CN1741820A - Nucleic acids, polypeptides, and methods for modulating apoptosis - Google Patents

Abstract

The present invention relates to isolated and/or purified rat apoptosis-specific eucaryotic initiation Factor-5A (eIF-5A) and deoxidant 8-hydroxyl-2,7,10-deoxyhypusine synthase (DHS) nucleic acids and polypeptides. The present invention also relates to methods of modulating apoptosis using apoptosis-specific eIF-5A and DHS, and antisense oligonucleotides and expression vectors of apoptosis-specific eIF-5A and DHS useful in such methods.

Description

Regulate the nucleic acid of apoptosis, polypeptide, and method

Invention field

The present invention relates to apoptosis-specific eukaryotic initiation factor-5A (eIF-5A) and deoxidation 8-hydroxyl-2,7,10-triamido capric acid synzyme (DHS) nucleic acid and polypeptide, and the method for utilizing apoptosis-specific eIF-5A and DHS to regulate the apoptosis of cell.

Background of invention

Apoptosis is the cell incident that the hereditism programmes, and it is characterised in that clear and definite morphology characteristics, and as cell shrinkage, chromatin concentrates, the nucleus fracture, and cell membrane bubbles.Kerr etc. (1972) Br.J.Cancer, 26,239-257; Wyllie etc. (1980) Int.Rev.Cytol., 68,251-306.It is playing a significant role in normal tissue development and homeostasis, and the defective of apoptosis program is considered to have caused the multiple human diseases from neural degeneration and autoimmune disease to tumor.Thompson (1995) Science, 267,1456-1462; Mullauer etc. (2001) Mutat.Res, 488,211-231.Although fully characterized the morphological feature of apoptotic cell already, the molecular pathways of regulating this process has just just begun to illustrate.

A histone that is considered to performance pivotal role in apoptosis is a cysteine proteinase family, and it is called as caspases, and its seemingly most of apoptosis pathway is necessary.Creagh ﹠amp; Martin (2001) Biochem.Soc.Trans, 29,696-701; Dales etc. (2001) Leuk.Lyniphoina, 41,247-253.Caspases reacts on apoptotic stimulus, starts apoptosis by the various cell proteins of cracking, and described cracking has caused the typical performance of apoptosis, comprises cell shrinkage, and cell membrane bubbles and dna break.Chang?&?Yang(2000)Microbiol.Mol.Biol.Rev.，64，821-846。

Pro apoptotic protein, as Bax or Bak also as described in apoptosis pathway performance pivotal role, it is by discharging the caspase-activating molecules, as mitochondrial cytochrome c, so that promote what the death of cell played a role by apoptosis.Martinou ﹠amp; Green (2001) Nat.Rev.Mol.Cell.Biol., 2,63-67; Zou etc. (1997) Cell, 90,405-413.Such as the anti-apoptotic proteins of Bcl-2, can promote the survival of cell by the activity of antagonism pro apoptotic protein Bax and Bak.Tsujimoto(1998)Genes?Cells，3，697-707；Kroemer(1997)Nature?Med.，3，614-620。The ratio of Bax: Bcl-2 is considered to determine an approach of cell fate; Excessive Bax can promote apoptosis, and excessive Bcl-2 can promote cell survival.Salomons etc. (1997) Iras.J.Cancer, 71,959-965; Wallace-Brodeur ﹠amp; Lowe (1999) Cell Mol.Life Sci., 55,64-75.

The another kind of crucial albumen relevant with apoptosis is by tumor suppressor gene p53 encoded protein.This albumen is the transcription factor that can regulate the cell growth, and induces to sustain damage and go up the apoptosis of unsettled cell with the hereditism, is commonly considered as being undertaken by rise Bax.Bold etc. (1997) Surgical Oracology, 6,133-142; Ronen etc., 1996; Schuler﹠amp; Green (2001) Biochem.Soc.Tra71s., 29,684-688; Ryan etc. (2001) Curr.Opin.Cell Biol., 13,332-337; (2001) Biochem.Biophys.Acta such as Z rnig, 1551, F1-F37.

The particular shape feature of apoptotic cells characterize to take place, and has produced the multiple method that is used to assess the generation and the development of apoptosis already.Can be used for the activation that such feature is flippa se of apoptotic cell of their detection, it has caused Phosphatidylserine---be positioned externalization of the phospholipid of plasma membrane endite usually.Fadok etc. (1992) J.Immzznol., 149,4029-4035.Apoptotic cells with Phosphatidylserine of externalization can be by with the link coupled Phosphatidylserine of fluorescent dye-conjugated protein---annexin V dyeing detects.Can by with 3 of the exposure of the Deoxydization nucleotide labeled dna fragment of fluorescein-labelling '-the OH end, detect the characteristic dna break that in apoptotic process, takes place.Can with such as Hoescht33258 can bind nucleic acid fluorescent dye, the chromatin that is used for detecting apoptotic cell concentrates and the nucleus fracture.Can also understand the degree of the apoptosis of cell mass by being present in the active degree of caspase protein cleavage in the cell extract.

Go up the method for determining as the hereditism, as any other development program, apoptosis can interrupt by sudden change.The change of apoptosis pathway is considered to bring into play pivotal role in comprising the multiple lysis of cancer.Wyllie etc. (1980) Int.Rev.Cytol., 68,251-306; Thompson (1995) Science, 267,1456-1462; Sen ﹠amp; D ' Incalci (1992) FEBS Letters, 307,122-127; McDonnell etc. (1995) Seminars inCancer and Biology, 6,53-60.Research to cancer takes place and makes progress concentrates on the cell proliferation aspect traditionally always.But, the important function of apoptosis in tumor takes place was clear and definite already recently.In fact,, utilize tumor model to obtain mostly to the understanding of apoptosis, because the control of apoptosis always changes in some way in tumor cell.Bold etc. (1997) Surgical Oncology, 6,133-142.

Between the emergence period, apoptosis can pass through multiple signal enabling in tumor.The extracellular signal comprises growth or survival factors consumption, anoxia and ionizing radiation.The internal signal that can start apoptosis comprises DNA damage, the telomere of shortening, and Cancer-causing mutation.They can produce unsuitable proliferation signal.Lowe?&?Lin(2000)Carcinogenesis?21，485-495。Ionizing radiation and nearly all cytotoxicity chemotherapy agents that is used for the treatment of malignant tumor all are considered to by starting the effect that endogenous apoptosis mechanism plays inducing cell death.Rowan ﹠amp; Fisher (1997) Leukemia, 11,457-465; Kerr etc. (1994) Cancer, 73,2013-2026; Martin ﹠amp; Schwartz (1997) Oncology Research, 9,1-5.

Evidence suggests, early stage in cancer progression, tumor cell is to apoptosis-induced reagent (as ionizing radiation or chemotherapeutics) being responsive.But, along with the progress of tumor, described cell has produced the resistance to apoptotic stimulus.Naik etc. (1996) Genes andDevelopment, 10,2105-2116.This can be interpreted as what early-stage cancer to the treatment reaction than late period pathological changes reaction good.As if the resistance to chemotherapy and radiation that terminal cancer produces, relevant with the change of described apoptosis pathway, this change has limited the ability of tumor cell to the reaction of apoptotic stimulus.Reed etc. (1996) Journal of Cellular Biology, 60,23-32; Meyn etc. (1996) Cancer Metastasis Reviews, 15,119-131; Hannun (1997) Blood, 89,1845-1853; Reed (1995) Toxicology Letters, 82-83,155-158; Hickman (1996) European Journal of Cancer, 32A, 921-926.The resistance of chemotherapy is relevant with the overexpression of anti-apoptotic genes expression bc1-2 and the disappearance or the sudden change of short apoptosis bax gene in chronic lymphocytic leukemia and the colon cancer respectively.

As if tumor cell is successfully set up the ability of dissemination metastatic tumor, relevant with the change of described apoptosis pathway.Bold etc. (1997) Surgical Oncology, 6,133-142.For example, the sudden change of caused by tumor suppressor p 53 is considered to appear in 70% the tumor.Evan etc. (1995) Curr.Opin.Cell Biol., 7,825-834.Make the sudden change of p53 inactivation, limited cell effect in DNA damage and apoptosis-induced ability, make described cell that further sudden change take place easily.Ko?&?Prives(1996)Genes?and?Development，10，1054-1072。

Therefore, apoptosis and tumor transform and the generation of neoplasm metastasis and make progress closely relatedly, and to the better understanding of relevant apoptosis pathway, may cause being used for treating by gene therapy method adjusting apoptosis pathway the new potential target of cancer.Bold etc. (1997) SurgicalOncology, 6,133-142.

Known deoxidation 8-hydroxyl-2,7,10-triamido capric acid synzyme (DHS) and contain 8-hydroxyl-2,7,10-triamido capric acid eukaryotic translation initiation factor-5A (eIF-5A) plays a significant role in a lot of cell processes that comprise cell growth and differentiation.The aminoacid of Hypusine---a kind of uniqueness is present in all eukaryotic cells and archeobacteria of checking, but is not present in the eubacteria, and eIF-5A is the unique known 8-of containing hydroxyl-2,7, the albumen of 10-triamido capric acid.Park (1988) J.Biol.Chem., 263,7447-7449; Sch ü mann ﹠amp; Klink (1989) System.Appl.Microbiol., 11,103-107; Bartig etc. (1990) System.Appl.Microbiol., 13,112-116; Gordon etc. (1987a) J.Biol.Chem., 262,16585-16589.Active eIF-5A by two translations after step form: first step is, by deoxidation 8-hydroxyl-2,7, the catalysis of 10-triamido capric acid synzyme, the amino butyl of the 4-of spermidine is partly transferred on the alpha-amido of special lysine of precursor eIF-5A, form deoxidation 8-hydroxyl-2,7,10-triamido capric acid residue; Second step comprises the hydroxyl-2,7 by deoxidation 8-, and 10-triamido capric acid hydroxylase makes the amino butyl part of hydroxylization of this 4-, so that form 8-hydroxyl-2,7,10-triamido capric acid.

The aminoacid sequence of eIF-5A is quite conservative between different plant species, and there is strict conservative in the aminoacid sequence around the 8-hydroxyl-2,7 in eIF-5A, 10-triamido capric acid residue, this shows that this modification may be important for survival.Park etc. (1993) Biofactors, 4,95-104.This hypothesis has obtained the further support of relevant discovery, up to the present promptly, all is present in the inactivation of the two kinds of isoforms of the eIF-5A in the yeast, or the inactivation of DHS gene, first step of their inactivation of energy catalysis, blocking-up cell division.Schnier etc. (1991) Mol.Cell.Biol., 11,3105-3114; Sasaki etc. (1996) FEBS Lett., 384,151-154; Park etc. (1998) J.Biol.Chem., 273,1677-1683.But, consume the eIF-5A albumen in the yeast, only caused synthetic little the weakening of overall protein, this shows that eIF-5A may be that the translation of specific hypotype of mRNA is necessary, rather than albumen is totally synthetic necessary.Kang etc. (1993), " initiation factor eIF-5A consumes on cell proliferation and the synthetic influence of albumen ", Tuite, M. (ed.), Protein Synthesis and Targeting in Yeast, NATO Series H.About having the discovery of the motif of high conservative, also supported the viewpoint of the important function of eIF-5A recently in conjunction with the part of eIF-5A.Xu?&?Chen(2001)J.Biol.Chem.，276，2555-2561。In addition, find the 8-hydroxyl-2,7 of the eIF-5A of modified, 10-triamido capric acid residue be combine with the sequence-specific of RNA necessary, and in conjunction with the protective effect that can not provide to ribonuclease.

First kind of cDNA of eIF-5A 1989 by clone such as Smit-McBride, from this time, already from comprising yeast, rat, Embryo Gallus domesticus, Herba Medicaginis and Fructus Lycopersici esculenti have been cloned cDNA or the gene of eIF-5A in interior various eukaryotes.Smit-McBride etc. (1989a) J.Biol.Chez., 264,1578-1583; Schnier etc. (1991) (yeast); Sano, A. (1995) in Imahori, M. etc. (eds), Polyamine, Basic and ClinicalAspects, VNU Science Press, The Netherlands, 81-88 (rat); Rinaudo ﹠amp; Park (1992) FASEB J., 6, A453 (Embryo Gallus domesticus); Pay etc. (1991) Plant Mol.Biol., 17,927-929 (Herba Medicaginis); Wang etc. (2001) J.Biol.Chem., 276,17541-17549 (Fructus Lycopersici esculenti).

In addition, the cell internal consumption of eIF-5A has caused the obvious accumulation of specific mRNAs in nucleus, it show mRNAs that eIF-5A may be responsible for specific type from nucleus to the cytoplasmic transportation of shuttling back and forth.Liu?&?Tartakoff(1997)Supplement?to?MolecularBiology?of?the?Cell，8，426a.Abstract?No.2476，37th?AmericanSociety?for?Cell?Biology?Annual?Meeting。The accumulation of eIF-5A on the relevant nuclear internal thread of nucleopore, and it and the generally interaction of cell nuclear export receptor have hinted that further eIF-5A is the shuttle back and forth albumen rather than the composition of polysome of caryoplasm.Rosorius etc. (1999) J.Cell Science, 112,2369-2380.

In various human tissues and mammal cell line, studied the expression of eIF-5A mRNA already.For example, after serum is deprived, after adding serum, in the human fibroblast, observed the change that eIF-5A expresses already.Pang?&?Chen(1994)J.CellPhysio.，160，531-538。In addition, in the fibroblast of aging, observed deoxidation 8-hydroxyl-2,7 already, weaken relevant of the abundance of 10-triamido capric acid synthase activity and precursor eIF-5A with aging, but, determine that as yet this phenomenon has embodied the probability of the average effect that the difference of isoform changes.Chen?&?Chen(1997b)J.Cell?Physiol.，170，248-254。

Research showed already that eIF-5A may be the cell target such as 1 type human immunity virus Rev albumen and the proteic virus protein of 1 type human T-leukemia virus Rex.Ruhl etc. (1993) J.Cell Biol., 123,1309-1320; Katahira etc. (1995) J.Virol., 69,3125-3133.Preliminary study shows, eIF-5A may be by deciding RNA with other RNA-binding protein interactions targets such as Rev, and this has shown that these virus proteins may raise eIF-5A, carries out viral RNA processing.Liu etc. (1997) Biol.Signals, 6,166-174.

Known deoxidation 8-hydroxyl-2,7,10-triamido capric acid synzyme and eIF-5A play an important role in the cell processes of the key that comprises cell growth and aging.For example, deoxidation 8-hydroxyl-2,7, the antisense that 10-triamido capric acid synzyme is expressed in the plant weakens, and has caused the aging of blade and fruit to delay, and this shows the isoform that has old and feeble inductive eIF-5A in plant.Referring to WO 01/02592; PCT/US01/44505; U. S. application number 09/909,796.Coding deoxidation 8-hydroxyl-2,7 in yeast, the inactivation of the gene of 10-triamido capric acid synzyme or eIF-5A has caused fissional inhibition.Schnier etc. (1991) Mol.Cell.Biol., 11,3105-3114; Sasaki etc. (1996) FEBS Lett., 384,151-154; Park etc. (1998) J.Biol.Chem., 273,1677-1683.

Already the spermidine analog had been successfully used to vitro inhibition deoxidation 8-hydroxyl-2,7,10-triamido capric acid synzyme, and be used for suppressing in vivo 8-hydroxyl-2,7, and the formation of 10-triamido capric acid, it is accompanied by the inhibition that albumen is synthetic and cell is grown.Jakus etc. (1993) J.Biol.Chem., 268,13151-13159; Park etc. (1994) J.Biol.Chem., 269,27827-27832.As if polyamines itself, particularly putrescine and spermidine play a significant role in cell proliferation and differentiation equally.Tabor?&?Tabor(1984)Anne.Rev.Biochem.，53，749-790；Pegg(1988)Cancer?Res.，48，759-774。For example, the yeast mutants that polyamines biosynthesis pathway wherein had been blocked already can not be grown, unless the external source polyamines is provided.Cohn etc. (1980) J.Bacteriol., 134,208-213.

Confirmed already that polyamines can protect cell to avoid apoptosis induced.For example, handled the apoptosis of having blocked thymocyte cell by spermidine and spermine already, the mechanism of this effect seemingly suppresses the inscribe restriction endonuclease and activates.Desiderio etc. (1995) Cell Growth Differ., 6,505-513; Brune etc. (1991) Exp.Cell Res., 195,323-329.In addition, confirmed already that the external source polyamines can check the B-cell receptor mediated Apoptosis, and in unicellular parasite---the apoptosis in the schizotrypanum cruzi.Nitta etc. (2001) Exptl.Cell Res., 265,174-183; Piacenza etc. (2001) Proc.Natl.Acad.Sci., USA, 98,7301-7306.Have found that the spermine of low concentration and spermidine can reduce the quantity that neurocyte reduces during the normal development of neonate rat, and the protection brain is avoided neurogenous damage during cerebral ischaemia.Gilad etc. (1985) Brain Res., 348,363-366; Gilad ﹠amp; Gilad (1991) Exp.Neurol., 111,349-355.It is old and feeble that polyamines can also suppress, and it is a kind of form of cell death of the programming of plant tissue.Confirmed the aging of Folium Raphani after results that spermidine and putrescine can delay Dianthus carryophyllus and come off already.Wang ﹠amp; Baker (1980) Hort Science, 15,805-806 (Dianthus carryophyllus); Altman (1982) Physio.Plant., 54,189-193 (Folium Raphani that comes off).

But, in other researchs, observed already and reacted on the apoptosis induced that the external source polyamines occurs.For example, the human breast cancer cell line reacts to polyamine analogs by apoptosis-induced, and has confirmed already that excessive putrescine can induce the apoptosis of DH23A cell.McCloskey etc. (1995) Cancer Res., 55,3233-3236; Tome etc. (1997) Biochem.J., 328,847-854.

The above result of experiment that the polyamines of using by oneself carries out shows that generally existing in the apoptosis induction of the special isoform of eIF-5A plays a role.Specifically, above data with have the identical of views of apoptosis-specific isoform by the activated eIF-5A of DHS.This DHS reaction needed spermidine this true and the activated discovery unanimity that confirmed the proteoclastic crucial executor caspase that polyamines is can be apoptosis-induced relevant already.Stefanelli etc. (2000) Biochem.J., 347,875-880; Stefanelli etc. (1999) FEBS Lett., 451,95-98.In similar vein, the synthetic reagent that presses down of polyamines can delay apoptosis.Das etc. (1997) Oncol.Res., 9,565-572; Monti etc. (1998) Life Sci., 72,799-806; Ray etc. (2000) Am.J.Physiol., 278, C480-C489; Packham ﹠amp; Cleveland (1994) Mol.Cell Biol., 14,5741-5747.

About the external source polyamines can suppress and promote the discovery of apoptosis, can be by following facts explain: according to employed level, they can suppress to cause eIF-5A to activate, and therefore hinder the DHS reaction of apoptosis, or apoptosis-induced by toxic action.The external source polyamines of relevant low concentration can be blocked the discovery of the apoptosis of plant and animal system, and the competition that plays a part the DHS reaction with the polyamines of low concentration and their analog presses down this true coincideing of reagent.Or even the external source spermidine in fact,---it is the substrate of DHS reaction---also can hinder described reaction by substrate.Jakus etc. (1993) J.Biol.Chem., 268,13153-13159.

But, all polyamines and their analog all are deleterious under high concentration, and can be apoptosis-induced.This is because two kinds of former thereby occur results, although they can suppress the activation of apoptosis-specific isoform of the supposition of eIF-5A.At first, activated eIF-5A has the long half-life.Torrelio etc. (1987) Biochem.Biophys.Res.Commun., 145,1335-1341; Dou ﹠amp; Chen (1990) Biochim.Biophys.Acta., 1036,128-137.Therefore, by suppressing deoxidation 8-hydroxyl-2,7,10-triamido capric acid synthase activity and the disappearance of the activated apoptosis-specific eIF-5A that causes may not can in time occurs with the apoptosis that toxic action caused of blocking-up by spermidine.Secondly, polyamines is a deoxidation 8-hydroxyl-2,7, and the competitiveness of 10-triamido capric acid reaction presses down reagent, even therefore under deleterious concentration, also unlikely blocks described reaction fully.

The present invention relates to clone at the eIF-5A cDNA that is about to raise before apoptosis-induced.As if this apoptosis-specific eIF-5A may be the suitable target that gets involved the morbid state that causes apoptosis, because it works transcribing on the back adjusting level of downstream effect thing relevant with apoptosis pathway and transcription factor.Specifically, apoptosis-specific eIF-5A, as if the mRNAs of the downstream effect thing that can optionally promote to encode and the transcription factor of apoptosis from nucleus transporte to cells matter, and they are translated in Cytoplasm subsequently.Start the final decision of apoptosis, as if come from the complex interactions between inside and outside short apoptosis and the anti-apoptotic signal.Lowe?&?Lin(2000)Carcinogenesis，21，485-495。By its promotion downstream apoptosis effect thing and the ability of the translation of transcription factor, as if the eIF-5A that described apoptosis is relevant can adjust the balance between the above signal, so that help apoptosis.

Disclosed as the front, clear and definite already is that anti-tumor agent comprising salmosin can be apoptosis-induced, and the change of apoptosis pathway, can weaken drug-induced cell death.Schmitt?&?Lowe(1999)J?Pathol.，187，127-137。For example, a lot of cancer therapy drugs can raise p53, and the tumor cell of having lost p53 already can produce the drug resistance to these medicines.But, nearly all chemotherapeutics can both not rely on p53 and apoptosis-induced, if the dosage that uses is enough, even show resistant tumors, the approach that leads to apoptosis is not blocked fully yet.Wallace-Brodeur?&?Lowe(1999)Cell?Mol.Life?Sci.，55，64-75。This shows, although apoptosis eIF-5A induce---gene that it may not can correct sudden change---may also can avoid the p53 dependent pathway, and by promoting other approach apoptosis-induced.

