JP2005518811A - A method for determining genome-wide sequence changes associated with a phenotype - Google Patents

Abstract

The present invention provides a method for determining genome-wide sequence changes associated with a species phenotype in a non-hypothetical manner. In the method of the present invention, a set of restriction fragments for each subpopulation of individuals having a phenotype is created by digesting nucleic acids from the individual using one or more different restriction enzymes. A set of restriction sequence tags for the individual is then determined from such a set of restriction fragments. Restriction sequence tags for a sub-population of organisms are compared and grouped into one or more groups, each group containing restriction sequence tags that contain homologous sequences. The resulting group of one or more restriction sequence tags identifies sequence changes associated with the phenotype. The methods of the invention can be used to analyze a large number of sequence variants in many patient samples, for example, to identify subtle genetic risk factors.

Description

Field of Invention

  The present invention relates to a method for determining genome-wide sequence changes associated with a phenotype in a population of species organisms in a non-hypothetical manner. The present invention also relates to a method for generating genome-wide restriction sequence tags for an organism.

Background of the Invention

  Molecular methods for genetic analysis identify nucleotide sequence changes that occur naturally and randomly in the genome of an organism. Knowledge of DNA polymorphism between individuals and between populations is important in understanding the complex association between genotype changes and phenotype changes. In the absence of complete data about sequence changes, those skilled in the art rely on being able to identify “near” markers that make it possible to estimate the location of certain related loci or causative sequence changes. Whether such markers provide information depends on the magnitude of the linkage disequilibrium. Various markers can be used in linkage studies to look for candidate genes and in related studies to identify functional allelic changes in candidate genes that affect changes between individuals.

  In order to correlate adverse responses to drug treatment and susceptibility to disease with an individual's genomic organization, it is necessary to monitor differences in the genome between individuals. Current methods include monitoring a large set of genetic markers, eg, thousands of single nucleotide polymorphisms (SNPs) that spread uniformly throughout the genome. These SNPs are monitored in individuals from the control population, and in individuals in affected populations, or more generally in populations with a given phenotype. Linkage disequilibrium between these two populations for a given SNP is then used as a measure for the physical proximity on the genome between the SNPs and the genomic region involved in drug response or disease susceptibility Is done.

SNPs are the most common form of genetic polymorphism. This, along with their potential as a functional variant, is a major pharmacogenetic indicator and as a marker for mapping genes for complex diseases, both in SNPs. (Rish et al., 1996, Science, 273: 1516-7; Kruglyak, 1997, Nat. Genet. 17: 21-4; Masood, 1999, Nature, 398: 545-6). A very large number of SNPs have already been identified, and more than 2,500,000 SNPs have been registered in the NCBI SNP database alone ( http://www.ncbi.nlm.nih.gov/SNP/ ). Many recent studies have focused on identifying polymorphisms present in the coding sequences of potential candidate genes associated with common diseases (Nickerson et al., Nat. Genet., 1998, 19: 233). -240; Cambien et al., 1999, Am. J. Hum. Genet., 65: 183-91; Risch et al., 1996, Science, 273: 1516-7; Kruglyak, 1997, Nat. Genet. Masood, 1999, Nature, 398: 545-6; Cargill et al., 1999, Nat. Genet., 22: 231-238; Halushka et al., 1999, Nat. Genet., 22: 239-247).

  In the current state of the art, SNPs must first be discovered by intensively re-sequencing the majority of the genomes of individuals belonging to a well-selected control population of around 100 people. The most common difference found is a candidate for SNPs. This method is very time consuming and expensive and the results depend on the choice of control population.

  Once a SNP has been identified, a method must be developed that allows a large number of SNPs in an individual to be scored quickly and cost effectively. In the current state of the art, most methods used to score SNPs rely on amplification by PCR (or alternative DNA amplification methods) of a small region surrounding the SNP. This amplification step requires knowledge of the region surrounding the SNP and the use of specific and custom nucleic acid primers for each SNP. Amplifying a large number of different DNA sequences simultaneously is a tedious and expensive process requiring sophisticated and expensive robotics and large amounts of expensive reaction reagents.

  The ability to quickly and accurately genotype this abundant source of change is becoming an even more important goal in the field of genetics (Bonn, D., 1999, Lancet, 353: 1684). Various available techniques may be transferred to laboratories performing high-throughput genotyping (Landegren et al., 1998, Genome Research, 8: 769-776). These include 5 ′ exonuclease assays such as TaqMan (Lyvak et al., 1995, Nature Genet., 9: 341-342), molecular beacons (Tyagi et al., 1998, Nat. Biotechnol., 16: 49-53), Oligonucleotide Ligation Assay (OLA) (Tobe et al., 1996, Nucleic Acids Res., 24: 3738-3732), Dye Labeled Oligonucleotide Ligation (DOL) (Chen et al., 1998, Genomes Res., 8: 549- 556), minisequencing (Chen et al., 1997, Nucleic Acids res., 25: 347-353; Pastinen et al., 1997, Genome Res., 7: 606-614), microarray technology Hacia et al., 1998, Genome Res., 8: 1245-1258; Wang et al., 1998, Science, 280: 1077-1082), and scorpion assays (Whitcombe et al., 1999, Nat. Biotechnol., 17: 804-807) and the like. Is included.

  There are two major problems with these existing methods. One is that SNPs must be identified and arbitrarily selected prior to scoring, and the other is that a large number of different DNA products must be generated by specific amplification. That is not to be. Therefore, the present inventors have designed a method that specifically avoids these two problems.

  In the current state of the art, existing methods do not meet the demands of the pharmaceutical industry. Besides the pharmaceutical industry, many other fields such as medical research, health care, veterinary medicine, agriculture, food, cosmetics and many other industries and fields are the same based on various associations and / or various organisms Has attracted attention using the method. Therefore, new methods are needed to obtain sufficient utilization for a large number of genetic changes in organisms with low cost, very high throughput and high accuracy.

  Therefore, a very large number in many patient samples to identify subtle genetic risk factors that are not detected by current genomic scans due to the use of fewer markers, limited sample sizes, and / or pooled samples There is a need for more efficient methods for analyzing the sequence variants of. Accordingly, it is an object of the present invention to provide a more efficient method for detecting nucleic acid changes. It is also an object of the present invention to provide a more efficient sequencing method.

  Any discussion or citation of a reference herein shall not be construed as an admission that such reference is prior art to the present invention.

Summary of the Invention

The present invention provides a method for determining genome-wide sequence changes associated with a species phenotype, preferably in a non-hypothetical manner. In one embodiment, changes across the genome are determined from a subpopulation of individuals having a particular phenotype. In the methods of the invention, a set of restriction fragments for each individual in a subpopulation of individuals having a phenotype is created by digesting nucleic acid from the individual using one or more different restriction enzymes. Preferably, such a set of restriction fragments comprises a sufficient number of different restriction fragments to make it possible to identify sequence changes in the genome of the organism. More preferably, such a set of restriction fragments, at least 10, 100, 1000, 10 ^4, 10 ^5, 10 ^6, 10 ⁷ or 10 ⁸ different restriction fragment.

  A set of restriction sequence tags is then determined for each individual from such a set of restriction fragments of the individual. In the methods of the invention, a set of restriction sequence tags for individuals in a subpopulation having a particular phenotype is preferably a set of restriction fragments of the individual (eg, a set of restrictions derived from the individual's genomic DNA). Fragment) and then sequencing each portion of the restriction fragment using a method involving the generation of DNA colonies (described below).

  The various sets of restriction sequence tags obtained for different individuals in the subpopulation are then preferably compared and grouped into one or more groups, each of which includes restriction sequence tags that contain homologous sequences. Is done. The comparison preferably allows the number or frequency of each group of restriction sequence tags to be determined. A collection of restriction tags that are homologous to a subpopulation can be used to identify sequence changes associated with the phenotype. In a preferred embodiment, the restriction sequence tag is compared to the genome sequence of the organism to identify the genomic location of the restriction sequence tag. In another preferred embodiment, restriction sequence tags flanking the recognition site are also identified from the genome sequence of the organism.

Detailed Description of the Invention

  The present invention provides a method for determining genome-wide sequence changes associated with a species phenotype (see, eg, FIG. 1). The present invention uses a hypothesis, at least in part, by obtaining and comparing a sufficiently large number of sequence tags whose sequence changes associated with the phenotype are derived from genomic DNA or cDNA of individuals with the phenotype. Based on the discovery that it can be determined without For example, changes across the genome can be determined from a subpopulation of individuals with a particular phenotype (eg, individuals belonging to a particular tribe, variant, species, genus, family, etc. that have the same phenotypic characteristics) . Changes across the genome can also be determined from, for example, a healthy individual, an individual with a particular disease, or an individual susceptible to a particular disease, or a subpopulation of individuals at a particular developmental stage.

  In the methods of the present invention, a set of restriction fragments for each member of a subpopulation of individuals having a phenotype is created by digesting nucleic acids from the individual using one or more different restriction enzymes. As used herein, a set of restriction fragments can include one or more restriction fragments. A set of restriction sequence tags for the individual is then determined from such a set of restriction fragments. Restriction sequence tags for a subpopulation of organisms are compared and grouped into one or more groups, each of which includes restriction sequence tags that contain homologous sequences. In one embodiment, a group of restriction tags consists of restriction tags that are at least 60%, 70%, 80%, 90% or 99% homologous. In another embodiment, a group of restriction tags consists of restriction tags with 100% homology. The resulting group of one or more restriction sequence tags can be used to identify sequence changes associated with the phenotype. In preferred embodiments, the phenotype being investigated is related to the rate or combination of sequence changes. The present invention also provides a method for determining genome-wide sequence changes between multiple phenotypes by comparing restriction sequence tags of various different phenotypes. The method of the present invention can be applied to any species of organism. The method of the present invention is particularly useful for higher eukaryotes having a complex genome, for example, higher animals including humans, plants, and the like, but is not limited thereto. In particular, the methods of the invention are useful for analyzing and identifying sequence changes associated with disease susceptibility or response to therapy in humans.

