. Wallace-Brodeur and Lowe, Cell Mol. Life Sci., 55: 64-75 (1999). This may induce apoptosis by bypassing the p53-dependent pathway and promoting alternative pathways, even though induction of apoptotic eIF-5A cannot correct the mutated gene. It suggests that you can.

  Induction of eIF-5A associated with apoptosis has the ability to selectively target cancer cells with little or no effect on normal neighboring cells. This results from the mitogenic oncogene expressed in tumor cells providing an apoptotic signal in the form of a specific species of mRNA that is not present in normal cells. Lowe et al., Cell 74: 954-967 (1993); Lowe and Lin, Carcinogenesis, 21: 485-495 (2000). For example, restoration of wild-type p53 in p53-mutant tumor cells directly induces apoptosis and further increases drug sensitivity in tumor cell lines and xenografts (Spitz et al., 1996; Badie et al., 1998).

  The selectivity of apoptosis-eIF-5A stems from the fact that it selectively promotes the translation of downstream apoptotic effector and transcription factor mRNAs by mediating their translocation from the nucleus to the cytoplasm. Therefore, in order for apoptotic eIF-5A to have an effect, these effector and transcription factor mRNAs must be transcribed. Since these mRNAs are transcribed in cancer cells but not in adjacent normal cells, apoptotic eIF-5A is expected to promote apoptosis of cancer cells but have minimal, if any, effects on normal cells. The Thus, restoration of apoptotic capacity in tumor cells by apoptosis-related eIF-5A can attenuate the toxicity and side effects experienced by cancer patients due to selective targeting of tumor cells. Induction of apoptotic eIF-5A also has the ability to enhance the response of tumor cells to anti-cancer agents, thereby improving the effectiveness of these substances against drug-resistant tumors. This in turn can result in reduced doses of anticancer drugs for efficacy and reduced toxicity to the patient.

SUMMARY OF THE INVENTION The present invention relates to isolated and / or purified rat apoptosis-specific eIF-5A and DHS nucleic acids and polypeptides, and apoptosis-specific eIF-5A and DHS antisense oligonucleotides and expression. Provide vector. The present invention also provides isolated and / or purified human eIF-5A2 (also referred to herein as proliferative eIF-5A). The present invention also provides a method of modulating apoptosis using apoptosis-specific eIF-5A and DHS.

Detailed Description of the Invention The present invention is based in part on the discovery and characterization of a full-length cDNA encoding eIF-5A isolated from rat corpus luteum, which is related to apoptosis (apoptosis-specific). I have to. Accordingly, in one embodiment, the present invention provides an isolated nucleic acid comprising a nucleotide sequence encoding a rat apoptosis-specific eIF-5A polypeptide. The present invention also provides a purified polypeptide comprising the amino acid sequence of a rat apoptosis-specific eIF-5A polypeptide. Rat apoptotic-specific eIF-5A polypeptide is differentially expressed in apoptotic cells and is specific for eIF-5A, the precursor of the 4-aminobutyl moiety of spermidine catalyzed by deoxyhypusine synthase Resulting from the formation of a deoxyhypusine residue by rearrangement of the conserved lysine to the α-amino group, and the formation of hypsin by hydroxylation of this 4-aminobutyl moiety by deoxyhypusine hydroxylase, resulting in eIF-5A It means any rat-specific polypeptide that activates.

  In addition, using the rat apoptotic-specific eIF-5A sequence nucleic acids and polypeptides of the present invention, apoptotic-specific nucleic acids and polypeptides from other cells, tissues, organs or animals are described herein. And can be isolated using techniques well known to those skilled in the art. The present invention further provides nucleic acid molecules suitable as primers or hybridization probes for the detection of nucleic acids encoding the rat apoptosis-specific eIF-5A polypeptide of the present invention.

  The nucleic acids of the invention can be DNA, RNA, DNA / RNA duplex, protein-nucleic acid (PNA), or derivatives thereof. A nucleic acid or polypeptide as used herein is “isolated” or “purified” if it is substantially free of cellular material or free of chemical precursors or other chemicals. It is called. It should be understood that the term isolated or purified does not mean a library-type preparation that contains a myriad of other sequence fragments. The nucleic acids or polypeptides of the invention can be purified to homogeneity or other purity. The level of purification is based on the intended use. An important feature is that this preparation allows the desired function of the nucleic acid or polypeptide, even in the presence of significant amounts of other components.

  The isolated polypeptide may be purified from cells that naturally express it, purified from (recombinant) cells that have been modified to express it, or synthesized using known protein synthesis methods. Can do. For example, recombinant production of proteins involves the cloning of nucleic acid molecules encoding either eIF-5A or DHS that induce apoptosis into expression vectors. The expression vector is introduced into the host cell and the protein is expressed in the host cell. The protein can then be isolated from the cells by any suitable purification method using standard protein purification techniques.

  Preferably, the isolated nucleic acid encoding the rat apoptosis-specific eIF-5A polypeptide of the invention has the nucleotide sequence of SEQ ID NO: 1, and the purified polypeptide of the invention comprises It has the amino acid sequence of SEQ ID NO: 2. The rat apoptosis-specific eIF-5A nucleic acids and polypeptides of the present invention comprise, in addition to sequences having a substantial sequence that is the same or homologous to SEQ ID NO: 1 and SEQ ID NO: 2, respectively, as well as functional derivatives and variants thereof Is also included.

  As used herein, the term “substantial sequence identity” or “substantial homology” is used to indicate that a sequence exhibits substantial structural or functional equivalence with another sequence. . Structural or functional differences between sequences with substantial sequence identity or substantial homology are de minimus; that is, they affect the ability of the sequence to function as shown in the desired application. Will not affect. The difference may be due to, for example, inherent variations in codon usage between different species. When there is a significant amount of sequence overlap or similarity between two or more different sequences, or when different sequences exhibit similar physical properties, even if the sequences differ in length or structure The structural difference is considered minimal. Such properties include, for example, the ability to hybridize under defined conditions, or in the case of proteins, immunological cross-reactivity, similar enzymatic activity, and the like. Those skilled in the art can easily determine each of these properties by methods known in the art.

  In addition, the two nucleotide sequences have at least about 70% or more of these sequences, more preferably 80% or more, even more preferably about 90% or more, and most “Substantially complementary” when preferably about 95% or more has sequence similarity between them. Two amino acid sequences are polymorphic if they have a similarity of at least 50%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95%. It is substantially homologous between the active or operatively related portions of the peptide.

  To determine the percent identity of the two sequences, these sequences were juxtaposed for optimal comparison (e.g., gaps, one of the first and second amino acid or nucleic acid sequences for optimal alignment). Or can be introduced into both, as well as non-homologous sequences can be ignored for comparison purposes). In preferred embodiments, at least 30%, 40%, 50%, 60%, 70%, 80% or 90% or more of the length of the reference sequence is juxtaposed for comparison purposes. The amino acid residues or nucleotides are then compared at the corresponding amino acid position or nucleotide position. If the position of the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position of the second sequence, then the molecule is identical at that position (as used herein). The “identity” of the amino acid or nucleic acid is equivalent to the “homology” of the amino acid or nucleic acid. The percent identity between the two sequences is shared by these sequences, taking into account the number of gaps and the length of each gap that needs to be introduced for optimal alignment of the two sequences. It is a function of the number of positions that are identical.

  Comparison of sequences between two sequences and determination of percent identity and similarity can be accomplished using mathematical algorithms. (Computational Molecular Biology, edited by Lesk, AM, Oxford University Press, NY, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, Academic Press, NY, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, AM and Griffin, HG Editorial, Humana Press, NJ, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., M Stockton Press, NY, 1991).

  The nucleic acid and protein sequences of the present invention can further be used as a “query sequence” to search a sequence database, for example, to identify other family members or related sequences. Such a search can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (J. Mol. Biol., 215: 403-10 (1990)). BLAST nucleotide searches can be performed with the NBLAST program. The BLAST protein search can be performed by the XBLAST program, and an amino acid sequence homologous to the protein of the present invention can be obtained. To obtain a gapped alignment for comparative purposes, Gapped BLAST can be utilized as described in Altschul et al. (Nucleic Acids Res., 25 (17): 3389-3402 (1997)). When utilizing BLAST and Gapped BLAST programs, the default parameters of each program (eg, XBLAST and NBLAST) can be used.

  The term “functional derivative” of a nucleic acid is used herein to mean a homologue or analog of a gene or nucleotide sequence. A functional derivative can retain at least part of the function of a given gene, which allows its use in the present invention. A “functional derivative” of an apoptosis-specific eIF-5A polypeptide as described herein is specific for at least a portion of apoptosis-specific eIF-5A activity or apoptosis-specific eIF-5A A fragment, variant, analog, or chemical derivative of apoptosis-specific eIF-5A that retains immune cross-reactivity with the antibody. A fragment of an apoptosis-specific eIF-5A polypeptide refers to any subset of this molecule.

  Functional variants can also include substitutions of similar amino acids that do not cause a change in function or cause a minor change. Amino acids that are essential for function are identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham et al., Science, 244: 1081-1085 (1989)). be able to. The latter procedure introduces a single alanine mutation at each residue of the molecule. The resulting mutant molecules are then tested for biological activities such as kinase activity or in assays such as in vitro proliferative activity. Positions that are important for binding partner / substrate binding are also crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol. Biol., 224: 899-904 (1992); de Vos et al., Science, 255 : 306-312 (1992)).

  A “variant” has one or more substituted nucleotides but retains the ability to hybridize to a specific gene or to encode an mRNA transcript that hybridizes to native DNA. As such, it means a molecule that is substantially similar to either the entire gene or a fragment thereof. “Homolog” means a fragment or variant sequence from a different animal genus or species. "Analog" means a non-naturally occurring molecule that is substantially similar to or functions in association with the entire molecule, variants or fragments thereof.

  Variant peptides include natural variants as well as those produced by methods well known in the art. Such variants can be easily identified / produced using the molecular techniques and sequence information disclosed herein. Furthermore, such variants can be easily distinguished from other proteins based on sequence and / or structural homology to the eIF-5A or DHS proteins of the present invention. The degree of homology / identity present is mainly whether the protein is a functional or non-functional variant, the magnitude of diversity present in the paralog family, and their homologous molecules It will be based on the evolutionary distance between species.

  Non-naturally occurring variants of the eIF-5A or DHS proteins of the present invention can be readily produced using recombinant techniques. Such variants include, but are not limited to, deletions, additions and substitutions of the amino acid sequence of the protein. For example, one class of substitution is conservative amino acid substitution. Such a substitution replaces a given amino acid of the protein with another amino acid of similar properties. Typically, conservative substitutions are exchanged with one another between the aliphatic amino acids Ala, Val, Leu and Ile; interchange of hydroxyl groups of Ser and Thr; exchange of acidic groups of Asp and Glu; And Gln amide groups; Lys and Arg basic group exchange; and Phe and Tyr aromatic residue exchange. Guidance on which amino acid changes are probably phenotypically silent can be found in Bowie et al. (Science, 247: 1306-1310 (1990)).

  Alternatively, but also preferably, the nucleic acid encoding the rat apoptosis-specific eIF-5A polypeptide of the invention hybridizes under high stringency conditions to a nucleotide sequence that is complementary to that of SEQ ID NO: 1. Soybeans. The term “hybridization” as used herein generally refers to the hybridization of nucleic acids under appropriate conditions of stringency, as will be readily apparent to those skilled in the art, depending on the nature of the probe and target sequences. Used to mean Hybridization and wash conditions are well known in the art, and conditions that depend on the desired stringency by varying the incubation time, temperature and / or ionic strength of the solution can be readily adjusted. See, for example, Sambrook, J. et al., “Molecular Cloning: A Laboratory Manual”, 2nd edition, Cold Spring Harbor Press, Cold Spring Harbor, NY, 1989.

The selection of conditions is dictated by the length of the sequence to be hybridized, particularly the length of the probe sequence, the relative GC content of the nucleic acid, and the amount of mismatch allowed. Low stringency conditions are preferred when partial hybridization between strands with less complementarity is desired. High stringency conditions are preferred when perfect or near perfect complementarity is desired. For typical high stringency conditions, the hybridization solution contains 6xS.SC, 0.01M EDTA, 1x Denhardt's solution and 0.5% SDS. Hybridization is performed at about 68 ° C. for about 3-4 hours for the cloned DNA fragments and about 12-16 hours for total eukaryotic DNA. For lower stringency, the temperature of hybridization is reduced to about 42 ° C. below the melting temperature (T _m ) of the duplex. T _m is known as a function of the ionic strength of the solution in addition to the GC content and the double chain length.

  As used herein, the phrase “hybridizes to the corresponding portion” of a DNA or RNA molecule hybridizes to, for example, an oligonucleotide, a polynucleotide, or any nucleotide sequence (sense or antisense orientation). Means that it recognizes and hybridizes to the sequence of another nucleic acid molecule that is approximately the same size and has sufficient sequence similarity so that hybridization is achieved under appropriate conditions. For example, as long as about 70% or more sequence similarity exists between two sequences, a sense molecule 100 nucleotides long recognizes and hybridizes to approximately 100 nucleotide portions of the nucleotide sequence. Will soy. The size of the “corresponding portion” allows for some mismatches in the hybridization so that the “corresponding portion” is smaller or larger than the molecule that hybridizes to it, for example 20-30% longer or It is also understood that short, preferably longer than or less than about 12-15%.

  In addition, functional variants of a polypeptide can also include substitutions of similar amino acids that do not cause a change in function or cause a minor change. Amino acids essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham et al., Science, 244: 1081-1085 (1989)). it can. The latter approach introduces a single alanine mutation at each residue of the molecule. The resulting mutant molecule is then tested in a biological activity or assay.

  For example, an apoptosis-specific eIF-5A analog means a non-naturally occurring protein or peptidomimetic that is substantially similar to either the entire protein or a fragment thereof. Apoptosis-specific chemical derivatives of eIF-5A usually contain additional chemical moieties that are not part of the peptide or peptide fragment. The modification is introduced into the peptide or fragment thereof by reacting the targeted amino acid residue of the peptide with an organic derivatizing agent capable of reacting with a selected side chain or terminal residue. can do.