The inducing of the eIF-5A relevant with apoptosis has the potentiality that target is optionally decided cancerous cell, the rare or not effect to normal adjacent cell simultaneously.This is the expression owing to the mitogenesis oncogene of expressing in tumor cell, and the apoptotic signal of the mRNA form that is not present in the specific type in the normal cell is provided.Lowe etc. (1993) Cell, 74,954-967; Lowe ﹠amp; Lin (2000) Carcinogenesis, 21,485-495.For example, the recovery of wild type p53 in p53-saltant tumor cell may be directly apoptosis-induced, and drug susceptibility (Spitz etc., 1996 of improving tumor cell line and xenograft; Badie etc., 1998).

The selectivity of apoptosis-eIF-5A comes from the following fact: promptly it can be by mediation from nucleus to cytoplasmic transhipment, optionally promote the translation of the mRNAs of coding downstream apoptosis effect thing and transcription factor.Therefore, can play a role, must transcribe the mRNAs of described effector of coding and transcription factor in order to make apoptosis eIF-5A.Because mRNAs can transcribe in cancerous cell, and can not transcribe in adjacent normal cell, can estimate that apoptosis eIF-5A can promote the apoptosis in the cancerous cell, but to the rare (if there is) influence of normal cell.Therefore, recover the apoptosis potentiality of tumor cell, may decide tumor cell by target optionally and alleviate toxicity and the side effect that the cancer patient stands with the relevant eIF-5A of apoptosis.Apoptosis-induced eIF-5A also has and strengthens the potentiality of tumor cell to the reaction of cancer therapy drug, and therefore improves the effect of these reagent to resistant tumors.The latter can cause cancer therapy drug than low dosage to patient's effectiveness and lower toxicity again.

Summary of the invention

The invention provides rat apoptosis-specific eIF-5A and the DHS nucleic acid and the polypeptide of isolating and/or purification, and the antisense oligonucleotide of apoptosis-specific eIF-5A and DHS and expression vector.The present invention also provides the people eIf-5A2 (proliferative eIF-5A is otherwise known as) of isolating and/or purification here.The present invention also provides the method for utilizing apoptosis-specific eIF-5A and DHS to regulate apoptosis.

The accompanying drawing summary

Fig. 1 represents the nucleotide sequence of 3 of rat apoptosis-specific eIF-5A ' end and the aminoacid sequence of derivation.

Fig. 2 represents the nucleotide sequence of 5 of rat apoptosis-specific eIF-5A ' end and the aminoacid sequence of derivation.

Fig. 3 represents the nucleotide sequence of rat corpus luteum apoptosis-specific eIF-5A total length eDNA.

Fig. 4 represents the nucleotide sequence of 3 of rat apoptosis-specific DHS eDNA ' end and the aminoacid sequence of derivation.

Fig. 5 is the comparison of the full length nucleotide sequence of rat corpus luteum apoptosis-specific eIF-5A cDNA and the nucleotide sequence of people eIF-5A (number of obtaining BC000751 or NM_001970, SEQ ID NO:3).

Fig. 6 is the comparison of the full length nucleotide sequence of rat corpus luteum apoptosis-specific eIF-5A eDNA and the nucleotide sequence of people eIF-5A (number of obtaining NM-020390, SEQ ID NO:4).

Fig. 7 is the comparison of the nucleotide sequence (number of obtaining BC003889) of the full length nucleotide sequence of rat corpus luteum apoptosis-specific eIF-5A cDNA and mice eIF-5A.Mice nucleotide sequence (number of obtaining BC003889) is SEQ ID NO:5.

Fig. 8 is the comparison of aminoacid sequence (number of obtaining BC000751 or NM_001970) of the derivation of the full length amino acid sequence of derivation of rat corpus luteum apoptosis-specific eIF-5A and people eIF-5A.

Fig. 9 is the comparison of aminoacid sequence (number of obtaining NM_020390) of the derivation of the full length amino acid sequence of derivation of rat corpus luteum apoptosis-specific eIF-5A and people eIF-5A.

Figure 10 is the comparison of aminoacid sequence (number of obtaining BC003889) of the derivation of the full length amino acid sequence of derivation of rat corpus luteum apoptosis-specific eIF-5A and mice eIF-5A.

Figure 11 is the comparison of the nucleotide sequence (number of obtaining BC000333, SEQ ID NO:8) of the nucleotide sequence of partial-length of rat corpus luteum apoptosis-specific DHS cDNA and people DHS.

Figure 12 is the restriction figure of rat corpus luteum apoptosis-specific eIF-5A cDNA.

Figure 13 is the restriction figure of the rat corpus luteum apoptosis-specific DHS cDNA of partial-length.

Figure 14 uses ³²The Northern trace (Figure 14 A) of total RNA that 3 of the rat corpus luteum apoptosis-specific eIF-5A cDNA of P-dCTP-labelling '-end is surveyed and the gel (Figure 14 B) of ethidium bromide staining.

Figure 15 uses ³²The Northern trace (Figure 15 A) of total RNA that 3 of the rat corpus luteum apoptosis-specific DHS cDNA of P-dCTP-labelling '-end is surveyed and the gel (Figure 15 B) of ethidium bromide staining.

Figure 16 represents DNA sequence ladder experiment, wherein, after injection PGF-2 α, has checked the degree of apoptosis in the rat corpus luteum of superovulation.

Figure 17 is the isolating agarose gel of isolating genomic DNA from the rat corpus luteum of apoptosis, and expression is handled rat DNA sequence ladder afterwards with PGF-2 α.

Figure 18 represents DNA sequence ladder experiment, wherein, has checked the degree of the apoptosis in the cell dispersion of rat corpus luteum of superovulation in being exposed to the rat that prostaglandin F-2 α (PGF-2 α) handled with spermidine before.

Figure 19 represents DNA sequence ladder experiment, wherein, has checked the degree of apoptosis in the rat corpus luteum of superovulation in the rat of handling with spermidine and/or PGF-2 α.

Figure 20 uses ³²The Southern trace of the rat genomic dna that the partial-length rat corpus luteum apoptosis-specific eIF-5AcDNA of P-dCTP-labelling surveys.

Figure 21 represents pHM6, and it is a mammal epi-position marker expression carrier (RocheMolecular Biochemicals).

Figure 22 is ³²3 ' untranslated region of the rat corpus luteum apoptosis-specific DHS cDNA of P-dCTP-labelling is surveyed passes through that serum is deprived and after apoptosis-induced, the gel (Figure 22 B) of the Northern trace of isolating total RNA (Figure 22 A) and ethidium bromide staining from the COS-7 cell.

Figure 23 is the flow chart of the transient transfection method of expression COS-7 cell.

Figure 24 is after with the pHM6 transfection, the Western trace of the transient expression of the foreign protein in the COS-7 cell.

When Figure 25 was illustrated in the pHM6 transient transfection COS-7 cell of the total length rat apoptosis-specific eIF-5A that contains sense orientation, the apoptosis that is embodied by the caspase increased activity strengthened.

When Figure 26 is illustrated in the pHM6 transient transfection COS-7 cell of the total length rat apoptosis-specific eIF-5A that contains sense orientation, strengthens the apoptosis that is embodied by dna break and strengthen.

When Figure 27 is illustrated in the pHM6 transient transfection COS-7 cell of the total length rat apoptosis-specific eIF-5A that contains sense orientation, strengthens the apoptosis that is embodied by the nucleus fracture and strengthen.

When Figure 28 is illustrated in the pHM6 transient transfection COS-7 cell of the total length rat apoptosis-specific eIF-5A that contains sense orientation, strengthens the apoptosis that is embodied by the nucleus fracture and strengthen.

When Figure 29 is illustrated in the pHM6 transient transfection COS-7 cell of the total length rat apoptosis-specific eIF-5A that contains sense orientation, exposes the apoptosis that is embodied by Phosphatidylserine and strengthen.

Figure 30 is illustrated in when containing the pHM6 transient transfection COS-7 cell of total length rat apoptosis-specific eIF-5A of sense orientation, expose the enhancing that embodies by the Phosphatidylserine that has strengthened apoptosis.

When Figure 31 is illustrated in the pHM6 transient transfection COS-7 cell of the total length rat apoptosis-specific eIF-5A that contains sense orientation, strengthens the apoptosis that is embodied by the nucleus fracture and strengthen.

Apoptosis strengthened when Figure 32 was illustrated in the pHM6 transient transfection COS-7 cell of the total length rat apoptosis-specific eIF-5A that contains sense orientation.

The downward modulation of Bcl-2 when Figure 33 is illustrated in the pHM6 transient transfection COS-7 cell of the total length rat apoptosis-specific eIF-5A that contains sense orientation.Figure 31 A is the painted Western blot of Coomassie brilliant blue; Figure 31 B is corresponding Western trace.

Figure 34 makes probe in detecting with Bcl-2, and usefulness contains along the painted Western blot of Coomassie brilliant blue of the COS-7 cell of the pHM6 transient transfection of the total length rat apoptosis-specific eIF-5A of sense orientation and corresponding Western trace.

Figure 35 makes probe in detecting with c-Myc, and usefulness contains along the painted Western blot of Coomassie brilliant blue of the COS-7 cell of the pHM6 transient transfection of the total length rat apoptosis-specific eIF-5A of sense orientation and corresponding Western trace.

Figure 36 makes probe in detecting with p53, and usefulness contains along the painted Western blot of Coomassie brilliant blue of the COS-7 cell of the pHM6 transient transfection of the total length rat apoptosis-specific eIF-5A of sense orientation and corresponding Western trace.

Figure 37 is painted Western blot of Coomassie brilliant blue and the corresponding Western trace that the pHM6-total length rat apoptosis-specific eIF-5A in the COS-7 cell with anti--[HA] peroxidase probe in detecting expresses, and makes painted Western blot of Coomassie brilliant blue and the corresponding Western trace that the pHM6-total length rat apoptosis-specific eIF-5A in the COS-7 cell of probe in detecting expresses with p53.

Figure 38 is the comparison of the sequence (the Genbank number of obtaining XM_113401) of isolating eIF5A2 and people eIF5A2 from the RKO cell.

Figure 39 is illustrated in after the transient transfection, the curve chart of the apoptosis percentage ratio that occurs in RKO and RKO-E6 cell.With pHM6-LacZ or pHM6-eIF5A1 transient transfection RKO and RKO-E6 cell.The pHM6-LacZ cells transfected crossed with respect to actinomycin D treatment of no use is crossed with actinomycin D treatment, and shows apoptosis with the RKO cell of pHM6-eIF5A1 transfection and strengthened 240%.Cross with respect to actinomycin D treatment of no use, use the pHM6-LacZ cells transfected, cross, and show apoptosis with the RKO-E6 cell of pHM6-eIF5A1 transfection and increased by 105% with actinomycin D treatment.

Figure 40 is illustrated in after the transient transfection, the curve chart of the percentage ratio of the apoptosis that occurs in the RKO cell.Use pHM6-LacZ, pHM6-eIF5A1, pHM6-eIF5A2, or the eIF5A1 transient transfection RKO cell of pHM6-truncate.With respect to the control cells of pHM6-LacZ transfection, showing apoptosis with the pHM6-eIF5A1 cells transfected has increased by 25%.For the eIF5A1 cells transfected with pHM6-eIF5A2 or pHM6-truncate, this increase is not obvious.

Figure 41 is illustrated in the curve chart that transient transfection appears at the percentage ratio of the apoptosis in the RKO cell afterwards.The RKO cell is not carried out transfection, perhaps with pHM6-LacZ or pHM6-eIF5A1 transient transfection.After transfection efficiency is proofreaied and correct, 60% be apoptosis with the pHM6-eIF5A1 cells transfected.

Figure 42 provides after transient transfection, the result of the apoptotic flow cytometry of RKO.The RKO cell is that untransfected is crossed, or uses pHM6-LacZ, pHM6-eIF5A1, and pHM6-eIF5A2, or the eIF5A1 transient transfection of pHM6-truncate is crossed.This table has been represented the percentage ratio of the generation apoptotic cells calculated according to the area below the peak of each.After background apoptosis in the cell that untransfected is crossed and transfection efficiency are proofreaied and correct, 80% show apoptosis with the pHM6-eIF5A1 cells transfected.Use pHM6-LacZ, the eIF5A1 cells transfected of pHM6-eIF5A2 or pHM6-truncate only shows the apoptosis of background level.

Figure 43 provides after with the actinomycin D treatment of 0.25 μ g/ ml 0,3,7,24 and 48 hours, the proteic Western trace that extracts from the RKO cell.The picture on top is represented the Western trace as first antibody with anti--p53.Intermediary picture is represented the Western trace as first antibody with anti--eIF5A1.The picture of bottom is illustrated in after the chemiluminescence detection, is used to resist with Coomassie brilliant blue is painted-film of eIF5A1 trace, is used to confirm identical application of sample amount.Make p53 and eIF5A1 all obtain rise by actinomycin D treatment.

Detailed Description Of The Invention

The present invention's part is separated from the rat corpus luteum based on (apoptosis-specific) of coding apoptosis involvement Discovery and the sign of full-length cDNA of eIF-5A. Therefore, in one embodiment, this The bright separation that the nucleotide sequence that comprises coding rat apoptosis-specific eIF-5A polypeptide is provided Nucleic acid. The present invention also provides the amino acid sequence that comprises rat apoptosis-specific eIF-5A polypeptide The polypeptide of purifying. Rat apoptosis-specific eIF-5A polypeptide represent rat specific any with Lower polypeptide, its expression in the cell that carries out apoptosis is different, and is because deoxidation 8-Hydroxyl-2,7, the formation of 10-triamido capric acid residue causes, this deoxidation 8-hydroxyl-2,7,10 The formation of-triamido capric acid residue is by at deoxidation 8-hydroxyl-2,7,10-triamido capric acid Under the catalytic action of synzyme the 4-aminobutyl of spermidine is partly transferred to precursor eIF-5A The alpha-amido of special conservative lysine on, and by deoxidation 8-hydroxyl-2,7,10-three Amino capric acid hydroxylase makes 4-aminobutyl part hydroxylation form 8-hydroxyl-2,7,10-triamido Capric acid, thus activate eIF-5A.

In addition, nucleic acid of the present invention and polypeptide-rat apoptosis-specific eIF-5A sequence can be used for from other cells tissue, organ, or separate apoptosis-specific nucleic acid and polypeptide in the animal, wherein use explanation provided by the present invention and technology well-known to those skilled in the art.The present invention also provides the primer of the nucleic acid that is suitable as detection coding rat apoptosis-specific eIF-5A polypeptide of the present invention or the nucleic acid molecules of hybridization probe.

Nucleic acid of the present invention can be DNA, RNA, DNA/RNA duplex, protein-nucleic acid (PNA), or their derivant.In this article, be substantially free of cell material or do not contain precursor or during other chemical substances, just being said to be is " isolating " or " purification " when nucleic acid or polypeptide.Should be understood that not the representing of the isolating or purification of term contained the preparation of the library type of a large amount of other sequence fragments.Can be with nucleic acid of the present invention or peptide purification to evenly or reach other purity.The level of purification is based on the purposes of expection.Key feature is the ideal function that said preparation can be realized described nucleic acid or polypeptide, even also be like this under the situation that has a large amount of other compositions.

Described isolating polypeptide can be from its cell of natural expression purification, purification from changed over (reorganization) cell that can express it already, or utilize the known protein synthetic method synthetic.For example, proteic recombinant production comprises that cloned nucleic acid molecule with coding apoptosis-induced property eIF-5A or DHS is to expression vector.Described expression vector is imported host cell, and in described host cell, express described albumen.Can adopt the protein purification technology of standard then,, from described cell, separate described albumen by any suitable purification scheme.

The encode isolating nucleic acid of rat apoptosis-specific eIF-5A polypeptide of the present invention preferably have the nucleotide sequence of SEQ ID NO:1, and the polypeptide of purification of the present invention has the aminoacid sequence of SEQ ID NO:2.Rat apoptosis-specific eIF-5A nucleic acid of the present invention and polypeptide also comprise respectively having the sequence of remarkable sequence homogeneity or homology with SEQ ID NO:1 and SEQ ID NO:2, and its functional derivatives and variant.

In this article, term " significant sequence homogeneity " or " significant homology " are used to indicate the sequence that has significant structure or function homogeneity with another kind of sequence.Any structure or the difference on the function that have between significant sequence homogeneity or the significant homology sequence all are inappreciable; In other words, they can not influence described sequence is brought into play the appointment effect in needed purposes ability.For example, difference may be because the inherent variation on codon uses between the different plant species causes.If between two or more different sequences, there is the overlapping or similarity of a large amount of sequences, even if perhaps under the different situation of sequence length or structure different sequences also show similar physiologic character, just think that structural difference is inappreciable.For example, described feature comprises the ability of hybridization under given conditions, perhaps for albumen, and immunology cross reactivity, similar enzymatic activity etc.The technical staff can determine each such feature easily by methods known in the art.

In addition, if between two kinds of nucleotide sequences, have about at least 70% or higher, more preferably 80% or higher, even more preferably about 90% or higher, most preferably about 95% or higher sequence similarity, just think that these two kinds of nucleotide sequences are " complementary basically ".If the activity of polypeptide, or have at least 50% between the relevant part on the function, preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% similarity just thinks that this two seed amino acids sequence is homologous basically.

In order to determine the percentage homogeneity of two kinds of sequences, for the best comparison purpose described sequence (is for example compared, one of can be in first kind or second seed amino acid or nucleotide sequence or both on introduce the room, so that carry out the best comparison, and can ignore the non-homology sequence for comparison purposes).In preferred embodiments, for purpose relatively, at least 30%, 40%, 50%, 60%, 70%, 80% of reference sequences, or 90% or bigger length compare.Amino acid residue or nucleotide on corresponding amino acid position or nucleotide position have been compared then.When the position on first kind of sequence is occupied by the identical amino acid residue on the relevant position on second kind of sequence or nucleotide, these two molecules are exactly identical (in this article, aminoacid or nucleic acid " homogeneity " are equal to aminoacid or nucleic acid " homology ") on this position.Percentage homogeneity between two kinds of sequences is the function of same position quantity common between these two sequences, has considered that the best comparison for two sequences needs the quantity in the room of introducing and the length in each room.

Sequence between two sequences relatively and percentage homogeneity and similarity definite can be finished with mathematical algorithm.(Computational?Molecular?Biology，Lesk，A.M.，ed.，Oxford?University?Press，New?York，1988；Biocomputing：Informatics?and?Genome?Projects，Smith，D.W.，ed.，AcademicPress，New?York，1993；Computer?Analysis?of?sequence?Data，Part1，Griffin，A.M.，and?Griffin，H.G.，eds.，Humana?Press，New?Jersey，1994；Sequence?Ahalysis?in?Molecular?Biology，von?Heinje，G.，Academic?Press，1987；and?sequence?Analysisprimer，Gribskov，M.and?Devereux，J.，eds.，M?Stockton?Press，New?York，1991)。

Nucleic acid of the present invention and protein sequence can also be retrieved sequence library as " search sequence ", for example, be identified other family members or relevant sequence.Described retrieval can be carried out with the NBLAST and the XBLAST program (2.0 editions) of ((1990) J.Mol Biol.215:403-10) such as Altschul.The retrieval of BLAST nucleotide can be carried out with the NBLAST program.The retrieval of BLAST albumen can be carried out with the XBLAST program, so that the aminoacid sequence of acquisition and albumen homology of the present invention.For the comparison in the band room that obtains to be used for the comparison purpose, can adopt (1997) Nucleic Acids Res.25 (17): the 3389-3402 such as BLAST:Altschul in the band room that is disclosed in the following document.When adopting the blast program in BLAST and band room, can adopt the default parameters of corresponding program (for example, XBLAST and NBLAST).

" functional derivatives " of term nucleic acid is used to indicate the congener or the analog of gene or nucleotide sequence in this article.Functional derivatives can keep at least a portion function of specific gene, makes it can be used in the present invention." functional derivatives " of the apoptosis-specific eIF-5A polypeptide that this paper is disclosed is the fragment of apoptosis-specific eIF-5A, variant, analog, or chemical derivative, it kept at least a portion apoptosis-specific eIF-5A active or with immune cross-reactivity to the special antibody of apoptosis-specific eIF-5A.The fragment of apoptosis-specific eIF-5A polypeptide is represented any hypotype of this molecule.

Functional variant can also comprise similar amino acid whose replacement, and it can not cause the change on the function or cause unconspicuous change.Can identify by method known in the field the aminoacid that function is important, as direct mutagenesis or alanine scanning mutagenesis (Cunningham etc. (1989) Science 244:1081-1085).A kind of method in back can import single alanine mutation on each residue of molecule.Check the biologic activity of resulting mutating molecule then, as kinase activity or use it for such as the active analysis of in-vitro multiplication.Can also pass through such as crystallization, the structural analysis of nuclear magnetic resonance, NMR or photoaffinity labeling is determined binding partners/substrate in conjunction with important site (Smith etc. (1992) J.Mol.Biol.224:899-904; (1992) Science 255:306-312 such as de Vos).

" variant " expression and complete gene or the similar basically molecule of its fragment, as the nucleotide with nucleotide of one or more replacements replaces variant, but, it kept with specific gene hybridization or coding can with the ability of the mRNA transcript of n DNA hybridization.Fragment or variant sequence that " congener " expression belongs to or plants from different animals.The non-native molecules that " analog " expression is substantially similar to or whole relatively molecule or its variant or fragment work.