  The methods of the invention can be used to identify polymorphisms in a species' genome from restriction sequence tags. The method of the present invention provides several advantages when compared to existing methods: i) no need to find a large set of polymorphisms before starting a correlation study, ii) There is no need to select a limited set of polymorphisms before starting a correlation study, iii) no need to use prior knowledge of any sequence, iv) synthesis of a large set of different oligonucleotides V) it is not necessary to perform a very large number of specific amplification steps, vi) the number of polymorphisms used in the study is easily increased by using a very large number of different restriction enzymes Vii) The entire procedure is performed by manipulating only one physical sample, whereas in other methods the number of physical samples is the number of polymorphs analyzed. At least one step proportional to That is, there is an amplification step, viii) it is not necessary to pool a sample of the population because each individual can be analyzed; ix) sequence changes that are present at a very low frequency in the population can be identified; x ) Analysis costs are orders of magnitude lower than current genotyping methods.

  In the description and examples below, a number of terms are used herein. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given to such terms, the following definitions are provided.

  The term “genomic region” refers to a portion of a genome that contains one or more sequence changes identified by comparing samples from a population of individuals using the methods of the invention.

  The term “nucleic acid” refers to at least two nucleotides covalently linked. The nucleic acids of the invention can contain phosphodiester bonds. The nucleic acids of the present invention also include, for example, phosphoramide linkages (see, eg, Beaucage et al., 1993, Tetrahedron, 49, 1925; which is incorporated herein by reference in its entirety), phosphorothioate linkages (See, eg, Mag et al., 1991, Nucleic Acids Res., 19: 1437; US Pat. No. 5,644,048, each of which is incorporated herein by reference in its entirety). Phosphorodithioate linkages (see Briu et al. (1989), J. Am. Chem. Soc., 111: 2321), O-methyl phosphoramidite linkages (eg, Eckstein, Oligonucleotides and Analogues: A Practical A proach (see Oxford University Press), and peptide nucleic acid backbones and linkages (eg, Egholm (1992), J. Am. Chem. Soc., 114: 1895; Nielsen (1993), Nature, 365: 566). All of which may be nucleic acid analogs with backbones that include (incorporated herein by reference in their entirety). For other nucleic acid analogs, see nucleic acid analogs having a positively charged backbone (see, eg, Denpcy et al. (1995), Proc. Natl. Acad. Sci. USA, 92: 6097; this is incorporated by reference in its entirety. Incorporated into the specification), nucleic acid analogs having a nonionic backbone (US Pat. Nos. 5,386,023, 5,637,684, 5,602,240, 5,216) 141, and 4,469,863, each of which is incorporated herein by reference in its entirety, and nucleic acid analogs having a non-ribose backbone (see US Pat. 235,033 and 5,034,506, each of which is incorporated herein by reference in its entirety. Includes Included) it is. Nucleic acids containing one or more carbocyclic sugars are also included in the definition of nucleic acids (eg, Jenkins et al. (1995), Chem. Soc. Rev., pages 169-176; this is incorporated by reference in its entirety) Incorporated herein). Some nucleic acid analogs are also described in Rawls, C & E News, June 2, 1997, page 3, which is incorporated herein by reference in its entirety. These modifications of the ribose-phosphate backbone are made to facilitate the addition of additional components such as labels, or to increase the stability and half-life of such molecules under physiological conditions. be able to. In addition, mixtures of naturally occurring nucleic acids and analogs can be made. Alternatively, mixtures of different nucleic acid analogs, as well as mixtures of naturally occurring nucleic acids and analogs can be made. Those of skill in the art understand how to select the appropriate analog used in various embodiments of the present invention. For example, natural nucleic acids are preferred when digesting with restriction enzymes. Nucleic acids can be single stranded or double stranded, as defined, or can contain portions of both single stranded or double stranded sequences. The nucleic acid can be DNA (eg, genomic DNA, cDNA), RNA, or hybrid, where the nucleic acid includes any combination of deoxyribonucleotides and ribonucleotides, and includes uracil, adenine, thymine, cytosine, guanine, Includes any combination of bases including inosine, xanthine, hypoxanthine, isocytosine, isoguanine and the like.

  The term “oligonucleotide” as used herein refers to the normal manner of monomer-to-monomer interaction, eg, Watson-Crick type base pairing, base stacking, Hoogsteen type. Or natural or modified monomers or linear linear oligomers that can specifically bind to the target polynucleotide, such as by reverse Hoogsteen-type base pairing (deoxyribonucleotides, ribonucleotides, etc. Including). Preferably, the monomers are linked by phosphodiester bonds or analogs thereof, and oligonucleotides ranging in size from several monomer units (eg 3-4) to several tens of monomer units (eg 40-60). Form. When an oligonucleotide is represented by a string such as “ATGCCCTG”, the nucleotides are 5 ′ to 3 ′ in order from left to right, and “A” indicates adenosine unless otherwise indicated. , “C” represents cytidine, “G” represents guanosine, “T” represents thymidine, and “U” represents uridine. The term “nucleotide” refers to “deoxyribonucleotide” or “ribonucleotide”, and “dATP”, “dCTP”, “dGTP”, “dTTP” and “dUTP” represent triphosphate ester derivatives of individual nucleotides. Oligonucleotides usually contain natural nucleotides. However, oligonucleotides can also include non-natural nucleotide analogs. Although oligonucleotides having natural nucleotides or non-natural nucleotides can be used, it will be apparent to those skilled in the art that oligonucleotides consisting of natural nucleotides are preferred, for example when enzymatic treatment is performed.

  The term “polymorphism” indicates that there are two or more alleles in a population. The term “allele” refers to one of several alternative sequence variants at a specific locus. A polymorphism at only one chromosomal location constitutes a genetic marker. The term “SNP” refers to a single nucleotide polymorphism. Preferably, genetic alterations, such as SNPs, are common in populations of organisms and are inherited in a Mendelian manner. Such alleles may have an associated phenotype or may not have an associated phenotype.

  The term “heterozygote” as used herein refers to an individual having different alleles at corresponding loci on homologous chromosomes. Thus, as used herein, the term “heterozygote” describes individuals or strains that have different alleles at one or more paired loci on homologous chromosomes.

  As used herein, the term “homozygote” refers to an individual having the same allele at a corresponding locus on a homologous chromosome. Thus, as used herein, the term “homozygote” describes an individual or strain that has the same allele at one or more paired loci on homologous chromosomes.

  The term “mutation” means a genetic change in the DNA sequence of an organism.

  The term “genotype” is generally known to mean (i) the genetic makeup of an individual or (ii) the type of allele found at a locus in an individual.

  The term “restriction endonuclease” or “restriction enzyme” recognizes a specific base sequence (target site or recognition site) in a double-stranded DNA molecule and is at or near the target site or recognition site. For example, an enzyme that cleaves the DNA molecule within a specific distance from the target site or recognition site.

  The term “restriction site” usually refers to a region between 4 and 8 nucleotides or more than 20 nucleotides within a nucleic acid (preferably a double-stranded nucleic acid) containing a recognition site and / or cleavage site for a restriction endonuclease. However, it is not limited to these. A recognition site corresponds to a sequence in a nucleic acid to which a restriction endonuclease or a group of restriction endonucleases bind. A cleavage site or cut site corresponds to a specific sequence where cleavage by a restriction endonuclease occurs. Depending on the restriction endonuclease, the cleavage site may be present in the recognition site. However, some restriction endonucleases, such as type IIS endonucleases, have a cleavage site that exists outside the recognition site.

  The term “restriction fragment” refers to a DNA molecule that results from digesting a DNA molecule with a restriction endonuclease.

  The term “engineered nucleic acid” or “adapter” refers to a short double-stranded DNA molecule having a predetermined nucleotide sequence. Preferably, the engineered nucleic acid or adapter is 10 base pairs to 500 base pairs in length. More preferably, the engineered nucleic acid or adapter is 10 base pairs to 150 base pairs in length. Preferably, the engineered nucleic acid or adapter is designed in such a way that it can be ligated to the end of a restriction fragment. Such nucleic acids can be designed by those skilled in the art given the sequence at the end of the restriction fragment. Preferably, the engineered nucleic acid comprises a sequence of one or more amplification primers, where each amplification primer is preferably present near one end of the engineered nucleic acid and the end of the molecule Oriented to allow primer extension in the direction toward Amplification primers may be the same or different. Preferably, the engineered nucleic acid also includes a sequence of one or more sequencing primers, wherein each sequencing primer is preferably present near one end of the engineered nucleic acid. And oriented to allow primer extension in the direction towards the end of the molecule. The sequencing primers may be the same or different. In some embodiments, the amplification primer and sequencing primer may be the same. In some embodiments, the engineered nucleic acid can also include one or more restriction sites. Engineered nucleic acids are also referred to in this disclosure as DNA colony vectors.

  The term “ligation” refers to an enzymatic reaction catalyzed by ligase in which two double-stranded DNA molecules are covalently linked. One DNA strand or both DNA strands can be covalently linked. It is also possible to prevent ligation of one of the two strands by chemically and / or enzymatically modifying one of the ends in order to be able to join only one of the two DNA strands.

  The term “solid support” includes any solid surface to which nucleic acids can be bound, such as latex beads, dextran beads, polystyrene, polypropylene surfaces, polyacrylamide gels, gold surfaces, glass surfaces, and silicon wafers. However, it is not limited to these. Preferably, the solid support is a glass surface.

  The term “nucleic acid colony” or “colony” refers to an isolated region on a solid surface containing, for example, multiple copies of a nucleic acid strand. Multiple copies of its complementary strand may also be present in this same colony. Multiple copies of nucleic acid strands constituting a colony are generally immobilized on a solid support and exist in a single-stranded or double-stranded form.

  The term “colony primer” as used herein refers to a nucleic acid molecule that can hybridize to a complementary sequence (hybridization) and includes an oligonucleotide sequence that initiates a specific polymerase reaction. . The sequence containing the colony primer is chosen to have maximal hybridization activity with its complementary sequence and very low non-specific hybridization activity relative to other sequences. The colony primer can be 5 to 100 bases in length, but preferably can be 15 to 25 bases in length. Naturally occurring nucleotides or non-naturally occurring nucleotides can be present in the primer. One or more different colony primers can be used to generate nucleic acid colonies in the methods of the invention.