  Initial discovery and characterization of a full-length cDNA encoding apoptosis-specific eIF-5A isolated from rat corpus luteum led to the discovery and characterization of a partial length cDNA clone encoding DHS. Is also isolated from rat corpus luteum and is associated with apoptosis. Accordingly, in an additional aspect, the present invention provides an isolated nucleic acid comprising a nucleotide sequence encoding a rat apoptosis-specific DHS polypeptide. Also provided is a purified polypeptide comprising the amino acid sequence of a rat apoptosis-specific DHS polypeptide. Rat apoptotic-specific DHS polypeptide is differentially expressed in apoptotic cells and the 4-aminobutyl portion of spermidine to the α-amino group of non-active eIF-5A specifically conserved lysine By rearrangement is meant any suitable polypeptide specific for rats that catalyzes the formation of deoxyhypusine residues to form deoxyhypusine, thereby activating eIF-5A.

  Preferably, the isolated nucleic acid encoding the rat apoptosis-specific DHS polypeptide of the present invention has the nucleotide sequence of SEQ ID NO: 6, and the purified polypeptide of the present invention is SEQ ID NO: : 7 amino acid sequence. The rat apoptosis-specific DHS nucleic acids and polypeptides of the present invention, in addition to sequences having substantial sequence identity or homology with SEQ ID NO: 6 and SEQ ID NO: 7, respectively, as described above, Their functional derivatives and variants are also encompassed. Alternatively and preferably, the isolated nucleic acid of the invention has a nucleotide sequence that hybridizes under high stringency conditions to the complement of SEQ ID NO: 6, which has also been described above.

  As with the rat apoptosis-specific eIF-5A sequence nucleic acids and polypeptides described herein, the rat apoptosis-specific DHS sequence nucleic acids and polypeptides of the present invention may be used to Apoptosis-specific DHS nucleic acids and polypeptides can be isolated from animals. The isolation of such DHS sequences from animals and humans is achieved using methods known in the art and the guidance provided herein based on at least 80% sequence similarity across species. be able to. The invention also provides nucleic acid molecules that are suitable as primers or hybridization probes for the detection of nucleic acids encoding the rat apoptosis-specific DHS polypeptides of the invention.

  Apoptosis-specific eIF-5A and DHS are likely to act in the post-transcriptional regulation of downstream effectors and transcription factors involved in the apoptotic pathway, making it suitable for the regulation of apoptosis, including apoptosis underlying the disease process Target. Accordingly, the present invention also provides a method of modulating apoptosis in a cell by administering to the cell a substance that modulates apoptosis-specific eIF-5A and / or DHS function. By those skilled in the art, the substance can be one that modulates apoptosis-specific eIF-5A function only, apoptosis-specific DHS function alone, or both apoptosis-specific eIF-5A and DHS functions. Must be understood.

  Apoptosis can be regulated by appropriate alterations in normal levels of apoptosis-specific eIF-5A and / or DHS function in the cell. As intended herein, modifications or alterations can be complete or partial and alter transcriptional or translational control or alter apoptosis-specific eIF-5A and / or DHS function in cells Other changes can be included. Apoptosis-specific eIF-5A or DHS function is deoxy-high by DHS-catalyzed translocation of the 4-aminobuty moiety of spermidine to the α-amino group of lysine specifically conserved in the precursor eIF-5A. It means the formation of a pussin residue as well as the hydroxylation of this 4-aminobutyl moiety by deoxyhypusine hydroxylase to form hypusine and activate eIF-5A.

  In one embodiment of the invention, the substance can inhibit apoptosis-specific eIF-5A and / or DHS function, thereby inhibiting apoptosis. Inhibition of apoptosis is a reduction in intensity and / or number and / or any or all well-defined apoptotic morphological features such as cell shrinkage, chromatin condensation, nuclear fragmentation, and membrane foam. Means start delay.

  One substance that can inhibit apoptosis-specific eIF-5A and / or DHS function is an antisense oligonucleotide. Preferably, the antisense oligonucleotide has a nucleotide sequence encoding a portion of an apoptosis-specific eIF-5A polypeptide and / or an apoptosis-specific DHS polypeptide. Many suitable nucleic acid sequences encoding apoptosis-specific eIF-5A polypeptides and / or DHS polypeptides are known in the art. For example, SEQ ID NOs: 1, 3, 4, 5, 11, 15, 19, 20, and 21 (apoptosis-specific eIF-5A nucleic acid sequences), SEQ ID NOs: 6 and 8 (apoptosis-specific DHS nucleic acid sequences) SEQ ID NOs: 12 and 16 (apoptosis-specific eIF-5A polypeptide sequences) and SEQ ID NO: 7 (apoptosis-specific DHS polypeptide sequences), or portions thereof, provide suitable sequences. Other suitable sequences can be found using sequences known as probes according to the methods described herein.

  Accordingly, the present invention also provides an antisense oligonucleotide encoding a portion of an apoptosis-specific eIF-5A polypeptide and / or an apoptosis-specific DHS polypeptide, or a complement thereof. The antisense oligonucleotides of the invention can be in the form of RNA or DNA, such as cDNA, genomic DNA, or synthetic RNA or DNA. DNA can be double-stranded or single-stranded, and if single-stranded can be a coding strand or a non-coding strand. Specific hybridization of an oligomeric compound with its target nucleic acid results in interference with the normal function of this nucleic acid, commonly referred to as “antisense”. Interfering DNA functions include replication and transcription. The function of the RNA to be disturbed is, for example, translocation of the RNA to the protein translation site, protein translation from the RNA, production of one or more mRNA species by RNA splicing, and engagement or promotion by the RNA. Catalytic activity. The overall effect of such antisense oligonucleotides is inhibition of the expression of apoptosis-specific eIF-5A and / or DHS and / or inhibition of the amount of activated apoptosis-specific eIF-5A produced.

  Alternatively, apoptosis-specific eIF-5A activation by apoptosis-specific DHS can be inhibited by administration of a chemical that inhibits the DHS enzyme reaction. For example, the initiation of a DNA ladder reflecting apoptosis in the rat corpus luteum is delayed when the animals are treated with spermidine, an inhibitor of DHS response after induction of apoptosis by injection of PGF-2α (FIG. 18 -19). Jakus et al., J. Biol. Chem., 268: 13151-13159 (1993).

  Apoptosis may be inhibited or parenchymal by the addition of a substance that degrades apoptosis-specific eIF-5A DNA, RNA, or protein, or a substance that degrades DNA, RNA, or protein of apoptosis-specific DHS May be reduced, resulting in the inhibition of apoptosis-specific eIF-5A activation by apoptosis-specific DHS. In another embodiment of the invention, inhibition of expression of endogenous mammalian apoptosis-specific DHS, apoptosis-specific eIF-5A, or both is affected through the use of ribozymes. Examples of suitable drugs are those that inhibit apoptosis-specific eIF-5A activation by apoptosis-specific DHS, those that inhibit apoptosis-specific eIF-5A activation by deoxyhypusine hydroxylase, apoptosis -Inhibits transcription and / or translation of specific DHS, and inhibits transcription and / or translation of apoptosis-specific deoxyhypusine hydroxylase, inhibits transcription or translation of apoptosis-specific eIF-5A Including things. Examples of drugs that inhibit activation of eIF-5A by apoptosis-specific DHS are spermidine, 1,3-diamino-propane, 1,4-diamino-butane (putrescine), 1,7-diamino-heptane, or There is 1,8-diamino-octane.

  It is also possible to inhibit apoptosis-specific eIF-5A by inactivation of the gene encoding apoptosis-specific eIF-5A in the cell. Such inactivation can occur by deletion of a gene in the cell or introduction of a deletion or mutation into the gene and thereby inactivation of that gene. This gene can also be inactivated by insertion into another DNA fragment, so that endogenous apoptosis-specific eIF-5A protein expression does not occur. Similarly, activation of apoptosis-specific eIF-5A can be inhibited by inactivation of a gene encoding apoptosis-specific DHS in the cell. Methods for introducing mutations such as deletions and insertions into eukaryotic genes are known in the art, eg, US Pat. No. 5,464,764. Oligonucleotides and expression vectors useful for gene mutations in cells can be produced according to methods known in the art and the guidance provided herein; for example, for the production and expression of antisense oligonucleotides. Useful methods can be used to produce oligonucleotides and expression vectors useful for gene mutations in cells.

  It is also possible to inhibit the expression of apoptosis-specific eIF-5A by suppressing the expression of the gene encoding apoptosis-specific eIF-5A in the cell. Such inactivation can be achieved via co-suppression, for example, by introducing into the cell a nucleotide sequence encoding apoptosis-specific eIF-5A that results in co-suppression. it can. Similarly, it is possible to inhibit the activation of apoptosis-specific eIF-5A by suppressing the expression of genes encoding apoptosis-specific DHS in cells via co-suppression. Oligonucleotides and expression vectors useful for co-suppression can be produced according to methods known in the art and the guidance provided herein; for example, methods useful for the production and expression of antisense oligonucleotides include: It can be used to produce oligonucleotides and expression vectors useful for co-suppression. Co-suppression methods are known in the art, for example, as in US Pat. No. 5,686,649.

  One consequence of inhibition (eg, by antisense, mutation, or co-suppression) is a reduction in the amount of mRNA encoding endogenous translatable apoptosis-specific eIF-5A or DHS. As a result, the amount of apoptosis-specific DHS protein produced is reduced, thereby reducing the amount of activated eIF-5A, which in turn reduces the translation of apoptosis-specific protein. . Thus, apoptosis is inhibited or delayed because new protein synthesis is required for initiation of apoptosis.

  In another embodiment of the invention, the agent can induce apoptosis-specific eIF-5A or DHS function, thereby inducing apoptosis. Induction of apoptosis is an increase in either intensity or number of any or all of the well-defined morphological characteristics characteristic of apoptosis, such as cell shrinkage, chromatin condensation, nuclear fragmentation, and membrane foam Or the promotion of initiation.

  Any suitable substance that induces apoptosis-specific eIF-5A and / or DHS function can be used. It will be appreciated by those skilled in the art that both inactive and active forms of apoptosis-specific eIF-5A can be administered. Native apoptotic-specific DHS will activate eIF-5A when non-active, or unmodified hypusine is administered. Many suitable nucleic acid sequences encoding apoptosis-specific eIF-5A polypeptides and / or DHS polypeptides are known in the art. For example, SEQ ID NO: 1, 3, 4, 5, 11, 15, 19, 20, and 21 (apoptosis-specific eIF-5A nucleic acid sequence), SEQ ID NOs: 6 and 8 (apoptosis-specific DHS nucleic acid sequence), SEQ ID NOs: 12 and 16 (apoptosis-specific eIF-5A polypeptide sequence) and SEQ ID NO: 7 (apoptosis-specific DHS polypeptide sequence), or portions thereof, provide suitable sequences. Other suitable sequences can be found using known sequences as probes according to the methods described herein.

  For example, a naked nucleic acid (naked DNA vector such as an oligonucleotide or a plasmid) or a polypeptide, including a recombinantly produced polypeptide, can be administered to a cell. Recombinantly produced polypeptide means that the DNA sequence encoding eIF-5A or DHS protein is placed in a suitable expression vector, as detailed below. The host is transfected with this expression vector and then produces the desired polypeptide. This polypeptide is then isolated from the host cell. The eIF-5A protein that induces recombinant apoptosis can be produced, for example, in Chinese hamster ovary (CHO) cells by a person skilled in the art and activated using recombinant DHS. Wang et al., J Biol. Chem., 276: 17541-17549 (2001); Eriksson et al., Semin. Hematol, 38: 24-31 (2001). These polypeptides can also be synthesized, which are synthesized using known protein synthesis methods.

  Polypeptide uptake can be facilitated with a ligand, such as, for example, a ligand from Bacillus anthracis that mediates uptake into a wide range of cells. Liu et al., J. Biol. Chem., 276: 46326-46332 (2001). Recombinant proteins can also be administered to mammalian target cells, tissues, and organs using liposomes. Liposomes entrapping the protein are administered intravenously. Targeting can be achieved by the incorporation of a ligand specific for the cellular receptor into the liposome. See, for example, Kaneda, Adv Drug Delivery Rev, 43: 197-205 (2000).

  One preferred substance that induces apoptosis-specific eIF-5A or DHS function is an expression vector. Accordingly, the present invention provides an expression vector having a promoter operably linked to a nucleic acid encoding an apoptosis-specific eIF-5A polypeptide and / or DHS polypeptide. The expression vector of the present invention can be in the form of RNA or DNA, eg, cDNA, genomic DNA, or synthetic RNA or DNA. The DNA can be double-stranded or single-stranded, and if single-stranded can be a coding strand or a non-coding strand. Any suitable expression vector (see, eg, Pouwels et al., Cloning Vectors: A Laboratory Manual, (Elsevior, N.Y .: 1985)) can be used. Preferred expression vectors have a promoter sequence operably linked to a nucleotide sequence encoding an apoptosis-specific (related) eIF-5A polypeptide and / or an apoptosis-specific (related) DHS polypeptide. .

  In this expression vector, the desired nucleic acid and promoter are operably linked so that the promoter can drive the expression of the nucleic acid. Any suitable promoter can be used provided that the nucleic acid is expressed. Examples of such suitable promoters include various viral promoters, eukaryotic promoters, and constitutively active promoters. As long as this operable linkage is maintained, the expression vector can include one or more nucleic acids (eg, nucleic acids encoding both apoptosis-specific eIF-5A and / or DHS). This expression vector enhances polyadenylation sequences, ribosome binding sites (RES), transcriptional regulatory elements (e.g. enhancers, silencers, etc.), stability of the vector or transcript, or translation or processing of the desired transcript in the cell Other elements can optionally be included, such as other sequences (eg, secretion signals, leaders, etc.) or any other suitable element.

  Expression vectors can be derived from viruses such as adenovirus, adeno-associated virus, herpes virus, retrovirus or lentivirus. The expression vectors of the present invention can be transfected into host cells, including bacterial species, mammalian or insect host cell systems, including baculovirus systems (eg, Luckow et al., Bio / Technology, 6:47 ( 1988)), and established cell lines such as, but not limited to, 293, COS-7, C127, 3T3, CHO, HeLa, BHK.

  Unlike plasmids and other viral vectors (e.g., herpes simplex virus), adenoviral vectors provide gene transfer in both dividing and non-dividing cells, and cardiovascular systems such as myocardium, vascular endothelium, and skeletal muscle Adenoviral vectors are preferred because they involve high levels of protein expression at the relevant site. In addition, genes introduced by adenoviral vectors function at epichromosomal positions, so that there is little risk of inappropriate insertion of the transgene into important sites in the host genome. Adenoviral vectors are also preferably deficient in at least one gene function required for viral replication. Preferably, the adenoviral vector is deficient in at least one essential gene function of the E1, E2, and / or E4 region of the adenoviral genome. More preferably, the vector additionally lacks at least part of the E3 region of the adenovirus genome (eg, XbaI deletion of the E3 region).