Variant peptides comprises naturally occurring variant, and the variant of producing by method well-known in the art.Described variant can utilize molecular engineering and the disclosed sequence information of this paper to identify easily/prepare.In addition, can according to eIF-5A of the present invention or proteic sequence of DHS and/or structural homology, from other albumen, distinguish described variant easily.It is functional variant or non-functional variant that existing homology/homogeneity degree depends primarily on this albumen, is present in the divergence amount in the symbiosis congener family, and straight evolutionary distance between congener.

The variant that the proteic non-natural of eIF-5A of the present invention or DHS exists can utilize recombinant technique to prepare easily.Described variant includes, but are not limited to the disappearance on the described proteic aminoacid sequence, adds and replacement.For example, one type replacement is that conservative amino acid replaces.Described replacement is by the specific amino acids on the another kind of aminoacid replacement albumen with similar characteristics.That be considered to the conservative replacement usually is aliphatic amino acid Ala, Val, the replacement each other between Leu and the Ile; The mutual exchange of hydroxyl residue Ser and Thr; The exchange of acidic residues Asp and Glu; Replacement between amide residues Asn and the Gln; Exchange between alkaline residue Lys and the Arg; And the replacement between aromatic moieties Phe and the Tyr.Relevant any amino acid change may be reticent guidance on phenotype, is disclosed in the following document: Bowie etc., Science247:1306-1310 (1990).

In addition, but equally preferably, the nucleic acid of the rat apoptosis-specific eIF-5A polypeptide of the present invention of encoding can be under high stringent condition and the nucleotide hybridization that is complementary to SEQ ID NO:1.Term as used herein " hybridization " is normally used for being illustrated in the nucleic acid hybridization under the suitable stringent condition, and to be those skilled in the art be easy to draw according to the character of probe sequence and target sequence this condition.Hybridization and wash conditions are well known to those skilled in the art, and the adjustment of condition depends on the stringency of needs, can pass through the change incubation time, temperature, and/or the ionic strength of solution realizes easily.For example, referring to Sambrook, J. etc., Molecular Cloning:A Laboratory Manual, 2 ^NdEdition, Cold Spring Harbour Press, Cold Spring Harbor, New York, 1989.

The selection of condition is the length by the length, particularly probe sequence of the sequence of being hybridized, the relative G-C content of nucleic acid and the decision of the mispairing amount of permission.In the time need having part hybridization between two chains that have than the complementarity of low degree, low stringency is preferred.When needs perfectly or when perfectly complementary, high stringency is preferred.Concerning typical high stringency, described hybridization solution contains 6 * S.S.C., 0.01M EDTA, 1 * Denhardt ' s solution and 0.5%SDS.For the fragment of cloned DNA, hybridization was carried out under 68 ℃ greatly about 3-4 hour, and for total eukaryotic DNA, hybridization was carried out about 12-16 hour.For low stringency, hybridization temperature is reduced to the melting temperature (T that is lower than duplex _m) about 42 ℃.Known T _mIt is the function of the ionic strength of G-C content and duplex length and solution.

In this article, phrase " with appropriate section hybridization " DNA or RNA divide the molecule of subrepresentation hybridization, for example, oligonucleotide, polynucleotide or any molecular sequences (justice or antisense orientation are arranged) can be discerned having roughly the same size and having the sequence that can realize the sequence similarity enough with it of hybridizing under appropraite condition on another nucleic acid molecules, and with its hybridization.For example, length is the part that the adopted molecule of having of 100 nucleotide can be discerned about 100 nucleotide of nucleotide sequence, and with its hybridization, as long as between two sequences, have about 70% or higher sequence similarity.Should be understood that the size of " appropriate section " allows to exist some mispairing in hybridization, therefore, " appropriate section " may less than or greater than with the molecule of its hybridization, for example, big or little 20-30% preferably is no more than about 12-15% greatly or for a short time.

In addition, the functional variant of polypeptide can also comprise similar amino acid whose replacement, and it can not cause the change on the function or cause unconspicuous change.Can identify by method known in the field the aminoacid that function is important, as direct mutagenesis or alanine scanning mutagenesis (Cunningham etc., Science 244:1081-1085 (1989)).A kind of method in back is introduced an alanine mutation on each residue of molecule.Detect the biologic activity of resulting mutating molecule then or be used for analysis.

For example, the analog of apoptosis-specific eIF-5A represents to be substantially similar to the albumen or the peptide mimics of intact proteins or its segmental non-natural existence.The chemical derivative of apoptosis-specific eIF-5A comprises under the normal condition other chemical parts of a part that is not described peptide or fragments of peptides.Can import peptide or its fragment with modifying by allowing fixed amino acid residue and the organic derivatization reagent of target of described peptide react, described organic derivatization reagent can react with selected side chain or terminal residue.

The initial discovery and the sign of the full-length cDNA of separated coding apoptosis-specific eIF-5A from the rat corpus luteum have caused cDNA clone's the discovery and the sign of the partial-length of encoding D HS, and the latter also is isolating from the rat corpus luteum, and relevant with apoptosis.Therefore, in other embodiments, the invention provides the isolating nucleic acid of the nucleotide sequence that comprises coding rat apoptosis-specific DHS polypeptide.The polypeptide of the purification that comprises rat apoptosis-specific DHS amino acid sequence of polypeptide also is provided.Rat apoptosis-specific DHS polypeptide, the any suitable polypeptide that expression is special to rat, its expression difference in apoptotic cell, and its energy catalytic deoxidation 8-hydroxyl-2,7, the formation of 10-triamido capric acid residue, this is by formation deoxidation 8-hydroxyl-2 on the alpha-amido of the special conservative lysine of the eIF-5A that the amino butyl of the 4-of spermidine is partly transferred to inactivation, 7,10-triamido capric acid, thus activate eIF-5A.

The isolating nucleic acid of rat apoptosis-specific DHS polypeptide of the present invention of encoding preferably has the nucleotide sequence of SEQ ID NO:6, and the polypeptide of purification of the present invention has the aminoacid sequence of SEQ ID NO:7.Rat apoptosis-specific DHS nucleic acid of the present invention and polypeptide also comprise respectively having the sequence of remarkable sequence homogeneity or homology with SEQ ID NO:6 and SEQ ID NO:7, and their functional derivatives and the variant that disclosed already of front.In addition, and equally preferably, isolating nucleic acid of the present invention has the nucleotide sequence that can hybridize with the complement of SEQ IDNO:6 under stringent condition, and this sequence disclosed equally in front.

With regard to the nucleic acid and polypeptide of the disclosed rat apoptosis-specific eIF-5A sequence of this paper, the nucleic acid of rat apoptosis-specific DHS sequence of the present invention can be used for from comprising that other human animals separate apoptosis-specific DHS nucleic acid and polypeptide with polypeptide.Separate described DHS sequence in animal and human body, the guidance that can be by means commonly known in the art provided with this paper realizes according at least 80% sequence homogeneity between the species.The present invention also provides to be suitable as and has been used to detect the primer of coding rat apoptosis-specific DHS polypeptide of the present invention or the nucleic acid molecules of hybridization probe.

Apoptosis-specific eIF-5A and DHS are used to regulate apoptosis, comprise the suitable target of the apoptosis that causes lysis, because it may play a role aspect the adjusting of back transcribing of the downstream effect thing of apoptosis involvement approach and transcription factor.Therefore, the present invention also provides by use the method that the reagent that can regulate apoptosis-specific eIF-5A and/or DHS function is regulated the apoptosis of cell to described cell.One skilled in the art will appreciate that described reagent can be the reagent of only regulating apoptosis-specific eIF-5A function, only regulate the reagent of apoptosis-specific DHS function, or regulate the two reagent of apoptosis-specific eIF-5A and DHS function.

Apoptosis is regulated in any suitable change of normal level that can be by apoptosis-specific eIF-5A in the cell and/or DHS function.As this paper purpose, modifying or change can be complete or part, and can comprise the change of transcribing or translating control or change apoptosis-specific eIF-5A in the described cell and/or other changes of DHS function.Apoptosis-specific eIF-5A or DHS functional representation and deoxidation 8-hydroxyl-2,7,10-triamido capric acid residue forms relevant any activity, the formation of this residue realizes by following process: the amino butyl of the 4-of spermidine is partly transferred on the alpha-amido of the special conservative lysine of precursor eIF-5A, this process is catalytic by DHS, and by deoxidation 8-hydroxyl-2,7, the amino butyl part of this 4-of 10-triamido capric acid hydroxylase hydroxylation, so that form 8-hydroxyl-2,7,10-triamido capric acid, thus activate eIF-5A.

In one embodiment of the present invention, described reagent can suppress apoptosis-specific eIF-5A and/or DHS function, thereby suppresses apoptosis.Suppress apoptosis, be illustrated in any minimizing of intensity and/or quantitative aspects, and/or at the peculiar any or all of clear and definite already morphological feature of apoptosis, for example, cell shrinkage, chromatin concentrates, the postponement that nucleus fracture and cell membrane bubble and show effect.

A kind of reagent that can suppress apoptosis-specific eIF-5A and/or DHS function is antisense oligonucleotide.Described antisense oligonucleotide preferably has the nucleotide sequence of the part of coding apoptosis-specific eIF-5A polypeptide and/or apoptosis-specific DHS polypeptide.The suitable nucleotide sequence of a lot of coding apoptosis-specific eIF-5A polypeptide and/or DHS polypeptide is known in the art.For example, SEQ ID NOS:1,3,4,5,11,15,19,20, with 21 (apoptosis-specific eIF-5A nucleotide sequences), SEQ ID NOS:6 and 8 (apoptosis-specific DHS nucleotide sequence), SEQ IDNOS:12 and 16 (apoptosis-specific eIF-5A peptide sequence) and SEQ ID NO:7 (apoptosis-specific DHS peptide sequence), or its part, suitable sequence is provided.Other suitable sequences can use known array to make probe, find according to the method that this paper is disclosed.

Therefore, the present invention also provides the part of coding apoptosis-specific eIF-5A polypeptide and/or apoptosis-specific DHS polypeptide, or the antisense oligonucleotide of its complement.Antisense oligonucleotide of the present invention can be RNA or dna form, for example, and cDNA, genomic DNA, or synthetic RNA or DNA.Described DNA can be double-stranded or strand, and if strand can be coding strand or noncoding strand.The specific hybrid of oligomeric compounds and its target nucleic acid has caused the interference to described nucleic acid normal function, is commonly called " antisense ".Wanting the function of interferential DNA to comprise duplicates and transcribes.For example, the function of interferential RNA to comprise rna transport and translate into albumen to the protein translation site by RNA, spliced rna is so that form one or more mRNA types, and the catalytic activity that can be undertaken or promote by RNA.The general effect of described antisense oligonucleotide is the expression that suppresses apoptosis-specific eIF-5A and/or DHS, and/or the quantity of the activatory apoptosis-specific eIF-5A that is produced.

In addition, can suppress the activation of apoptosis-specific DHS by using the chemical reagent that can suppress the DHS enzymatic reaction to apoptosis-specific eIF-5A.For example,, use spermidine when after apoptosis-induced by injection PGF-2 α, promptly a kind of DHS reaction but during the described animal of agent treated, the appearance of DNA sequence ladder reflects that the apoptosis in the rat corpus luteum postponed (Figure 18-19).Jakus etc., (1993) J.Biol.Chem.268:13151-13159.

Can also be by adding the apoptosis-specific eIF-5A DNA that to degrade, RNA, or albumen, the apoptosis-specific DHS DNA that maybe can degrade, RNA, or proteic reagent, suppress or significantly weaken apoptosis, thereby prevent to activate apoptosis-specific eIF-5A by apoptosis-specific DHS.In another embodiment of the invention, endogenous mammal apoptosis-specific DHS, apoptosis-specific eIF-5A, or the inhibition of the two expression are by using the ribozyme influence.The example of suitable drug comprises and can suppress the activated medicine of apoptosis-specific eIF-5A by apoptosis-specific DHS, can be by deoxidation 8-hydroxyl-2,7,10-triamido capric acid hydroxylase suppresses the activated medicine of apoptosis-specific eIF-5A, the medicine of transcribing and/or translating that can suppress apoptosis-specific DHS can suppress apoptosis-specific deoxidation 8-hydroxyl-2,7, the medicine of transcribing and/or translating of 10-triamido capric acid hydroxylase, and the medicine of transcribing or translating that can suppress apoptosis-specific eIF-5A.Can comprise spermidine by the example of the activated medicine of apoptosis-specific DHS inhibition eIF-5A, 1,3-diaminourea-propane, 1,4-diaminourea-butane (putrescine), 1,7-diaminourea-heptane, or 1,8-diaminourea-octane.

Can also suppress apoptosis-specific eIF-5A by the gene of the coding apoptosis-specific eIF-5A in the as killed cells.Described deactivation can be by removing the gene in the described cell, or by importing disappearance or sudden change in described gene, so that the described gene of deactivation and realizing.Described gene can also pass through to insert another dna fragmentation and deactivation in this gene, thereby the proteic expression of endogenous apoptosis-specific eIF-5A does not take place.Equally, can suppress the activation of apoptosis-specific eIF-5A by the gene of the coding apoptosis-specific DHS in the as killed cells.Being used for sudden change, is well known in the art as lacking and inserting the method that imports eukaryotic gene, for example, and U.S. Patent number 5,464,764.The oligonucleotide and the expression vector that can be used for gene mutation in the cell can prepare according to the guidance that method known in the field and this paper are provided; For example, be used to prepare the method with the antisence oligonucleotide, can be used for preparing the oligonucleotide and the expression vector that are used for making gene mutation at cell.

Can also suppress the expression of apoptosis-specific eIF-5A by suppressing the expression of gene of coding apoptosis-specific eIF-5A in the cell.Described deactivation can for example, by the nucleotide sequence transfered cell of the apoptosis-specific eIF-5A that will encode, suppress so that take place altogether by suppressing realization altogether.Equally, can suppress the activation of apoptosis-specific eIF-5A by suppressing the expression of gene of coding apoptosis-specific DHS in the cell altogether.The oligonucleotide and the expression vector that are used for common inhibition can prepare according to the guidance that method known in the field and this paper are provided; For example, the method that is used to prepare with the antisence oligonucleotide can be used for preparing oligonucleotide and the expression vector that is used for common inhibition.The method that is used for common inhibition is well known in the art, for example, and referring to U.S. Patent number 5,686,649.

A result who suppresses (for example, by antisense, suddenling change or inhibition altogether) is to have reduced the amount of endogenous interpretable apoptosis-specific eIF-5A or DHS-coding mRNA.Therefore, reduced the proteic quantity of apoptosis-specific DHS that is produced, thereby reduced the amount of activated eIF-5A, the latter has reduced the proteic translation of apoptosis-specific again.To be that apoptosis begins necessary because the albumen that starts anew is synthetic, suppresses thus or delayed apoptosis.

In another embodiment of the invention, described reagent can apoptosis-induced specificity eIF-5A or DHS function, thereby apoptosis-induced.Apoptosis-induced, represent the intensity that the peculiar morphological feature of any or all clear and definite already apoptosis occurs or any increase or the acceleration of quantitative aspects, described morphological feature for example, cell shrinkage, chromatin concentrates, nucleus fracture, and cell membrane bubbles.

The suitable reagent of apoptosis-induced specificity eIF-5A of any energy and/or DHS function can use.It will be appreciated by persons skilled in the art that and to use apoptosis-specific eIF-5A inactivation and activity form.If use the inactivation form, or 8-hydroxyl-2,7,10-triamido capric acid-unmodified form, natural apoptosis-specific DHS will activate eIF-5A.The a lot of suitable nucleotide sequence of coding apoptosis-specific eIF-5A polypeptide and/or DHS polypeptide is well known in the art.For example, SEQ ID NOS:1,3,4,5,11,15,19,20, with 21 (apoptosis-specific eIF-5A nucleotide sequences), SEQ ID NOS:6 and 8 (apoptosis-specific DHS nucleotide sequence), SEQ ID NOS:12 and 16 (apoptosis-specific eIF-5A peptide sequence) and SEQ ID NO:7 (apoptosis-specific DHS peptide sequence), or their part, suitable sequence is provided.Other suitable sequences can utilize described known array to make probe, go to find according to the disclosed method of this paper.

For example, can use exposed nucleic acid (exposed dna vector is as oligonucleotide or plasmid), or polypeptide, comprise the polypeptide of recombinant production to cell.The polypeptide of recombinant production represent to encode eIF-5A or the proteic DNA sequence of DHS places suitable expression vector, will elaborate to this below.With the described host of described expression vector transfection, produce needed polypeptide then.From described host cell, separate described polypeptide then.For example, reorganization apoptosis-inducing eIF-5A albumen can be used Chinese hamster ovary (CHO) cell preparation by those skilled in the art, and activate by reorganization DHS.Wang etc. (2001) J.Biol.Chem., 276,17541-17549; Eriksson etc., (2001) Semin.Hemato., 38,24-31.Described polypeptide can also be synthetic, and it is to use known albumen synthetic method synthetic.

Polypeptide picked-up can be used part, for example, comes from the part of anthrax and quickens, described ligand-mediated it is absorbed in the various kinds of cell.Liu etc. (2001) J.Biol.Chem., 276,46326-46332.Can also use liposome that recombiant protein is applied to mammiferous target cell, tissue or organ.Comprising described proteic liposome uses by intravenous route.Can be incorporated into by part in the described liposome and realize targeting the specific cells receptor.For example, referring to Kaneda, Adv Drug Delivery Rev 43:197-205 (2000).

Can apoptosis-induced specificity eIF-5A or a kind of preferred reagent of DHS function be expression vector.Therefore, the invention provides and have operationally the expression vector that is connected with the nucleic acid of coding apoptosis-specific eIF-5A polypeptide and/or DHS polypeptide.Expression vector of the present invention can be RNA or dna form, for example, and cDNA, genomic DNA, or synthetic RNA or DNA.Described DNA can be double-stranded or strand, and if strand, it can be coding strand or noncoding strand.(for example, referring to Pouwels etc., Cloning Vectors:A Laboratory Manual (Elsevior, N.Y.:1985)) can use any suitable expression vector.Described expression vector preferably has the promoter sequence that the nucleotides sequence that is operatively coupled on coding apoptosis-specific (relevant) eIF-5A polypeptide and/or apoptosis-specific (being correlated with) DHS polypeptide lists.

In described expression vector, the nucleic acid and the promoter that need are operably connected, so that described promoter can drive described expression of nucleic acids.As long as described nucleic acid can be expressed, any suitable promoter can be used.The example of described suitable promoter comprises various viral promotors, eukaryotic promoter, and constitutive activity promoter.As long as keep this being operably connected, described expression vector can comprise more than one nucleic acid (for example, the nucleic acid of coding apoptosis-specific eIF-5A and/or DHS).Described expression vector can be chosen wantonly and comprise other factors, as the polyadenylation sequence, ribosome entry site(RES), transcription regulaton factor (for example, enhancer, silencer etc.), be used to strengthen carrier or transcript the transcript of intracellular stability or needs in other sequences of intracellular translation or processing (for example, secretion signal, targeting sequencing etc.), or other any suitable factors.

Expression vector can be from coming from virus, as adenovirus, and adeno associated virus, herpesvirus, retrovirus or slow virus.Can be in host cell with expression vector transfection of the present invention, described host cell includes, but are not limited to bacterial species, mammal or insect host cell system comprise that rhabdovirus system is (for example, referring to Luckow etc., Bio/Technology, 6,47 (1988)), with the cell line of setting up, as 293, COS-7, C127,3T3, CHO, HeLa, BHK etc.

Adenovirus is preferred, this be because with plasmid and other viral vector (for example, herpes simplex virus) difference, adenovirus vector can be realized gene transfer in splitted and non-splitted cell, can be in cardiovascular region of interest such as cardiac muscle, realize high-caliber protein expression in blood vessel endothelium and the skeletal muscle.In addition, work, therefore, have the risk that the less gene with shifting inserts the significant points of host genome inadequately by gene position outside chromosome that adenovirus vector shifts.It is desirable to equally, described adenovirus vector lacks the needed gene function of at least a virus replication.Described adenovirus vector preferably lacks the E1 of adenoviral gene group, E2, and/or at least a of E4 district must gene function.More preferably, described carrier also lacks at least a portion (for example, the XbaI site in E3 district disappearance) in the E3 district of adenoviral gene group.

Can recombinant adenovirus be sent be delivered in the cultured cells by simply virus being added in the culture medium.Can realize host animal/mankind's infection by virion being injected directly into blood flow or being expelled in the tissue that needs.By making described virus and liposome (for example, Lipofectin, Life Technologies) or Polyethylene Glycol compound, prolong the half-life of described virus in serum.Described adenovirus vector normally enters cell by interaction between virus fibrinous press-button structure territory and Coxsackie virus and the adenovirus receptor CAR.Can make described virus can express part by genetically engineered, described viral vector is directed at the cell that special cells maybe can not be expressed CAR the specific cells receptor-specific.

In another embodiment, can be by raising endogenous apoptosis-specific eIF-5A or apoptosis-specific DHS, or the two transcribe with chemical substance chemistry, or strengthen the activation of apoptosis-specific eIF-5A by chemistry, start or strengthen apoptosis.In a kind of such embodiment, use PGF-2 α for described animal/people's cancerous cell or tumor, so that raise transcribing of DHS and eIF-5A.

Apoptosis-specific eIF-5A is the suitable target of regulating apoptosis, comprises the apoptosis that causes lysis, because it may work the downstream effect thing and the transcribing in the adjusting of back of transcription factor of apoptosis involvement approach.Method of regulating apoptosis-specific eIF-5A and apoptosis-specific DHS alone or in combination of the present invention, can in zooblast, carry out, apoptosis induced or enhancing have been caused, and produced and be used for the treatment of and prophylactic new method and compositions, described disease is to cause by with cell the relevant etiologic reason of apoptosis taking place.