5.1. Collection and recording of samples from individuals with specific phenotypes The genomic DNA or cDNA of individuals with specific phenotypes can be obtained from samples collected from such individuals. Preferably, a subpopulation of individuals having that phenotype, eg, a subpopulation of individuals belonging to a particular race, variant, species, genus, family, etc. having the same phenotypic characteristics, or a particular condition (eg, healthy A subpopulation of individuals having a condition), an individual having a particular disease, or a subpopulation of individuals at a particular developmental stage. Samples from such subpopulation individuals are collected along with detailed documentation of the phenotypic features associated with that subpopulation. Such careful documentation facilitates the assignment of sequence changes to one or more phenotypes.

5.2. Methods for Generating Restriction Fragments by Restriction Digestion The method of the present invention comprises a genomic DNA or cDNA derived from an organism (eg, genomic DNA extracted from a cell derived from that organism, or a cell derived from that organism). From a set of restriction fragments) from a cDNA prepared from the prepared mRNA). In the present invention, DNA (eg, genomic DNA) can be obtained from an individual (eg, various cells, portions, tissues or organs). In various embodiments of the invention, one or more different restriction enzymes are used simultaneously or separately to generate such a set of restriction fragments, eg, from genomic DNA. Preferably, such a set of restriction fragments comprises a sufficiently large number of different restriction fragments to make it possible to identify sequence changes in the organism's genome. More preferably, such a set of restriction fragments, at least 10, 100, 1000, 10 ^4, 10 ^5, 10 ^6, 10 ⁷ or 10 ⁸ different restriction fragment.

  The nucleic acid molecule (eg, genomic DNA) to be analyzed can be obtained from any source (eg, tissue homogenate, blood, amniotic fluid, villus sample and bacterial culture). Nucleic acid molecules can be obtained from these sources using standard methods known in the art. Preferably, only a trace amount of nucleic acid is required, in which case the nucleic acid can be DNA or RNA (in the case of RNA, a reverse transcription step is required before the PCR step). When molecular biology methods are used in the methods of the invention, they are performed using standard methods (eg, Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, New York, 1989; Sambrook). Et al, Molecular Cloning, Laboratory Manual (3rd edition), Cold Spring Harbor, New York, 2001; Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic H

  Any restriction enzyme known in the art can be used with the present invention. In some embodiments of the invention, a type IIS endonuclease is used in one or more steps. Type IIS endonucleases are generally commercially available and are well known in the art. Type IIS endonucleases recognize specific sequence base pairs within double-stranded polynucleotide sequences. When recognizing such a sequence, the endonuclease cleaves the polynucleotide sequence, which generally causes an overhang, or “sticky end”, of one strand of the sequence. Remain. The type II endonuclease has a palindromic structure as its type II endonuclease recognition site, that is, the base pair sequence recognizes when read in the 5 ′ to 3 ′ direction. Does not require the same for both strands of the site. In addition, type IIS endonucleases also generally cleave outside of their recognition sites. Since cleavage occurs at any polynucleotide sequence location that is a specific base pair away from the recognition site, type IIS endonucleases allow capture of intervening sequences up to the cleavage site in some embodiments of the invention. . Specific type IIs endonucleases useful in the present invention include EarI, MnlI, PleI, AlwI, BbsI, BceAI, BsaI, BsmAI, BspMI, Eco57I, Esp3I, HgaI, SapI, SfaNI, BbvI, BsmFI, FokF, This includes but is not limited to BseRI, HphI, MmeI and MboII. Currently discovered enzymes cleave at most 20 to 25 bases from the recognition site. Enzymes that cleave further from the recognition site, eg, 50 bases or more, 100 bases or more, or 200 bases or more from the recognition site are useful for the present invention.

  In some embodiments of the invention, a combination of a low frequency cutter (rare cutter) and a high frequency cutter (frequent cutter) is used to generate restriction fragments. A rare cutter is a restriction endonuclease having a recognition site consisting of a sequence of more than 4 nucleotides (preferably a sequence of 6 or 8 nucleotides). Examples of commercially available rare cutters include PstI, HpaII, MspI, ClaI, HhaI, EcoRII, BstBI, HinPI, MaeII, BbvI, PvuII, XmaI, SmaI, NciI, AvaI, HaeII, SalI, XhoI and PvI. Among them, PstI, HpaII, MspI, ClaI, HhaI, EcoRII, BstBI, HinPI and MaeII are preferable. A high frequency cutter is a restriction endonuclease with a recognition site for nucleotides of 4 bases or less than 4 bases. Examples of suitable high frequency cutter enzymes include MseI and TaqI.

  In some embodiments of the invention, the restriction fragment is linked to other nucleic acids or to itself at the digestion site. Typically, restriction enzymes are blunt ends (in which case the terminal nucleotides of both strands are base-paired) or sticky ends (in which case one of the two strands protrudes and a short single-stranded extension). Give one part). In some embodiments of the invention, when the restriction enzyme is type IIS, a step comprising modification of the end by converting the overhanging end to a blunt end using a polymerase is preferably added.

5.3. Methods for Determining Restriction Sequence Tags Any method known in the art can be used to determine a set of restriction sequence tags for restriction fragments generated by the method of Section 5.2. Preferably, the restriction fragment is amplified prior to sequencing. However, sequencing methods that do not require amplification (eg, single molecule sequencing, etc.) can also be used without further amplification steps. Preferably, the resulting restriction sequence tag is at least 5 nucleotides in length. More preferably, the resulting restriction sequence tag is in the range of 10-20 nucleotides. Even more preferably, the length of the restriction sequence tag is up to 50 nucleotides.

  Preferably, methods involving the generation and sequencing of DNA colonies are used to determine restriction sequence tags for restriction fragments. Any of the methods known in the art can be used in the present invention (eg PCT International Publication No. 98/44151, PCT International Publication No. 98/44152, PCT International Publication No. 00 / No. 18957 and PCT Publication No. WO 02/46456; all of which are hereby incorporated by reference in their entirety). One nucleic acid colony can be generated from only one immobilized nucleic acid template (eg, a nucleic acid template derived from a restriction fragment). The method of the present invention allows the simultaneous production of a large number of such nucleic acid colonies, each containing a different immobilized nucleic acid.

DNA colonies can be generated by methods that involve capturing and amplifying DNA fragments (eg, restriction fragments) using primers immobilized on a solid surface (PCT Publication No. WO 98/44151). And PCT Publication No. 98/44152). In embodiments of the invention in which the DNA fragment is circular, the step of linearizing the circular DNA fragment using restriction enzymes is preferably performed prior to colony preparation. In one embodiment, DNA colonies are generated from a sample of DNA molecules (eg, a pool of restriction fragments) by a method comprising the following steps:
i) providing a solid surface comprising a plurality of colony primers immobilized to the solid surface at the 5 ′ end, wherein each colony primer is high relative to the sequence at the 3 ′ end of the DNA molecule in the sample. Containing sequences that are capable of hybridizing;
ii) denaturing the DNA molecule to produce a single stranded fragment;
iii) annealing the single stranded fragment to the immobilized colony primer;
iv) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
v) denaturing the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
vi) annealing the immobilized single-stranded fragment to the immobilized colony primer;
vii) Steps of repeating steps iv) to vi) so that colonies exist at specific positions on the solid surface.

  In a preferred embodiment, the immobilized colony primer comprises a sequence that is hybridizable to a sequence within the DNA molecule. For example, a DNA molecule in a sample can be a restriction fragment linked to a nucleic acid having a predetermined sequence. In such a case, the immobilized primer can have a sequence that is capable of hybridizing to the sequence in its predetermined sequence. In some other embodiments of the present invention, colony primers having different sequences can be used. The primer used in the present invention is preferably at least 5 bases in length. More preferably, the primer is less than 100 bases or less than 50 bases in length. In the present invention, the step of annealing the template to the immobilized primer, the step of extending the primer, and the step of separating the extended primer from the template are used repeatedly. It will be appreciated by those skilled in the art that these steps can be performed using reagents and conditions in PCR (or reverse transcriptase + PCR) technology. Various PCR techniques are disclosed, for example, in “PCR: Clinical Diagnostics and Research” (published by Springer-Verlag in 1992; which is incorporated herein by reference in its entirety).

DNA colonies can also be generated by the method described in PCT International Publication No. 00/18957. In embodiments of the invention in which the DNA fragment to be amplified is circular, the step of linearizing the circular DNA fragment using restriction enzymes is preferably performed prior to colony preparation. In one embodiment, DNA colonies are generated from a sample of DNA molecules (eg, a pool of restriction fragments) by a method comprising the following steps:
i) mixing the DNA molecules in the sample with colony primers, wherein each colony primer comprises a sequence that is capable of hybridizing to a sequence at the 3 ′ end of the DNA molecule;
ii) binding the DNA molecule and colony primer to the solid surface at the 5 ′ end of both the DNA molecule and colony primer to produce an immobilized DNA molecule and an immobilized colony primer;
iii) denaturing the immobilized DNA molecule to yield an immobilized single-stranded fragment;
iv) annealing the immobilized single stranded fragment to the immobilized colony primer to obtain an annealed single stranded fragment;
v) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
vi) denaturing the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
vii) annealing the immobilized single-stranded fragment to the immobilized colony primer, and viii) performing steps iv) to vii) so that each colony is present at a specific location on the solid surface. Repeating process.

  Preferably, the proportion of colony primers in the mixture is higher than the proportion of colony templates. Preferably, the ratio of colony primer to colony template is such that when the colony primer and nucleic acid template are immobilized on a solid support, a “lawn” of colony primers is formed. In this case, the colony primer lawn is individually immobilized at various intervals within the colony primer lawn, with multiple colony primers present at a substantially uniform density over the entire area of the solid support or a defined area. With one or more colony templates. The primer used in the present invention is preferably at least 5 bases in length. More preferably, the primer is less than 100 bases or less than 50 bases in length. In the present invention, the steps of annealing the template to the immobilized primer, the primer extension step, and the step of separating the extended primer from the template are used repeatedly. It will be appreciated by those skilled in the art that these steps can be performed using reagents and conditions in PCR (or reverse transcriptase + PCR) technology. Various PCR techniques are disclosed, for example, in “PCR: Clinical Diagnostics and Research” (published by Springer-Verlag in 1992).