  The recombinant adenovirus can be delivered to the cultured cells by simply adding the virus to the culture medium. Host animal / human infection can be achieved by injecting the viral particles directly into the bloodstream or the desired tissue. The serum half-life of this virus can be extended by conjugating the virus with liposomes (eg, Lipofectin, Life Technologies) or polyethylene glycol. Adenoviral vectors normally enter cells through the interaction between the knob domain of the viral fiber protein and the coxsackievirus / adenovirus receptor (CAR). This viral vector can be directed to specific cells or cells that do not express CAR by genetically engineering the virus to express specific ligands for certain cell receptors.

  In another embodiment, apoptosis is either up-regulated by transcription of endogenous apoptosis-specific eIF-5A, or apoptosis-specific DHS, or both, or by apoptosis-specific eIF-5A Can be initiated or enhanced by chemically enhancing the activation of. In one such embodiment, PGF-2α can be administered to animal / human cancer cells or tumors to upregulate DHS and eIF-5A transcription.

  Since apoptosis-specific eIF-5A probably acts in the post-transcriptional regulation of downstream effectors and transcription factors associated with the apoptotic pathway, this is appropriate for the regulation of apoptosis, including apoptosis underlying the disease process Target. The methods of the invention that modulate apoptosis-specific eIF-5A and apoptosis-specific DHS, either alone or in combination, can be realized in animal cells, resulting in induction or enhancement of apoptosis, and apoptosis Resulting in novel etiology and compositions for the treatment and prevention of diseases caused by or otherwise having the etiology associated with the inability of the cells to receive the disease.

  Many important human diseases are caused by abnormal regulation of apoptosis. These abnormalities can result in a pathological increase in the number of cells (eg, cancer) or loss that causes cell damage (eg, degenerative disease). By way of non-limiting example, the methods and compositions of the present invention can be used to prevent or treat the following apoptosis-related diseases and disorders: neurological / neurodegenerative disorders (eg, Alzheimer's disease, Parkinson's disease) , Huntington's disease, amyotrophic lateral sclerosis (Lou Gering's disease), autoimmune diseases (e.g. rheumatoid arthritis, systemic lupus erythematosus (SLE), multiple sclerosis), Duchenne muscular dystrophy (DMD), exercise Neuropathy, ischemia, chronic heart failure, stroke, infant spinal muscular atrophy, cardiac arrest, renal failure, atopic dermatitis, sepsis and septic shock, AIDS, hepatitis, glaucoma, diabetes (types 1 and 2), Asthma, retinitis pigmentosa, osteoporosis, xenograft rejection, and burn injury.

  The method of the present invention may be used for therapeutic treatment of an animal having cancer cells or an animal suffering from a tumor, respectively, in an amount sufficient to kill cancer cells or inhibit tumor progression. it can. An amount adequate to accomplish this is defined as a therapeutically effective amount. The effective amount for this use depends on the severity of the disease and the general condition of the animal's own immune system.

  Inhibition of tumor growth means prevention or reduction of tumor progression, eg, tumor growth, invasion, metastasis and / or recurrence. Using the method of the present invention, for example, breast, heart, lung, small intestine, colon, spleen, kidney, bladder, head and neck, ovary, prostate, brain, pancreas, skin, bone, bone marrow, blood, thymus, Suitable tumors can be treated, including uterine, testis, cervical or liver tumors. Animals, preferably mammals, and more preferably humans can be treated using the compositions and methods of the present invention. Thus, the methods of the invention can be performed in vitro, ex vivo, or in vivo.

  The dosing schedule will also vary depending on the condition and animal condition, and typically ranges from a single bolus dose or continuous infusion to repeated administration per day (e.g. every 4-6 hours), Or by treatment and animal condition. However, it should be noted that the present invention is not limited to any particular dose.

  In the present invention, any suitable method or route can be used for administration, such as oral, intravenous, intraperitoneal, subcutaneous, or intramuscular administration. The dosage of antagonist administered will depend on many factors, including, for example, the type of molecule being administered, the type and severity of the tumor being treated, and the route of administration. However, it should be emphasized that the present invention is not limited to any particular method or route of administration.

  In one alternative embodiment, the methods of the invention can be used in combination with one or more conventional therapies. For example, a suitable antineoplastic substance can be used, such as a chemotherapeutic agent or radiation. In additional alternative embodiments, the methods of the invention can be used in combination with one or more suitable adjuvants, such as cytokines (eg, IL-10 and IL-13) or other immunostimulatory agents.

  In another alternative embodiment, apoptosis-specific eIF-5A and proliferative eIF-5A can be used to diagnose an apoptosis-related disorder, wherein proliferating eIF-5A is apoptosis-specific It differs from eIF-5A in that it is transcribed from different positions with different promoters; the two are structurally homologous or differ at the carboxy terminus. The diagnostic methods of the present invention relate to the comparison of the amount of proliferative eIF-5A present in a given cell with the amount of apoptosis-specific eIF-5A present in the same cell. During a period of normal function, the cells produce proliferative eIF-5A (also referred to herein as eIF-5A2), apoptosis-specific eIF-5A (also referred to herein as eIF-5A1). Have a greater amount than. However, in some cancer cells, the normal regulatory mechanism is gone and the amount of apoptosis-specific eIF-5A relative to the amount of proliferating eIF-5A is altered. This probably makes it possible to diagnose the cancerous nature of the cell before a change in the cell phenotype.

  In yet another embodiment, the ratio of proliferative eIF-5A to apoptosis-specific eIF-5A can be used in drug screening. Such a method is also related to the comparison of the amount of proliferating eIF-5A present in a given cell with the amount of apoptosis-specific eIF-5A present in the same cell. The normal ratio of proliferative eIF-5A to apoptosis-specific eIF-5A is compared to the ratio of proliferative eIF-5A to apoptosis-specific eIF-5A after contacting cells with drug candidates. I will. Changing the ratio of proliferative eIF-5A to apoptosis-specific eIF-5A after contact enables the identification of candidate substances with these apoptosis-modulating activities. Candidate substances having apoptosis-modulating activity are useful in the treatment of diseases associated with apoptosis through either inhibition or induction of apoptosis. In addition, changes in the ratio of proliferative eIF-5A to apoptosis-specific eIF-5A can be used to regulate apoptosis, which is one of the conditions described herein in connection with abnormal apoptosis. Can be useful in the treatment of.

  This method can be used to effectively screen a large number of potential candidate substances, ie libraries, to identify library members that modulate apoptosis. Any candidate substance or library of candidate substances can be screened using this method. For example, biological response modifiers that have shown promise as apoptosis modulators include monoclonal antibodies that alter signal transduction pathways, cytokines such as TRAIL (Apo2 ligand), ligands for retinoid / steroid family nuclear receptors, As well as small molecule molecules that bind and inhibit protein kinases, which can be screened for defined apoptosis-modulating activities using the methods of the invention.

  One suitable candidate substance is a protein kinase C-α antisense oligonucleotide, ISIS 3521 (ISIS Pharmaceuticals, Carlspad, CA), which has anti-tumor activity. Another specific candidate substance is caspase (Idun Pharmaceuticals, San Diego, CA), which is known to play an important role in the initiation and execution of apoptosis in various cell types leading to cancer and neurodegenerative diseases. GENASENSE ™ (Genta, Berkeley Heights, NJ), an antisense drug that blocks the production of Bcl-2; INGN 241 (Introgen Therapeutics, Houston, TX), which targets P53 Rituximab (IDEC, Osaka, Japan), which is an anti-CD20 monoclonal antibody; and general apoptosis-driven therapy for cardiovascular disease and cancer (AEgera Therapeutics, Quebec, Canada).

  It will be appreciated that the nucleic acids and polypeptides of the invention are administered in the form of a composition additionally containing a pharmaceutically acceptable carrier when used in animals for prophylactic or therapeutic purposes. Suitable pharmaceutically acceptable carriers include, for example, one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof. Pharmaceutically acceptable carriers further contain minor amounts of adjuvants such as wetting or emulsifying agents, preservatives or buffering agents that enhance the shelf life or effectiveness of the bound protein. As is well known in the art, injectable compositions can be formulated to provide immediate, sustained or delayed release of the active ingredient after administration to a mammal.

  The compositions of the present invention can be in a variety of forms. These include, for example, solid, semi-solid and liquid dosage forms such as tablets, pills, powders, liquid solutions, dispersions or suspensions, liposomes, suppositories, injections and infusion solutions. The preferred form depends on the intended mode of administration and therapeutic application.

  Such compositions can be prepared by methods well known in the pharmaceutical art. In making this composition, the active ingredient is usually mixed with the carrier or diluted with the carrier and / or enclosed in a carrier such as a capsule, sachet, paper or other container. When the carrier is utilized as a diluent, it is a solid, semi-solid or liquid material that acts as a solvent, excipient or medium for the active ingredient. The composition therefore comprises tablets, troches, sachets, cachets, elixirs, suspensions, aerosols (as solids or in liquid media), eg ointments, softeners containing up to 10% by weight of active ingredient. And hard gelatin capsules, suppositories, injectable solutions, suspensions, sterile packaged powders, and topical patches.

  As generally described herein, the same will be more readily understood with reference to the following examples provided for illustration. These examples are presented to aid in understanding the invention, but are not intended to limit the scope in any way and are not so constructed. These examples do not include detailed descriptions of conventional methods. Such methods are well known to those skilled in the art and have been described in many publications. Like those used in the construction of vectors and plasmids, the insertion of nucleic acids encoding polypeptides into such vectors and plasmids, the introduction of plasmids into host cells, and the expression and determination of genes and gene products Detailed descriptions of conventional methods can be obtained from many publications, including Sambrook, J. et al. (Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press (1989)). Can do. All references mentioned herein are incorporated in their entirety.

Example
Example 1
This example illustrates the isolation and characterization of a full-length cDNA encoding a rat eIF-5A nucleic acid exhibiting apoptosis-specific expression.

Superovulation and apoptosis-inducing juvenile (21-30 days old) female rats in the rat corpus luteum by subcutaneous injection of PMSG (pregnant mare serum gonadotropin) 50 IU, and HCG (human chorionic gonadotropin) 50 IU 60-65 hours later Over ovulation. Seven days after treatment with HCG, luteal apoptosis was induced by subcutaneous injection of 500 mg of PGF-2α. Rats were sacrificed at different time points (eg, 1, 8, and 24 hours) after PGF-2α treatment, and the corpora lutea was removed and placed in liquid nitrogen. Control luteal tissue was removed from rats sacrificed immediately prior to PGF-2α treatment.

Six to nine days after distributed superovulation of rat ovary yolk cells , rats were treated by subcutaneous injection of PGF-2α 500 mg into multiple sites. After 15-30 minutes, the ovaries were removed from the superovulated rats and placed in EBSS (Gibco) on ice, wiped dry and weighed. The connective tissue was removed, the ovaries were minced with a razor blade and washed twice with EBSS 2X. A collagenase solution was prepared by vigorously stirring 6.5 mg of collagenase (Sigma, catalog number C5138) in 5 ml of EBSS. Tissue shredded from 8 ovaries was added to 5 ml of collagenase in EBSS in a 50 ml Erlenmeyer flask and agitated slowly by withdrawing several times with a Diamed pipette. The flask containing the shredded tissue was then placed in a 37 ° C. water bath for 20 minutes under 95% air, 5% CO ₂ with gentle agitation (position 45 in the GFL incubator).

  After this incubation, the flask was placed on ice and the cell suspension was transferred by a plastic full volume pipette onto a Nitex filter equipped with Swiss Nitex Nylon Monofilament (75m). The filtrate was collected in a 15 ml Falcon tube. Add a second aliquot (2.5 ml) of collagenase solution (collagenase 6.5 mg / EBSS 5 ml) to the minced tissue remaining in the 50 ml Erlenmeyer flask and gently agitate using a pipette for 10 minutes. Incubate and filter as before. The two filtrates were combined and centrifuged at room temperature for 5 minutes in a clinical centrifuge (˜200 g). All supernatants were removed with a pipette, leaving less than 2 ml, discarded, and the precipitated cells were resuspended in 2 ml of the remaining supernatant.

The cells were washed twice by adding 5 ml of MEM and centrifuging and resuspending as described above. Washed cells were resuspended in 30 ml MEM containing 10 mM glutamine in a 50 ml Erlenmeyer flask and incubated for 1 hour at 37 ° C. without shaking in 95% air, 5% CO ₂ . Cells were then centrifuged as described above and resuspended in MEM containing 10 mM glutamine.

The concentration of dispersed cells was determined using a hemocytometer and viability was assessed using trypan blue dye. 2-5 × 10 ⁵ aliquots of cells were placed in 12 × 75 mm tubes and incubated for 2-5 hours at 37 ° C. under 95% air, 5% CO ₂ without shaking. The progress of apoptosis during this period was monitored by assessing the degree of DNA ladder.

Visualization of rat corpus luteum apoptosis by DNA ladder The degree of apoptosis was determined by DNA ladder. Genomic DNA was isolated from dispersed luteal cells or excised luteal tissue using the QIAamp DNA Blood Kit (Qiagen) according to the manufacturer's instructions. The corpus luteum was excised 1 and 24 hours after induction of apoptosis prior to induction of apoptosis by treatment with PGF-2α. The isolated DNA contains 500 ng of DNA at room temperature with 0.2 μCi [α- ³² P] dCTP, 1 mM Tris, 0.5 mM EDTA, 3 units of Klenow enzyme, and 0.2 pM each of dATP, dGTP, and dTTP. End-labeled by incubation for 30 minutes. Unincorporated nucleotides were removed by passing the sample through a 1 ml Sepadex G-50 column according to Sambrook et al. Samples were then separated on Tris-acetic acid-EDTA (1.8%) gel electrophoresis. The gel was dried under vacuum at room temperature for 30 minutes and exposed to x-ray film at -80 ° C for 24 hours.

In one experiment, the degree of apoptosis of superovulated rat corpus luteum was tested either at 0, 1, or 24 hours after injection of PGF-2α. In the 0 hour control, the ovaries were removed without PGF-2α injection. Ladder of low molecular weight DNA fragment reflecting nuclease activity related to apoptosis is not clear in control corpus luteum tissue extracted before PGF-2α treatment, but becomes recognizable within 1 hour after induction of apoptosis and induces apoptosis It became prominent by 24 hours later, which is shown in FIG. In this figure, the upper panel is an autoradiography of a Northern blot probed with a ³² P-dCTP-labeled 3′-untranslated region of rat corpus luteum apoptosis-specific DHS cDNA. The lower panel is an ethidium bromide stained gel of total RNA. Each lane contained 10 μg RNA. This data shows that eIF-5A transcript was down-regulated after serum collection.