A lot of important human diseasess are causing unusually by apoptosis control.These may cause the pathology of cell quantity (for example, cancer) to increase or cells injury forfeiture (for example, degenerative disease) unusually.As the indefiniteness example, method and composition of the present invention can be used for preventing and treats following disease relevant with apoptosis and imbalance: neurological/neurodegenerative disease (for example, Alzheimer, parkinson, Huntington's disease, amyotrophic lateral sclerosis (LouGehrig ' s disease), autoimmune disease (for example, rheumatoid arthritis, systemic lupus erythematosus (sle) (SLE), multiple sclerosis, Duchenne's dystrophy (DMD), motor neuron, ischemia, chronic heart failure, apoplexy, baby's spinal muscular atrophy, sudden cardiac arrest, renal failure, atopic dermatitis, sepsis and septic shock, AIDS, hepatitis, glaucoma, diabetes (1 type and 2 types), asthma, retinitis pigmentosa, osteoporosis, xenograft rejection, and burn.

Method of the present invention can be used for the animal that therapeutic treatment has cancerous cell or suffers from tumor, and its treating capacity is enough to kill cancer cell respectively or suppresses the progress of tumor.Be enough to realize the dosage of this purpose, be defined as treating effective dose.The amount that can realize this purposes depends on the order of severity of disease, and the immune general state of animal self.

The inhibition of tumor growth means the progress that suppresses or weaken tumor, for example, growth of tumor, invasion is shifted and/or recurrence.Method of the present invention can be used for treating any suitable tumor, for example, comprises mammary gland, heart, lung, small intestinal, colon, spleen, kidney, bladder, head and neck, ovary, prostate, brain, pancreas, skin, skeleton, bone marrow, blood, thymus, uterus, testis, the tumor of cervix uteri or liver.Animal, preferred mammal, more preferably human, can utilize the compositions and methods of the invention to treat.Therefore, method of the present invention can exsomatize or the interior enforcement of body external.

Therapeutic regimen can also change according to the situation of morbid state and described animal, and usually from single medicine group's dosage or (for example repeatedly use the successive every day of infusing, used once every 4-6 hour) between change, or definite according to the situation of treatment and animal.But, should be pointed out that the present invention is not limited to any given dose.

In the present invention, any suitable method or approach all can be used for using, and be for example oral, intravenous, and intraperitoneal, subcutaneous, or intramuscular administration.The dosage of the antagonist of being used depends on multiple factor, for example, comprises the type of the molecule of being used, the tumor type that treat and the order of severity and route of administration.But, should emphasize to be that the present invention is not limited to any specific application process or approach.

In a kind of alternate embodiment, method of the present invention can be used in combination with one or more traditional therapies.For example, can use suitable anti-tumor agent comprising salmosin, as chemotherapy agents or radiotherapy.In another kind of alternate embodiment, method of the present invention can be used in combination with one or more suitable adjuvants, for example, and cytokine (for example, IL-10 and IL-13), or other immunostimulant.

In another kind of alternate embodiment, can carry out the medical diagnosis on disease relevant with proliferative eIF-5A with apoptosis-specific eIF-5A with apoptosis, the difference of proliferative eIF-5A and apoptosis-specific eIF-5A is that they are to transcribe from different positions by different promoteres; But, these two kinds of compositions structurally are homologous, have difference at carboxyl terminal.Diagnostic method of the present invention comprises the amount of the proliferative eIF-5A that relatively is present in the specific cells and is present in the amount of the apoptosis-specific eIF-5A in the same cell.During normally playing a role, the amount of the proliferative eIF-5A that cell had (this paper also is referred to as eIF-5A2) is greater than the amount of apoptosis-specific eIF-5A (this paper also is referred to as eIF-5A1).But, in some cancerous cell, normal regulatory mechanism is made mistakes, and, the amount of apoptosis-specific eIF-5A, change has taken place in the amount of proliferative eIF-5A relatively.This change makes diagnosis cell to be cancerous cell before any phenotype variation takes place described cell.

In another embodiment, the ratio of proliferative eIF-5A and apoptosis-specific eIF-5A can be used for drug screening.This method also relates to the amount of the proliferative eIF-5A that relatively is present in the specific cells and is present in the amount of the apoptosis-specific eIF-5A in the same cell.With the normal ratio of proliferative eIF-5A and apoptosis-specific eIF-5A, compare with the ratio of proliferative eIF-5A after the described cells contacting drug candidates and apoptosis-specific eIF-5A.The change of the ratio of proliferative eIF-5A and apoptosis-specific eIF-5A after contact can be used for identifying that having apoptosis regulates active described material standed for.Can regulate active material standed for and be used for the treatment of the disease relevant having apoptosis, by suppressing or apoptosis-induced realization this purpose with apoptosis.In addition, the change of the ratio of proliferative eIF-5A and apoptosis-specific eIF-5A can be used to regulate apoptosis, also it can be used for the treatment of the disclosed any situation relevant of this paper with aberrant apoptosis.

Make in this way, can effectively screen a large amount of potential material standed fors, i.e. library is so that determine the member that can regulate apoptosis in this library.The library of any material standed for or material standed for can utilize this method screening.For example, the biologically instrumentality had shown the prospect as apoptosis regulator already, comprise the monoclonal antibody that can change signal transduction path, cytokine (Apo2 part) such as TRAIL, the part of biostearin/steroid family nuclear receptor, with can in conjunction with and the kinase whose micromolecular compound of Profilin, can utilize their apoptosis of determining of method of the present invention screening to regulate activity.

A kind of suitable material standed for is the protein kinase C-alpha antisense oligonucleotide, and ISIS 3521 (ISIS Pharmaceuticals, Inc., Carlsbad, CA), it has anti-tumor activity.Other specificity material standed fors comprise caspases (Idun Pharmaceuticals, SanDiego, CA), known its performance pivotal role aspect the startup of apoptosis and execution in causing the various kinds of cell type of cancer and neurodegenerative disease; GENA SENSETM (Genta, Inc., Berkeley Heights, NJ), it is to block the antisense drug that Bc1-2 produces; INGN 241 (Introgen Therapeutics, Inc., Houston, TX), it is gene therapy guiding P53; (Japan), it is the anti-CD 20 monoclonal antibody to rituximab for IDEC Corporation, Osaka; And the general apoptosis driving treatment of cardiovascular disease and cancer (EgeraTherapeutics Inc., Quebec, Canada).

Should be understood that, when nucleic acid of the present invention and polypeptide are used for the prevention of animal or therapeutic purposes, should use with the composition forms that also comprises carrier that can be medicinal.For example, suitablely can medicinal carrier comprise in the following ingredients one or more: water, saline, the saline solution of phosphoric acid buffer, glucose, glycerol and ethanol etc., and their combination.Carrier that can be medicinal can also comprise the auxiliary substance of trace, as wetting agent or emulsifying agent, and antiseptic or cushion, they can increase described protein-bonded shelf-life or effect.As known in the art, can prepare the compositions of injection, after using to animal so that the quick of described active component, the release that continues or postpone are provided.

Compositions of the present invention can be a various ways.Comprising, for example, solid, semisolid and liquid dosage form, as tablet, pill, powder, liquid solution, dispersion liquid or suspension, liposome, suppository, injectable and transfusable solution.Preferred dosage form depends on the method for application and the therapeutic use of expection.

Described compositions can prepare in the known mode of field of pharmacology.When the described compositions of preparation, described active component mixes with carrier usually, or dilutes with carrier, and/or wraps in the carrier, and for example, described carrier can be a capsule, medicated bag, paper or other solvent version.When described carrier was used as diluent, it can be a solid, semisolid, or fluent material, and it plays the vehicle of active component, the effect of excipient or medium.Therefore, described compositions can be a tablet, lozenge, medicated bag, cachet, elixir, suspension, aerosol (solid or be present in the liquid medium), for example, contain percentage by weight and be the ointment of 10% reactive compound nearly, soft and hard gelatine capsule, suppository, injection, suspension, the powder of aseptic packaging and external patch.

Now the present invention has been carried out explanation generally, the present invention may be better understood by reference following examples, and these embodiment provide with form of description.It is in order to help to understand the present invention that these embodiment are provided, rather than wants, and is not to be construed as and limits scope of the present invention by any way.These embodiment do not comprise the detailed description to conventional method.These methods are well known to those of ordinary skill in the art, and are disclosed in the various kinds of document.Conventional method, as be used for the method for carrier construction and plasmid, nucleic acid encoding is inserted the method for described carrier and plasmid, plasmid is imported the method for host cell and the detailed description of expressing and measure the method for gene and gene outcome, can from various kinds of document, obtain, comprise Sambrook, J. etc., (1989) Molecular Cloning:A Laboratory Manual, 2ed., Cold SpringHarbor Laboratory Press.All documents of being mentioned are herein all received with their integral form and are done this paper reference.

Embodiment

Embodiment 1

Present embodiment has proved that coding has the separation and the sign of the full-length cDNA of the specific expressed rat eIF-5A nucleic acid of apoptosis.

Apoptosis induced in superovulation and the rat corpus luteum

With the PMSG (priatin of conceived mare) of 50IU carry out subcutaneous injection and after 60-65 hour the HCG (human chorionic gonadotropin) with 50IU carry out subcutaneous injection, make the female rats superovulation of jejune (21-30 age in days).After handling 7 days with HCG, the PGF-2 α by subcutaneous injection 500mg induces the corpus luteum apoptosis.Each time point after PGF-2 α handles (for example 1,8 and 24 hour, put to death rat), and with the corpus luteum taking-up, be placed in the liquid nitrogen.By before being about to, putting to death rat, obtain the contrast luteal tissue with PGF-2 α processing.

The dispersion of rat ovary lutein cell

After superovulation 6-9 days, the PGF-2 α by multidigit point subcutaneous injection 500mg handled rat.After 15-30 minute, described ovary is taken out in the rat body of superovulation, put into the EBSS (Gibco) that is placed on ice, absorbent drying, and weigh.The connective tissue that prunes away, and with razor blade described ovary is shredded, with 2 times of EBSS washings 2 times.By stir collagenase (Sigma, Catologue #C 5138) the preparation collagenase solution of 6.5mg at the EBSS of 5ml mesoscale eddies.Tissue from the chopping of 8 ovaries added to being dissolved in the collagenase among the EBSS of the 5ml that is contained in the 50ml conical flask, and, mildly stir by sucking several times in the Diamed pipette.The flask that the tissue of chopping will be housed is then put into 37 ℃ water-bath 20 minutes, the air 95%, softly vibration (position 45 on the GFL incubator) in 5% the carbon dioxide.

Described flask is placed on ice, and cell suspending liquid is transferred on the Nitex filter that Swiss Nitex Nylon Monofilament (75m) is housed after this hatches carrying out with the plastics pipette.With filtrate collection in 15ml Falcon test tube.Second part of aliquot sample (2.5ml) of collagenase solution (6.5mg collagenase/5ml EBSS) added in the tissue of staying the chopping in the 50ml conical flask, gently stir, hatch 10 minutes, and filter as stated above with pipette.Merge this two kinds of filtrates, and at room temperature, centrifugal on clinical centrifuge (approximately 200g) 5 minutes.Except about 2ml supernatant, with all supernatant of pipette sucking-off, and discard, sedimentary cell is suspended in the described remaining 2ml supernatant again.

Wash described cell 2 times by adding 5ml MEM, and centrifugal as stated above and suspension again.Washed cell is suspended among the MEM that the 30ml that is contained in the 50ml conical flask contains the 10mm glutamine again, and under 37 ℃, the air 95%, 5%CO ₂In hatched 1 hour, do not vibrate.Make described cell precipitation then according to the method described above, and be suspended in again among the MEM that contains the 10mM glutamine.

Measure the concentration of dispersive cell with hematimeter, and utilize platform to expect blue dyestuff assessment viability.With 2-5 * 10 ⁵The aliquot sample of cell is put into the test tube of 12 * 75mm, and under 37 ℃, the air 95%, 5%CO ₂In oscillatorily do not hatch 2-5 hour.By the degree of assessment DNA sequence ladder, the development of monitoring apoptosis during this period.

By the apoptosis in the DNA sequence ladder observation rat corpus luteum

Determine the degree of apoptosis by the DNA sequence ladder.Use QIAamp DNA Blood test kit (Qiagen), according to manufacturer's explanation, from dispersive lutein cell or from the luteal tissue of excision isolation of genomic DNA.Handling before apoptosis-induced, apoptosis-induced after 1 and 24 hour, excise luteal tissue by PGF-2 α.By at room temperature with the DNA of 500ng and 0.2 μ Ci[α- ³²P] dCTP, 1mM Tris, 0.5mM EDTA, the Klenow enzyme of 3 units, and dATP, each 0.2pM of dGTP and dTTP be incubation 30 minutes together, and separated DNA is carried out end labelling.According to the method for Sambrook etc.,, remove uncorporated nucleotide by allowing sample pass through the Sepadex G-50 post of 1ml.Separate described sample by Tris-acetic acid-EDTA (1.8%) gel electrophoresis then.At room temperature, allow described gel drying 30 minutes in a vacuum, and under-80 ℃, be exposed to x-ray film 24 hours.

In an experiment, the degree of the apoptosis in the rat corpus luteum of superovulation is after injection PGF-2 α 0,1, or detection in 24 hours, in 0 hour contrast, under the situation of not injecting PGF-2 α, take out ovary.Embody the low-molecular-weight dna fragments sequence ladder of the nuclease relevant with apoptosis, before handling, do not occur in the contrast luteal tissue of excision with PGF-2 α, but, after apoptosis-induced, can differentiate within an hour, and at apoptosis-induced back 24 hours clearly, described result as shown in figure 16.In this accompanying drawing, the top picture is to use ³²The autoradiograph of the Northern trace that 3 of the rat corpus luteum apoptosis-specific DHS cDNA of P-dCTP-labelling '-untranslated region is surveyed.The bottom picture is the gel of total RNA of ethidium bromide staining.Each swimming lane contains 10 μ g RNA.Data show, after serum is deprived, have the downward modulation of eIF-5A transcript.

In another experiment, corresponding control animal replaces PGF-2 α with saline and handles.After handling 15 minutes, corpus luteum is taken out in animal body with saline or PGF-2 α.After in animal body, taking out described tissue 3 hours and 6 hours, isolation of genomic DNA from corpus luteum.In the animal body of handling from PGF-2 α, took out after the described tissue 6 hours, and the DNA sequence ladder occurred and the end labelling of the genomic DNA that strengthened, and after taking out tissue, do not have appearance in 3 hours.Referring to Figure 17.After handling 15 minutes, in the corpus luteum of excision, the DNA sequence ladder of reflection apoptosis also occurred, and under conditions in vitro, in EBSS (Gibco), kept 6 hour time with PGF-2 α.In the end labelling widely of genomic DNA, the nuclease relevant with apoptosis also appearred.

In another experiment, the PGF-2 α by subcutaneous injection 500 μ g has induced superovulation.Control rats is handled with isopyknic saline solution.After 15-30 minute, ovary is taken out, and decompose with collagenase.The dispersive cell of the rat that in the future personal PGF-2 α handles, in 10mm glutamine+10mm spermidine, hatched 1 hour, in not containing the 10mm glutamine of spermidine, hatch 5 hours (swimming lane 2) again, or in 10mm glutamine+10mm spermidine, hatched 1 hour, and in 10mm glutamine+1mm spermidine, hatch 5 hours (swimming lane 3) again.With the collagenase control cells of rat of saline treatment of disperseing to use by oneself, and only in glutamine, hatched 1 hour, and hatch 5 hours (swimming lane 1) again.Use the Klenow enzyme, with [α- ³²P]-dCTP carries out labelling to the 500ng DNA from each sample, separate on 1.8% agarose gel, and to exposure 24 hours, the result was as shown in figure 18.

In another embodiment, use the consumption of 1mg spermidine according to every 100g body weight, the rat of superovulation is carried out subcutaneous injection, before carrying out subcutaneous injection 24 with 500 μ g PGF-2 α, 12 and 2 hours, send the dosage of passing 3 equal 0.333mg/100g body weight.Control rats is divided into three groups: do not inject, three injection spermidines, but do not have PGF-2 α; And before handling, PGF-2 α injects isopyknic saline three times.After prostaglandin is handled 1 hour 35 minutes or 3 hours 45 minutes,, and be used for DNA isolation from the front taking-up ovary of described rat.Utilize the Klenow enzyme, with [α- ³²P]-the dCTP labelling is from the 500ng DNA of each sample, on 1.8% agarose gel, separates, and to exposure 24 hours: swimming lane 1, do not have injection (putting to death animal in the time identical with swimming lane 3-5); Swimming lane 2 is with spermidine injection 3 times (putting to death animal in the time identical with swimming lane 3-5); Swimming lane 3 with saline injection three times, is injected PGF-2 α (1 hour 35 minutes execution animals after handling with PGF-2 α) then; Swimming lane 4 with spermidine injection 3 times, is injected PGF-2 α (1 hour 35 minutes execution animals after handling with PGF-2 α) then; Swimming lane 5 with spermidine injection 3 times, is injected PGF-2 α (1 hour 35 minutes execution animals after handling with PGF-2 α) then; Swimming lane 6 with spermidine injection 3 times, is injected PGF-2 α (3 hours 45 minutes execution animals after handling with PGF-2 α) then; Swimming lane 7 with spermidine injection 3 times, is injected PGF-2 α (3 hours 45 minutes execution animals after handling with PGF-2 α) then.The result as shown in figure 19.

RNA separates

Separate total RNA the luteal tissue of in the rat body of different time after PGF-2 α is apoptosis-induced, taking out.Say simply, in liquid nitrogen, grind described tissue (5g).The powder and the 30ml guanidinesalt buffer (4M guanidinium isothiocyanate, 2.5mM NaOAc, pH8.5,0.8% beta-mercaptoethanol) that grind are mixed.By four layers of Mi Labu described mixture is filtered, and 4 ℃ with 10, centrifugal 30 minutes of the speed of 000g.With 11, the speed of 200g was carried out cesium chloride density gradient centrifugation 20 hours to supernatant then.The sedimentary RNA of ethanol rinsing with 75% is suspended in the 600ml DEPC-treated water again, and under-70 ℃, makes the RNA precipitation with 95% ethanol of 1.5ml and the 3M NaOAc of 60ml.

Genomic DNA separates and ladder

Use QIAamp DNA Blood test kit (Qiagen), according to manufacturer's explanation, isolation of genomic DNA from the luteal tissue extracted or dispersive lutein cell.By with 500ngDNA and 0.2 μ Ci[α- ³²P] dCTP, 1mM Tris, 0.5mM EDTA, the Klenow enzyme of 3 units, and dATP, each 0.2pM of dGTP and dTTP was at room temperature hatched 30 minutes together, and described DNA is carried out end labelling.According to the method for disclosures such as Maniatis,, remove unconjugated nucleotide by allowing sample pass through 1ml Sephadex G-50 post.Separate described sample by Tris-acetic acid-EDTA (2%) gel electrophoresis then.At room temperature, under vacuum condition, allow described gel drying 30 minutes, and under-80 ℃, be exposed to x-ray film 24 hours.

Plasmid DNA is separated, dna sequencing

Disclosed alkaline bleach liquor cleavage methods such as Sambrook above are used for isolated plasmid dna.Utilize the dideoxy sequencing method that the total length positive cDNA clone is checked order.Sanger etc., Proc.Natl.Acad.Sci.USA, 74:5463-5467.Utilize BLAST retrieval (GenBank, Bethesda, MD), editor and analysis open reading frame, utilize BCM Search Launcher to finish sequence alignment: Multiple sequece Alignments Pattern-InducedMultiple Alignment Method is (referring to F.Corpet, Nuc.Acids Res., 16:10881-10890, (1987)).Sequence and sequence alignment are shown in Fig. 5-11.

The Northern blot hybridization of rat corpus luteum RNA

On the formaldehyde agarose gel of 1% degeneration, from the rat corpus luteum in each stage of being in apoptosis, separate the total RNA of 20mg, and be fixed on the nylon membrane.Utilize random primer test kit (Boehringer), use ³²The total length rat apoptosis-specific eIF-5A cDNA (SEQ ID NO:1) of P-dCTP labelling detects film 7 * 10 ⁷In addition, utilize random primer test kit (Boehringer), use ³²The total length rat apoptosis-specific DHS cDNA (SEQID NO:6) of P-dCTP labelling detects described film (7 * 10 ⁷Cpm).At room temperature, with 1 * SSC, 0.1%SDS washs described film 1 time, and with 0.2 * SSC, 0.1%SDS washs 3 times under 65 ℃.Dry described film, and under-70 ℃, be exposed to x-ray film and spend the night.

Just as can be seen, in the luteal tissue of apoptosis, eIF-5A and DHS have obtained rise.After apoptosis-induced by PGF-2 α processing, the expression of apoptosis-specific eIF-5A obviously strengthens---and lower in the zero-time, significantly improve within an hour in processing, handling further raising within 8 hours, and handling slightly raising (Figure 14) within 24 hours.In the zero-time, the expression of DHS is lower, significantly improves within an hour in processing, is handling still further raising within 8 hours, and is handling slightly raising (Figure 15) once more within 24 hours.