Isothermal amplification of nucleic acids on a solid support can also be used to generate DNA colonies (see, eg, PCT Publication No. WO 02/46456). In embodiments of the invention in which the DNA fragment to be amplified is circular, the step of linearizing the circular DNA fragment using restriction enzymes is preferably performed prior to colony preparation. In one embodiment, DNA colonies are generated from a sample of DNA molecules (eg, a pool of restriction fragments) by a method comprising the following steps:
i) mixing the DNA molecules in the sample with a colony primer, wherein each colony primer contains a sequence capable of hybridizing to the sequence at the 3 ′ end of the DNA molecule, and the concentration of the colony primer is bound. Regulated so that amplification of the DNA molecule can occur;
ii) attaching the DNA molecule and colony primer to the solid surface at the 5 ′ end to yield an immobilized DNA molecule and an immobilized colony primer;
iii) adding an amplification solution containing a polymerase and nucleotides to the solid surface so that colonies each present at specific locations on the solid surface are isothermally generated.

  The amount of immobilized nucleic acid in step ii) determines the average number of DNA colonies per surface unit that can be created. The preferred concentration range of DNA molecules to be immobilized is preferably between 1 nM and 0.01 nM for the colony template and between 50 nM and 1000 nM for the colony primer. In a preferred embodiment, the reaction temperature is chosen to be the optimum temperature for polymerase activity. In a preferred embodiment, the DNA molecules in the sample are in the range of about 50-5000 base pairs in size.

In the method described in this section, various colonies occur at isolated locations on the surface. The density of colonies on the surface can be controlled, for example, by adjusting the density of primers immobilized on the surface. In a preferred embodiment, the colony density is 10 ^{4 to 6} colonies / cm ² , more preferably 10 ^{7 to 8} colonies / cm ² or more. Colony size can also be controlled by adjusting experimental conditions. Preferably, the colony has a maximum length of 10 nm to 100 μm, more preferably a maximum length of 100 nm to 10 μm.

  A DNA colony can be sequenced to determine at least a portion of its sequence. In one embodiment, sequencing comprises hybridizing a suitable primer (which may be referred to herein as a “sequencing primer”) with a nucleic acid molecule within a DNA colony, extending the primer. And determining the nucleotide used to extend the primer. Preferably, the nucleotide used to extend the primer in each colony is detected before the next nucleotide is added to the growing nucleic acid strand, and thus this allows the base nucleic acid to be Sequencing can be performed.

  Detection of incorporated nucleotides is facilitated by including one or more labeled nucleotides in the primer extension reaction. Any suitable detectable label can be used, for example, a fluorophore, a radioactive label, and the like. Preferably, a fluorescent label is used. Any fluorescent label known in the art can be used. The same label or different labels can be used for each different type of nucleotide. When the label is a fluorophore and the same label is used for each different type of nucleotide, incorporation of each nucleotide results in a cumulative increase in the signal detected at a particular wavelength. If different labels are used, these signals can be detected at different appropriate wavelengths. In a preferred embodiment, a mixture of labeled and unlabeled nucleotides of the same type is used for each primer extension step.

  In order to be able to hybridize the appropriate sequencing primer to the nucleic acid template to be sequenced, the nucleic acid template usually must be in single-stranded form. When the nucleic acid template constituting the nucleic acid colony is present in a double-stranded form, the nucleic acid template can be obtained by using methods well known in the art, for example, but not limited to, denaturation, cleavage, etc. It can be processed to obtain a single-stranded nucleic acid template.

  The sequencing primer that hybridizes to the nucleic acid template and is used for primer extension is preferably a short oligonucleotide, eg, 15-25 nucleotides in length. The sequence of the primer can be designed to hybridize to a portion of the nucleic acid template to be sequenced, preferably under stringent conditions. The sequence of the primer used for sequencing may have the same or similar sequence as the sequence of the colony primer used to generate the nucleic acid colony.

  When the sequencing primer is annealed to the nucleic acid template to be sequenced by subjecting the nucleic acid template and sequencing primer to appropriate conditions (determined by methods well known in the art) Primer extension, for example, providing nucleic acid polymerase and nucleotides (at least a portion of which is provided in a labeled form), and conditions suitable for primer extension when appropriate nucleotides are provided. Done using. The DNA polymerases and nucleotides that can be used are well known to those skilled in the art.

  Preferably, after each primer extension step, a washing step is included to remove unincorporated nucleotides that may interfere with subsequent steps. After the primer extension step is performed, DNA colonies can be detected to determine whether labeled nucleotides are incorporated into the extended primer. Thereafter, the primer extension step can be repeated to determine the next and subsequent nucleotides incorporated into the extended primer.

  Any device that makes it possible to detect the presence or absence and preferably the amount of an appropriate label (eg fluorescence or radioactivity) incorporated into the extended primer is used for sequencing. be able to. In embodiments where the label is a fluorescent label, a CCD camera attached to a magnifying device (such as a microscope) can be used.

  The detection system is preferably used in combination with an analytical system to determine the number and identity of nucleotides incorporated in each colony after each step of primer extension. This analysis can be performed immediately after each primer extension step or later using the recorded data, but this analysis allows the sequencing of the nucleic acid template within a given colony. Become.

  In a further embodiment of the invention, determining the complete or partial sequence of two or more nucleic acids by determining the complete or partial sequence of a nucleic acid template present in two or more nucleic acid colonies Can do. Preferably, multiple sequences are determined simultaneously and the nucleotides added to the nucleic acid colony are usually added in a selected order that is repeated throughout the analysis (eg, dATP, dTTP, dCTP, dGTP).

  Thus, it can be appreciated that the complete or partial sequence of the nucleic acid template that constitutes a particular nucleic acid colony can be determined.

  The primers and oligonucleotides used in the methods of the invention are preferably DNA, can be synthesized using standard techniques, and, when appropriate, detectably labeled using standard methods. (Ausubel, supra). Detectable labels that can be used in the methods of the present invention include, but are not limited to, fluorescent labels such as fluorescein and rhodamine. The label used in the method of the invention is detected using standard methods.

  The method of the invention can also be facilitated by the use of a kit containing the reagents required to perform the assay. The kit can contain reagents for performing analysis of single restriction fragment tags (eg, used in diagnostic methods) or multiple restriction fragment tags (eg, used in genomic mapping). When multiple samples are analyzed, multiple sets of appropriate primers and oligonucleotides are provided in the kit. In addition to the primers and oligonucleotides required to perform the various methods, the kit can contain the enzymes used in the methods, reagents for detecting the label, and the like. The kit can also contain a solid substrate used in carrying out the method of the invention. For example, the kit can contain a solid substrate such as a glass plate or a silicon or glass microchip.

5.4. Method for identifying restriction sequence tags associated with a phenotype Restriction sequence tags obtained for each individual are then compared within a subpopulation of a given phenotype to identify all homologous tags, And the number of homologous restriction sequence tags is determined. In a preferred embodiment, the two restriction sequence tags obtained within the DNA colony represent the ends of the corresponding restriction fragments in a set of restriction fragments. These two tags are derived from physical proximity to each other on the genome. Each tag can also be combined with the restriction site sequence of the restriction enzyme used to digest the genomic DNA to obtain a longer sequence. Homologous tags are grouped. In one embodiment, a group of restriction tags consists of restriction tags that are at least 60%, 70%, 80%, 90% or 99% homologous. In another embodiment, a group of unique restriction tags consists of restriction tags with 100% homology. A collection of restriction tags for a subpopulation can be used to identify sequence changes associated with the phenotype. In one preferred embodiment, the phenotype being investigated is related to the rate of sequence changes in the population or to a combination of sequence changes. In one embodiment, a percentage of one or more specific sequences in a population, eg, a restriction that each differs between two different populations by 10% or more, 20% or more, 50% or more, 70% or more, or 90% or more The percentage of one or more specific sequences in a population, as represented by the relative number of restriction tags in each one or more specific groups of sequence tags, is a phenotypic difference between the two populations. Identified as related. In another preferred embodiment, the phenotype is associated with a particular combination of sequence changes found in individuals from the population. In one embodiment, represented by a combination of percentages of multiple specific sequences in a population, eg, a combination of the number of restriction tags in multiple specific restriction sequence tag groups (ie, the total number of restriction tags in multiple groups). As such, combinations of proportions of a plurality of specific sequences in a population are such that combinations of proportions are 10% or more, 20% or more, 50% or more, 70% or more or 90% or more between two different populations. If different, they are identified as being associated with a phenotypic difference between the two populations. In another embodiment, a plurality of such combinations are used to identify phenotypic differences. In embodiments where multiple combinations are used, each combination in the plurality of combinations can include one or more specific sequences that are also included in different combinations in the plurality of combinations. These embodiments are illustrated in Example 6.3 (below).

  In one embodiment, the restriction sequence tag can be compared to the genome sequence of the organism to identify the genomic location of the restriction sequence tag. In another embodiment, restriction sequence tags that flank the genome on both sides of the recognition site are identified from the genome sequence of the organism.

5.5. Specific Preferred Embodiments for Obtaining Restriction Sequence Tags Several preferred embodiments for obtaining restriction sequence tags are described in this section. These methods can be used with any of the methods described in Sections 5.1 to 5.4 to identify sequence changes associated with phenotypes. It will be apparent to those skilled in the art that any repetition and / or combination of one or more of the specific embodiments described in this section can also be used.

(I) First Specific Embodiment In a preferred embodiment, the present invention provides a method for generating restriction sequence tags in biological samples (FIGS. 2A and 2B). In this method, one or more first restriction enzymes are used to digest nucleic acid extracted from a biological sample to produce a set of restriction fragments. A set of restriction sequence tags is then determined from the set of restriction fragments by a method comprising the following steps:
1) Ligating a restriction fragment in a set of restriction fragments with a first engineered nucleic acid comprising a predetermined sequence comprising one or more recognition sites for a second restriction enzyme to form a set of first circles Obtaining a nucleic acid fragment, wherein the recognition site is positioned and oriented such that the second restriction enzyme cuts within the restriction fragment;
2) digesting the first circular nucleic acid fragment with a second restriction enzyme;
3) modifying the end generated by the second restriction enzyme to allow ligation;
4) ligating the ends generated by the second restriction enzyme to produce a set of second circular nucleic acid fragments; and 5) sequencing at least a portion of each of the restriction fragments in the second circular nucleic acid. And determining a set of restriction sequence tags.