  In another example, the corresponding control animals were treated with saline instead of PGF-2α. After 15 minutes of treatment with saline or PGF-2α, the corpus luteum was removed from the animals. Genomic DNA was isolated from the corpus luteum at 3 and 6 hours after excision of tissue from the animals. Increased end labeling of DNA ladder and genomic DNA was evident 6 hours after removal of tissue from PGF-2α-treated animals, but not 3 hours after tissue removal. See FIG. When the corpus luteum was excised 15 minutes after treatment with PGF-2α and maintained for 6 hours under in vitro conditions in EBSS (Gibco), a DNA ladder reflecting apoptosis was also evident. Nuclease activity associated with apoptosis was also evident from the larger number of end-labels of genomic DNA.

In another experiment, superovulation was induced by subcutaneous injection of 500 μg PGF-2α. Control rats were treated with an equal volume of saline. After 15-30 minutes, the ovaries were removed and shredded with collagenase. Dispersed cells from rats treated with PGF-2α were treated with 10 mM glutamine + 10 mM spermidine for 1 hour and further without spermidine for 5 hours in 10 mM glutamine (lane 2), or with 10 mM glutamine + 10 mM spermidine for 1 hour and further Incubation for 5 hours (lane 3) in 10 mM glutamine + 1 mM spermidine. Control cells from rats treated with saline were dispersed with collagenase and incubated in glutamine alone for 1 hour and another 5 hours (lane 1). 500 ng of DNA from each sample was labeled with [α- ³² P] -dCTP using Klenow enzyme, separated on a 1.8% agarose gel, and exposed to film for 24 hours. The results are shown in FIG.

In yet another experiment, superovulated rats were injected subcutaneously with spermidine 1 mg / 100 g body weight, 3 times 24, 12, and 2 hours prior to 500 μg subcutaneous injection of PGF-2α, 0.333 mg / 100 g body weight, etc. Delivered in doses. Control rats were divided into 3 sets: no injection, 3 injections of spermidine, no PGF-2α; and 3 injections of equal volume of saline prior to PGF-2α treatment. The ovaries were removed from the rats either 1 hour 35 minutes or 3 hours 45 minutes after prostaglandin treatment and used for DNA isolation. 500 ng of DNA from each sample was labeled with [α- ³² P] -dCTP using Klenow enzyme, separated on a 1.8% agarose gel, and exposed to film for 24 hours: Lane 1, no injection (animals were Lane 2, 3 injections of spermidine (animals were sacrificed at the same time as lane 3-5); lane 3, 3 injections with saline followed by PGF-2α Injection (animal was sacrificed 1 hour 35 minutes after PGF-2α treatment); Lane 4, 3 injections of spermidine followed by PGF-2α injection (animal was 1 hour after PGF-2α treatment) Lane 5, 3 injections of spermidine followed by injection of PGF-2α (animals were sacrificed 1 hour 35 minutes after PGF-2α treatment); Lane 6, 3 injections of spermidine Injection followed by PGF-2α injection (animals were sacrificed 3 hours 45 minutes after PGF-2α treatment); Lane 7, three injections of spermidine followed by PGF-2α injection (animals) After PGF-2.alpha treatment were sacrificed at 3 hours and 45 minutes). The results are shown in FIG.

RNA isolation Total RNA, after apoptosis induction by PGF-2α, at various times, was isolated from excised corpus luteum tissue from the rats. Briefly, tissue (5 g) was ground in liquid nitrogen. The ground powder was mixed with 30 ml of guanidinium buffer (4M guanidinium isothiocyanate, 2.5 mM NaOAc, pH 8.5, 0.8% β-mercaptoethanol). The mixture was filtered through 4 layers of Miracloth and centrifuged at 10,000g, 4 ° C for 30 minutes. The supernatant was then subjected to cesium chloride density gradient centrifugation at 11,200 g for 20 hours. Pelleted RNA was washed with 75% ethanol, resuspended in 600 ml DEPC-treated water, and RNA was precipitated at −70 ° C. with 1.5 ml 95% ethanol and 60 ml 3M NaOAc.

Genomic DNA isolation and ladder genomic DNA was isolated from extracted luteal tissue or dispersed luteal cells using the QIAamp DNA Blood Kit (Qiagen) according to the manufacturer's instructions. DNA was incubated for 30 minutes at room temperature with 500 ng of DNA with 0.2 μCi [α- ³² P] dCTP, 1 mM Tris, 0.5 mM EDTA, 3 units Klenow enzyme, and 0.2 pM each of dATP, dGTP, and dTTP, End-labeled. Unincorporated nucleotides were removed by passing the sample through a 1 ml Sepadex G-50 column according to the method described in Maniatis. Samples were then separated on Tris-acetic acid-EDTA (2%) gel electrophoresis. The gel was dried under vacuum at room temperature for 30 minutes and exposed to x-ray film at -80 ° C for 24 hours.

Plasmid DNA isolation, DNA sequencing
Plasmid DNA was isolated using the alkaline lysis method described by Sambrook et al. Full length positive cDNA clones were sequenced using dideoxy sequencing. Sanger et al., Proc. Natl. Acad. Sci. USA, 74: 5463-5467. Open reading frames were aggregated and analyzed using BLAST search (GenBank, Bethesda, MD), and sequence alignment was performed using the BCM Search Launcher: Multiple Sequence Alignments Pattern-Induced Multiple Alignment Method (F. Corpet Nuc. Acids Res. 16: 10881-10890 (1987)). Sequences and sequence alignments are shown in Figure 5-11.

Northern blot hybridization of rat corpus luteum RNA 20 mg total RNA isolated from rat corpus luteum at various stages of apoptosis was separated on a 1% denaturing formaldehyde agarose gel and immobilized on a nylon membrane. The membrane was probed ( ⁷ × 10 ⁷ ) using full-length rat apoptosis-specific eIF-5A cDNA (SEQ ID NO: 1) labeled with ³² P-dCTP using a random primer kit (Boehringer). Alternatively, the membrane was probed ( ⁷ × 10 ⁷ cpm) using full-length rat apoptosis-specific DHS cDNA (SEQ ID NO: 6) labeled with ³² P-dCTP using a random primer kit (Boehringer). The membranes were washed once with 1 × SSC, 0.1% SDS at room temperature and three times at 0.2 × SSC, 0.1% SDS, 65 ° C. The membranes were dried and exposed to X-ray film overnight at -70 ° C.

  As can be seen, both eIF-5A and DHS were up-regulated in apoptotic luteal tissue. Apoptosis-specific eIF-5A expression is significantly enhanced after induction of apoptosis by PGF-2α treatment-low at 0 but substantially increased within 1 hour of treatment and even more within 8 hours of treatment Increased and slightly increased within 24 hours of treatment (Figure 14). DHS expression was low at 0, substantially increased within 1 hour of treatment, even more increased within 8 hours of treatment, and slightly increased again within 24 hours of treatment (Figure 15).

Production of apoptotic rat corpus luteum RT-PCR products using primers based on yeast, fungal, and human eIF-5A sequences Partial length apoptotic-specific eIF-5A sequences corresponding to the 3 'end of this gene ( SEQ ID NO: 11) was produced from apoptotic rat corpus luteum RNA template by RT-PCR using oligonucleotide primer pairs designed from yeast, fungal and human eIF-5A sequences. The upstream primer used to isolate the 3 ′ end of the rat eIF-5A gene is a 20 nucleotide degenerate primer: 5 ′ TCSAARACHGGNAAGCAYGG 3 ′ (SEQ ID NO: 9), where S is selected from C and G; R Is selected from A and G; H is selected from A, T, and C; Y is selected from C and T; and N is any nucleic acid. The downstream primer used to isolate the 3 ′ end of the rat eIF-5A gene contains 42 nucleotides: 5 ′ GCGAAGCTTCCATGGCTCGAGTTTTTTTTTTTTTTTT TTTTT 3 ′ (SEQ ID NO: 10). Reverse transcriptase polymerase chain reaction (RT-PCR) was performed. Briefly, 5 mg of downstream primer was used to synthesize the first strand of cDNA. The first strand was then used as a template for RT-PCR using both upstream and downstream primers.

  Separation of the RT-PCR product on an agarose gel revealed the presence of a 900 bp fragment that was subcloned into pBluescript ™ (Stratagene Cloning Systems, La Jolla, Calif.) Using blunt end ligation and sequencing (SEQ ID NO: 11). The 3 ′ terminal cDNA sequence is SEQ ID NO: 11 and the 3 ′ terminal amino acid sequence is SEQ ID NO: 12. See Figure 1-2.

  A partial length apoptosis-specific eIF-5A sequence (SEQ ID NO: 15) corresponding to the 5 ′ end of this gene and an overlap with the 3 ′ end were generated by RT-PCR from an apoptotic rat corpus luteum RNA template. The 5 ′ primer was a 24-mer with the sequence 5 ′ CAGGTCTAGAGTTGGAATCGAAGC 3 ′ (SEQ ID NO: 13), which was designed from the human eIF-5A sequence. The 3 ′ primer was a 30-mer with the sequence 5 ′ ATATCTCGAGCCTTGATTGCAACAGCTGCC 3 ′ (SEQ ID NO: 14), which was designed according to the 3 ′ end RT-PCR fragment. Reverse transcriptase polymerase chain reaction (RT-PCR) was performed. Briefly, 5 mg of downstream primer was used to synthesize the first strand of cDNA. The first strand was then used as a template for RT-PCR using both upstream and downstream primers.

  Separation of RT-PCR products on an agarose gel revealed the presence of a 500 bp fragment, which was transformed into pBluescriptTM (Stratagene Cloning Systems, Inc., using the XbaI and XhoI cloning sites present in the upstream and downstream primers, respectively. La Jolla, CA) was subcloned and sequenced (SEQ ID NO: 15). The 5 ′ terminal cDNA sequence is SEQ ID NO: 15 and the 5 ′ terminal amino acid sequence is SEQ ID NO: 16. See Figure 2.

  The sequences at the 3 ′ and 5 ′ ends of rat apoptosis-specific eIF-5A (SEQ ID NO: 11 and SEQ ID NO: 15, respectively) overlapped, resulting in a full-length cDNA sequence (SEQ ID NO: 1). This full length sequence was juxtaposed and compared to the sequence in the GeneBank database. See Figure 1-2. This cDNA clone encodes a 154 amino acid polypeptide (SEQ ID NO: 2) having a calculated molecular mass of 16.8 KDa. The nucleotide sequence of the full-length cDNA of rat apoptosis-specific corpus luteum eIF-5A gene obtained by RT-PCR, SEQ ID NO: 1 is shown in FIG. 3, and the corresponding derived amino acid sequence is SEQ ID NO: 9. is there. The derived full-length amino acid sequence of eIF-5A was juxtaposed with human and mouse eIF-5a sequences. See Figure 7-9.

Production of apoptotic rat corpus luteum RT-PCR products using primers based on human DHS sequences Partial-length apoptotic-specific DHS sequence (SEQ ID NO: 6) corresponding to the 3 'end of this gene Produced by RT-PCR from a rat corpus luteum RNA template using oligonucleotide primer pairs designed from human DHS sequences. The 5 ′ primer is a 20-mer with the sequence 5′GTCTGTGTATTATTGGGCCC 3 ′ (SEQ ID NO: 17); the 3 ′ primer is a 42-mer with the sequence 5 ′ GCGAAGCTTCCATGGCTCGAGTTTTTTTTTTTTTTTTTTTTT 3 ′ (SEQ ID NO: 10). Reverse transcriptase polymerase chain reaction (RT-PCR) was performed. Briefly, 5 mg of downstream primer was used to synthesize the first strand of cDNA. The first strand was then used as a template for RT-PCR using both upstream and downstream primers.

  Separation of the RT-PCR product on an agarose gel revealed the presence of a 606 bp fragment that was subcloned and sequenced into pBluescript ™ (Stratagene Cloning Systems, La Jolla, Calif.) Using blunt end ligation. (SEQ ID NO: 6). The nucleotide sequence (SEQ ID NO: 6) of the rat apoptotic-specific corpus luteum DHS gene partial length cDNA obtained by RT-PCR is shown in FIG. 4 and the corresponding derived amino acid sequence is SEQ ID NO: 7. .

Genomic DNA isolation and Southern blot analysis Genomic DNA for Southern blots was isolated from isolated rat ovaries. Approximately 100 mg of ovarian tissue was divided into small pieces and placed in a 15 ml tube. The tissue was washed twice by gently shaking the tissue suspension with 1 ml PBS, after which the PBS was removed using a pipette. This tissue is resuspended in 2.06 ml of DNA-buffer (0.2 M Tris-HCl, pH 8.0 and 0.1 mM EDTA) and 240 μl of 10% SDS and 100 μl of protease K (Boehringer Manheim; 10 mg / ml). Was added. The tissue was left overnight at 45 ° C. in a shaking water bath. The next day, 100 μl of another protease K (10 mg / ml) was added and the tissue suspension was incubated for an additional 4 hours in a 45 ° C. water bath. After incubation, the tissue suspension was extracted once with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and once with an equal volume of chloroform: isoamyl alcohol (24: 1). After extraction, 1/10 volume of 3M sodium acetate (pH 5.2) and 2 volumes of ethanol were added. A DNA pipette was drawn from the solution using a glass pipette sealed with a Bunsen burner and formed with a hook, and the DNA was transferred to a clean microcentrifuge tube. The DNA was washed once with 70% ethanol and air dried for 10 minutes. The DNA pellet was dissolved in 500 μl of 10 mM Tris-HCl (pH 8.0) and 10 μl RNase A (10 mg / ml) was added and the DNA was incubated at 37 ° C. for 1 hour. DNA was extracted once with phenol: chloroform: isoamyl alcohol (25: 24: 1) and the DNA was added by adding 1/10 volume of 3M sodium acetate (pH 5.2) and 2 volumes of ethanol. Precipitated. DNA was pelleted by centrifugation at 13,000 xg for 10 minutes at 4 ° C. The DNA pellet was washed once with 70% ethanol and the DNA was lysed by spinning in 200 μl of 10 mM Tris-HCl (pH 8.0) at 4 ° C. overnight.