Utilization prepares the rat corpus luteum RT-PCR product of apoptosis based on the primer of yeast, fungus and human eIF-5A sequence

Utilization is according to yeast, the a pair of oligonucleotide primers of fungus and human eIF-5A sequential design, by RT-PCR, be equivalent to the apoptosis-specific eIF-5A sequence (SEQ ID NO:11) of the partial-length of described gene 3 ' end with the rat corpus luteum RNA template preparation of apoptosis.The forward primer that is used to separate 3 of rat eIF-5A gene ' end is the degenerate primer with 20 nucleotide: 5 ' TCSAARACHGGNAAGCAYGG 3 ' (SEQ ID NO:9), and wherein, S is selected from C and G; R is selected from A and G; H is selected from A, T, and C; Y is selected from C and T; And N is any nucleic acid.The downstream primer that is used to separate 3 of rat eIF-5A gene ' end is the primer with 42 nucleotide: 5 ' GCGAAGCTTCCATGG CTCGAGTTTTTTTTTTTTTTTTTTTTT 3 ' (SEQ ID NO:10).Carry out reverse transcriptase polymerase chain reaction (RT-PCR).Say simply, use the 5mg downstream primer, synthesized article one chain of cDNA.Then, use the upstream and downstream primer, described article one chain is used as the RT-PCR template.

On agarose gel, the RT-PCR product is separated, has found the segmental existence of 900bp, connect by flush end, with its sub-clone to pBluescript ^TM(StratageneCloning Systems, LsJolla, CA) on, and the order-checking (SEQ ID NO:11).Described 3 ' terminal cDNA sequence is SEQ ID NO:11, and described 3 ' terminal amino acids sequence is SEQ ID NO:12.Referring to Fig. 1-2.

By RT-PCR, with the rat corpus luteum RNA template of apoptosis, prepared be equivalent to 5 of described gene ' end and with the apoptosis-specific eIF-5A sequence (SEQ ID NO:15) of the eclipsed described partial-length of 3 ' end.Described 5 ' primer is the 24-aggressiveness with following sequence, 5 ' CAGGTCTAGAGTTGGAATCGAAGC 3 ' (SEQ ID NO:13), and this primer is according to people eIF-5A sequential design.3 ' primer is the 30-aggressiveness with following sequence, 5 ' ATATCTCGAGCCTT GATTGCAACAGCTGCC 3 ' (SEQ ID NO:14), and it is according to described 3 ' terminal RT-PCR fragment design.Carry out reverse transcriptase-polymerase chain reaction (RT-PCR).Say simply, use the 5mg downstream primer, synthesized article one chain of cDNA.Use described upstream and downstream primer then, with the template of described article one chain as RT-PCR.

On agarose gel, separate described RT-PCR product, found the segmental existence of 500bp, utilize the XbaI and the XhoI cloning site that are present in upstream and downstream respectively, with this fragment sub-clone to pBluescript ^TM(Stratagene Cloning Systems, LaJolla, CA) on, and the order-checking (SEQ ID NO:15).5 ' terminal cDNA sequence is SEQ ID NO:15, and 5 ' terminal amino acids sequence is SEQ ID NO:16.Referring to Fig. 2.

3 of stack rat apoptosis-specific eIF-5A ' and 5 ' terminal sequence (being respectively SEQ IDNO:11 and SEQ ID NO:15), and obtained full length cDNA sequence (SEQ ID NO:1).This full length sequence is compared, and compare with sequence among the GeneBank data base.Referring to Fig. 1-2.Described cDNA clones coding has 154 amino acid whose polypeptide (SEQ IDNO:2), and its calculating molecular weight is 16.8Kda.Figure 3 illustrates the full-length cDNA of the rat apoptosis-specific corpus luteum eIF-5A gene that obtains by RT-PCR, and corresponding aminoacid sequence of deriving is SEQ ID NO:9.The full length amino acid sequence of the derivation of eIF-5a and people and mice eIF-5A sequence are compared.Referring to Fig. 7-9.

Utilization prepares the rat corpus luteum RT-PCR product of apoptosis based on the primer of people DHS sequence

Use is according to a pair of oligonucleotide primers of people DHS sequential design, and by RT-PCR, with the rat corpus luteum RNA template of apoptosis, preparation is equivalent to the apoptosis-specific DHS sequence (SEQ ID NO:6) of the partial-length of 3 of described gene ' end.Described 5 ' primer is the 20-aggressiveness with following sequence, 5 ' GTCTGTGTATTATTGGGCCC 3 ' (SEQ ID NO.17); Described 3 ' primer is the 42-aggressiveness with following sequence, 5 ' GCGAAGCTTCCATGGCTCGAGTTTTTTTTTTTTTTTTTTTTT 3 ' (SEQ ID NO:10).Carry out reverse transcriptase-polymerase chain reaction (RT-PCR).Say simply, use the 5mg downstream primer, synthesized article one chain of cDNA.Use described upstream and downstream primer then, with the template of described article one chain as RT-PCR.

On agarose gel, separate described RT-PCR product, found the segmental existence of 606bp, connect this fragment sub-clone to pBluescript by flush end ^TM(StratageneCloning Systems, LaJolla, CA) on, and the order-checking (SEQ ID NO:6).Figure 4 illustrates the nucleotide sequence (SEQ ID NO:6) of cDNA of the partial-length of the rat apoptosis-specific corpus luteum DHS gene that obtains by RT-PCR, and corresponding aminoacid sequence of deriving is SEQ ID NO:7.

The separation of genomic DNA and Southern analyze

Isolation of genomic DNA from the rat ovary of excision is used for the Southern trace.The ovary tissue of about 100mg is divided into small pieces, and puts into the test tube of 15ml.PBS with 1ml washs described tissue 2 times, and the described suspensions of tissues that mildly vibrates is removed PBS with pipette then.Organize in the DNA-buffer (0.2MTris-HCl pH8.0 and 0.1mM EDTA) that is suspended in 2.06ml again described, and add the 10%SDS of 240 μ l and E.C. 3.4.21.64 (the Boehringer Manheim of 100 μ l; 10mg/ml).Described tissue is put into the water-bath of vibration, under 45 ℃, spend the night.Second day, add the E.C. 3.4.21.64 (10mg/ml) of 100 μ l again, and, more described suspensions of tissues is placed in 45 ℃ the water-bath and hatched again 4 hours.After described hatching, use isopyknic phenol: chloroform: isoamyl alcohol (25: 24: 1) extracts described suspensions of tissues 1 time, uses isopyknic chloroform: isoamyl alcohol (24: 1) extracts 1 time.After described extraction, add 3M sodium acetate (pH5.2) and 2 times of volume of ethanol of 1/10 volume.To seal and make the glass pipette of hook shape by the Bunsen burner, and be used for the DNA silk is pulled out from solution, and described DNA is transferred in the clean microcentrifugal tube.With the described DNA of 70% washing with alcohol 1 time, and air-dry 10 minutes.Described DNA resolution of precipitate in the 10mM of 500ul Tris-HCl (pH8.0), is added the RNase A (10mg/ml) of 10 μ l, and under 37 ℃, hatched described DNA1 hour.Use phenol: chloroform: isoamyl alcohol (25: 24: 1) extracts described DNA 1 time, and makes the DNA precipitation by 3M sodium acetate (pH5.2) and 2 times of volume of ethanol of adding 1/10 volume.By under 4 ℃ centrifugal 10 minutes, make described DNA precipitation with the speed of 13,000 * g.Described DNA precipitates with 70% washing with alcohol, and spends the night by rotating described DNA down at 4 ℃, and it is dissolved in 200 μ l 10mM Tris-HCl (pH8.0).

In order to carry out the Southern engram analysis, with various restriction endonucleases digestion isolating genomic DNA from rat ovary, described enzyme can not the cracking endogenous gene or can only cracking 1 time.In order to realize this purpose, allow 10 μ g genomic DNAs, the restriction endonuclease of 20 μ l 10 * reaction buffers and 100U reacted 5-6 hour in the total reaction volume of 200 μ l.On the agarose gel of DNA application of sample to 0.7% with digestion, and with 40 volts voltage electrophoresis 6 hours, or spend the night with 15 volts voltage electrophoresis.After electrophoresis, in 0.2N HCl, described gel carried out 10 minutes depurination treatment, use denaturing soln (0.5M NaOH then, 1.5M NaCl) carry out 2 times 15 minutes washing, and (1.5M NaCl, 0.5M Tris-HCl pH7.4) carries out 2 times 15 minutes washing with neutralization buffer.Described DNA is transferred on the nylon membrane, and make described film at hybridization solution (40% Methanamide, 6 * SSC, (1 * Denhart ' s solution is 0.02%Ficoll to 5 * Denhart ' s solution, 0.02%PVP, and 0.02%BSA), prehybridization the denatured salmon sperm dna of 0.5%SDS and 1.5mg).By causing PCR fragment (3 ' UTR of 650bp and the coding region of 50bp) at random, and add on the described film with the consumption of 1 * 106cpm/ml with the 700bp of 3 ' UTR of [a-32P]-dCTP labelling rat eIF-5A cDNA.

Use similarly, [α- ³²P]-dCTP is to the PCR fragment of the 606bp of the rat DHS cDNA (labelling that 3 ' UTR) of the coding region of 450bp and 156bp causes at random, and add on second identical film with the consumption of 1 * 106cpm/ml.Under 42 ℃, allow described blot hybridization spend the night, wash 2 times with 2X SSC and 0.1%SDS down at 42 ℃ then, and use 1X SSC and 0.1%SDS washing 2 times down at 42 ℃.Allow described trace to exposure 3-10 days then.

By shown in Figure 20,, and use with restriction endonuclease cracking rat corpus luteum genomic DNA ³²The total length eIF-5A cDNA of P-dCTP-labelling detects.The hybridization of several restricted fragments of the DNA sample that complete cDNA probes and each restriction endonuclease digest has been found in the hybridization of carrying out under stringent condition, and this has shown the existence of the isoform of some kinds of eIF-5A.It is to be noted that especially with Ec oRV digestion rat genomic dna the time, it has restriction site in the open reading frame of apoptosis-specific eIF-5A, in the Southern trace, can detect two restricted fragments of isoform of the apoptosis-specific of eIF-5A.In Figure 20, these two fragments are indicated with double-head arrow.Be equivalent to the restricted fragment of isoform of the apoptosis-specific of eIF-5A, mark by single arrow in the swimming lane that indicates EcoR1 and BamH1, these restriction endonucleases do not have cracking site in their open reading frame.Above result shows that described apoptosis-specific eIF-5A is a single copy gene in the rat body.Shown in Fig. 5-13, the eIF-5A gene is high conservative between species, and therefore, what can expect is to have significant conservative between the isoform in any species.

Figure 21 represents to use ³²The Southern trace of the rat genomic dna that the rat corpus luteum apoptosis-specific DHScDNA of the partial-length of P-dCTP-labelling surveys.With the described genomic DNA of EcoRV cracking, this restriction endonuclease can not cracking as the cDNA of the described partial-length of probe.Two restricted fragments occurred, shown the described gene that has two copies, perhaps described gene comprises the intron with EcoRV site.

Embodiment 2

Present embodiment has confirmed the adjusting to apoptosis with apoptosis-specific eIF-5A and DHS.

The cultivation of COS-7 cell and RNA separate

The African green monkey kidney fibroblast-like cell that the mutant of the antigenic SV40 of encoding wild type T was transformed is that COS-7 is used for all experiments based on transfection.Cultivate the COS-7 cell in the improved Eagle ' of Dulbecco ' s s culture medium (DMEM), described culture medium contains 0.584 gram L-glutamine, every liter of sodium bicarbonate that contains 4.5g glucose and 0.37% for every liter.Described culture media supplemented has 10% the hyclone (FBS) and the penicillin/streptomycin of 100 units.Allow described cell in the wet environment of 5% carbon dioxide and 95% air, grow under 37 ℃.Every 3-4 days, the solution separating attached cell by with 0.25% trypsin and 1mM EDTA carried out successive transfer culture to described cell.With 1: 10 split ratio, isolated cells is assigned in the new culture dish that fresh culture is housed.

Growth is used for the COS-7 cell of isolation of RNA in the culture dish (Corning) that the 150-mm tissue culture treated is crossed.By with trypsin-EDTA solution separating, gather in the crops described cell.Described isolated cells is collected in the centrifuge tube, and by making described cell precipitation in centrifugal 5 minutes with the speed of 3000rpm.Remove supernatant, and in liquid nitrogen, described cell precipitation is carried out quick freezing.Use GenElute mammal total RNA micropreparation test kit (Sigma), according to manufacturer's explanation, isolation of RNA from described refrigerated cell.

The transfection of construction of recombinant plasmid and COS-7 cell

Utilize mammal epi-position marker expression carrier pHM6 (Roche MolecularBiochemicals) to make up to carry along the complete encoding sequence of the rat apoptosis eIF-5A of sense orientation with along the recombiant plasmid of 3 ' untranslated region (UTR) of the rat apoptosis eIF-5A of antisense orientation, as shown in figure 21.Described carrier comprises with the lower part: CMV promoter-human cytomegalic inclusion disease virus immediate early promoter/enhancer; HA-is from the nonapeptide epitope labelling of influenza hemagglutinin; BGH pA-bovine growth hormone polyadenylation signal; The flori-f1 starting point; SV40 ori-SV40 early promoter and starting point; Neomycin-neomycin resistance (G418) gene; SV40 pA-SV40 polyadenylation signal; Col E1-Col E1 starting point; Ampicillin-ampicillin resistance gene.By PCR, by the complete encoding sequence of the amplification of the original rat eIF-5A RT-PCR (SEQ IDNO:1) on pBluescript rat apoptosis eIF-5A and 3 ' UTR of rat apoptosis eIF-5A.For the described total length eIF-5A that increases, used following primer: forward primer 5 ' GCC AAGCTTAATGGCAGATGATTTGG 3 ' (SEQ.ID NO:18) (Hind3) and reverse primer 5 ' CT GAATTCCAGT TATTTTGCCATGG 3 ' (SEQ.ID NO:22) (EcoR1).For the described 3 ' UTR rat eIF-5A that increases, used following primer: forward primer 5 ' AAT GAATTCCGCCATGACAGAGGAGGC 3 ' (SEQ.ID NO:23) (EcoR1) and reverse primer 5 ' GCG AAGCTTCCATGG CTCGAGTTTTTTTTTTTTTTTTTTTTT3 ' (SEQ.ID NO:10) (Hind3).

The length of isolating total length rat eIF-5A PCR product is 430bp after agarose gel electrophoresis, and the length of 3 ' UTR rat eIF-5A PCR product is 697bp.With these two kinds of PCR product sub-clones on the Hind3 and EcoR1 site of pHM6, so that preparation pHM6-total length eIF-5A and pHM6-antisense 3 ' UTReIF-5A.Press frame sub-clone total length rat eIF-5A PCR product, make the upstream that is present in multiple clone site from the nonapeptide epitope labelling of influenza hemagglutinin (HA), so that can utilize anti--described recombiant protein of [HA]-peroxidase antibody test.Expression is started by human cytomegalic inclusion disease virus immediate early promoter/enhancer, so that guarantee the high level expression in mammal cell line.The feature of described plasmid also is neomycin resistance (G418) gene, and it allows to select stable transformant, and SV40 early promoter and starting point, and it allows to carry out episome in the cell that can express the SV40 large T antigen such as COS-7 and duplicates.

For the cell that is used for protein extraction, the COS-7 cell that will be used for transfection experiment is cultivated at 24 porocyte culture plates (Corning), perhaps for being used for painted cell, is placed on middle cultivation of cultivation microscope slide (Falcon) of 4 chambers.Allow described cell replenish 10%FBS, but grow into the degree of converging of 50-70% in the DMEM culture medium of shortage penicillin/streptomycin.Be diluted in by the plasmid DNA with 0.32 μ g among the DMEM of serum-free of 42.5 μ l, it is dull and stereotyped or cultivate the transfection media that use in a hole of microscope slide to prepare enough 24 holes, and, at room temperature hatched described mixture 15 minutes.(Gibco BRL) is diluted among the DMEM of serum-free of 42.5 μ l, and at room temperature hatched 5 minutes transfection reagent with 1.6 μ l---LipofectAMINE.After 5 minutes, described LipofectAMINE mixture is added in the described DNA mixture, and at room temperature hatched together 30-60 minute.Want cells transfected with serum-free DMEM washing, cover transfection media then at the top, and described cell was put back to described growth room 4 hours.

After hatching, in described cell, add the DMEM+20%FBS of 0.17ml.Before dyeing or results are apoptosis-induced before carrying out the Western engram analysis, described cell was cultivated 40 hours again.In contrast, also carried out the simulation transfection, wherein, described plasmid DNA has been saved from transfection medium.

Protein extraction and Western trace

Separate the albumen that is used for the Western trace from the cell of transfection, this is by using PBS (8g/L NaCl, 0.2g/L KCl, 1.44g/L Na ₂HPO ₄And 0.24g/L KH ₂PO ₄) washing described cell 2 times, the sds gel sample loading buffer (50mMTris-HCl pH6.8,100mM dithiothreitol, DTT, 2%SDS, 0.1% bromophenol blue and 10% glycerol) that adds the heat of 150 μ l then carries out.Described cell pyrolysis liquid is collected in the microcentrifugal tube, 95 ℃ of down heating 10 minutes, centrifugal 10 minutes then with the speed of 13,000 * g.Supernatant is transferred in the new centrifuge tube, and preserved stand-by down at-20 ℃.

In order to carry out the Western trace, on the 12%SDS-polyacrylamide gel, separate the total protein of 2.5 or 5 μ g.Isolating albumen is transferred on the poly-inclined to one side vinylidene fluoride film.Then described film was hatched 1 hour in lock solution (being dissolved in 5% defatted milk powder among the PBS, 0.02% Hydrazoic acid,sodium salt), and wash 3 times each 15 minutes with PBS-T (PBS+0.05%Tween-20).Under 4 ℃, in PBS-T, preserve described film and spend the night.Second day, at room temperature after rising again, sealed described film 30 minutes with 1 μ g/ml polyvinyl alcohol.With the described film of rinsed with deionized water 5 times, sealing 30 minutes in being dissolved in 5% the milk of PBS then.Before described film is cultivated, in 5% milk, use first antibody and cultivated 30 minutes.

Some kinds of first antibodies have been used.Use anti-[HA]-peroxide enzyme antibody (Roche Molecular Biochemicals) with 1: 5000 dilution ratio, so that detect described Recombinant Protein Expression.Because this antibody coupling on peroxidase, does not need second antibody, washs described trace, and develops by chemiluminescence.Employed other first antibodies can be discerned p53 (Ab-6) from Oncogene, Bcl-2 (Ab-1), and the monoclonal antibody of c-Myc (Ab-2).The monoclonal antibody of p53 is to use with the dilution ratio of 0.1 μ g/ml, and the monoclonal antibody of Bc1-2 and c-Myc all is to use with the dilution ratio of 0.83 μ g/ml.After hatching 60-90 minute, wash described film 3 times with PBS-T, each 15 minutes with first antibody.And then with 1% the milk dilution second antibody that is dissolved in PBS, and hatched described film 60-90 minute.With p53 (Ab-6) when the first antibody, employed second antibody be with 1: 1000 dilution proportion with the link coupled goat of alkali phosphatase (Rockland) anti--mice IgG.With Bcl-2 (Ab-1) and c-Myc (Ab-2) during as described first antibody, with 1: 5000 dilution ratio use with the link coupled rabbit of peroxidase (Sigma) anti--mice IgG.After hatching, wash described film 3 times with PBS-T with described second antibody.

Used two kinds of detection methods, so that described trace is developed, these two kinds of methods are colorimetric method and chemiluminescence method.Have only as p53 (Ab-6) to be used as first antibody, just use described colorimetric method when using the link coupled second antibody of described alkali phosphatase simultaneously.Observe bonded antibody by hatch described trace in the dark in following solution, this solution comprises the 0.33mg/mL nitroblue tetrazolium, 0.165mg/mL 5-bromo-4-chloro-3-indole phosphate ester, 100mMNaCl, 5mM MgCl ₂And 100mM Tris-HCl (pH9.5).By in being dissolved in the 2mM EDTA of PBS, hatching described trace, stop described color reaction.Chemical luminescence detection method is used for every other first antibody, comprises anti--[HA] peroxidase, Bcl-2 (Ab-1), and c-Myc (Ab-2).ECL Plus Western trace detection kit (AmershamPharmacia Biotech) is used to detect peroxidase-link coupled binding antibody.Say simply,, then, use 40: 1 the mixture of reagent A and reagent B to hatch in the dark 5 minutes described film absorbent drying slightly.Described film is blotted, be placed between the acetas sheet material, and be exposed to x-ray film 10 seconds to 10 minutes.

Apoptosis-induced in COS 7 cells

The apoptosis that two kinds of methods is used to induce COS 7 cells of transfection: actinomycin D is deprived and used to serum, and streptomycete (Calbiochem) is handled.Concerning these two kinds are handled, after transfection, removed culture medium in 40 hours.For the serum starvation experiment, replace described culture medium with serum-free and antibiotic-free DMEM.The cell that to grow in the DMEM of the antibiotic-free that has replenished 10%FBS is with comparing.Actinomycin D for apoptosis is induced, and replaces described culture medium with having replenished 10%FBS with the DMEM that is dissolved in the antibiotic-free of 1 μ g/ml actinomycin D in the methanol.Control cells is to grow in the DMEM of the antibiotic-free that has replenished 10%FBS and isopyknic methanol.In these two kinds of methods, the percentage ratio of apoptotic cells after 48 hours by with Hoescht or the annexin V-Cy3 mensuration that dyes.As shown in figure 22, also, confirmed apoptosis induced by the Northern engram analysis.