  Preferably, each of the second restriction enzyme recognition sites in the first engineered nucleic acid is near the end of the first engineered nucleic acid. In one preferred embodiment, each of the second restriction enzyme recognition sites in the first engineered nucleic acid is less than 20 nucleotides from the end of the first engineered nucleic acid. More preferably, each of the second restriction enzyme recognition sites in the first engineered nucleic acid is present at 0-5 nucleotides from the end of the first engineered nucleic acid. Preferably, the second restriction enzyme is a type IIs endonuclease. In a preferred embodiment, the type IIs endonuclease cleaves at least 5 bases, 10 bases or more, 20 bases or more, 50 bases or more, 100 bases or more, or 200 bases or more from its recognition site. In another embodiment, the second circular nucleic acid fragment is obtained, for example, by using a third restriction enzyme that is different from the first and second restriction enzymes to obtain a set of third restriction fragments. Can be linearized. In preferred embodiments, the method further comprises amplifying the third restriction fragment using a primer found in the first engineered nucleic acid. In another preferred embodiment, the step of digesting with a third restriction enzyme followed by amplification can be replaced by a step of amplifying the second circular nucleic acid fragment.

  In a preferred embodiment, the step of fixing and amplifying the second circular nucleic acid fragment is performed before step 5). In a more preferred embodiment, fixation and amplification is performed by any one of the DNA colony methods described in Section 5.3. In an even more preferred embodiment, sequencing is performed by any of the base-by-base primer extension methods described in Section 5.3.

  In yet another preferred embodiment of the invention, the step of modifying the ends of the second restriction fragment is performed using a DNA polymerase such that the ends are smooth because the ends are ligated. This is done by filling in the ends of the fragments or by removing the protruding nucleotides of the second restriction fragment.

  In another preferred embodiment, the method of the invention comprises a purification step and / or a DNA isolation step after each step.

  In yet another preferred embodiment, small genomic DNA sequences in a set of restriction fragments are ligated to some extent, inserted into a plasmid, cloned into bacteria, and the bacteria are plated on agarose plates, and each individual bacterial colony Are isolated and sequenced using Sanger sequencing using an automated capillary sequencer. Other methods that do not use a bacterial cloning step are also known to those skilled in the art. For example, the first engineered nucleic acid can include a combinatorial sequence tag so that the third nucleic acid fragment can be used for molecular cloning on the beads and sequenced one by one.

(II) Second Specific Embodiment In another embodiment, the present invention provides a method for generating restriction sequence tags in biological samples (FIGS. 3A and 3B). In this method, a first restriction enzyme is used to digest nucleic acid extracted from a biological sample to produce a set of restriction fragments. The first restriction enzyme cuts on both sides of the recognition site in such a way that the cleavage site contains a portion of the sequence that is not part of the recognition site. Restriction enzymes that can be used for this purpose include, but are not limited to, BaeI, BcgI, BsaXI. A set of restriction sequence tags is then determined from the set of restriction fragments by a method comprising the following steps:
1) modifying the ends generated by the first restriction enzyme to allow ligation;
2) ligating the restriction fragments in a set of restriction fragments with a first engineered nucleic acid comprising a predetermined nucleotide sequence to obtain a set of first circular nucleic acid fragments; and 3) a first circular Sequencing at least a portion of each of the restriction fragments in the nucleic acid to determine a set of restriction sequence tags.

  In a preferred embodiment, the step of fixing and amplifying the first circular nucleic acid fragment is performed before step 3). In a more preferred embodiment, fixation and amplification is performed by any one of the DNA colony methods described in Section 5.3. In an even more preferred embodiment, sequencing is performed by the one-base primer extension method described in Section 5.3.

  In yet another preferred embodiment of the invention, the step of modifying the ends of the second restriction fragment is performed using a DNA polymerase such that the ends are smooth because the ends are ligated. This is done by filling in the ends of the fragments or by removing the protruding nucleotides of the second restriction fragment.

  In another preferred embodiment, the method of the invention comprises a purification step and / or a DNA isolation step after each step.

(III) Third Specific Embodiment In yet another embodiment, the present invention provides a method for generating restriction sequence tags in biological samples (FIGS. 4A and 4B). In this method, one or more first restriction enzymes are used to digest nucleic acid extracted from a biological sample to produce a set of restriction fragments. A set of restriction sequence tags is then determined from the set of restriction fragments by a method comprising the following steps:
1) ligating the restriction fragments in a set of restriction fragments with a first engineered nucleic acid to obtain a set of first nucleic acid fragments, wherein the first engineered nucleic acid is a second Comprising a predetermined nucleotide sequence comprising a recognition site for a restriction enzyme, the recognition site being positioned and oriented such that a second restriction enzyme cuts within the restriction fragment;
2) digesting the first nucleic acid fragment with a second restriction enzyme;
3) modifying the end generated by the second restriction enzyme to allow ligation;
4) ligating the end produced by the second restriction enzyme with a second engineered nucleic acid comprising a predetermined nucleotide sequence to produce a second nucleic acid fragment; and 5) in the second nucleic acid fragment Sequencing at least a portion of each of the restriction fragments to determine a set of restriction sequence tags.

  Preferably, the recognition site for the second restriction enzyme in the first engineered nucleic acid is near the end of the first engineered nucleic acid. In one preferred embodiment, the recognition site for the second restriction enzyme in the first engineered nucleic acid is less than 20 nucleotides from the end of the first engineered nucleic acid. In a more preferred embodiment, the recognition site for the second restriction enzyme in the first engineered nucleic acid is present at 0-5 nucleotides from the end of the first engineered nucleic acid. Preferably, the second restriction enzyme is a type IIs endonuclease. In a preferred embodiment, the type IIs endonuclease cleaves at least 5 bases, 10 bases or more, 20 bases or more, 50 bases or more, 100 bases or more, or 200 bases or more from its recognition site.

  In a preferred embodiment, the step of fixing and amplifying the second nucleic acid fragment is performed before step 5). In a more preferred embodiment, fixation and amplification is performed by any one of the DNA colony methods described in Section 5.3. In an even more preferred embodiment, sequencing is performed by the one-base primer extension method described in Section 5.3.

  In yet another preferred embodiment of the invention, the step of modifying the ends of the second restriction fragment is performed using a DNA polymerase such that the ends are smooth because the ends are ligated. This is done by filling in the ends of the fragments or by removing the protruding nucleotides of the second restriction fragment.

  In another preferred embodiment, the method of the invention comprises a purification step and / or a DNA isolation step after each step.

(IV) Fourth Specific Embodiment In yet another preferred embodiment, the present invention provides a method for generating restriction sequence tags in biological samples (FIGS. 5A and 5B). In this method, one or more rare cutters are used to digest nucleic acid extracted from a biological sample to produce a set of restriction fragments. Preferably, a rare cutter that recognizes a recognition sequence of 6 bases, 8 bases or more than 8 bases is used. A set of restriction sequence tags is then determined from the set of restriction fragments by a method comprising the following steps:
1) ligating the restriction fragments in a set of restriction fragments with a first engineered nucleic acid comprising a predetermined nucleotide sequence to obtain a set of first nucleic acid fragments;
2) digesting the first nucleic acid fragment with one or more second restriction enzymes to obtain a second restriction fragment, wherein the second restriction enzyme is different from the first restriction enzyme; Does not cleave within the first engineered nucleic acid;
3) ligating the end of the second restriction fragment with a second engineered nucleic acid comprising a predetermined nucleotide sequence to produce a set of second nucleic acid fragments; and 4) a second nucleic acid fragment. Sequencing at least a portion of each of the restriction fragments in to determine a set of restriction sequence tags.

  In a preferred embodiment, digestion with the first and second restriction enzymes occurs simultaneously prior to ligation with the first and second engineered fragments.

  In a preferred embodiment, the step of fixing and amplifying the second nucleic acid fragment is performed before step 4). In a more preferred embodiment, fixation and amplification is performed by any one of the DNA colony methods described in Section 5.3. In an even more preferred embodiment, sequencing is performed by the one-base primer extension method described in Section 5.3.

  In another preferred embodiment, the method of the invention comprises a purification step and / or a DNA isolation step after each step.

(V) Other Specific Embodiments The present invention also provides a method for generating restriction sequence tags for biological samples. In such methods, one or more first restriction enzymes are used to digest nucleic acid extracted from a biological sample to produce a set of restriction fragments. Multiple different second restriction enzymes are then used to further digest the restriction fragment. Such a method makes it possible to further increase the number of restriction sequence tags present near the recognition site of the first restriction enzyme.

In one preferred embodiment (FIGS. 6A and 6B), after digestion with a first restriction enzyme, a set of restriction sequence tags is determined from a set of restriction fragments by a method comprising the following steps:
1) ligating the restriction fragments in a set of restriction fragments with a first engineered nucleic acid comprising a predetermined nucleotide sequence to obtain a set of first nucleic acid fragments;
2) digesting the first nucleic acid fragment with a second restriction enzyme to obtain a second restriction fragment, wherein the second restriction enzyme is different from the first restriction enzyme, Does not cleave within the engineered nucleic acid;
3) ligating the end of the second restriction fragment with a second engineered nucleic acid comprising a predetermined nucleotide sequence to produce a set of second nucleic acid fragments; and 4) a second nucleic acid fragment. Sequencing at least a portion of each of the restriction fragments in to determine a set of restriction sequence tags.

In another preferred embodiment (FIGS. 7A and 7B), after digestion with the first restriction enzyme, a set of restriction sequence tags is determined from the set of restriction fragments by a method comprising the following steps:
1) ligating restriction fragments in a set of restriction fragments with a first engineered nucleic acid to obtain a set of first circular nucleic acid fragments, wherein the first engineered nucleic acid is a second A predetermined nucleotide sequence comprising a recognition site for the restriction enzyme and two recognition sites for the third restriction enzyme, wherein the second restriction enzyme recognition site is present between the recognition sites for the third restriction enzyme, The recognition site for the third restriction enzyme is positioned and oriented such that the third restriction enzyme cuts within the restriction fragment, and the second restriction enzyme and the third restriction enzyme are different from each other;
2) digesting the first nucleic acid fragment with a second restriction enzyme to obtain a set of second restriction fragments;
3) ligating the ends of the second restriction fragment to create a set of second circular nucleic acid fragments; and 4) sequencing at least a portion of each of the restriction fragments in the third circular nucleic acid fragment; Determining a set of restriction sequence tags.