For Southern blot analysis, genomic DNA isolated from rat ovary was digested with various restriction enzymes that either did not cut the endogenous gene or cut only once. To achieve this, 10 μg genomic DNA, 20 μl 10 × reaction buffer and 100 U restriction enzyme were reacted in a total reaction volume of 200 μl for 5-6 hours. Digested DNA was loaded on a 0.7% agarose gel and electrophoresed either at 40V for 6 hours or at 15V overnight. After electrophoresis, the gel was depurinated in 0.2 N HCl for 10 minutes, then washed twice in denaturing solution (0.5 M NaOH, 1.5 M NaCl) for 15 minutes, and neutralization buffer (1.5 Washing was carried out twice for 15 minutes in M NaCl, 0.5M Tris-HCl, pH 7.4). The DNA is transferred to a nylon membrane and the membrane is hybridized with a hybridization solution (40% formamide, 6 × SSC, 5 × Denhart's solution (1 × Denhart's solution is 0.02% Ficoll, 0.02% PVP, and 0.02% BSA), 0.5%. SDS and 1.5 mg denatured salmon sperm DNA). A 3′UTR 700 bp PCR fragment of rat eIF-5A cDNA (650 bp 3′UTR and 50 bp coding region) was labeled with [α ³² P] -dCTP by random priming and 1 × 10 ⁶ cpm on this membrane Added at / ml.

Similarly, a 606 bp PCR fragment of rat DHS cDNA (450 bp coding region and 156 bp 3′UTR) is randomly primed, labeled with [α ³² P] -dCTP, and into a second identification membrane, 1 × 10 Added at ⁶ cpm / ml. These blots were hybridized overnight at 42 ° C. and then washed twice at 42 ° C. with 2 × SSC and 0.1% SDS and twice at 42 ° C. with 1 × SSC and 0.1% SDS. These blots were then exposed to film for 3-10 days.

Rat corpus genomic DNA was cut with the restriction enzyme shown in FIG. 20 and probed with ³² P-dCTP-labeled full-length eIF-5A cDNA. Hybridization under high stringency conditions revealed hybridization of the full-length cDNA probe to several restriction fragments of the DNA sample digested by each restriction enzyme, indicating that some of the eIF-5A The presence of an isoform is indicated. Of particular note, when rat genomic DNA is digested with EcoRV, which has a restriction site within the open reading frame of apoptosis-specific eIF-5A, the two limitations of the apoptosis-specific isoform of eIF-5A The fragment is detectable by Southern blot. These two fragments are indicated by two arrows in FIG. Restriction fragments corresponding to the apoptosis-specific isoform of eIF-5A are indicated by single arrows in the lane labeled with EcoR1 and BamH1, and these restriction enzymes do not have a cleavage site in the open reading frame. It was. These results suggest that apoptosis-specific eIF-5A is a single copy gene in rats. As shown in FIGS. 5 to 13, the eIF-5A gene is highly conserved across species, and as a result, it is expected that there will be a significant amount of conservation between isoforms within any species.

FIG. 21 shows a Southern blot of rat genomic DNA probed with ³² P-dCTP labeled partial length rat corpus luteum apoptosis-specific DHS cDNA. This genomic DNA was cleaved with EcoRV, but this restriction enzyme does not cleave the partial length cDNA used as a probe. Two restriction fragments are evident, indicating that there are two copies of the gene or that the gene contains an intron with an EcoRV site.

Example 2
This example demonstrates the regulation of apoptosis by apoptosis-specific eIF-5A and DHS.

COS-7 cell culture and RNA isolation COS-7, an African green monkey kidney fibroblast-like cell line transformed with the SV40 mutant encoding wild type T antigen, was transfected into all transfection-based Used for experiment. COS-7 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing L-glutamine 0.584 g / L, glucose 4.5 g / L, and sodium bicarbonate 0.37%. This culture medium was supplemented with 10% fetal bovine serum (FBS) and 100 U penicillin / streptomycin. Cells were grown at 37 ° C. in a humidified environment of 5% CO ₂ and 95% air. Cells were subcultured every 3-4 days by detaching adherent cells with a solution of 0.25% trypsin and 1 mM EDTA. The detached cells were distributed at a split ratio of 1:10 into a new culture dish containing fresh medium.

  COS-7 cells used for RNA isolation were grown in 150-mm tissue culture treated dishes (Coming). These cells were harvested by detaching with trypsin-EDTA solution. The detached cells were collected in a centrifuge tube and the cells were pelleted by centrifugation at 3000 rpm for 5 minutes. The supernatant was removed and the cell pellet was snap frozen in liquid nitrogen. RNA was isolated from frozen cells using the GenElute Mammalian Total RNA Miniprep kit (Sigma) according to the manufacturer's instructions.

Construction of recombinant plasmid and transfection of COS-cell Recombinant plasmid carrying the full length coding sequence of rat apoptotic eIF-5A in sense direction and 3 'untranslated region (UTR) of rat apoptotic eIF-5A in antisense direction Was constructed using the mammalian epitope tag expression vector pHM6 (Roche Molecular Biochemicals) and is shown in FIG. This vector includes: CMV promoter-human cytomegalovirus immediate promoter / enhancer; HA-nonapeptide epitope tag derived from influenza hemagglutinin; BGH pA-bovine growth hormone polyadenylation signal; f1 ori-f1 origin SV40 ori-SV40 early promoter and origin; neomycin-neomycin resistance (G418) gene; SV40 pA-SV40 polyadenylation site signal; Col E1-ColE1 origin; ampicillin-ampicillin resistance gene. The full length coding sequence of rat apoptotic eIF-5A and the 3′UTR of rat apoptotic eIF-5A were amplified by PCR from the original rat eIF-5A RT-PCR fragment (SEQ ID NO: 1) in pBluescript. To amplify full-length eIF-5A, the primers used were: forward 5 'GCC AAGCTT AATGGCAGATGATTTGG 3' (SEQ ID NO: 18) (Hind3), and reverse 5 'CT GAATTC CAGTTATTTTGCCATGG 3' (SEQ ID NO: : 22) (EcoR1). To amplify 3'UTR rat eIF-5A, the primers used were: forward 5'AAT GAATTC CGCCATGACAGAGGAGGC 3 '(SEQ ID NO: 23) (EcoR1) and reverse 5'GCG AAGCTT CCATGGCTCGAGTTTTTTTTTTTTTTTTTTTTT 3' (sequence Number: 10) (Hind3).

  The full-length rat eIF-5A PCR product isolated after agarose gel electrophoresis was 430 bp in length, while the 3 ′ UTR rat eIF-5A PCR product was 697 bp in length. Both PCR products were subcloned into the Hind 3 and EcoR1 sites of pHM6, producing pHM6-full length eIF-5A and pHM6-antisense 3′UTR eIF-5A. This full-length rat eIF-5A PCR product was purified from influenza hemagglutinin (HA) upstream of multiple cloning sites to enable detection of recombinant proteins using anti- [HA] -peroxidase antibodies. Subcloned in-frame with a peptide epitope tag. Expression was driven by the human cytomegalovirus immediate early promoter / enhancer to ensure high levels of expression in mammalian cell lines. This plasmid contains the neomycin resistance (G418) gene that allows for the selection of stable transfectants, and the SV40 early promoter that allows episomal replication in cells expressing the SV40 large T antigen, such as COS-7 and It also features a starting point.

  COS-7 cells used for transfection experiments are either 24-well cell culture plates for cells used for protein extraction (Corning) or 4-chamber culture slides for cells used for staining (Falcon) Incubated in either of the above. Cells were grown to 50-70% confluence in DMEM medium supplemented with 10% FBS but lacking penicillin / streptomycin. Prepare sufficient transfection medium for one well or culture slide in a 24-well plate by diluting 0.32 μg of plasmid DNA in 42.5 μl of serum-free DMEM and incubating this mixture at room temperature for 15 minutes did. 1.6 μl of transfection reagent LipofectAMINE (Gibco, BRL) was diluted in 42.5 μl of serum-free DMEM and incubated at room temperature for 5 minutes. After 5 minutes, the LipofectAMINE mixture was added to the DNA mixture and incubated at room temperature for 30-60 minutes. Transfected cells were washed once with serum-free DMEM, then overlaid on transfection medium, and the cells were returned to the growth chamber and left for 4 hours.

  After incubation, 0.17 ml DMEM + 20% FBS was added to these cells. These cells were cultured for an additional 40 hours before being induced to undergo apoptosis and then harvested for staining or Western blot analysis. As a control, mock transfection was also performed in which plasmid DNA was removed from the transfection medium.

Protein extraction and Western blot proteins from transfected cells, cells in PBS (8 g / L NaCl, 0.2 g / L KCl, 1.44 g / L Na ₂ HPO ₄ , and 0.24 g / L KH ₂ PO ₄ ) Isolate for Western blot by two washes followed by 150 μl of hot SDS gel-load buffer (50 mM Tris-HCl, pH 6.8, 100 mM dithiothreitol, 2% SDS, 0.1% bromophenol blue, And 10% glycerol). Cell lysates were collected in microfuge tubes, heated at 95 ° C. for 10 minutes, and then centrifuged at 13,000 × g for 10 minutes. The supernatant was transferred to a new microcentrifuge tube and stored at −20 ° C. until use.

  For Western blots, 2.5 or 5 μg of total protein was separated on a 12% SDS polyacrylamide gel. The separated protein was transferred to a polyvinylidene difluoride membrane. The membrane is then incubated for 1 hour in blocking solution (5% skim milk powder in PBS, 0.02% sodium azide) and 3 times over 15 minutes in PBS-T (PBS + 0.05% Tween-20). Washed twice. The membrane was stored overnight at 4 ° C. in PBS-T. After warming to room temperature the next day, the membrane was blocked in 1 μg / ml polyvinyl alcohol for 30 seconds. The membrane was rinsed 5 times with deionized water and blocked with 5% milk solution in PBS for 30 minutes. The primary antibody was preincubated with 5% milk solution in PBS for 30 minutes and then incubated with the membrane.

  Several primary antibodies were used. Anti- [HA] -peroxidase antibody (Roche Molecular Biochemicals) was used at a dilution of 1: 5000 to detect recombinant protein expression. Since this antibody is conjugated to peroxidase, no secondary antibody was needed and the blot was washed and developed by chemiluminescence. Another primary antibody used is a monoclonal antibody derived from an oncogene that recognizes p53 (Ab-6), Bcl-2 (Ab-1), and c-Myc (Ab-2). Monoclonal antibodies against p53 were used at a dilution of 0.1 μg / ml, and both monoclonal antibodies against Bcl-2 and c-Myc were used at a dilution of 0.83 μg / ml. After incubation with the primary antibody for 60-90 minutes, the membrane was washed 3 times with PBS-T for 15 minutes. The secondary antibody was then diluted in 1% milk in PBS and incubated with the membrane for 60-90 minutes. When p53 (Ab-6) is used as the primary antibody, the secondary antibody used is goat anti-mouse IgG (Rockland) conjugated to alkaline phosphatase diluted 1: 1000. When Bcl-2 (Ab-1) and c-Myc (Ab-2) were used as primary antibodies, rabbit anti-mouse IgG (Sigma) conjugated to peroxidase was used at a dilution of 1: 5000. After incubation with the secondary antibody, the membrane was washed 3 times with PBS-T.

Blots were developed using two colorimetric and chemiluminescent detection methods. The colorimetric method was used only when p53 (Ab-6) was used as a primary antibody in combination with a secondary antibody conjugated to alkaline phosphatase. The bound antibodies were 0.33 mg / mL nitroblue tetrazolium, 0.165 mg / mL 5-bromo-4-chloro-3-indolyl phosphate, 100 mM NaCl, 5 mM MgCl ₂ , and 100 mM Tris-HCl (pH 9.5). Were visualized by incubation of the blots in the dark in the solution. The color reaction was stopped by incubation of the blot in 2 mM EDTA in PBS. The chemiluminescent detection method was used for all other primary antibodies, including anti- [HA] peroxidase, Bcl-2 (Ab-1), and c-Myc (Ab-2). Peroxidase-conjugated antibodies were detected using ECL Plus Western blot detection kit (Amersham Pharmacia Biotech). Briefly, the membrane was wiped until slightly dry and then incubated in the dark with a 40: 1 mixture of Reagent A and Reagent B for 5 minutes. The membrane was wiped dry, placed between acetate sheets, and exposed to X-ray film for varying periods of 10 seconds to 10 minutes.

Induction of apoptosis in COS-7 cells Two methods were used to induce apoptosis in transfected COS-7 cells using serum deprivation and treatment of Streptomyces species (Calbiochem) with actinomycin D. For both treatments, media was removed 40 hours after transfection. For serum starvation experiments, the medium was replaced with serum- and antibiotic-free DMEM. Cells grown in antibiotic-free DMEM supplemented with 10% FBS were used as controls. For actinomycin D induction of apoptosis, the medium was replaced with antibiotic-free DMEM supplemented with 1 μg / ml actinomycin D dissolved in 10% FBS and methanol. Control cells were grown in antibiotic-free DMEM supplemented with 10% FBS and an equal volume of methanol. For both methods, the percentage of apoptotic cells was determined 48 hours after staining with either Hoescht or Annexin V-Cy3. Apoptosis induction was also confirmed by Northern blot analysis and is shown in FIG.

Hoescht staining nuclear fragmentation and such condensation, in order to identify apoptotic cells based on morphological characteristics, using a nuclear stain Hoescht, it was labeled nuclei of transfected COS-7 cells. A fixative solution consisting of a 3: 1 mixture of anhydrous methanol and glacial acetic acid was prepared immediately before use. An equal volume of fixative was added to the medium of COS-7 cells growing on the culture slide and incubated for 2 minutes. The medium / fix solution mixture was removed from the cells and discarded, and 1 ml of fix solution was added to the cells. After 5 minutes, the fixative was discarded and 1 ml of fresh fixative was added to the cells and incubated for 5 minutes. The fixative was discarded and the cells were air-dried for 4 minutes, after which 1 ml of Hoescht staining solution (0.5 μg / ml Hoescht 33258 in PBS) was added. After 10 minutes incubation in the dark, the stain was discarded and the slides were washed 3 times with deionized water for 1 minute. After washing, 1 ml of McIlvaine's buffer (0.021 M citrate, 0.058 M Na ₂ HPO ₄ .7H ₂ O; pH 5.6) was added to the cells and they were incubated for 20 minutes in the dark. The buffer was discarded and the cells were air-dried in the dark for 5 minutes and the chamber separating the wells of the culture slide was removed. A few drops of Vectashield mounting medium (Vector Laboratories) for fluorescence were added to the slide and the coverslip was overlaid. Stained cells were observed under a fluorescence microscope using a UV filter. Cells with brightly stained and fragmented nuclei were scored for apoptosis.