Hoescht dyeing

Nucleus dyestuff Hoescht is used for the nucleus of the COS-7 cell of labelling transfection, so that, identify apoptotic cells according to such as nucleus fracture and spissated morphological feature.Before being about to use, the fixative that preparation is made up of 3: 1 mixture of absolute methanol and glacial acetic acid.Isopyknic fixative is added in the culture medium that is grown in the COS-7 cell on the cultivation microscope slide, and hatched 2 minutes.Described culture medium/fixative mixture is removed from described cell, and discarded, and the fixative of 1ml is added on the described cell.After 5 minutes, described fixative device is discarded, and the fixative that 1ml is new adds on the described cell, and hatched 5 minutes.Described fixative is discarded, and, add the Hoescht dyestuff (0.5 μ g/ml Hoescht 33258 is dissolved among the PBS) of 1ml then air-dry 4 minutes of described cell.After hatching in the dark 10 minutes, staining solution is discarded, and with deionized water wash 3 times, each 1 minute.After washing, with McIlvaine ' s buffer (0.021M citric acid, the 0.058M Na of 1ml ₂HPO ₄7H ₂O; PH5.6) add on the described cell, and hatched in the dark 20 minutes.Discard described buffer, and in the dark with air-dry 5 minutes of described cell, and remove the chamber in the hole of separating described cultivation microscope slide.Add the several Vectashield mounting mediums (Vector Laboratories) that are used to send fluorescence to described microscope slide, and cover with coverslip.Painted cell is observed under fluorescence microscope, uses ultraviolet filter.Be apoptotic cells with dying nucleus bright or fracture, adding up.

Annexin V-Cy3 dyeing

Annexin V-Cy3 apoptosis detection kit (Sigma) is used for the Phosphatidylserine of externalization on the apoptotic cells is carried out fluorescent labeling.Use this test kit according to manufacturer's method, carried out following improvement.Say simply, will be grown in the COS-7 cell washing 2 times of the transfection on the cultivation microscope slide of four chambers with PBS, with 1 * binding buffer liquid washing 3 times.Add in the 150 μ l staining solutions (1 μ g/ml AnnCy3 is dissolved in 1 * binding buffer liquid), and described cell was hatched 10 minutes in the dark.Remove staining solution then, and wash described cell 5 times with 1 * binding buffer liquid.The wall of described chamber is removed from described cultivation microscope slide, and some 1 * binding buffer liquid are placed on the described cell, and cover with coverslip.Analyze described painted cell by fluorescence microscope, use green filter to observe the red fluorescence of (apoptosis) cell of described positive staining.By the quantity of the described cell of statistics under visible light, determine total cell mass.

Embodiment 3

Present embodiment has confirmed the adjusting to apoptosis with apoptosis-specific eIF-5A and DHS

Use general scheme and the method disclosed in the embodiment in front, Figure 23 is the flow chart that explanation is used for the scheme of transient transfection COS-7 cell, wherein, the plasmid DNA of cell in the serum-free medium in lipofectAMINE hatched 4 hours, add serum, and described cell was hatched 40 hours again.Then, before analyzing (promptly not doing further processing), described cell is placed in the conventional culture medium that contains serum hatched 48 hours, deprived serum 48 hours, so that apoptosis-induced before analyzing, perhaps used actinomycin D treatment 48 hours, so that apoptosis-induced before analyzing.

Figure 22 is illustrated in and uses the pHM6 transfection Western trace of the transient expression of foreign protein in the COS-7 cell afterwards.In the simulation transfection, perhaps use pHM6-LacZ, pHM6-antisense 3 ' rF5A (pHM6-antisense 3 ' UTR rat apoptosis eIF-5A), or pHM6-has after adopted rF5A (the pHM6-total length rat apoptosis eIF-5A) transfection 48 hours protein isolate from the COS-7 cell.By the albumen of SDS-PAGE fractionated, transfer on the pvdf membrane, and carry out the Western trace with anti--[HA]-peroxidase from 5 μ g of each sample.By the bonded antibody of chemiluminescence detection, and be exposed to x-ray film 30 seconds.LacZ (swimming lane 2) and have the expression of adopted rat apoptosis eIF-5A (swimming lane 4) high-visible.

As indicated above, the COS-7 cell is simulation (pHM6-total length rat eIF-5A) transfection transfection or that adopted rF5A transfection is arranged with pHM6-.After the transfection 40 hours, deprived 48 hours, induce described cell generation apoptosis by serum.Use the even caspase assay kit of fluoremetry (Roche Diagnostics) to measure the proteolytic activity of caspase in the cell extract of transfection.Also utilize FragEL dna break apoptosis detection kit (Oncogene) to measure dna break, this test kit can be with 3 '-OH end of the exposure of fluorescein-labeled Deoxydization nucleotide labeled dna fragment.

Other COS-7 cells are simulation transfection or (the pHM6-total length rat eIF-5A) that adopted rF5A transfection is arranged with pHM6-.After the transfection 40 hours, allow the regrowth 48 hours in containing the regular culture medium of serum (not doing further processing) of described cell, deprived 48 hours by serum, induce and carry out apoptosis, or carry out apoptosis by inducing in 48 hours with the actinomycin D treatment of 0.5 μ g/ml.Described cell dyes with Hoescht 33258, and the apoptotic cells nuclear fragmentation is followed in its expression, or dyes with annexin V-Cy3, and its expression Phosphatidylserine exposes the apoptosis of following.Also, use green filter to observe painted cell by fluorescence microscope, and statistical magnitude, so that determine to take place the percentage ratio of apoptotic cells.The total cell mass of counting under visible light.

Figure 25 represents that the apoptosis that embodies by the caspase increased activity strengthens, and at this moment, the COS-7 cell is with containing along the pHM6 transient transfection of the total length rat apoptosis-inductive eIF-5A of sense orientation.The expression of rat apoptosis-inductive eIF-5A causes the caspase activity to increase by 60%.

Figure 26 represents that the apoptosis that increase to embody by dna break strengthens, and at this moment, the COS-7 cell is with containing along the pHM6 transient transfection of the total length rat apoptosis-inductive eIF-5A of sense orientation.The expression of rat apoptosis-inductive eIF-5A causes dna break to increase by 273%.Figure 27 represents to increase by nucleus fracture the detection of the apoptosis that embodies, and at this moment, the COS-7 cell is with containing along the pHM6 transient transfection of the total length rat apoptosis-inductive eIF-5A of sense orientation.In the cell of expressing rat apoptosis-inductive eIF-5A, the nuclear occurrence rate of fracture is higher.Figure 28 represents that increasing the apoptosis that embodies by nucleus fracture strengthens, and at this moment, the COS-7 cell is with containing along the pHM6 transient transfection of the total length rat apoptosis-inductive eIF-5A of sense orientation.Compare with the sample contrast of non-serum starvation and serum starvation, the expression of rat apoptosis-inductive eIF-5A causes the nucleus fracture to increase by 27% and 63% respectively.

Figure 29 represents the detection of the apoptosis that expose to embody by Phosphatidylserine, and at this moment, the COS-7 cell is with containing along the pHM6 transient transfection of the total length rat apoptosis-inductive eIF-5A of sense orientation.The apoptosis that the increase that Figure 30 represents to expose by Phosphatidylserine embodies strengthens, and at this moment, the COS-7 cell is with containing along the pHM6 transient transfection of the total length rat apoptosis-inductive eIF-5A of sense orientation.Compare with the sample contrast of non-serum starvation and serum starvation, the expression of rat apoptosis-inductive eIF-5A, having caused Phosphatidylserine to expose has respectively increased by 140% and 198%.

Figure 31 represents to increase the enhanced detection of apoptosis that embodies by nucleus fracture, and at this moment, the COS-7 cell is with containing along the pHM6 transient transfection of the total length rat apoptosis-inductive eIF-5A of sense orientation.Compare with the sample contrast of handling with untreated, the expression of rat apoptosis-inductive eIF-5A, causing nucleus to break has increased by 115% and 62% respectively.Figure 32 represents the enhanced comparison of apoptosis under the following conditions, wherein, the COS-7 cell is with what contain along the pHM6 transient transfection of the total length rat apoptosis-inductive eIF-5A of sense orientation, and described cell is not further processed, or it is handle, so that apoptosis-induced.

Embodiment 4

Present embodiment has confirmed after using apoptosis-specific eIF-5A and DHS the adjusting to apoptosis activity.

In addition, the COS-7 cell is simulated transfection, with the pHM6-LacZ transfection or with pHM6-adopted rF5A (pHM6-total length rat eIF-5A) transfection is arranged, and hatched 40 hours.Separate the protein sample of the 5 μ g from each sample, extract by SDS-PAGE, transfer on the pvdf membrane, and carry out the Western trace with the monoclonal antibody that can discern Bcl-2.-mice IgG anti-with the link coupled rabbit of peroxidase is used as second antibody, and carries out the bonded antibody of exposure tests by chemiluminescence with to x-ray film.The result shown in figure 32.With compare with the pHM6-LacZ cells transfected, detectable Bcl-2 is less in adopted rF5A cells transfected is arranged with pHM6-; Therefore, Bcl-2 has been reduced.

In addition, the COS-7 cell is simulated transfection, with pHM6-antisense 3 ' rF5A (pHM6-antisense 3 ' UTR) transfections of rat apoptosis-specific eIF-5A or adopted rF5A (pHM6-total length rat apoptosis-specific eIF-5A) transfection is arranged with pHM6-.After transfection 40 hours, deprived 48 hours by serum, induce described cell generation apoptosis.Separate the protein sample of the 5 μ g from each sample, extract by SDS-PAGE, transfer on the pvdf membrane, and carry out the Western trace with the monoclonal antibody that can discern Bcl-2.-mice IgG anti-with the link coupled rabbit of peroxidase is used as second antibody, and carries out the bonded antibody of exposure tests by chemiluminescence with to x-ray film.

In addition, the COS-7 cell is simulated transfection, with the pHM6-LacZ transfection or with pHM6-adopted rF5A (pHM6-total length rat eIF-5A) transfection is arranged, and cultivated 40 hours.Separate the protein sample of the 5 μ g from each sample, extract by SDS-PAGE, transfer on the pvdf membrane, and carry out the Western trace with the monoclonal antibody that can discern p53.-mice IgG anti-with the link coupled rabbit of alkali phosphatase is used as second antibody, and detects bonded antibody by colorimetric analysis.

At last, the COS-7 cell is simulated transfection, with the pHM6-LacZ transfection or with pHM6-adopted rF5A (pHM6-total length rat eIF-5A) transfection is arranged, and hatched 40 hours.Separate the protein sample of the 5 μ g from each sample, extract by SDS-PAGE, transfer on the pvdf membrane, and with the monoclonal antibody detection that can discern p53.Survey the corresponding proteins trace with anti-[HA]-peroxidase, so that determine rat apoptosis-specific eIF-5A expression levels.-mice IgG anti-with the link coupled goat of alkali phosphatase is used as second antibody, and by the bonded antibody of chemiluminescence detection.

Figure 33 represents the downward modulation of Bcl-2, and at this moment, the COS-7 cell is with containing along the pHM6 transient transfection of the total length rat apoptosis-inductive eIF-5A of sense orientation.The top picture is represented the painted Western blot of Coomassie brilliant blue; The bottom picture is represented corresponding Western trace.With compare with the pHM6-LacZ cells transfected, detectable Bcl-2 is less in adopted rF5A cells transfected is arranged with pHM6-.

Figure 34 represents the rise of Bcl-2, and at this moment, the COS-7 cell is with containing along the pHM6 transient transfection of the total length rat apoptosis-inductive eIF-5A of antisense orientation.The top picture is represented the painted Western blot of Coomassie brilliant blue; The bottom picture is represented corresponding Western trace.With with the simulation transfection or have the pHM6-LacZ cells transfected of adopted rF5A to compare with containing pHM6-, detectable Bcl-2 is more in usefulness pHM6-antisense 3 ' rF5A cells transfected.

Figure 35 represents the rise of c-Myc, and at this moment, the COS-7 cell is with containing along the pHM6 transient transfection of the total length rat apoptosis-inductive eIF-5A of sense orientation.The top picture is represented the painted Western blot of Coomassie brilliant blue; The bottom picture is represented corresponding Western trace.With compare with pHM6-LacZ or simulation contrast cells transfected, in justice 3 ' rF5A cells transfected was arranged with pHM6-, detectable Bcl-2 was more.

Figure 36 represents the rise of c-Myc, and at this moment, the COS-7 cell is with containing along the pHM6 transient transfection of the total length rat apoptosis-inductive eIF-5A of sense orientation.The top picture is represented the painted Western blot of Coomassie brilliant blue; The bottom picture is represented corresponding Western trace.With compare with pHM6-LacZ or simulation contrast cells transfected, detectable p53 is more in justice 3 ' rF5A cells transfected is arranged with pHM6-.

Figure 37 represents that p53 raises the dependency to the expression of pHM6-total length rat apoptosis-inductive eIF-5A in the COS-7 cell.On the Western trace of surveying with anti-[HA]-peroxidase, the top picture is represented the painted Western blot of Coomassie brilliant blue, and the bottom picture is represented corresponding Western trace.Compare with second kind of transfection, how detectable rat apoptosis-inductive eIF-5A is arranged in first kind of transfection.In the Western trace of surveying with anti--p53, the top picture is represented the painted Western blot of corresponding Coomassie brilliant blue, and the bottom picture represent to use p53 for first kind of transfection, compare with pHM6-LacZ transfection or simulation contrast cells transfected, detectable p53 is more in adopted rF5A cells transfected is arranged with pHM6-.For second kind of transfection, wherein, the expression of rat apoptosis-inductive eIF-5A is less, and adopted rF5A is being arranged with pHM6-, and the level of p53 does not have detectable difference between pHM6-LacZ or the simulation contrast cells transfected.

Embodiment 5

Present embodiment has confirmed that apoptosis-specific eIF-5A can have the cell of active p53 (RKO cell) and not have in the cell (RKO-E6 cell) of active p53 apoptosis-induced, this shows that apoptosis-specific eIF-5A can start apoptosis by the approach except the p53 approach.This has also supported our argument: promptly it can work in the upstream of the cancer of number of different types, and might kill these cancerous cell.

Present embodiment has confirmed that the avtive spot of eIF-5A is described proteic 5 ' terminal (promptly referring to the eIF-5A1 that uses truncate experiment), and it most possibly comprises the RNA binding structural domain.

In addition, present embodiment has confirmed that people eIF-5A2 most possibly is proliferative eIF-5A, because it can not be apoptosis-induced.Therefore, it is believed that two eIF-5A gene apoptosis-specific eIf-5A1 in the human data storehouse are apoptogenes, and eIF-5A2 is an amplified gene.

The cultivation of RKO and RKO-E6 cell

With RKO (American type culture collection CRL-2577)---can express the CCL188 of wild type p53, and RKO-E6 (American type culture collection CRL-2578)---come from RKO's, the human papillomavirus E6 oncogene that comprised stable integration, can cause the cell line of normal p53 level and miopragia, be used for experiment based on transfection.Contain non essential amino acid, cultivating RKO and RKO-E6 cell among the minimal essential medium Eagle (MEM) of Earle ' s salt and L-glutamine.In this culture medium, replenished the penicillin/streptomycin of 10% hyclone (FBS) and 100 units.Allow described cell under 37 ℃, in the wet environment of 5% carbon dioxide and 95% air, grow.Every 3-4 days described cell is carried out successive transfer culture, comprise solution separating attached cell with 0.25% trypsin and 1mM EDTA.With 1: 10-1: 12 split ratio is assigned to isolated cells in the culture dish that new culture medium is housed.

The clone of people eIFSA2

Use by RT-PCR, is used isolating RNA separation of human eIF5A2 from RKO at the primer of sequence (ACCESSION XM113401) design of the people eIF5A2 that can obtain from GenBank.Figure 38 provides the comparison of the sequence of isolating eIF-5A and people eIF-5A2 from the RKO cell.RNA is isolating from the RKO cell with GenElute mammal total RNA micropreparation test kit (Sigma).The forward primer of eIF5A2 of being used to increase has following sequence 5 ' AAACTACCATCTCCCCTGCC 3 ' (SEQ.ID 24), and reverse primer has following sequence 5 ' TGCCCTACACAGGCTGAAAG 3 ' (SEQ ID NO:25).With the PCR product sub-clone of resulting 936bp to pGEM-T Easy carrier (Promega), and order-checking.

Then pGEM-T Easy-eIF5A2 construct is used as template, preparation eIF5A2PCR segment arrives this segment sub-clone in the frame of described mammalian expression vector pHM6 (Roche).The forward primer of people eIF5A2 of being used to increase is 5 ' ATCAAGCTTGCCCACCATGGCAGACG 3 ' (SEQ ID NO:26), and reverse primer is 5 ' AACGAATTCCATGCCTGATGTTTCCG 3 ' (SEQ ID NO:27).The PCR product of resulting 505bp digests with Hind3 and EcoR1, and sub-clone is on the Hind3 and EcoR1 site of pHM6.

The structure of the eIF5A1 of pHM6-truncate

Whether important for the carboxyl terminal district that determines eIF5A1 for its apoptosis-induced activity, made up the eIF5A1 of carboxyl-terminal deletion.The eIF5A1 of 1-127 number amino acid whose truncate of coding is to use pBS-rat eIF5A1 to make template by PCR preparation.Forward PCR primer is 5 ' GCCAAGCTTAATGGCAGATGATTTGG 3 ' (SEQ ID NO:18), and reverse primer is 5 ' TCCGAATTCGTACTTCTGCTCAATC 3 ' (SEQ ID NO:28).Digest the PCR product of resulting 390bp with EcoR1 and Hind3, and sub-clone is on the EcoR1 and Hind3 site of pHM6.

Transfection

For being used for the painted cell of Hoescht, the RKO or the RKO-E6 cell that will be used for transfection experiment are placed on upward cultivation of vestibule chambers 8 cultivation microscope slides (Falcon), or for putting on the 6 hole flat boards and cultivate by the cell of flow cytometry.Allow described cell replenish 10%FBS, but lack the degree of converging that grows into 70-80% in the MEM culture medium of penicillin/streptomycin.The transfection media that 1 hole of microscope slide is cultivated in enough 8 holes prepares by the following method: the plasmid DNA of 0.425 μ g is diluted among the MEM of serum-free of 22 μ l, and at room temperature hatched this mixture 15 minutes.(Gibco BRL) is diluted among the MEM of serum-free of 22 μ l, and at room temperature hatched 5 minutes with the transfection reagent LipofectAMINE of 0.85 μ l.After 5 minutes, the LipofectAMINE mixture is added in the described DNA mixture, and at room temperature hatched 30-60 minute.MEM washing with serum-free is wanted cells transfected 1 time, and the MEM with 44 μ l adds in the described transfection media then, and this culture medium is covered on the described cell.Described cell is put back in the described growth room 4 hours.After described hatching, in described cell, add the MEM+20%FBS of 88 μ l.Then described cell was cultivated 44 hours again, and according to foregoing method, with Hoescht 33258 dyeing.In another group experiment, transfection after,, and dyeed 20 hours with Hoescht subsequently with the RKO on 0.25 μ g/ml actinomycin D treatment, the 8 holes cultivation microscope slide or RKO-E6 cell 24 hours.The transfection of carrying out on 6 hole flat boards is carried out in an identical manner, and different is that all reagent has all increased by 4.81 times.After transfection 48 hours, gather in the crops the RKO cell of the transfection on the 6 hole flat boards, and fixing, so that pass through flow cytometry as stated above.

Determining of transfection efficiency

By the pHM6-LacZ-cells transfected being dyeed, determine transfection efficiency with 5-bromo-4-chloro-3-indole-β-D-galactose pyranoside (X-GAL).The cell of dying blue color is a cells transfected of expressing LacZ, and transfection efficiency is to calculate divided by total cell quantity by the quantity of the cell of dying blue color.After transfection, cells transfected carried out 48 hours dyeing.Wash described cell 2 times with PBS, then at room temperature, in 0.5% glutaraldehyde/PBS, fix 10 minutes.Use 1mM MgCl ₂/ PBS washs described cell 3 times, uses staining solution [to be dissolved in the 5mM K among the PBS then ₄Fe (CN) ₆3H ₂O, 5mM K ₃Fe (CN) ₆, 1mM, MgCl ₂, 0.1%X-GAL] and washing, up to the cell that blue color occurs dying.

Hoescht dyeing

Nucleus dyestuff Hoescht is used for the RKO of labelling transfection and the nucleus of RKO-E6 cell, so that, identify apoptotic cells according to nuclear fracture and concentrated.The fixative that preparation is made up of 3: 1 mixture of absolute methanol and glacial acetic acid before being about to use.Isopyknic fixative is added in the cell culture medium that is grown on the cultivation microscope slide, and hatched 2 minutes.Described culture medium/fixative mixture is removed from cell, and discarded, the 1ml fixative is added on the described cell.Discard described fixative after 5 minutes, and the fixative that 1ml is new adds on the described cell to, and hatched 5 minutes.Described fixative is discarded, and, add the Hoescht dyestuff (0.5 μ g/mlHoescht 33258 is dissolved among the PBS) of 1ml then air-dry 4 minutes of described cell.After hatching in the dark 10 minutes, described staining solution is discarded, and with the described microscope slide of deionized water wash 3 times, each 1 minute.After washing, with McIlvaine ' s buffer (0.021M citric acid, the 0.058M Na of 1ml ₂HPO ₄* 7H ₂O; PH5.6) add on the described cell, and hatched in the dark 20 minutes.Described buffer is discarded, and, remove the chamber in the hole of separating described cultivation microscope slide in the dark with air-dry 5 minutes of described cell.Some Vectashield fluorescence mounting mediums (Vector Laboratories) are added on the described microscope slide, and cover with coverslip.Under fluorescence microscope, use the UV light filter to observe painted cell.The nucleus statistics that to be dyed bright cell or have a fracture is apoptotic cell.