  Preferably, the method further comprises, after step 3), 3i) digesting the second circular nucleic acid fragment with a third restriction enzyme to produce a set of third nucleic acid fragments; 3ii) third Modifying the ends generated by the restriction enzymes of to allow ligation; and 3iii) ligating the third nucleic acid fragment to create a set of third circular nucleic acid fragments. Preferably, the recognition site for the third restriction enzyme in the first engineered nucleic acid is near the end of the first engineered nucleic acid. In one preferred embodiment, each of the third restriction enzyme recognition sites in the first engineered nucleic acid is present less than 20 nucleotides from the end of the first engineered nucleic acid. In a more preferred embodiment, each of the third restriction enzyme recognition sites in the first engineered nucleic acid is present at 0-5 nucleotides from the end of the first engineered nucleic acid. Preferably, the third restriction enzyme is a type IIs endonuclease. In a preferred embodiment, the type IIs endonuclease cleaves at least 5 bases, 10 bases or more, 20 bases or more, 50 bases or more, 100 bases or more, or 200 bases or more from its recognition site.

In yet another preferred embodiment (FIGS. 8A and 8B), after digestion with the first restriction enzyme, a set of restriction sequence tags is determined from the set of restriction fragments by a method comprising the following steps:
1) ligating the restriction fragments in a set of restriction fragments with a first engineered nucleic acid to obtain a set of first nucleic acid fragments, wherein the first engineered nucleic acid comprises a first A predetermined nucleotide sequence comprising a recognition site for a second restriction enzyme that is different from the restriction enzyme;
2) digesting the first nucleic acid fragment with a second restriction enzyme to obtain a set of second restriction fragments;
3) ligating the ends of the second restriction fragments to create a set of first circular nucleic acid fragments; and 4) sequencing at least a portion of each of the fourth nucleic acid fragments, thereby providing a set Determining a restriction sequence tag.

  Preferably, the method further comprises, after step 3), 3i) digesting the first circular nucleic acid fragment with a third restriction enzyme to produce a set of third nucleic acid fragments, wherein 3 restriction enzymes are different from the first and second restriction enzymes; 3ii) modifying the ends generated by the third restriction enzyme to allow ligation; and 3iii) a third nucleic acid fragment To produce a set of second circular nucleic acid fragments.

  In such embodiments, the set of restriction fragments generated by the first restriction enzyme is preferably further digested separately with each of a plurality of different second restriction enzymes. More preferably, the plurality of different second restriction enzymes comprises at least 3, 5, 10 or 20 different restriction enzymes.

  In a preferred embodiment, the step of fixing and amplifying the first circular nucleic acid fragment is performed prior to the sequencing step. In a more preferred embodiment, fixation and amplification is performed by any one of the DNA colony methods described in Section 5.3. In an even more preferred embodiment, sequencing is performed by the one-base primer extension method described in Section 5.3.

  In yet another preferred embodiment of the invention, the step of modifying the ends of the second restriction fragment is performed using a DNA polymerase so that the ends are blunt because the ends are ligated. Or by removing the protruding nucleotides of the second restriction fragment.

  In another preferred embodiment, the method of the invention comprises a purification step and / or a DNA isolation step after each step.

  According to such an embodiment, each first restriction tag in which the first restriction tag is present next to the first restriction enzyme recognition site and the second restriction tag is present next to the second restriction enzyme recognition site. Identifying two restriction sequence tags contained in the fragment part and storing information that the first and second restriction sequence tags are paired restriction sequence tags derived from the same first restriction fragment It becomes possible to do.

  Restriction sequence tags can be further grouped by sequence homology and, if possible, further grouped paired restriction sequence tags containing the same first restriction sequence tag, and grouped pairs Information that the second restriction tag from the resulting restriction sequence tag is physically present on the same side of the given first restriction enzyme recognition site, near the given first restriction enzyme recognition site. It can be grouped by saving. In a preferred embodiment of the present invention, when genomic sequences are available, restriction sequence tags are clustered by mapping to identify adjacent restriction sequence tags present on the genome on either side of the recognition site for the first restriction enzyme. Further steps are provided.

  The following examples are given as illustrations of the invention and are therefore not intended to limit the invention in any way.

6.1. Example 1 Preparation of DNA Colony Template: Double Restriction Sequence Tag This example illustrates the manipulation of a vector for in vitro production of a DNA tag. An embodiment for generating restriction sequence tags derived from genomic DNA is shown in FIG. 9A. In this example, a plasmid vector having a DNA cloning site located between two BsmFI sites was used. This vector is based on the pUC19 plasmid chosen because of its small size.

1) First generation of cloning vector The first generated cloning vector was designed for use with genomic DNA digested with a single restriction enzyme. In this example, the genomic DNA of bacteriophage λ was used to actually demonstrate the creation of restriction sequence tags.

Two variants of the vector were made by cloning a synthetic linker into pUC19. In the first variant, the vector comprises the following insert:
BsmFI BamHI BsmFI
GGGAC GGATCC GTCCC (SEQ ID NO: 1)
CCCTG CCTAGG CAGGG (SEQ ID NO: 2)

  This allows cloning of λDNA digested with Sau3AI into a BamHI restriction site flanked by two BsmFI sites. The BamHI site of pUC19 was previously removed from the vector.

In the second variant, the vector contains an insert with an AatII restriction site (underlined) formed by two adjacent BsmFI sites:
BsmFI BsmFI
GG GAC GTC CC (SEQ ID NO: 3)
CC CTG CAG GG (SEQ ID NO: 4)
AatII

  This allows cloning of TaiI digested lambda DNA into a vector. The AatII site of pUC19 was previously removed from the vector.

  Both initially generated vectors were dephosphorylated before use to prevent self-ligation of empty vectors. After ligation of the lambda DNA fragments, DNA polymerase I and ligase were used to repair the integrity of both DNA strands.

Below is a summary of the steps used, which are also common for the vectors that are also made:
i) First ligation ii) Inactivation of T4 DNA ligase by heating iii) Digestion with BsmFI iv) Filling of DNA ends with Klenow enzyme and dNTPs v) Inactivation of BsmFI by heating vi) Second ligation reaction

The following protocol for in vitro restriction sequence tag generation was used in this example:
First ligation 0.1 μg of genomic DNA of bacteriophage λ cleaved by appropriate enzyme
0.05 μg of linear vector (purified by agarose gel)
1 mM ATP
1 x Buffer NEB4
1 μl T4 DNA ligase (New England Biolabs, 400 u / μl)
Incubate for 2 hours at room temperature in a total volume of 10 μl.
Inactivate T4 DNA ligase by heating at 65 ° C. for 20 minutes.

BsmFI digestion Add 5 μl of solution containing:
1 x Buffer NEB4
0.5 μl BsmFI (New England Biolabs, 2 u / μl).
Incubate at 65 ° C. for 2 hours.

Klenow treatment Add 5 μl of solution containing:
1x T4 DNA ligase buffer (New England Biolabs)
100 μM dNTPs
0.5 μl Klenow fragment (New England Biolabs, 5 u / μl).
Incubate for 5 minutes at room temperature.
Inactivate the enzyme by heating at 80 ° C. for 20 minutes.

Add an equal volume of solution containing the second linkage below:
1 × MSL buffer 2 mM ATP
20% PEG6000
10% (v / v) T4 DNA ligase (New England Biolabs, 400 u / μl)
Incubate overnight at 16 ° C.

  In the above protocol, minimal salt ligation (MSL) buffer was used because intramolecular ligation is more efficient in low salt. The composition of the MSL buffer is shown below:

  Analysis of in vitro ligation products was performed by PCR. If two λDNA restriction sequence tags of the correct size are present in the vector, a 134 bp amplification product is formed. Smaller size amplification products can be formed, for example, by inserting only one tag into the vector, empty vector without any tag, or by self-ligation after BsmFI digestion of the empty vector.

  PCR product length analysis was performed using an Agilent DNA500 chip or a DNA1000 chip. Another method of examining in vitro ligation products to transform competent E. coli cells into in vitro ligation products was followed by analysis of plasmids isolated from individual colonies. When the product of the first ligation of λDNA to the vector was analyzed, multiple peaks were observed as a result of various lengths of DNA fragments inserted into the vector (FIG. 9B).

  When the product of the second ligation was analyzed, the expected size fragment was present with a smaller fragment (FIG. 9C).

  Although the originally generated vector allowed size standardization of lambda genomic DNA into two restriction sequence tags with the expected size, some undesirable products were detected. The cause is probably the self-ligation of the vector during the first ligation reaction. This can occur as a result of incomplete dephosphorylation, or can be induced by DNA polymerase I treatment that can remove dephosphorylated bases from the ends of the vector. This problem can be overcome by partial filling of genomic DNA fragments, as illustrated in the examples using single restriction sequence tags. For example, the BamHI site can be partially filled with dGTP.

  Alternatively, the vector can be designed by replacing the BamHI site with a BglII site. Ligation of the BamHI genomic fragment into a BglII digested vector in the presence of BglII restriction enzyme prevents vector self-ligation. Only the expected ligation product of the vector-insert suppresses the BglII site and thus resists digestion.

  The BsmFI enzyme was evaluated in a simple construct. A circular plasmid containing a 2000 bp DNA insert at the BamHI site of the originally generated vector was digested using BsmFI (a site not present in the insert), resulting in a 3000 bp band of the vector containing the bound DNA tag. Isolated from an agarose gel. This DNA was treated with Klenow enzyme and dNTPs to generate blunt ends, and treated with T4 ligase for the second ligation. The results shown in FIG. 9D show that there is no fragment band smaller than the expected size of 133 bp. The extra bands of larger size fragments were not observed in subsequent experiments and are therefore considered to be PCR artifacts.

  This experiment shows that the BsmFI enzyme cleaves correctly at its error-free distance and tag production can be performed successfully. An alternative method of creating blunt ends to allow ligation of two restriction sequence tags is to insert a linker between the two restriction sequence tags.

  Another option is to reverse the vector-insert-linker system. The first ligation allows the genomic DNA fragment to become a linker (which is useful for linearization of DNA colonies and allows sequencing of both strands of DNA amplified in each DNA colony. Containing a unique cleavage site). After digestion with an IIS type enzyme, a “vector” arm is ligated to the end cleaved by the IIS type enzyme.