Annexin V-Cy3 staining Annexin V-Cy3 apoptosis detection kit (Sigma) was used to fluorescently label the outwardly transported phosphatidylserine on apoptotic cells. This kit was modified as follows, and others were used according to the manufacturer's protocol. Briefly, transfected COS-7 cells growing on four chamber culture slides were washed twice with PBS and three times with 1 × binding buffer. 150 μl of staining solution (1 μg / ml AnnCy3 in 1 × binding buffer) was added and the cells were incubated in the dark for 10 minutes. The staining solution was then removed and the cells were washed 5 times with 1x binding buffer. The chamber wall was removed from the culture slide, a few drops of 1 × binding buffer were placed on the cells, and the coverslips were overlaid. Stained cells were analyzed with a fluorescence microscope using a green filter to visualize the red fluorescence of positively stained (apoptotic) cells. Total cell population was determined by counting the number of cells under visible light.

Example 3
This example demonstrates the regulation of apoptosis by apoptosis-specific eIF-5A and DHS.

  FIG. 23 is a flow chart illustrating the procedure for transient transfection of COS-7 cells using the general techniques and methods described in the previous examples, where cells in serum-free medium are Incubated in plasmid DNA in lipofectAMINE for 4 hours, serum was added, and cells were incubated for an additional 40 hours. Cells are then incubated for 48 hours in normal medium before analysis (i.e., without further treatment), serum depleted for 48 hours to induce apoptosis prior to analysis, or to induce apoptosis prior to analysis Either treatment with actinomycin D for 48 hours was performed.

  FIG. 22 is a Western blot illustrating the transient expression of foreign proteins in COS-7 cells after transfection with pHM6. Mock transfection or transfection with pHM6-LacZ, pHM6-antisense 3'rF5A (pHM6-antisense 3'UTR rat apoptotic eIF-5A), or pHM6-sense rF5A (pHM6-full length rat apoptotic eIF-5A) Forty-eight hours after either of these was performed, the protein was isolated from COS-7 cells. 5 μg of protein from each sample was fractionated by SDS-PAGE, transferred to a PVDF membrane, and Western blotted with anti- [HA] peroxidase. Bound antibody was detected by chemiluminescence and exposed to x-ray film for 30 seconds. The expression of LacZ (lane 2) and sense rat apoptotic eIF-5A (lane 4) is clearly recognizable.

  As described above, COS-7 cells were either mock transfected or transfected with pHM6-sense rF5A (pHM6-full length rat eIF-5A). Forty hours after transfection, these cells were induced to undergo apoptosis by 48 hour recovery of serum. Caspase proteolytic activity in transfected cell extracts was measured using a fluorometric homogenous caspase assay kit (Roche Diagnostics). DNA fragmentation was also measured using a FragEL DNA fragmentation apoptosis detection kit (Oncogene) in which the exposed 3′-OH ends of the DNA fragments were labeled with fluorescein-labeled deoxynucleotides.

  Additional COS-7 cells were either mock transfected or transfected with pHM6-sense rF5A (pHM6-full length rat eIF-5A). Forty hours after transfection, the cells are grown in normal medium containing serum for an additional 48 hours (no further treatment), induced to undergo apoptosis by 48 hour serum recovery, or actinomycin D. Of 0.5 μg / ml was induced to undergo apoptosis for 48 hours. Cells were stained with either Hoescht 33258, which shows nuclear fragmentation associated with apoptosis, or with annexin V-Cy3, which shows phosphatidylserine exposure associated with apoptosis. Stained cells were also visualized with a fluorescence microscope using a green filter and counted to determine the percentage of cells undergoing apoptosis.

  FIG. 25 shows enhancement, as reflected by increased caspase activity when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-induced eIF-5A in the sense direction. Exemplifies induced apoptosis. Rat apoptosis-induced expression of eIF-5A resulted in a 60% increase in caspase activity.

  FIG. 26 shows that as reflected by increased DNA fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-induced eIF-5A in the sense orientation, Illustrates enhanced apoptosis. Rat apoptosis-induced eIF-5A expression resulted in a 273% increase in DNA fragmentation. Figure 27, as reflected by increased DNA fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-induced eIF-5A in the sense orientation, Illustrates the detection of apoptosis. There was a greater incidence of DNA fragmentation in cells expressing rat apoptosis-induced eIF-5A. Figure 28, as reflected by increased nuclear fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-induced eIF-5A in the sense orientation, Illustrates enhanced apoptosis. Rat apoptosis-induced eIF-5A expression resulted in a 27% and 63% increase in nuclear fragmentation over the control in the non-serum starved and serum starved samples, respectively.

  Figure 29 shows the detection of apoptosis as reflected by phosphatidylserine exposure when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-induced eIF-5A in sense orientation Is illustrated. Figure 30 shows enhancement as reflected by increased phosphatidylserine exposure when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-induced eIF-5A in the sense direction. Exemplifies induced apoptosis. Rat apoptosis-induced eIF-5A expression resulted in a 140% and 198% increase in phosphatidylserine exposure over the control in non-serum starved and serum starved samples, respectively.

  FIG. 31 shows enhancement as reflected by increased nuclear fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-induced eIF-5A in the sense orientation. Exemplifies induced apoptosis. Rat apoptosis-induced eIF-5A expression resulted in 115% and 62% increase in nuclear fragmentation over control in untreated and treated samples, respectively. FIG. 32 shows that COS-7 cells transiently transfected with pHM6 containing full-length rat apoptosis-induced eIF-5A in the sense orientation, under conditions with no further treatment or treatment to induce apoptosis. 3 illustrates a comparison of enhanced apoptosis compared.

Example 4
This example demonstrates the modulation of apoptotic activity following administration of apoptosis-specific eIF-5A and DHS.

  In addition, COS-7 cells were mock transfected, transfected with pHM6-LacZ, or transfected with pHM6-sense rF5A (pHM6-full length rat eIF-5A) and incubated for 40 hours. A 5 μg sample of protein extract from each sample was fractionated by SDS-PAGE, transferred to a PVDF membrane, and Western blotted with a monoclonal antibody that recognizes Bcl-2. Rabbit anti-mouse IgG conjugated to peroxidase was used as a secondary antibody and bound antibody was detected by chemiluminescence and exposure to x-ray film. The results are shown in FIG. Less Bcl-2 was detectable in cells transfected with pHM6-sense rF5A than in cells transfected with pHM6-LacZ; as a result, Bcl-2 was down-regulated.

  Additional COS-7 cells are mock transfected, transfected with pHM6-antisense 3'rF5A (rat apoptosis-specific eIF-5A pHM6-antisense 3'UTR), or pHM6-sense rF5A Transfected with (pHM6-full length rat apoptosis-specific eIF-5A). Forty hours after transfection, these cells were induced for apoptosis by serum collection for 48 hours. A 5 μg sample of protein extract from each sample was fractionated by SDS-PAGE, transferred to a PVDF membrane, and Western blotted with a monoclonal antibody that recognizes Bcl-2. Rabbit anti-mouse IgG conjugated to peroxidase was used as a secondary antibody, and bound antibody was detected by chemiluminescence and exposure to x-ray film.

  In addition, COS-7 cells were mock transfected, transfected with pHM6-LacZ, or transfected with pHM6 sense rF5A (pHM6-full length rat eIF-5A) and incubated for 40 hours. A 5 μg sample of protein extract from each sample was fractionated by SDS-PAGE, transferred to a PVDF membrane, and Western blotted with a monoclonal antibody that recognizes p53. Goat anti-mouse IgG conjugated to alkaline phosphatase was used as a secondary antibody, and bound antibody was detected by a colorimetric method.

  Finally, COS-7 cells were mock transfected, transfected with pHM6-LacZ, or transfected with pHM6-sense rF5A (pHM6-full length rat eIF-5A) and incubated for 40 hours. A 5 μg sample of protein extract from each sample was fractionated by SDS-PAGE, transferred to a PVDF membrane and probed with a monoclonal antibody that recognizes p53. Corresponding protein blots were probed with anti- [HA] -peroxidase to determine the level of rat apoptosis-specific eIF-5A expression. Goat anti-mouse IgG conjugated to alkaline phosphatase was used as a secondary antibody and bound antibody was detected by chemiluminescence.

  FIG. 33 shows down-regulation of Bcl-2 when COS-7 cells are transiently transfected with pHM6 containing full-length rat apoptosis-induced eIF-5A in the sense direction. The upper panel shows Coomassie blue-stained protein blot; the lower panel shows the corresponding Western blot. Less Bcl-2 was detectable in cells transfected with pHM6-sense rF5A than in cells transfected with pHM6-LacZ.

  FIG. 34 shows up-regulation of Bcl-2 when COS-7 cells are transiently transfected with pHM6 containing full-length rat apoptosis-induced eIF-5A in the antisense direction. The upper panel shows Coomassie blue-stained protein blot; the lower panel shows the corresponding Western blot. More Bcl-2 was detectable in cells transfected with pHM6-antisense 3′rF5A than in mock-transfected cells or cells transfected with pHM6-sense rF5A.

  FIG. 35 shows c-Myc up-regulation when COS-7 cells are transiently transfected with pHM6 containing full-length rat apoptosis-induced eIF-5A in the sense direction. The upper panel shows Coomassie blue-stained protein blot; the lower panel shows the corresponding Western blot. More c-Myc was detectable in pHM6-LacZ transfected cells or mock controls than in cells transfected with pHM6-sense rF5A.

  FIG. 36 shows p53 upregulation when COS-7 cells are transiently transfected with pHM6 containing full-length rat apoptosis-induced eIF-5A in the sense direction. The upper panel shows Coomassie blue-stained protein blot; the lower panel shows the corresponding Western blot. More p53 was detectable in pHM6-LacZ transfected cells or mock control cells transfected with pHM6-sense rF5A.

  FIG. 37 shows the dependence of p53 upregulation on pHM6-full length rat apoptosis-induced expression of eIF-5A in COS-7 cells. In a Western blot probed with anti- [HA] -peroxidase, the upper panel shows the Coomassie blue-stained protein blot and the lower panel shows the corresponding Western blot. More rat apoptosis-induced eIF-5A was detectable in the first transfection than in the second transfection. In a Western blot probed with anti-p53, the upper panel of A shows the corresponding Coomassie blue-stained protein blot, and the lower panel shows a Western blot with p53. For the first transfection, more p53 was detectable in cells transfected with pHM6-sense rF5A than in cells transfected with pHM6-LacZ or mock controls. For the second transfection in which there is less expression of rat apoptosis-induced eIF-5A, no difference in p53 levels was detected between cells transfected with pHM6-sense rF5A, pHM6-LacZ or mock controls. It was possible.

Example 5
This example demonstrates that apoptosis-specific eIF-5A can induce apoptosis in cells with active p53 (RKO cells) and cells without active p53 (RKO-E6 cells), This indicates that apoptosis-specific eIF-5A can initiate apoptosis via pathways other than the p53 pathway. This supports our assertion that this works upstream and probably can kill a wide variety of different cancer types.

  This example also shows that the active site of eIF-5A1 is the carboxy terminus of the protein (ie see experiments with truncated eIF-5A1), possibly including an RNA binding domain.

  Furthermore, this example also shows that this is mostly proliferative eIF-5A since human eIF-5A2 is unable to induce apoptosis. Thus, this is considered to be two eIF-5A genes from the human data bank, apoptosis-specific eIF-5A1 is an apoptosis gene, and eIF-5A2 is a proliferation gene.

RKO (American Type Culture Collection (ATCC) CRL-2577), a human colon cancer cell line that expresses wild-type p53 cultured in RKO and RKO-E6 cells , and stably causes a decline in normal p53 levels and function RKO-E6 (ATCC CRL2578), an RKO-derived cell line containing the integrated human papillomavirus E6 oncogene, was used for transfection-based experiments. RKO and RKO-E6 cells were cultured in Eagle's minimum essential medium (MEM) containing non-essential amino acids, Earle's salt, and L-glutamine. The culture medium was supplemented with 10% fetal bovine serum (FBS) and 100 U penicillin / streptomycin. Cells were grown at 37 ° C. in a humidified environment of 5% CO ₂ and 95% air. These cells were passaged every 3-4 days by detaching adherent cells with a solution of 0.25% trypsin and 1 mM EDTA. The detached cells were distributed at a separation ratio of 1:10 to 1:12 in a new culture dish containing a new medium.

Cloning of human eIF5A2 Human eIF5A2 is GenBank (deposit number XM It was isolated by RT-PCR from RNA isolated from RKO cells using primers designed for the sequence of human eIF5A2 available from 113401). FIG. 38 provides an alignment of human eIF-5A isolated from RKO cells with the sequence of human eIF-5A2. RNA was isolated from RKO cells using GenElute Mammalian Total RNA Miniprep Kit (Sigma). The forward primer used to amplify eIF5A2 had the sequence 5 ′ AAACTACCATCTCCCCTGCC 3 ′ (SEQ ID NO: 24) and the reverse primer had the sequence 5 ′ TGCCCTACACAGGCTGAAAG 3 ′ (SEQ ID NO: 25). The resulting 936 bp PCR product was subcloned into pGEM-T Easy Vector (Promega) and sequenced.

  Thereafter, the pGEM-T Easy-eIF5A2 construct was used as a template and subcloned in-frame into the mammalian expression vector pHM6 (Roche). The forward primer used to amplify human eIF5A2 was 5 ′ ATCAAGCTTGCCCACCATGGCAGACG 3 ′ (SEQ ID NO: 26) and the reverse primer was 5 ′ AACGAATTCCATGCCTGATGTTTCCG 3 ′ (SEQ ID NO: 27). The resulting 505 bp PCR product was digested with Hind3 and EcoR1 and cloned into the Hind3 and EcoR1 sites of pHM6.

Construction of pHM6-cleaved eI5A1
To determine if the carboxy-terminal region of eIF5A1 is important for its apoptosis-inducing activity, eIF5A1 lacking the carboxy-terminus was constructed. A truncated eIF5A1 encoding amino acids 1-127 was produced by PCR using pBS-rat eIF5AI as a template. The forward PCR primer was 5 ′ GCCAAGCTTAATGGCAGATGATTTGG 3 ′ (SEQ ID NO: 18) and the reverse primer was 5 ′ TCCGAATTCGTACTTCTGCTCAATC 3 ′ (SEQ ID NO: 28). The resulting 390 bp PCR product was digested with EcoR1 and Hind3 and subcloned into the EcoR1 and Hind3 sites of pHM6.