By the Flow cytometry dna break

The dna segment that produces during apoptosis is with fluorescein-FragELTM dna break detection kit (Oncogene Research Products), with fluorescein-labeled Deoxydization nucleotide labelling.After transfection, by trypsin treatment 48 hours, results with various construct cells transfected, and were fixed and labelling according to manufacturer's explanation on 6 hole culture plates.Say simply, under 4 ℃, make described cell precipitation 5 minutes with the speed of 1000 * g, and with PBS (8g/L NaCl, 0.2g/L KCl, 1.44g/L Na ₂HPO ₄And 0.24g/L KH ₂PO ₄) wash 1 time.Described cell is suspended in 4% formaldehyde (PBS) again, and at room temperature hatched 10 minutes.Make described cell precipitation once more, be suspended in again in the ethanol of 1ml 80%, and preserve down at 4 ℃.On the same day of analyzing, (concentration is 1 * 106 cell/ml) transfer in the microcentrifugal tube, and by making cell precipitation in centrifugal 5 minutes with the speed of 1000 * g with the fixed cell of 1ml.Sedimentary cell is suspended in 1 * TBS (20mM TrispH7.6,140mM NaCl) of 200 μ l again, and at room temperature hatched 10-15 minute.And then make described cell precipitation, and be suspended in again in the 20g/ml E.C. 3.4.21.64 of 100 μ l, and at room temperature hatched 5 minutes.Make described cell precipitation, and be suspended in again in 1 * TdT level pad of 100 μ l, and at room temperature hatched 10-30 minute.Make described cell precipitation by centrifugal then, and be suspended in again in the TdT labeled reactant mixture of 60 μ l, and hatched in the dark 1-1.5 hour.After cultivating, make described cell precipitation by centrifugal, and 1 * TBS of 200 μ l washing 2 times.Described cell is resuspended among 1 * TBS that final volume is 0.5ml, and on the flow cytometry that is equipped with 488nm argon laser light source, analyzes.

Protein extraction and Western trace

Protein isolate carries out the Western trace from cells transfected, comprises with PBS washing described cell 2 times, adds sds gel sample loading buffer (the 50mMTris-HCl pH6.8 of 150 μ l heat then, the 100mM dithiothreitol, DTT, 2%SDS, 0.1% bromophenol blue and 10% glycerol).Described cell pyrolysis liquid is collected in the microcentrifugal tube, 95 ℃ of down heating 10 minutes, centrifugal 10 minutes then with the speed of 13,000 * g.Supernatant is transferred in the new microcentrifugal tube, and preserved stand-by down at-20 ℃.

In order to carry out the Western trace, on 12%S DS-polyacrylamide gel, separate the total protein of 5 μ g or 10 μ g.Isolating albumen is transferred on the PVDF membrane.Cultivate described film in lock solution (5% defatted milk powder, 0.02% Hydrazoic acid,sodium salt is dissolved among the PBS) then, and wash 3 times each 15 minutes with PBS-T (PBS+0.05%Tween-20).Described film is placed among the PBS-T, preserves down at 4 ℃ and spend the night.At second day, after the room temperature of rising again, sealed described film 30 seconds with the polyvinyl alcohol of 1 μ g/ml.With the described film of rinsed with deionized water 5 times, then, with 5% the milk sealing that is dissolved in PBS 30 minutes.Before cultivating with described film, in being dissolved in 5% milk soln of PBS/0.025%Tween-20 with described first antibody preincubate 30 minutes.

The monoclonal antibody that can discern p53 (Ab-6) of described film available from Oncogene, or in the chicken body, prepare at inhaling the described film of seal with the polyclonal antibody of the terminal homologous synthetic peptide of the c-of people eIF5A1 (amino-CRLPEGDLGKEIEQKYD-carboxyl).The monoclonal antibody of p53 is to use with the diluent form of 0.1 μ g/ml, and the antibody of anti-eIF5A1 is to use with 1: 1000 dilution ratio.After hatching 60-90 minute, wash described film 3 times with PBS-T, each 15 minutes with first antibody.Hatched 60-90 minute then with 1% the milk dilution second antibody that is dissolved in PBS/0.025%Tween-20, and with described film.With p53 (Ab-6) when the first antibody, employed second antibody be dilution ratio be 1: 1000 with the link coupled goat anti-mouse IgG of alkali phosphatase (Rockland).To resist-when eIF5A1 is used as first antibody, be to use with 1: 10000 dilution ratio with the anti-chicken IgY of the link coupled rabbit of peroxidase (Gallus Immunotech).After hatching, wash described film 3 times with PBS-T with described second antibody.

Manifest described trace with two kinds of detection methods: colorimetric method and chemiluminescence method.Only with p53 (Ab-6) as first antibody, just use colorimetry when using the link coupled second antibody of alkali phosphatase simultaneously.By in the dark at the 0.33mg/mL nitroblue tetrazolium, 0.165mg/mL5-bromo-4-chloro-3-indole phosphate ester, 100mM NaCl, 5mM MgCl ₂And cultivate described trace in the solution of 100mM Tris-HCl (pH9.5), observe bonded antibody.Stop color reaction by in being dissolved in the 2mM EDTA of PBS, hatching described trace.Chemical luminescence detection method is used for every other first antibody, comprises anti--[HA]-peroxidase and anti--eIF5A1.(Amersham Pharmacia Biotech) is used to detect peroxidase-link coupled binding antibody with ECLPlus Western trace detection kit.Say simply,, use in the dark then in 40: 1 the mixture of reagent A and reagent B and hatched 5 minutes described film absorbent drying slightly.Described film is blotted, be placed between the two-layer acetas, and be exposed to x-ray film 10 seconds to 30 minutes.

Figure 39 represents to show the curve chart of the percentage ratio that appears at the apoptosis in RKO and the RKO-E6 cell after transient transfection.With pHM6-LacZ or pHM6-eIF5A1 transient transfection RKO and RKO-E6 cell, after 24 hours, handle described cell with 0.25 μ g/ml actinomycin D or isopyknic methanol (contrast).Carry out dyeing in 20 hours with 20 pairs of described cells of Hoescht subsequently, and under fluorescence microscope, observe with the UV light filter.To be apoptosis owing to spissated chromatin dyes bright cell statistics.Compare with the cell of crossing with the actinomycin D treatment of no use of pHM6-LacZ transfection, top experiment disclosed cross with actinomycin D treatment and show apoptosis with the RKO cell of pHM6-eIF5A1 transfection and improved 240%.Compare with the cell of crossing with the actinomycin D treatment of no use of pHM6-LacZ transfection, cross with actinomycin D treatment and show apoptosis with the RKO-E6 cell of pHM6-eIF5A1 transfection and improved 105%.

Figure 40 provides the curve chart of the percentage ratio that is illustrated in the apoptosis that occurs after the transient transfection in the RKO cell.Use pHM6-LacZ, pHM6-eIF5A1, pHM6-eIF5A2, or the eIF5A1 transient transfection RKO cell of pHM6-truncate.With Hoescht described cell is dyeed after 44 hours, and under fluorescence microscope, observe with the UV light filter.To be apoptosis owing to spissated chromatin dyes bright cell statistics.With compare with the control cells of pHM6-LacZ transfection, showing apoptosis with the pHM6-eIF5A1 cells transfected has increased by 25%.For the eIF5A1 cells transfected with pHM6-eIF5A1 or pHM6-truncate, this increase is not obvious.

Figure 41 provides and has been illustrated in the curve chart that transient transfection appears at the percentage ratio of the apoptosis in the RKO cell afterwards.The RKO cell is not carried out transfection, perhaps carry out transient transfection with pHM6-LacZ or pHM6-eIF5A1.With Hoescht described cell is dyeed after 44 hours, and under fluorescence microscope, observe with the UV light filter.To be apoptotic cells owing to spissated chromatin dyes bright cell statistics.After transfection efficiency is proofreaied and correct, be apoptotic cells with 60% cell of pHM6-eIF5A1 transfection.

Figure 42 provides the apoptotic flow cytometry of RKO after transient transfection.Pair cell does not carry out transfection or uses pHM6-LacZ, pHM6-eIF5A1, and pHM6-eIF5A2, or the eIF5A1 of pHM6-truncate carries out transient transfection.After 48 hours, gather in the crops described cell and fixing.Embody the DNA of the fracture of apoptosis with the link coupled Deoxydization nucleotide labelling of fluorescein, and on the flow cytometry that is equipped with 488nm argon laser light source, analyze.Appear at fluorescence below the E from non--apoptotic cells, and appear at fluorescence below the F from apoptotic cells takes place.This has expressed the percentage ratio of the generation apoptotic cells of calculating according to the area below the peak of each.After the background apoptosis in the cell of untransfected and transfection efficiency are proofreaied and correct, show apoptosis with 80% cell of pHM6-eIF5A1 transfection.Use the pHM6-LacZ transfection, the eIF5A1 cells transfected of pHM6-eIF5A2 or pHM6-truncate only shows the apoptosis of background level.

Figure 43 provides from the proteic Western trace that extracts in 0,3,7,24 and 48 hours the RKO cell of 0.25 μ g/ml actinomycin D treatment.On the 12%SDS-polyacrylamide gel, separate 5 μ g (for anti--eIF5A1) or the 10 μ g (total protein of antagonism-p53), and transferring on the PVDF membrane.The top picture is represented the Western trace as first antibody with anti-p53.Intermediary picture represents to resist-and eIF5A1 is as the Western trace of first antibody.The picture of bottom is represented to be used for to carry out painted film with Coomassie brilliant blue antagonism-eIF5A1 trace, carries out chemiluminescence detection then, equates so that confirm the application of sample amount.After with actinomycin D treatment, p53 and eIF5A1 have obtained rise.

Sequence table

<110>SENESCO?TECHNOLOGIES，INC.

＜120〉nucleic acid of adjusting apoptosis, polypeptide, and method

<130>10799/83

<140>

<141>2003-05-07

<150>10/200,148

<151>2002-07-23

<150>10/141,647

<151>2002-05-07

<160>28

<170>FastSEQ?for?Windows?Version?4.0

<210>1

<211>1139

<212>DNA

＜213〉Rodents

<220>

<221>CDS

<222>(33)...(497)

<400>1

caggtctaga?gttggaatcg?aagcctctta?aa?atg?gca?gat?gat?ttg?gac?ttc 53

Met?Ala?Asp?Asp?Leu?Asp?Phe

1 5

gag?aca?gga?gat?gca?ggg?gcc?tca?gcc?acc?ttc?cca?atg?cag?tgc?tca 101

Glu?Thr?Gly?Asp?Ala?Gly?Ala?Ser?Ala?Thr?Phe?Pro?Met?Gln?Cys?Ser

10 15 20

gca?tta?cgt?aag?aat?ggt?ttt?gtg?gtg?ctc?aag?ggc?cgg?cca?tgt?aag 149

Ala?Leu?Arg?Lys?Asn?Gly?Phe?Val?Val?Leu?Lys?Gly?Arg?Pro?Cys?Lys

25 30 35

atc?gtc?gag?atg?tct?act?tcg?aag?act?ggc?aag?cat?ggc?cat?gcc?aag 197

Ile?Val?Glu?Met?Ser?Thr?Ser?Lys?Thr?Gly?Lys?His?Gly?His?Ala?Lys

40 45 50 55

gtc?cat?ctg?gtt?ggt?att?gat?att?ttt?act?ggg?aag?aaa?tat?gaa?gat 245

Val?His?Leu?Val?Gly?Ile?Asp?Ile?Phe?Thr?Gly?Lys?Lys?Tyr?Glu?Asp

60 65 70

atc?tgc?ccg?tcg?act?cat?aac?atg?gat?gtc?ccc?aac?atc?aaa?agg?aat 293

Ile?Cys?Pro?Ser?Thr?His?Asn?Met?Asp?Val?Pro?Asn?Ile?Lys?Arg?Asn

75 80 85

gat?ttc?cag?ctg?att?ggc?atc?cag?gat?ggg?tac?cta?tcc?ctg?ctc?cag 341

Asp?Phe?Gln?Leu?Ile?Gly?Ile?Gln?Asp?Gly?Tyr?Leu?Ser?Leu?Leu?Gln

90 95 100

gac?agt?ggg?gag?gta?cga?gag?gac?ctt?cgt?ctg?cct?gag?gga?gac?ctt 389

Asp?Ser?Gly?Glu?Val?Arg?Glu?Asp?Leu?Arg?Leu?Pro?Glu?Gly?Asp?Leu

105 110 115

ggc?aag?gag?att?gag?cag?aag?tat?gac?tgt?gga?gaa?gag?atc?ctg?atc 437

Gly?Lys?Glu?Ile?Glu?Gln?Lys?Tyr?Asp?Cys?Gly?Glu?Glu?Ile?Leu?Ile

120 125 130 135

aca?gtg?ctg?tcc?gcc?atg?aca?gag?gag?gca?gct?gtt?gca?atc?aag?gcc 485

Thr?Val?Leu?Ser?Ala?Met?Thr?Glu?Glu?Ala?Ala?Val?Ala?Ile?Lys?Ala

140 145 150

atg?gca?aaa?taa?ctggcttcca?gggtggcggt?ggtggcagca?gtgatccatg 537

Met?Ala?Lys *

agcctacaga?ggcccctccc?ccagctctgg?ctgggccctt?ggctggactc?ctatccaatt 597

tatttgacgt?tttattttgg?ttttcctcac?cccttcaaac?tgtcggggag?accctgccct 657

tcacctagct?cccttggcca?ggcatgaggg?agccatggcc?ttggtgaagc?tacctgcctc 717

ttctctcgca?gccctgatgg?gggaaaggga?gtgggtactg?cctgtggttt?aggttcccct 777

ctcccttttt?ctttttaatt?caatttggaa?tcagaaagct?gtggattctg?gcaaatggtc 837

ttgtgtcctt?tatcccactc?aaacccatct?ggtcccctgt?tctccatagt?ccttcacccc 897

caagcaccac?tgacagactg?gggaccagcc?cccttccctg?cctgtgtctc?ttcccaaacc 957

cctctatagg?ggtgacaaga?agaggagggg?gggaggggac?acgatccctc?ctcaggcatc 1017

tgggaaggcc?ttgcccccat?gggctttacc?ctttcctgtg?ggctttctcc?ctgacacatt 1077

tgttaaaaat?caaacctgaa?taaaactaca?agtttaatat?gaaaaaaaaa?aaaaaaaaaa 1137

aa 1139

<210>2

<211>154

<212>PRT

＜213〉Rodents

<400>2

Met?Ala?Asp?Asp?Leu?Asp?Phe?Glu?Thr?Gly?Asp?Ala?Gly?Ala?Ser?Ala

1 5 10 15

Thr?Phe?Pro?Met?Gln?Cys?Ser?Ala?Leu?Arg?Lys?Asn?Gly?Phe?Val?Val

20 25 30

Leu?Lys?Gly?Arg?Pro?Cys?Lys?Ile?Val?Glu?Met?Ser?Thr?Ser?Lys?Thr

35 40 45

Gly?Lys?His?Gly?His?Ala?Lys?Val?His?Leu?Val?Gly?Ile?Asp?Ile?Phe

50 55 60

Thr?Gly?Lys?Lys?Tyr?Glu?Asp?Ile?Cys?Pro?Ser?Thr?His?Asn?Met?Asp

65 70 75 80

Val?Pro?Asn?Ile?Lys?Arg?Asn?Asp?Phe?Gln?Leu?Ile?Gly?Ile?Gln?Asp

85 90 95

Gly?Tyr?Leu?Ser?Leu?Leu?Gln?Asp?Ser?Gly?Glu?Val?Arg?Glu?Asp?Leu

100 105 110

Arg?Leu?Pro?Glu?Gly?Asp?Leu?Gly?Lys?Glu?Ile?Glu?Gln?Lys?Tyr?Asp

115 120 125

Cys?Gly?Glu?Glu?Ile?Leu?Ile?Thr?Val?Leu?Ser?Ala?Met?Thr?Glu?Glu

130 135 140

Ala?Ala?Val?Ala?Ile?Lys?Ala?Met?Ala?Lys

145 150

<210>3

<211>462

<212>DNA

＜213〉Rodents

<400>3

atggcagatg?acttggactt?cgagacagga?gatgcagggg?cctcagccac?cttcccaatg?60

cagtgctcag?cattacgtaa?gaatggcttt?gtggtgctca?aaggccggcc?atgtaagatc?120

gtcgagatgt?ctacttcgaa?gactggcaag?cacggccacg?ccaaggtcca?tctggttggt?180

attgacatct?ttactgggaa?gaaatatgaa?gatatctgcc?cgtcaactca?taatatggat?240

gtccccaaca?tcaaaaggaa?tgacttccag?ctgattggca?tccaggatgg?gtacctatca?300

ctgctccagg?acagcgggga?ggtacgagag?gaccttcgtc?tccctgaggg?agaccttggc?360

aaggagattg?agcagaagta?cgactgtgga?gaagagatcc?tgatcacggt?gctgtctgcc?420

atgacagagg?aggcagctgt?tgcaatcaag?gccatggcaa?aa 462

<210>4

<211>462

<212>DNA

＜213〉Rodents

<220>

<221>misc_feature

<222>(1)...(462)

＜223〉n=A, T, C or G

<400>4

atggcagacg?aaattgattt?cactactgga?gatgccgggg?cttccagcac?ttaccctatg?60

cagtgctcgg?ccttgcgcaa?aaacggcttc?gtggtgctca?aaggacgacc?atgcaaaata?120

gtggagatgt?caacttccaa?aactggaaag?catggtcatg?ccaaggttca?ccttgttgga?180

attgatattt?tcacgggcaa?aaaatatgaa?gatatttgtc?cttctactca?caacatggat?240

gttccaaata?ttaagagaaa?tgattatcaa?ctgatatgca?ttcaagatgg?ttacctttcc?300

ctgctgacag?aaactggtga?agttcgtgag?gatcttaaac?tgccagaagg?tgaactaggc?360

aaagaaatag?agggaaaata?caatgcaggt?gaagatgtac?aggtgtctgt?catgtgtgca?420

atgagtgaag?aatatgctgt?agccataaaa?ccctnngcaa?at 462

<210>5

<211>462

<212>DNA

＜213〉Rodents

<400>5

atggcagatg?atttggactt?cgagacagga?gatgcagggg?cctcagccac?cttcccaatg?60

cagtgctcag?cattacgtaa?gaatggtttt?gtggtgctca?aaggccggcc?atgtaagatc?120

gtcgagatgt?ctacttcgaa?gactggcaag?catggccatg?ccaaggtcca?tctggttggc?180

attgacattt?ttactgggaa?gaaatatgaa?gatatctgcc?cgtcgactca?taatatggat?240

gtccccaaca?tcaaacggaa?tgacttccag?ctgattggca?tccaggatgg?gtacctatcc?300

ctgctccagg?acagtgggga?ggtacgagag?gaccttcgtc?tgcctgaagg?agaccttggc?360

aaggagattg?agcagaagta?tgactgtgga?gaagagatcc?tgatcacagt?gctgtctgcc?420

atgacagagg?aggcagctgt?tgcaatcaag?gccatggcaa?aa 462

<210>6

<211>606

<212>DNA

＜213〉Rodents

<220>

<221>CDS

<222>(1)...(456)

<400>6

gct?gtg?tat?tat?tgg?gcc?cat?aag?aac?cac?ata?cct?gtg?ctg?agt?cct 48

Ala?Val?Tyr?Tyr?Trp?Ala?His?Lys?Asn?His?Ile?Pro?Val?Leu?Ser?Pro

1 5 10 15

gca?ctc?aca?gac?ggc?tca?ctg?ggt?gac?atg?atc?ttt?ttc?cat?tcc?tat 96

Ala?Leu?Thr?Asp?Gly?Ser?Leu?Gly?Asp?Met?Ile?Phe?Phe?His?Ser?Tyr

20 25 30

aaa?aac?cca?ggc?ttg?gtc?ctg?gac?atc?gtt?gaa?gac?ctg?cgg?ctc?atc 144

Lys?Asn?Pro?Gly?Leu?Val?Leu?Asp?Ile?Val?Glu?Asp?Leu?Arg?Leu?Ile

35 40 45

aac?atg?cag?gcc?att?ttc?gcc?aag?cgc?act?ggg?atg?atc?atc?ctg?ggt 192

Asn?Met?Gln?Ala?Ile?Phe?Ala?Lys?Arg?Thr?Gly?Met?Ile?Ile?Leu?Gly

50 55 60

gga?ggc?gtg?gtc?aag?cac?cac?atc?gcc?aat?gct?aac?ctc?atg?cgg?aat 240

Gly?Gly?Val?Val?Lys?His?His?Ile?Ala?Asn?Ala?Asn?Leu?Met?Arg?Asn

65 70 75 80

gga?gct?gac?tac?gct?gtt?tat?atc?aac?aca?gcc?cag?gag?ttt?gat?ggc 288

Gly?Ala?Asp?Tyr?Ala?Val?Tyr?Ile?Asn?Thr?Ala?Gln?Glu?Phe?Asp?Gly

85 90 95

tca?gac?tca?gga?gcc?cgg?cca?gat?gag?gct?gtc?tcc?tgg?ggc?aag?atc 336

Ser?Asp?Ser?Gly?Ala?Arg?Pro?Asp?Glu?Ala?Val?Ser?Trp?Gly?Lys?Ile

100 105 110

cgg?atg?gat?gca?cag?cca?gta?aag?gtc?tat?gct?gat?gca?tct?ctg?gtt 384

Arg?Met?Asp?Ala?Gln?Pro?Val?Lys?Val?Tyr?Ala?Asp?Ala?Ser?Leu?Val

115 120 125

ttc?ccc?ttg?ctg?gtg?gct?gag?aca?ttc?gcc?caa?aag?gca?gat?gcc?ttc 432

Phe?Pro?Leu?Leu?Val?Ala?Glu?Thr?Phe?Ala?Gln?Lys?Ala?Asp?Ala?Phe

130 135 140

aga?gct?gag?aag?aat?gag?gac?tga?gcagatgggt?aaagacggag?gcttctgcca 486

Arg?Ala?Glu?Lys?Asn?Glu?Asp *

145 150

cacctttatt?tattatttgc?ataccaaccc?ctcctgggcc?ctctccttgg?tcagcagcat 546

cttgagaata?aatggccttt?ttgttggttt?ctgtaaaaaa?aggactttaa?aaaaaaaaaa 606

<210>7

<211>151

<212>PRT

＜213〉Rodents

<400>7

Ala?Val?Tyr?Tyr?Trp?Ala?His?Lys?Asn?His?Ile?Pro?Val?Leu?Ser?Pro

1 5 10 15

Ala?Leu?Thr?Asp?Gly?Ser?Leu?Gly?Asp?Met?Ile?Phe?Phe?His?Ser?Tyr

20 25 30

Lys?Asn?Pro?Gly?Leu?Val?Leu?Asp?Ile?Val?Glu?Asp?Leu?Arg?Leu?Ile

35 40 45

Asn?Met?Gln?Ala?Ile?Phe?Ala?Lys?Arg?Thr?Gly?Met?Ile?Ile?Leu?Gly

50 55 60

Gly?Gly?Val?Val?Lys?His?His?Ile?Ala?Asn?Ala?Asn?Leu?Met?Arg?Asn

65 70 75 80

Gly?Ala?Asp?Tyr?Ala?Val?Tyr?Ile?Asn?Thr?Ala?Gln?Glu?Phe?Asp?Gly

85 90 95

Ser?Asp?Ser?Gly?Ala?Arg?Pro?Asp?Glu?Ala?Val?Ser?Trp?Gly?Lys?Ile

100 105 110

Arg?Met?Asp?Ala?Gln?Pro?Val?Lys?Val?Tyr?Ala?Asp?Ala?Ser?Leu?Val

115 120 125

Phe?Pro?Leu?Leu?Val?Ala?Glu?Thr?Phe?Ala?Gln?Lys?Ala?Asp?Ala?Phe

130 135 140

Arg?Ala?Glu?Lys?Asn?Glu?Asp

145 150

<210>8

<211>453

<212>DNA

＜213〉people (Homo sapiens)