2) Second production vector The second production vector uses two different enzymes for cloning, for example allowing further reduction of the average size of genomic DNA fragments and self-ligation of empty vectors Designed to avoid. To facilitate the separation of the completely cut plasmid from the partially digested plasmid on an agarose gel, a 1000 bp DNA fragment (which is derived from the BlueScript plasmid pBSK) is placed between the restriction sites of the untreated vector. Included. Dephosphorylation and DNA polymerase I treatment are not required for the second production vector.

  The untreated vector contains an insert as shown in FIG. 10A, which allows the use of SphI and AccI restriction sites for cloning. The own SphI and AccI sites of the pUC19 plasmid were removed. Since the 3 'overhang is formed by SphI digestion, the empty vector cannot self-ligate unless the overhang is completely removed by Klenow enzyme. DNA digested by two different enzymes can be inserted into a second production vector. FIG. 10A shows several possibilities for cloning.

  In vitro ligation of lambda DNA digested with MspI and SphI was carried out into a vector that had been opened with SphI-AccI. Analysis of the second ligation product showed that only a single band of the correct size was present, as shown in FIG. 10B. The product of the second ligation was transformed into E. coli cells. Thirty colonies were seeded in the liquid culture. Twelve plasmids from the bacterial culture with the highest density were analyzed. No plasmid corresponding to the empty vector was observed. No plasmid with an insert size variation of more than 2 bases was observed.

  Similar experiments were performed with AluI and SphI digested lambda DNA inserted into a HincII and SphI digested vector (AluI and HincII give blunt ends). FIG. 10C shows the analysis result of the product of the first ligation. Fragments of various sizes derived from λDNA were observed by analysis using an Agilent 2100 Bioanalyzer DNA1000 chip, as expected. A very large peak is a size marker. FIG. 10D shows the analysis result of the product of the second ligation. Only a single fragment of the expected size was observed by analysis using an Agilent 2100 Bioanalyzer DNA1000 chip.

6.2. Example 2 Preparation of DNA Colony Template: Single Restriction Sequence Tag In this example, as shown in FIG. 4A, a DNA colony template each containing a single restriction sequence tag derived from a DNA sample to be genotyped. The preparation of is illustrated. Since the variable fragment (ie, restriction sequence tag) represents less than 6% of the size of the DNA colony template, the size normalization step of this protocol ensures efficient and comparable amplification of all DNA colonies. Insertion into a DNA colony vector makes it possible to add universal sequences to generate a DNA colony template.

  The general strategy of in vitro cloning used in this example is shown in FIGS. 11A-11B. Briefly, a short double stranded adapter (called “short arm”) consists of an amplification primer Px followed by a hexanucleotide TCCGAC that forms the recognition site for the type IIs restriction enzyme MmeI. The 5 'end of the oligonucleotide contains a biotin moiety attached via a cleavable disulfide bond. The complementary strand is 5 'phosphorylated and contains extended nucleotides that are compatible with the sticky ends of the DNA digested by the first restriction enzyme. The short arm is ligated with the DNA cleaved with the corresponding endonuclease and further treated with MmeI, an IIS type enzyme. This leaves the 20 bp DNA fragment bound to the short arm. The conjugate is then purified from other DNA fragments using streptavidin beads and ligated to a “long arm” containing another amplification primer Py.

  Even when this cloning strategy is based on DNA cleavage by an endonuclease that recognizes a 6 bp sequence (HindIII), digesting DNA with a second high-frequency cleavage enzyme (4 bp recognition site, RsaI) In order to reduce the average size.

The protocol for the preparation of templates from HindIII and RsaI digested lambda phage DNA, and the various resulting steps are summarized below:
i) Digestion of lambda genomic DNA ii) Ligation to short Px arm iii) Digestion with MmeI iv) Purification of Px arm-tag conjugate v) Binding of Py arm vi) Purification of final DNA colony template

  The protocol for each individual step used in this example is described in detail below.

  i) Digestion of genomic DNA of bacteriophage λ

  Lambda genomic DNA is digested with both HindIII and RsaI.

  10 μl of λ bacteriophage DNA (New England Biolabs, 0.5 μg / μl), 5 μl of buffer Y + / Tango (Fermentas); 32.5 μl of water; 1.25 μl of HindIII (New England Biolabs); 1.25 μl Of RsaI (New England Biolabs).

  Incubate at 37 ° C. for 2-16 hours.

  This gives a 100 ng / μl solution of λ phage DNA containing 42 fmol / μl HindIII ends.

  Partial filling of HindIII overhangs with dATP

  Various protocols can be used to maximize the linkage of the HindIII end of the lambda genomic DNA to the short arm vector while preventing self-ligation of the lambda genomic fragment and short arm self-ligation.

  It has been discovered that the optimal method to prevent HindIII end self-ligation is a single base loading with dATP. The short arm fragment must also be designed to be compatible with the partially filled HindIII end of the genomic DNA fragment.

HindIII end filling:
20 μl of HindIII-RsaI digested λ genomic DNA is mixed with 2 μl of 10 mM dATP; 1 μl of Klenow enzyme (New England Biolabs, 5 u / μl).

  Incubate at 25 ° C for 30 minutes, then at 70 ° C for 20 minutes.

ii) Ligation to short arm moieties Care must be taken during this ligation reaction to prevent the formation of short arm dimers (or to eliminate them from solution). Such dimers can be formed after partial digestion with MmeI to give a correctly sized template containing a short arm cloned fragment.

  As noted above, the use of short arms containing nonpalinic overhangs complementary to partially filled DNA ends is a preferred method. Alternatively, a short arm containing a dideoxy base at its 3 'end can be used. MmeI can cleave DNA if a nick is present immediately after the recognition site. The use of a short arm that is not phosphorylated is another option.

  This cloning step is performed by using a short arm with a 10-fold molar excess over the HindIII end filled with dATP.

Short arm preparation:
10 μl of 10 μM biotinylated oligo Short-A 5′-GAGGAAAGGGGAAGGGAAAAGAGAGTCCGAC-3 ′ (SEQ ID NO: 9) 10 mM Tris-HCl (pH 8.0) Mix with 10 μl of 10) 10 mM Tris-HCl (pH 8.0) solution. Oligo Short-A contains a cleavable disulfide bridge between biotin and its 5 ′ end.

  Warm to 80 ° C. and cool slowly to room temperature over 30 minutes.

Linking:
3 μl of 10 mM riboATP; 4 μl of 5 μM short arm; 1 μl of T4 DNA ligase (New England Biolabs, 400 u / μL) was added to the partially filled HindIII end of the genomic DNA mixture for 1 hour at 16 ° C. Incubate.

  Proceed with DNA purification according to the Qiagen MiniElute Reaction Clean Up protocol. Elute with 12 μl Buffer EB and repeat the elution with 5 μl freshly prepared Buffer EB without changing the tube.

  Under these ligation conditions, no marked multimerization of the genomic DNA fragment is observed due to blunt end ligation generated by RsaI.

  Purification of the sample using a Qiagen Mini Elute column instead of heat inactivating the T4 ligase is preferred to remove most of the unconnected arms. Double elution can increase the recovery of reaction products.

iii) Mmel digestion Effective digestion with Mmel is an important step in determining template yield. This enzyme must be used in a ratio not exceeding 1 unit to 2 units per μg of DNA. According to New England Biolabs, excess enzyme interferes with endonuclease cleavage.

  To the sample mixture, add 2 μl Buffer Y + / Tango (Fermentas); 2 μl 1 mM SAM; 1 μl (2 u) MmeI (New England Biolabs).

  Incubate for 1 hour at 37 ° C.

iv) Binding / releasing to streptavidin beads The manufacturer's information shows that 30 minutes is sufficient to bind the DNA to the beads, but overnight incubation has allowed The yield increases strongly. The cleavage of disulfide bonds and the release of DNA with 200 mM DTT is complete in 30 minutes. After this step, it is useful to analyze the yield of the desired product (50 bp) and the efficiency of Mmel digestion. Undigested products are observed as large DNA fragments.

Binding / release to SA beads:
10 μl of washed SA280 beads (Dynal) was added to 20 μl of 2 × B & W buffer (prepared according to Dynal protocol) and resuspended.

  Incubate overnight at room temperature with agitation. Wash the beads twice with 40 μl of 1 × B & W buffer. The beads are washed twice with 40 μl of 100 mM Tris-HCl (pH 8.0). Add 11 μl of 80 mM Tris-HCl (pH 8.0) containing 200 mM DTT to the beads.

  Incubate for 30 minutes at room temperature with agitation.

  Separate the supernatant from the beads and discard the beads. If necessary, 1 μl of the supernatant is analyzed on an Agilent 2100 Bioanalyzer DNA1000 chip.

v) Long arm ligation This ligation is based on recognizing random 2 bases present in the 3 ′ overhangs generated in the nom DNA by MmeI ligation. When these two bases are denatured, such ligation is a slow reaction and requires increased concentrations of enzyme (New England Biolabs, information note on MmeI).

Long arm preparation:
In a tube containing ready-to-use PCR beads (Amersham), 19 μl water; 1 μl 1 ng / μl pUC19 plasmid DNA (571-870 region amplified); 2.5 μl 10 μM oligo Long-A 5 Add '-CTCACATTAATTGCCGTTGCGNNCACTGCCCGCTTTCCCAG-3' (SEQ ID NO: 11); 2.5 μl of 10 μM Oligo Long-B 5′-CACCCAACCCAAACCAACCCAAACCGAAAAACGCCAGCAACG-3 '(SEQ ID NO: 12). Amplification was 25 cycles of program (94 ° C. for 2 minutes 30 seconds; 94 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. for 30 seconds) in a PTC-200 thermal cycler (MJ Research); For 10 minutes).

  The expected length of the amplified product is 323 bp. The reaction product is purified by a Qiagen column and its purity and concentration must be estimated by analysis on an Agilent 2100 Bioanalyzer DNA1000 chip.

  The PCR product must then be digested with BtsI. The amount of enzyme and the incubation time depend on the amount of PCR product. Digestion efficiency must be estimated by analysis on an Agilent 2100 Bioanalyzer DNA1000 chip. A change in size from 323 bp to 301 bp is predicted. If the digestion is complete, purification by Qiagen column (PCR product purification protocol) is sufficient to remove a small 22 bp product from the reaction. Otherwise, the 301 bp fragment must be purified on a 2% agarose gel.