Transfection RKO or RKO-E6 cells used in transfection experiments, in 8-well chamber culture slides (Falcon) for cells used for Hoescht staining, and 6-well plates for cells analyzed by flow cytometry Incubated in These cells were cultured to a confluence of 70-80% in MEM medium supplemented with 10% FBS but lacking penicillin / streptomycin. Sufficient transfection medium for one well of an 8-well culture slide was prepared by diluting 0.425 μg of plasmid DNA in 22 μl of serum-free MEM and incubating the mixture at room temperature for 15 minutes. Transfection reagent LipofectAMINE (Gibco, BRL) 0.85 μl was diluted in 22 μl of serum-free MEM and incubated for 5 minutes at room temperature. After 5 minutes, the LipofectAMINE mixture was added to the DNA mixture and incubated at room temperature for 30-60 minutes. Transfected cells were washed once with serum-free MEM, after which 44 μl of MEM was added to the transfection medium and this was layered on the cells. These cells were returned to the growth chamber and left for 4 hours. After incubation, 88 μl MEM + 20% FBS was added to the cells. The cells were then cultured for a further 44 hours and then stained as previously described by Hoescht 33258. In another experimental set, RKO or RKO-E6 cells in 8-well culture slides were treated with 0.25 μg / ml actinomycin D for 24 hours after transfection and then stained with Hoescht for 20 hours. Transfections performed in 6-well plates were performed in the same way except that all reagents were increased 4.81 fold. RKO cells transfected in 6-well plates were collected 48 hours after transfection and fixed for analysis by flow cytometry as described below.

Determination of transfection efficiency Transfection efficiency is determined by staining pHM6-LacZ-transfected cells with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-GAL). Decided. Blue stained cells were LacZ-expressing transfected cells and transfection efficiency was calculated as the number of blue stained cells divided by the total number of cells. Transfected cells were stained for 48 hours after transfection. These cells were washed twice with PBS and then fixed with 0.5% glutaraldehyde / PBS for 10 minutes at room temperature. These cells were washed three times with 1 mM MgCl ₂ / PBS, and then stained with 5 mM K ₄ Fe (CN) ₆ · 3H ₂ O, 5 mM K ₃ Fe (CN) ₆ , 1 mM MgCl ₂ , 0.1 in PBS. % X-GAL] was incubated until blue stained cells appeared.

To identify Hoescht staining nuclear fragmentation and apoptotic cells based on condensation, using a nuclear stain Hoescht, it was labeled transfected RKO and RKO-E6 cell nucleus. A fixative solution consisting of a 3: 1 mixture of anhydrous methanol and glacial acetic acid was prepared immediately before use. An equal volume of fixative was added to the growing cell medium on the culture slide and incubated for 2 minutes. The media / fix solution mixture was removed and discarded from the cells, and 1 ml of fix solution was added to the cells. After 5 minutes, the fixative was discarded and 1 ml of fresh fixative was added to the cells and incubated for 5 minutes. The fixative was discarded and the cells were air-dried for 4 minutes, after which 1 ml of Hoescht staining solution (0.5 μg / ml Hoescht 33258 in PBS) was added. After a 10 minute incubation in the dark, the staining solution was discarded and the slide was washed 3 times for 1 minute with deionized water. After washing, 1 ml of McIlvaine's buffer (0.021 M citrate, 0.058 M Na ₂ HPO ₄ .7H ₂ O; pH 5.6) was added to the cells and incubated for 20 minutes in the dark. The buffer was discarded, the cells were air-dried in the dark for 5 minutes, and the chamber separating the culture slide wells was removed. A few drops of Vectashield mount medium (Vector Laboratories) for fluorescence was added to the slide and covered with a coverslip. Stained cells were viewed under a fluorescence microscope using a UV filter. Lightly stained cells or fragmented nuclei were scored as apoptotic.

DNA fragmentation detection by flow cytometry DNA fragments produced during apoptosis were labeled with fluorescein-labeled deoxynucleotides using a fluorescein-FragEL ™ DNA fragmentation detection kit (Oncogene Research Products). Cells transfected with various constructs in 6-well culture plates were collected by trypsinization 48 hours after transfection and fixed and labeled according to the manufacturer's instructions. Briefly, cells were pelleted at 1000 × g for 5 minutes at 4 ° C. and once with PBS (8 g / L NaCl, 0.2 g / L KCl, 1.44 g / L Na ₂ HPO ₄ , and 0.24 g / L KH ₂ Washed in PO ₄ ). Cells were resuspended in 4% formaldehyde / PBS and incubated for 10 minutes at room temperature. These cells were pelleted again, resuspended in 1 ml of 80% ethanol and stored at 4 ° C. On the day of analysis, 1 ml of fixed cells (1 × 10 ⁶ cells / ml) was transferred to a microfuge tube and the cells were pelleted by centrifugation at 1000 × g for 5 minutes. Pelleted cells were resuspended in 200 μl of 1 × TBS (20 mM Tris, pH 7.6, 140 mM NaCl) and incubated for 10-15 minutes at room temperature. The cells were then pelleted again and resuspended in 100 μl of 20 μg / ml protease K and incubated for 5 minutes at room temperature. The cells were pelleted and resuspended in 100 μl of 1 × TdT equilibration buffer and incubated at room temperature for 10-30 minutes. Cells were then pelleted by centrifugation, resuspended in 60 μl of TdT labeling reaction mixture and incubated for 1-1.5 hours in the dark. After incubation, the cells were pelleted by centrifugation and washed twice with 200 μl of 1 × TBS. The cells were resuspended in a final volume of 0.5 ml 1xTBS and analyzed by a flow cytometer equipped with a 488 nm argon ion laser source.

Protein extraction and Western blot proteins were washed twice with PBS of cells, followed by warm SDS gel-loading buffer (50 mM Tris-HCl, pH 6.8, 100 mM dithiothreitol, 2% SDS, 0.1% bromophenol Isolated from the transfected cells for Western blot by addition of 150 μl of blue and 10% glycerol). Cell lysates were collected in microfuge tubes, heated at 95 ° C. for 10 minutes, and then centrifuged at 13,000 × g for 10 minutes. The supernatant was transferred to a new microcentrifuge tube and stored at −20 ° C. until use.

  For Western blot, 5 μg or 10 μg of total protein was separated on a 12% SDS polyacrylamide gel. The separated protein was transferred to a polyvinylidene difluoride membrane. The membrane was then incubated with blocking solution (5% skim milk powder in PBS, 0.02% sodium azide) for 1 hour and washed 3 times in PBS-T (PBS + 0.05% Tween-20) for 15 minutes. The membrane was stored overnight at 4 ° C. in PBS-T. After warming to room temperature the next day, the membrane was blocked in 1 μg / ml polyvinyl alcohol for 30 seconds. The membrane was washed 5 times with deionized water and then blocked with 5% milk solution in PBS for 30 minutes. Primary antibody was blocked with 5% milk solution in PBS / 0.025% Tween-20 for 30 minutes and then incubated with the membrane.

  These membranes are either a monoclonal antibody derived from an oncogene that recognizes p53 (Ab-6) or a polyclonal antibody against a synthetic peptide (amino-CRLPEGDLGKEIEQKYD-carboxy) homologous to the c-terminus of human eIF5A1 generated in chickens. Were blotted. Monoclonal antibody against p53 was used at a dilution of 0.1 μg / ml and antibody against eIF5A1 was used at a dilution of 1: 1000. The membrane was incubated with primary antibody for 60-90 minutes and then washed 3 times with PBS-T for 15 minutes. The secondary antibody was then diluted with 1% milk in PBS / 0.025% Tween-20 and incubated with the membrane for 60-90 minutes. When p53 (Ab-6) was used as the primary antibody, the secondary antibody used was goat anti-mouse IgG (Rockland) conjugated to alkaline phosphatase diluted 1: 1000. When anti-eIF5A1 was used as the primary antibody, rabbit anti-chicken IgY (Gallus Immunotech) conjugated to peroxidase was used at a dilution of 1: 10000. After incubation with the secondary antibody, the membrane was washed 3 times with PBS-T.

The blots were developed using two colorimetric and chemiluminescent detection methods. The colorimetric method was used only when p53 (Ab-6) was used as the primary antibody conjugated to the secondary antibody conjugated with alkaline phosphatase. The bound antibodies were 0.33 mg / mL nitroblue tetrazolium, 0.165 mg / mL 5-bromo-4-chloro-3-indolyl phosphate, 100 mM NaCl, 5 mM MgCl ₂ , and 100 mM Tris-HCl (pH 9.5). Visualization was by incubation of blots in the dark in solution. The color reaction was stopped by incubation of the blot in 2 mM EDTA in PBS. The chemiluminescent detection method was used for all other primary antibodies, including anti- [HA] peroxidase and anti-eIF5A1. The ECL Plus Western blot detection kit (Amersham Pharmacia Biotech) was used to detect peroxidase-conjugated antibody bound. Briefly, the membrane was wiped slightly until dry and then incubated with a 40: 1 mixture of Reagent A and Reagent B for 5 minutes in the dark. Membranes were wiped dry and placed between acetate sheets and exposed to X-ray film for varying periods of 10 seconds to 30 minutes.

  FIG. 39 shows a graph showing the percentage of apoptosis occurring in RKO and RKO-E6 cells after transient transfection. RKO and RKO-E6 cells were transiently transfected with pHM6-LacZ or pHM6-eIF5A1. After 24 hours, the cells were treated with either 0.25 μg / ml actinomycin D or an equal volume of methanol (control). These cells were stained with Hoescht after 20 hours and visually observed using a UV filter under a fluorescence microscope. Cells that stained brightly for condensed chromatin were scored as the degree of apoptosis. The experiment showed that RKO cells treated with actinomycin D and transfected with pHM6-eIF5A1 showed a 240% increase in apoptosis compared to cells transfected with pHM6-LacZ not treated with actinomycin D. I made it clear. RKO-E6 cells treated with actinomycin D and transfected with pHM6-eIF5A1 showed a 105% increase in apoptosis relative to cells transfected with pHM6-LacZ not treated with actinomycin D.

  FIG. 40 provides a graph showing the percentage of apoptosis occurring in RKO cells after transient transfection. RKO cells were transiently transfected with pHM6-LacZ, pHM6-eIF5A1, pHM6-eIF5A2, or pHM6-cleaved eIF5A1. After 44 hours, the cells were stained with Hoescht and visually viewed using a UV filter under a fluorescence microscope. Cells that stained brightly for condensed chromatin were scored as the degree of apoptosis. Cells transfected with pHM6-eIF5A1 showed a 25% increase in the degree of apoptosis relative to control cells transfected with pHM6-LacZ. This increase was not apparent for cells transfected with pHM6-eIF5A2 or pHM6-cleaved eIF5A1.

  FIG. 41 provides a graph showing the percentage of apoptosis occurring in RKO cells after transient transfection. RKO cells were not transfected or were transiently transfected with pHM6-LacZ or pHM6-eIF5A1. After 44 hours, the cells were stained with Hoescht and visually viewed using a UV filter under a fluorescence microscope. Cells that stained brightly for condensed chromatin were scored as the degree of apoptosis. After correcting for transfection efficiency, 60% of cells transfected with pHM6-eIF5A1 were apoptotic.

  FIG. 42 provides a flow cytometric analysis of RKO cell apoptosis after transient transfection. RKO cells were either not transfected or transiently transfected with pHM6-LacZ, pHM6-eIF5A1, pHM6-eIF5A2, or pHM6-cleaved eIF5A1. After 48 hours, cells were collected and fixed. Fragmented DNA reflecting apoptosis was labeled with fluorescein-conjugated deoxynucleotides and analyzed in flow cytometry equipped with a 488 nm argon ion laser source. The fluorescence generated at gate E is from non-apoptotic cells, and the fluorescence generated at gate F is from cells undergoing apoptosis. This table shows the percentage of cells undergoing apoptosis calculated based on the area under each gate peak. After correcting for background apoptosis and transfection efficiency in untransfected cells, 80% of cells transfected with pHM6-eIF5A1 showed apoptosis. Cells transfected with pHM6-LacZ, pHM6-eIF5A2 or pHM6-cleaved eIF5A1 showed only background levels of apoptosis.

  FIG. 43 provides a Western blot of proteins extracted from RKO cells treated with 0.25 μg / ml actinomycin D for 0, 3, 7, 24, and 48 hours. Total protein 5 μg (anti-eIF5A1) or 10 μg (anti-p53) was separated on a 12% SDS-polyacrylamide gel and transferred to a polyvinylidene difluoride membrane. The upper panel shows a Western blot using anti-p53 as the primary antibody. The middle panel shows a Western blot using anti-eIF5A1 as the primary antibody. The lower panel shows a membrane using an anti-eIF5A1 blot stained with Coomassie blue after chemiluminescence detection to demonstrate equal loading. Both p53 and eIF5A1 were upregulated by actinomycin D treatment.