<400>8

tccgtgtatt?actgggccca?gaagaaccac?atccctgtgt?ttagtcccgc?acttacagac?60

ggctcgctgg?gcgacatgat?cttcttccat?tcctacaaga?acccgggcct?ggtcctggac?120

atcgttgagg?acctgaggct?catcaacaca?caggccatct?ttgccaagtg?cactgggatg?180

atcattctgg?gcgggggcgt?ggtcaagcac?cacattgcca?atgccaacct?catgcggaac?240

ggggccgact?acgctgttta?catcaacaca?gcccaggagt?ttgatggctc?tgactcaggt?300

gcccgaccag?acgaggctgt?ctcctggggc?aagatccggg?tggatgcaca?gcccgtcaag?360

gtctatgctg?acgcctccct?ggtcttcccc?ctgcttgtgg?ctgaaacctt?tgcccagaag?420

atggatgcct?tcatgcatga?gaagaacgag?gac 453

<210>9

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<221>misc_feature

<222>(1)...(20)

＜223〉n=A, T, C or G

<400>9

tcsaarachg?gnaagcaygg 20

<210>10

<211>42

<212>DNA

＜213〉Rodents

<220>

＜223〉primer

<400>10

gcgaagcttc?catggctcga?gttttttttt?tttttttttt?tt 42

<210>11

<211>972

<212>DNA

＜213〉Rodents

<220>

<221>CDS

<222>(1)...(330)

<400>11

tcg?aag?acc?ggt?aag?cac?ggc?cat?gcc?aag?gtc?cat?ctg?gtt?ggt?att 48

Ser?Lys?Thr?Gly?Lys?His?Gly?His?Ala?Lys?Val?His?Leu?Val?Gly?Ile

1 5 10 15

gat?att?ttt?act?ggg?aag?aaa?tat?gaa?gat?atc?tgc?ccg?tcg?act?cat 96

Asp?Ile?Phe?Thr?Gly?Lys?Lys?Tyr?Glu?Asp?Ile?Cys?Pro?Ser?Thr?His

20 25 30

aac?atg?gat?gtc?ccc?aac?atc?aaa?agg?aat?gat?ttc?cag?ctg?att?ggc 144

Asn?Met?Asp?Val?Pro?Asn?Ile?Lys?Arg?Asn?Asp?Phe?Gln?Leu?Ile?Gly

35 40 45

atc?cag?gat?ggg?tac?cta?tcc?ctg?ctc?cag?gac?agt?ggg?gag?gta?cga 192

Ile?Gln?Asp?Gly?Tyr?Leu?Ser?Leu?Leu?Gln?Asp?Ser?Gly?Glu?Val?Arg

50 55 60

gag?gac?ctt?cgt?ctg?cct?gag?gga?gac?ctt?ggc?aag?gag?att?gag?cag 240

Glu?Asp?Leu?Arg?Leu?Pro?Glu?Gly?Asp?Leu?Gly?Lye?Glu?Ile?Glu?Gln

65 70 75 80

aag?tat?gac?tgt?gga?gaa?gag?atc?ctg?atc?aca?gtg?ctg?tcc?gcc?atg 288

Lys?Tyr?Asp?Cys?Gly?Glu?Glu?Ile?Leu?Ile?Thr?Val?Leu?Ser?Ala?Met

85 90 95

aca?gag?gag?gca?gct?gtt?gca?atc?aag?gcc?atg?gca?aaa?taa 330

Thr?Glu?Glu?Ala?Ala?Val?Ala?Ile?Lys?Ala?Met?Ala?Lys *

100 105

ctggcttcca?gggtggcggt?ggtggcagca?gtgatccatg?agcctacaga?ggcccctccc?390

ccagctctgg?ctgggccctt?ggctggactc?ctatccaatt?tatttgacgt?tttattttgg?450

ttttcctcac?cccttcaaac?tgtcggggag?accctgccct?tcacctagct?cccttggcca?510

ggcatgaggg?agccatggcc?ttggtgaagc?tacctgcctc?ttctctcgca?gccctgatgg?570

gggaaaggga?gtgggtactg?cctgtggttt?aggttcccct?ctcccttttt?ctttttaatt?630

caatttggaa?tcagaaagct?gtggattctg?gcaaatggtc?ttgtgtcctt?tatcccactc?690

aaacccatct?ggtcccctgt?tctccatagt?ccttcacccc?caagcaccac?tgacagactg?750

gggaccagcc?cccttccctg?cctgtgtctc?ttcccaaacc?cctctatagg?ggtgacaaga?810

agaggagggg?gggaggggac?acgatccctc?ctcaggcatc?tgggaaggcc?ttgcccccat?870

gggctttacc?ctttcctgtg?ggctttctcc?ctgacacatt?tgttaaaaat?caaacctgaa?930

taaaactaca?agtttaatat?gaaaaaaaaa?aaaaaaaaaa?aa 972

<210>12

<211>109

<212>PRT

＜213〉Rodents

<400>12

Ser?Lys?Thr?Gly?Lys?His?Gly?His?Ala?Lys?Val?His?Leu?Val?Gly?Ile

1 5 10 15

Asp?Ile?Phe?Thr?Gly?Lys?Lys?Tyr?Glu?Asp?Ile?Cys?Pro?Ser?Thr?His

20 25 30

Asn?Met?Asp?Val?Pro?Asn?Ile?Lys?Arg?Asn?Asp?Phe?Gln?Leu?Ile?Gly

35 40 45

Ile?Gln?Asp?Gly?Tyr?Leu?Ser?Leu?Leu?Gln?Asp?Ser?Gly?Glu?Val?Arg

50 55 60

Glu?Asp?Leu?Arg?Leu?Pro?Glu?Gly?Asp?Leu?Gly?Lys?Glu?Ile?Glu?Gln

65 70 75 80

Lys?Tyr?Asp?Cys?Gly?Glu?Glu?Ile?Leu?Ile?Thr?Val?Leu?Ser?Ala?Met

85 90 95

Thr?Glu?Glu?Ala?Ala?Val?Ala?Ile?Lys?Ala?Met?Ala?Lys

100 105

<210>13

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>13

caggtctaga?gttggaatcg?aagc 24

<210>14

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>14

atatctcgag?ccttgattgc?aacagctgcc 30

<210>15

<211>489

<212>DNA

＜213〉Rodents

<220>

<221>CDS

<222>(33)...(485)

<400>15

caggtctaga?gttggaatcg?aagcctctta?aa?atg?gca?gat?gat?ttg?gac?ttc 53

Met?Ala?Asp?Asp?Leu?Asp?Phe

1 5

gag?aca?gga?gat?gca?ggg?gcc?tca?gcc?acc?ttc?cca?atg?cag?tgc?tca 101

Glu?Thr?Gly?Asp?Ala?Gly?Ala?Ser?Ala?Thr?Phe?Pro?Met?Gln?Cys?Ser

10 15 20

gca?tta?cgt?aag?aat?ggt?ttt?gtg?gtg?ctc?aag?ggc?cgg?cca?tgt?aag 149

Ala?Leu?Arg?Lys?Asn?Gly?Phe?Val?Val?Leu?Lys?Gly?Arg?Pro?Cys?Lys

25 30 35

atc?gtc?gag?atg?tct?act?tcg?aag?act?ggc?aag?cat?ggc?cat?gcc?aag 197

Ile?Val?Glu?Met?Ser?Thr?Ser?Lys?Thr?Gly?Lys?His?Gly?His?Ala?Lys

40 45 50 55

gtc?cat?ctg?gtt?ggt?att?gat?att?ttt?act?ggg?aag?aaa?tat?gaa?gat 245

Val?His?Leu?Val?Gly?Ile?Asp?Ile?Phe?Thr?Gly?Lys?Lys?Tyr?Glu?Asp

60 65 70

atc?tgc?ccg?tcg?act?cat?aac?atg?gat?gtc?ccc?aac?atc?aaa?agg?aat 293

Ile?Cys?Pro?Ser?Thr?His?Asn?Met?Asp?Val?Pro?Asn?Ile?Lys?Arg?Asn

75 80 85

gat?ttc?cag?ctg?att?ggc?atc?cag?gat?ggg?tac?cta?tcc?ctg?ctc?cag 341

Asp?Phe?Gln?Leu?Ile?Gly?Ile?Gln?Asp?Gly?Tyr?Leu?Ser?Leu?Leu?Gln

90 95 100

gac?agt?ggg?gag?gta?cga?gag?gac?ctt?cgt?ctg?cct?gag?gga?gac?ctt 389

Asp?Ser?Gly?Glu?Val?Arg?Glu?Asp?Leu?Arg?Leu?Pro?Glu?Gly?Asp?Leu

105 110 115

ggc?aag?gag?att?gag?cag?aag?tat?gac?tgt?gga?gaa?gag?atc?ctg?atc 437

Gly?Lys?Glu?Ile?Glu?Gln?Lys?Tyr?Asp?Cys?Gly?Glu?Glu?ITe?Leu?Ile

120 125 130 135

aca?gtg?ctg?tcc?gcc?atg?aca?gag?gag?gca?gct?gtt?gca?atc?aag?gct 485

Thr?Val?Leu?Ser?Ala?Met?Thr?Glu?Glu?Ala?Ala?Val?Ala?Ile?Lys?Ala

140 145 150

cgag 489

<210>16

<211>151

<212>PRT

＜213〉artificial sequence

<400>16

Met?Ala?Asp?Asp?Leu?Asp?Phe?Glu?Thr?Gly?Asp?Ala?Gly?Ala?Ser?Ala

1 5 10 15

Thr?Phe?Pro?Met?Gln?Cys?Ser?Ala?Leu?Arg?Lys?Asn?Gly?Phe?Val?Val

20 25 30

Leu?Lys?Gly?Arg?Pro?Cys?Lys?Ile?Val?Glu?Met?Ser?Thr?Ser?Lys?Thr

35 40 45

Gly?Lys?His?Gly?His?Ala?Lys?Val?His?Leu?Val?Gly?Ile?Asp?Ile?Phe

50 55 60

Thr?Gly?Lys?Lys?Tyr?Glu?Asp?Ile?Cys?Pro?Ser?Thr?His?Asn?Met?Asp

65 70 75 80

Val?Pro?Asn?Ile?Lys?Arg?Asn?Asp?Phe?Gln?Leu?Ile?Gly?Ile?Gln?Asp

85 90 95

Gly?Tyr?Leu?Ser?Leu?Leu?Gln?Asp?Ser?Gly?Glu?Val?Arg?Glu?Asp?Leu

100 105 110

Arg?Leu?Pro?Glu?Gly?Asp?Leu?Gly?Lys?Glu?Ile?Glu?Gln?Lys?Tyr?Asp

115 120 125

Cys?Gly?Glu?Glu?Ile?Leu?Ile?Thr?Val?Leu?Ser?Ala?Met?Thr?Glu?Glu

130 135 140

Ala?Ala?Val?Ala?Ile?Lys?Ala

145 150

<210>17

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>17

gtctgtgtat?tattgggccc 20

<210>18

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer

<400>18

gccaagctta?atggcagatg?atttgg 26

<210>19

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>19

ttgaaggggt?gaggaaaa 18

<210>20

<211>15

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>20

ttgagtggga?taaag 15

<210>21

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>21

aatcatctgc?cattttaa 18

<210>22

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>22

ctgaattcca?gttattttgc?catgg 25

<210>23

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>23

aatgaattcc?gccatgacag?aggaggc 27

<210>24

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>24

aaactaccat?ctcccctgcc 20

<210>25

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>25

tgccctacac?aggctgaaaG 20

<210>26

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>26

atcaagcttg?cccaccatgg?cagacg 26

<210>27

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>27

aacgaattcc?atgcctgatG?tttccg 26

<210>28

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>28

tccgaattcg?tacttctgct?caatc 25

Claims (63)

1. isolating nucleic acid comprises the nucleotide sequence of coding rat apoptosis-specific eIF-5A polypeptide.

2. isolating nucleic acid as claimed in claim 1, wherein, described nucleotide sequence comprises SEQID NO:1.

3. isolating nucleic acid as claimed in claim 1, wherein, described nucleotide sequence can be hybridized with the complement of SEQ ID NO:1 under high stringent condition.

4. isolating nucleic acid as claimed in claim 1, wherein, described nucleotide sequence coded SEQID N0:2.

5. the polypeptide of a purification comprises rat apoptosis-specific eIF-5A amino acid sequence of polypeptide.

6. isolating nucleic acid as claimed in claim 5, wherein, described aminoacid sequence comprises SEQID NO:2.

7. isolating nucleic acid comprises the nucleotide sequence of coding rat apoptosis-specific DHS polypeptide.

8. isolating nucleic acid as claimed in claim 7, wherein, described nucleotide sequence comprises SEQID NO:6.

9. isolating nucleic acid as claimed in claim 7, wherein, described nucleotide sequence can be hybridized with the complement of SEQ ID NO:6 under high stringent condition.

10. isolating nucleic acid as claimed in claim 7, wherein, described nucleotide sequence coded SEQID NO:7.

11. the polypeptide of a purification comprises rat apoptosis-specific DHS amino acid sequence of polypeptide.

12. as the purified polypeptide of claim 11, wherein, described aminoacid sequence comprises SEQID NO:7.

13. a method of regulating the apoptosis of cell comprises to described cell and uses the reagent that can regulate apoptosis-specific eIF-5A function.

14. as the method for claim 13, wherein, described reagent can suppress apoptosis-specific eIF-5A function, thereby suppresses apoptosis.

15. as the method for claim 14, wherein, described reagent is antisense oligonucleotide.

16. as the method for claim 15, wherein, described antisense oligonucleotide comprises the nucleotide sequence of the part of coding apoptosis-specific eIF-5A polypeptide.

17. as the method for claim 16, wherein, described antisense oligonucleotide comprises SEQ IDNO:19,20, or 21.

18. as the method for claim 15, wherein, described antisense oligonucleotide comprises the nucleotide sequence of the part of coding apoptosis-specific DHS polypeptide.

19. as the method for claim 15, wherein, described reagent is the chemical substance or the medicine that can suppress apoptosis-specific eIF-5A function.

20. as the method for claim 13, wherein, described reagent can suppress apoptosis-specific DHS function, thereby suppresses apoptosis.

21. as the method for claim 20, wherein, described reagent is antisense oligonucleotide.

22. as the method for claim 21, wherein, described antisense oligonucleotide comprises the nucleotide sequence of the part of coding apoptosis-specific eIF-5A polypeptide.

23. as the method for claim 22, wherein, described nucleotide sequence comprises SEQ ID NO:19,20, or 21.

24. as the method for claim 21, wherein, described antisense oligonucleotide comprises the nucleotide sequence of the part of coding apoptosis-specific DHS polypeptide.

25. as the method for claim 20, wherein, described reagent is the chemical substance or the medicine that can suppress apoptosis-specific DHS function.

26. as the method for claim 13, wherein, described reagent can strengthen apoptosis-specific eIF-5A function, thereby induces the apoptosis of described cell.

27. as the method for claim 26, wherein, described reagent comprises expression vector.

28. as the method for claim 27, wherein, described expression vector comprises the promoter sequence that operationally is connected with the nucleotide sequence of coding apoptosis-specific eIF-5A polypeptide.

29. as the method for claim 27, wherein, described expression vector comprises the promoter sequence that operationally is connected with the nucleotide sequence of coding apoptosis-specific DHS polypeptide.

30. as the method for claim 13, wherein, described reagent can strengthen apoptosis-specific DHS function, thereby induces the apoptosis of described cell.

31. as the method for claim 30, wherein, described reagent comprises expression vector.

32. as the method for claim 31, wherein, described expression vector comprises the promoter sequence that operationally is connected with the nucleotide sequence of coding apoptosis-specific eIF-5A polypeptide.

33. as the method for claim 31, wherein, described expression vector comprises the promoter sequence that operationally is connected with the nucleotide sequence of coding apoptosis-specific DHS polypeptide.

34. as the method for claim 13, wherein, described cell comprises in animal body.

35., wherein, use described reagent for described animal as the method for claim 34.

36. a method of regulating the apoptosis of cell comprises to described cell and uses the reagent that can regulate apoptosis-specific DHS function.

37. as the method for claim 36, wherein, described reagent can suppress apoptosis-specific DHS function, thereby suppresses apoptosis.

38. as the method for claim 37, wherein, described reagent is antisense oligonucleotide.

39. as the method for claim 38, wherein, described antisense oligonucleotide comprises the nucleotide sequence of the part of coding apoptosis-specific eIF-5A polypeptide.

40. as the method for claim 39, wherein, described antisense oligonucleotide comprises SEQ IDNO:19,20, or 21.

41. as the method for claim 38, wherein, described antisense oligonucleotide comprises the nucleotide sequence of the part of coding apoptosis-specific DHS polypeptide.

42. as the method for claim 37, wherein, described reagent is the chemical substance or the medicine that can suppress apoptosis-specific eIF-5A function.

43. as the method for claim 36, wherein, described reagent can suppress apoptosis-specific DHS function, thereby suppresses apoptosis.

44. as the method for claim 44, wherein, described reagent is antisense oligonucleotide.

45. as the method for claim 45, wherein, described antisense oligonucleotide comprises the nucleotide sequence of the part of coding apoptosis-specific eIF-5A polypeptide.

46. as the method for claim 45, wherein, described antisense oligonucleotide comprises the nucleotide sequence of the part of coding apoptosis-specific DHS polypeptide.

47. as the method for claim 44, wherein, described reagent is the chemical substance or the medicine that can suppress apoptosis-specific DHS function.

48. as the method for claim 36, wherein, described reagent can strengthen apoptosis-specific eIF-5A function, thereby induces the apoptosis of described cell.

49. as the method for claim 48, wherein, described reagent comprises expression vector.

50. as the method for claim 49, wherein, described expression vector comprises the promoter sequence that operationally is connected with the nucleotide sequence of coding apoptosis-specific eIF-5A polypeptide.

51. as the method for claim 49, wherein, described expression vector comprises the promoter sequence that operationally is connected with the nucleotide sequence of coding apoptosis-specific DHS polypeptide.

52. as the method for claim 36, wherein, described reagent can strengthen apoptosis-specific DHS function, thereby induces the apoptosis of described cell.

53. as the method for claim 52, wherein, described reagent comprises expression vector.

54. as the method for claim 53, wherein, described expression vector comprises the promoter sequence that operationally is connected with the nucleotide sequence of coding apoptosis-specific eIF-5A polypeptide.

55. as the method for claim 53, wherein, described expression vector comprises the promoter sequence that operationally is connected with the nucleotide sequence of coding apoptosis-specific DHS polypeptide.

56. as the method for claim 36, wherein, described cell comprises in animal body.

57., wherein, use described reagent for described animal as the method for claim 56.

58. an antisense oligonucleotide comprises the nucleotide sequence of the part of coding apoptosis-specific eIF-5A polypeptide.

59. as the antisense oligonucleotide of claim 58, wherein, described nucleotide sequence comprises SEQ ID NO:19,20, or 21.

60. an antisense oligonucleotide comprises the nucleotide sequence of the part of coding apoptosis-specific DHS polypeptide.

61. an expression vector comprises the promoter that operationally is connected with the nucleotide sequence of coding apoptosis-specific eIF-5A polypeptide.

62. an expression vector comprises the promoter that operationally is connected with the nucleotide sequence of coding apoptosis-specific DHS polypeptide.

63. a method of identifying the adjusting of apoptosis comprises:

(i) provide test cell;

(ii) allow described test cell contact with drug candidates; With

(iii) be determined under the situation that has described drug candidates, whether the ratio of proliferative eIF-5A and apoptosis-specific eIF-5A changes in the described test cell,

Wherein, the change of the ratio of proliferative eIF-5A and apoptosis-specific eIF-5A is the index that apoptosis is regulated.

Images