FIG. 1 shows the nucleotide sequence of the 3 ′ end of rat apoptosis-specific eIF-5A and the amino acid sequence derived therefrom. FIG. 2 shows the nucleotide sequence of the 5 ′ end of rat apoptosis-specific eIF-5A cDNA and the amino acid sequence derived therefrom. FIG. 3 shows the nucleotide sequence of rat luteal apoptosis-specific eIF-5A full-length cDNA. FIG. 4 shows the nucleotide sequence of the 3 ′ end of rat apoptosis-specific DHS cDNA and the amino acid sequence derived therefrom. FIG. 5 shows an alignment of the full-length nucleotide sequence of rat luteal apoptosis-specific eIF-5A cDNA with the human eIF-5A nucleotide sequence (deposit number BC000751 or NM_001970, SEQ ID NO: 3). FIG. 6 shows an alignment of the full-length nucleotide sequence of rat luteal apoptosis-specific eIF-5A cDNA with the human eIF-5A nucleotide sequence (deposit number NM-020390, SEQ ID NO: 4). FIG. 7 shows the alignment of the full-length nucleotide sequence of rat luteal apoptosis-specific eIF-5A cDNA with the mouse eIF-5A nucleotide sequence (deposit number BC003889). The mouse nucleotide sequence (deposit number BC003889) is SEQ ID NO: 5. FIG. 8 shows the full-length amino acid sequence from rat luteal apoptosis-specific eIF-5A, the amino acid sequence from human eIF-5A (deposit number BCO000751 or NM 001970). FIG. 9 shows the full-length amino acid sequence from rat luteal apoptosis-specific eIF-5A, the amino acid sequence from human eIF-5A (deposit number NM 020390). FIG. 10 is an alignment of the full-length amino acid sequence derived from rat corpus luteum apoptosis-specific eIF-5A with the amino acid sequence derived from mouse eIF-5A (deposit number BC003889). FIG. 11 is an alignment of the partial nucleotide sequence of rat luteal apoptosis-specific DHS cDNA with the human DHS nucleotide sequence (Accession No. BC000333, SEQ ID NO: 8). FIG. 12 is a restriction map of rat luteal apoptosis-specific eIF-5A cDNA. FIG. 13 is a restriction map of partial length rat apoptosis-specific DHS cDNA. FIG. 14 shows Northern blot of total RNA probed with ³² P-dCTP-labeled 3′-end of rat luteal apoptosis-specific eIF-5A cDNA (FIG. 14A) and ethidium bromide stained gel (FIG. 14B). ). Figure 15 shows a Northern blot of total RNA probed with ³² P-dCTP-labeled 3'-end of rat corpus luteum apoptosis-specific DHS cDNA (Figure 15A) and ethidium bromide stained gel (Figure 15B). is there. FIG. 16 shows a DNA ladder experiment in which the extent of apoptosis in superovulated rat corpus luteum was tested after injection of PGF-2α. FIG. 17 is an agarose gel of genomic DNA isolated from apoptotic rat corpus luteum showing the DNA ladder after treatment of rat PGF-2α. FIG. 18 shows a DNA ladder experiment in which the degree of apoptosis in dispersed cells of superovulated rat corpus luteum was tested in rats treated with spermidine before being exposed to prostaglandin F-2α (PGF-2α). Show. FIG. 19 shows a DNA ladder experiment in which the degree of apoptosis in superovulated rat corpus luteum was tested in rats treated with spermidine and / or PGF-2α. FIG. 20 is a Southern blot of rat genomic DNA probed with ³² P-dCTP-labeled partial length rat luteal apoptosis-specific eIF-5A cDNA. FIG. 21 shows the mammalian epitope tag expression vector pHM6 (Roche Molecular Biochemicals). Figure 22 shows the total isolated from COS-7 cells after induction of apoptosis by removal of serum probed with ³² P-dCTP-labeled 3'-untranslated region of rat corpus luteum apoptosis-specific DHS cDNA. Shown are Northern blots of RNA (FIG. 22A) and ethidium bromide stained gel (FIG. 22B). FIG. 23 is a flow chart illustrating the procedure for transient transfection of COS-7 cells. FIG. 24 is a Western blot of transient expression of the protein in COS-7 cells after transfection with pHM6. Figure 25 illustrates enhanced apoptosis reflected by increased caspase activity when COS-7 cells are transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation doing. FIG. 26 shows enhanced enhancement reflected by increased DNA fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense direction. Illustrates apoptosis. Figure 27 shows the detection of apoptosis reflected by increased nuclear fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense direction. Illustrated. FIG. 28 shows enhanced apoptosis reflected by increased nuclear fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense direction Is illustrated. Figure 29 illustrates the detection of apoptosis reflected by phosphatidylserine exposure when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense direction. ing. FIG. 30 shows enhanced apoptosis reflected by increased phosphatidylserine exposure when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense direction Is illustrated. FIG. 31 shows enhanced apoptosis reflected by increased nuclear fragmentation when COS-7 cells were transiently transfected with p11MG containing full-length rat apoptosis-specific eIF-5A in the sense direction Is illustrated. FIG. 32 illustrates enhanced apoptosis when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense direction. FIG. 33 illustrates the down-regulation of Bcl-2 when COS-7 cells are transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense direction. FIG. 31A is a Coomassie blue-stained protein blot; FIG. 31B is the corresponding Western blot. Figure 34 shows Coomassie blue-stained protein of COS-7 cells transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the antisense direction using Bcl-2 as a probe Blot and corresponding western blot. Figure 35 shows Coomassie blue-stained protein of COS-7 cells transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense direction using c-Myc as a probe Blot and corresponding western blot. Figure 36 shows Coomassie blue-stained protein of COS-7 cells transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense direction when p53 is used as a probe. Blot and corresponding western blot. FIG. 37 shows a Coomassie blue-stained protein blot and corresponding Western blot of pHM6-full length rat apoptosis-specific eIF-5A expression in COS-7 cells using an anti- [HA] -peroxidase probe, and Coomassie blue-stained protein blot and corresponding Western blot of expression of pHM6-full length rat apoptosis-specific eIF-5A in COS-7 cells when p53 probe is used. FIG. 38 shows the sequence of human eIF5A2 isolated from RKO cells (Genbank accession number XM 113401). FIG. 39 is a graph showing the percentage of apoptosis occurring in RKO and RKO-E6 cells after transient transfection. RKO and RKO-E6 cells were transiently transfected with pHM6-LacZ or pHM6-eIF5A1. RKO cells showed a 240% increase in apoptosis compared to cells treated with pHM6-LacZ that were treated with actinomycin D and transfected with pRM6-eIF5A1 and not treated with actinomycin D. RKO-E6 cells were treated with actinomycin D and transfected with pHM6-eIF5A1, which showed a 105% increase in apoptosis compared to cells transfected with pHM6-LacZ not treated with actinomycin D. Indicated. FIG. 40 is a graph showing the proportion of apoptosis occurring in RKO cells after transient transfection. RKO cells were transiently transfected with pHM6-LacZ, pHM6-eIF5A1, pHM6-eIF5A2, or pHM6-cleaved eIF5A1. Cells transfected with pHM6-eIF5A1 showed a 25% increase in apoptosis compared to control cells transfected with pHM6LacZ. This increase was not evident in cells transfected with pHM6-eIF5A2 or pHM6-cleaved eIF5A1. FIG. 41 is a graph showing the percentage of apoptosis occurring in RKO cells after transient transfection. RKO cells were either untransfected or transiently transfected with pHM6-LacZ or pHM6-eIF5A1. After correcting for transfection efficiency, 60% of cells transfected with pHM6-eIF5A1 were apoptotic. FIG. 42 provides the results of flow cytometric analysis of RKO cell apoptosis after transient transfection. RKO cells were either not transfected or transiently transfected with pHM6-LacZ, pHM6-eIF5A1, pHM6-eIF5A2, or pHM6-cleaved eIF5A1. The table shows the percentage of cells undergoing apoptosis calculated based on the area under each gate peak. 80% of cells transfected with pHM6-eIF5A1 showed apoptosis after correction of transfection efficiency with apoptosis in untransfected cells as background. Cells transfected with pHM6-LacZ, pHM6-eIF5A2 or pHM6-cleaved eIF5A1 showed only background levels. FIG. 43 provides a Western blot of proteins extracted from RKO cells treated with 0.25 μg / ml actinomycin D for 0, 3, 7, 24, and 48 hours. The upper panel shows a Western blot using anti-p53 as the primary antibody. The middle panel shows a Western blot using anti-eIF5A1 as the primary antibody. The lower panel shows a membrane using an anti-eIF5A1 blot stained with Coomassie blue after chemiluminescence detection to reveal equal loading. Both p53 and eIF5A1 were upregulated by actinomycin D treatment.

Claims (63)

  An isolated nucleic acid comprising a nucleotide sequence encoding a rat apoptosis-specific eIF-5A polypeptide.   2. The isolated nucleic acid of claim 1, wherein the nucleotide sequence comprises SEQ ID NO: 1.   2. The isolated nucleic acid of claim 1, wherein the nucleotide sequence hybridizes to the complement of SEQ ID NO: 1 under high stringency conditions.   2. The isolated nucleic acid of claim 1, wherein the nucleotide sequence encodes SEQ ID NO: 2.   A purified polypeptide comprising the amino acid sequence of a rat apoptosis-specific eIF-5A polypeptide.   6. The purified polypeptide of claim 5, wherein the amino acid sequence comprises SEQ ID NO: 2.   An isolated nucleic acid comprising a nucleotide sequence encoding a rat apoptosis-specific DHS polypeptide.   8. The isolated nucleic acid of claim 7, wherein the nucleotide sequence comprises SEQ ID NO: 6.   8. The isolated nucleic acid of claim 7, wherein the nucleotide sequence hybridizes to the complement of SEQ ID NO: 6 under high stringency conditions.   8. The isolated nucleic acid of claim 7, wherein the nucleotide sequence encodes SEQ ID NO: 7.   A purified polypeptide comprising the amino acid sequence of a rat apoptosis-specific DHS polypeptide.   12. The purified polypeptide of claim 11, wherein the amino acid sequence comprises SEQ ID NO: 7.   A method of modulating apoptosis in a cell comprising administering to the cell a substance that modulates apoptosis-specific eIF-5A function.   14. The method of claim 13, wherein the substance inhibits apoptosis-specific eIF-5A function, thereby inhibiting apoptosis.   15. The method of claim 14, wherein the substance is an antisense oligonucleotide.   16. The method of claim 15, wherein the antisense oligonucleotide comprises a nucleotide sequence encoding a portion of an apoptosis-specific eIF-5A polypeptide.   17. The method of claim 16, wherein the antisense oligonucleotide comprises SEQ ID NO: 19, 20, or 21.   16. The method of claim 15, wherein the antisense oligonucleotide comprises a nucleotide sequence encoding a portion of an apoptosis-specific DHS polypeptide.   16. The method of claim 15, wherein the substance is a chemical substance or drug that inhibits apoptosis-specific eIF-5A function.   14. The method of claim 13, wherein the substance inhibits apoptosis-specific DHS function, thereby inhibiting apoptosis.   21. The method of claim 20, wherein the substance is an antisense oligonucleotide.   24. The method of claim 21, wherein the antisense oligonucleotide comprises a nucleotide sequence encoding a portion of an apoptosis-specific eIF-5A polypeptide.   23. The method of claim 22, wherein the nucleotide sequence comprises SEQ ID NO: 19, 20, or 21.   24. The method of claim 21, wherein the antisense oligonucleotide comprises a nucleotide sequence encoding a portion of an apoptosis-specific DHS polypeptide.   21. The method of claim 20, wherein the substance is a chemical or drug that inhibits apoptosis-specific DHS function.   14. The method of claim 13, wherein the substance enhances apoptosis-specific eIF-5A function, thereby inducing apoptosis in the cell.   27. The method of claim 26, wherein the substance comprises an expression vector.   28. The method of claim 27, wherein the expression vector comprises a promoter sequence operably linked to a nucleotide sequence encoding an apoptosis-specific eIF-5A polypeptide.   28. The method of claim 27, wherein the expression vector comprises a promoter sequence operably linked to a nucleotide sequence encoding an apoptosis-specific DHS polypeptide.   14. The method of claim 13, wherein the agent enhances apoptosis-specific DHS function, thereby inducing apoptosis in the cell.   32. The method of claim 30, wherein the substance comprises an expression vector.   32. The method of claim 31, wherein the expression vector comprises a promoter sequence operably linked to a nucleotide sequence encoding an apoptosis-specific eIF-5A polypeptide.   32. The method of claim 31, wherein the expression vector comprises a promoter sequence operably linked to a nucleotide sequence encoding an apoptosis-specific DHS polypeptide.   14. The method of claim 13, wherein the cell is contained within an animal.   35. The method of claim 34, wherein the substance is administered to the animal.   A method of modulating apoptosis in a cell comprising administering to the cell a substance that modulates apoptosis-specific DHS function.   38. The method of claim 36, wherein the substance inhibits apoptosis-specific DHS function, thereby inhibiting apoptosis.   38. The method of claim 37, wherein the substance is an antisense oligonucleotide.   40. The method of claim 38, wherein the antisense oligonucleotide comprises a nucleotide sequence encoding a portion of an apoptosis-specific eIF-5A polypeptide.   40. The method of claim 39, wherein the antisense oligonucleotide comprises SEQ ID NO: 19, 20, or 21.   40. The method of claim 38, wherein the antisense oligonucleotide comprises a nucleotide sequence encoding a portion of an apoptosis-specific DHS polypeptide.   38. The method of claim 37, wherein the substance is a chemical or drug that inhibits apoptosis-specific eIF-5A function.   38. The method of claim 36, wherein the substance inhibits apoptosis-specific DHS function, thereby inhibiting apoptosis.   45. The method of claim 44, wherein the substance is an antisense oligonucleotide.   46. The method of claim 45, wherein the antisense oligonucleotide comprises a nucleotide sequence encoding a portion of an apoptosis-specific eIF-5A polypeptide.   46. The method of claim 45, wherein the antisense oligonucleotide comprises a nucleotide sequence encoding a portion of an apoptosis-specific DHS polypeptide.   45. The method of claim 44, wherein the agent is a chemical or drug that inhibits apoptosis-specific DHS function.   38. The method of claim 36, wherein the agent enhances apoptosis-specific eIF-5A function, thereby inducing apoptosis in the cell.   49. The method of claim 48, wherein the substance comprises an expression vector.   50. The method of claim 49, wherein the expression vector comprises a promoter sequence operably linked to a nucleotide sequence encoding an apoptosis-specific eIF-5A polypeptide.   50. The method of claim 49, wherein the expression vector comprises a promoter sequence operably linked to a nucleotide sequence encoding an apoptosis-specific DHS polypeptide.   38. The method of claim 36, wherein the agent enhances apoptosis-specific DHS function, thereby inducing apoptosis in the cell.   54. The method of claim 52, wherein the substance comprises an expression vector.   54. The method of claim 53, wherein the expression vector comprises a promoter sequence operably linked to a nucleotide sequence encoding an apoptosis-specific eIF-5A polypeptide.   54. The method of claim 53, wherein the expression vector comprises a promoter sequence operably linked to a nucleotide sequence encoding an apoptosis-specific DHS polypeptide.   40. The method of claim 36, wherein the cell is contained within an animal.   57. The method of claim 56, wherein the substance is administered to the animal.   An antisense oligonucleotide comprising a nucleotide sequence encoding a portion of an apoptosis-specific eIF-5A polypeptide.   59. The antisense oligonucleotide of claim 58, wherein the nucleotide sequence comprises SEQ ID NO: 19, 20, or 21.   An antisense oligonucleotide comprising a nucleotide sequence encoding a portion of an apoptosis-specific DHS polypeptide.   An expression vector comprising a promoter operably linked to a nucleotide sequence encoding an apoptosis-specific eIF-5A polypeptide.   An expression vector comprising a promoter operably linked to a nucleotide sequence encoding an apoptosis-specific DHS polypeptide. A method to identify the regulation of apoptosis:
(i) providing a test cell;
(ii) contacting the test cell with a drug candidate; and
(iii) determining whether the ratio of eIF-5A proliferating in the test cell in the presence of the drug candidate to apoptosis-specific eIF-5A is altered,
The method wherein the ratio of proliferating eIF-5A to apoptosis-specific eIF-5A is an indicator of apoptosis regulation.

Images