Long arm connection:
To the supernatant removed from the beads, add 2 μl 100 mM MgCl ₂ ; 2 μl 10 mM rATP; 5 μl long arm; 1 μl concentrated T4 DNA ligase (New England Biolabs, 2000 u / μl).

  Incubate overnight at 16 ° C.

  If necessary, 1 μl of the reaction is analyzed on an Agilent 2100 Bioanalyzer DNA1000 chip.

vi) Final Template Purification For the final purification step, the desired linked template is separated from the free long arm and the resulting long arm dimer or unreacted 50 bp product. Heating the template in denaturing conditions must be avoided to minimize template strand dissociation.

Final template purification:
Load the entire sample onto a 2% agarose gel. Electrophoresis long enough to achieve good separation between the free long arm (301 bp), template (350 bp) and long arm dimer (600 bp). Cut out a band from agarose.

  DNA is purified by Clontech Montage Agarose kit or Qiagen MiniElute Agarose Extraction kit. If a Qiagen kit is used, the tube should not be warmed at 50 ° C. as recommended, but allowed to dissolve for 15 minutes at room temperature. If necessary, the final product can be analyzed on an Agilent 2100 Bioanalyzer DNA1000 chip.

After that, size standardization was confirmed. The same experiment was performed in parallel starting from bacteriophage λ genomic DNA or human genomic DNA labeled with ³³ P-dATP.

  FIG. 11C shows aliquots collected after various steps of the process and analyzed by autoradiography. Lane 1: complete DNA colony vector size PCR product (350 bp); lanes 2-6: lambda genomic DNA and lanes 7-10: human genomic DNA; lanes 3 and 7, after ligation to short arm; lane 4 and 8. Size normalization is observed after digestion with MmeI; Lanes 5, 6, 9 and 10: After ligation with long arms, DNA colony vectors with the expected size are thus generated.

  DNA colonies were then generated as follows: DNA colonies digested with HindIII, containing lambda or human genomic DNA fragments size-standardized with MmeI and constructed as shown in this example The vector was used to generate DNA colonies using the method of WO 00/18957. FIG. 11D shows a DNA colony of λDNA. FIG. 11E shows a DNA colony of λDNA (left column) or a human DNA DNA colony (first three images in the right column). These DNA colonies are then sequenced in situ using the method of WO 98/44152 to identify restriction sequence tags.

  The size of the DNA colony vector was also confirmed by PCR amplification. The PCR product was then cloned into pUC19 plasmid and transformed into E. coli competent cells (XL-2 Blue, Stratagene). Minipreps from individual clones were sequenced. The restriction sequence tag was confirmed to be the expected size of 20 bp. However, tags that were 21 bases in length for some clones were recovered. Tags with less than 20 bases were not found.

  Fingerprint experiments revealed that all 14 predicted HindIII digested lambda were present in the DNA colony vector. After Mmel treatment and long arm ligation, the fragment was purified from an agarose gel and primer extension was performed in the presence of three dXTP and one dideoxynucleotide (eg, dATP, dTTP, dCTP and ddGTP). The product was then analyzed on an acrylamide gel that allowed the identification of each expected fragment.

  If a 6-base cutter that produces a 4-base overhang is used for cloning, information on 21 consecutive bases can be obtained from the prepared template. Of the 21 bases, 6 bases are known bases that form endonuclease recognition sites, and 15 bases can be used to detect genetic changes. For some enzymes, this number can be increased if the “overhang” end of the short arm overlaps the MmeI site. For example, TCCGA linked to NcoI-terminal CATGG forms an MmeI site.

  Two variations of the standard protocol described above were also used to increase the ability of cloning. In one variation, an enzyme that produces blunt ends was used. If the enzyme used for DNA cleavage has a 6 base recognition sequence and results in blunt ends, information on 23 consecutive bases (6 bases are known and 17 bases are for SNP detection) There is). Since the efficiency of blunt end ligation is lower, longer ligation times are required. Nevertheless, sufficient ligation efficiency was achieved when ligation was performed overnight. The yield of template obtained using λDNA digested with MscI was similar to that using λDNA digested with HindIII.

  Analysis of the plasmid obtained by inserting the amplified template into the pUC19 plasmid revealed the following: (1) There is no “template” containing a short arm dimer; (2) Low amount of undesired product (only 1 to 2 out of 18 clones); (3) Various λ genomic DNA fragments are well displayed in the template (15 total) Only 3 fragments were detected twice in this template).

  In another variation, artificial creation of blunt ends was used. If the 4 base overhang remaining after the first DNA digest is removed, the cloning information increases to 25 bases (6 bases are known and 19 bases are for SNP detection). In a preliminary experiment, two enzymes capable of removing protrusions were investigated. Mungbean nuclease (New England Biolabs) failed to generate blunt ends efficiently. Removal of the 3 'overhang by Klenow enzyme gave satisfactory results. Furthermore, if the necessary deoxynucleotides are present, the latter enzyme can also effectively prevent the termini produced by the high frequency cutter from participating in ligation. For example, when DNA is digested with PstI and MspI, in the presence of dCTP, the Klenow enzyme trims the PstI end and converts the MspI end to an inactive single base 5 'overhang (Figure 12).

6.3. Example 3 Detection of Sequence Changes across the Genome This example illustrates an embodiment of the invention used to generate a large number of restriction sequence tags from a complex genome in a reproducible manner. The These restriction sequence tags are used to identify genetic variants between genomes without using prior knowledge of these variants, and in a comprehensive manner and specific to a population of individuals. To identify hypotheses based on prior knowledge of type-related variants, and to match such variants to the smallest genomic regions with the resulting high-density restriction sequence tags Useful to make.

  The method disclosed in this example is based on using the same restriction endonuclease to generate identical restriction fragments from different genomic DNA samples. After amplification, the ends of these restriction fragments are sequenced and the sequence is processed to a restriction that is a short sequence of nucleotides immediately adjacent to the recognition site of the restriction enzyme used for digestion of genomic DNA. Identify sequence tags.

For each individual in the population under study exemplified herein by patients in a clinical study, the method is performed according to the following steps:
1) Extraction of genomic DNA Genomic DNA is extracted from biological samples derived from various individuals. These biological samples are either oral mucosa or blood samples. Genomic DNA is extracted using standard protocols. Typically, 0.5 micrograms to 3 micrograms of genomic DNA is extracted from an oral mucosa sample and 4 micrograms of genomic DNA is extracted from a 100 microliter whole blood sample. Since one diploid human genome has about 6 picograms of DNA, this represents at least 80 to 600 copies of the diploid genome, which is sufficient for our purposes.

2) Restriction digestion The restriction endonuclease used is obtained, which depends directly on the average distance between the two restriction enzyme recognition sites, which is equal to the average length of the resulting genomic restriction fragment Selected according to the density of restriction sequence tags in the genome. Therefore, the goal is to obtain an average of at least one cleavage every 5000 bases, so a restriction with 6 bases of recognition sites is expected to produce fragments with an average size of 4096 bases. Enzymes are used. Thus, over 140,000 genome restriction fragments are generated for each diploid human genome containing about 6 billion bases. For each genomic restriction fragment, two restriction sequence tags are generated, so an estimated total of over 2.8 million different restriction sequence tags are generated for the diploid human genome. As discussed below, the restriction sequence tags that occur in these examples are 15 bases in length, and the polymorphisms are found every 500 bases in the human genome, with 2.8 million tags giving 80 per patient. It is estimated that over 1,000,000 polymorphisms, or one polymorphism occurs every 35,000 bases of the human genome sequence.

  The number of restriction sequence tags obtained per individual can be adjusted by using different restriction enzymes or combinations of enzymes. For example, a plurality of restriction enzymes can be used in combination to increase the number of restriction sequence tags, or the method can be repeated sequentially with different enzymes. Alternatively, enzymes with longer recognition sites can be used alone or in combination to reduce the number of restriction sequence tags.

  When this method is repeated for the same sample or different samples, it is essential to produce identical restriction fragments, resulting in identical restriction sequence tags, except for variations due to changes in the genomic sequence between samples. is there. Theoretically, different restriction enzymes (eg, isosizomers) with the same recognition site can be used. However, in these examples, the same enzyme that originates from the same organism and the same supplier is used.

  Restriction digests are performed using at least 10 to 20 copies of the diploid genome per patient. That is, redundancy is introduced to ensure that each restriction sequence tag is presented.

3) Insertion of genomic restriction fragments into amplification and sequencing vectors In this example, DNA colonies are used for amplification and sequencing of genomic restriction fragments.

  Genomic restriction fragments are ligated to a DNA colony vector (ie, an engineered nucleic acid having a predetermined sequence) by performing a ligation reaction that results in a circular molecule. A DNA colony vector has the following characteristics: two ends that are compatible with the ends of the digested genomic DNA fragment and are preferably sticky (where such ends are responsible for self-ligation of the vector). Two recognition sites for type IIS restriction enzymes (such as BsmFI, BceA1, Eco57I or MmeI), each of which is located in the immediate vicinity of the ends; Oriented to cause cleavage within the genomic restriction fragment linked to the vector); recognition sites for the two sequencing primers, each of which is also near the end of the vector, Oriented to allow primer extension in the direction of the genomic restriction fragment ligated with the vector); And two amplification primers that are oriented to allow amplification of a portion of the inserted fragment (wherein they can overlap the sequence of the sequencing primer); and optionally use an amplification primer sequence A recognition site for a restriction enzyme that cleaves at a low frequency located outside the region to be amplified. Additional features of the DNA colony vector include additional restriction sites present within the amplified region, eg, for linearization of the DNA colony, or spacer sequences.

  In order to prevent concatenation of genomic restriction fragments, DNA colony vector molecules are used in molar excess compared to genomic restriction fragments.

4) A circular DNA molecule containing a DNA colony vector linked to a standardized genomic restriction fragment of insert size is then digested with a type IIs restriction enzyme. For example, when BceAI is used, BceAI cuts 14 bases in the inserted genomic fragment. After a filling reaction using a DNA polymerase such as the Klenow fragment of DNA polymerase I or a T4 DNA polymerase, the resulting blunt ends are ligated, whereby the 28 base portion of the ligated genomic restriction fragment (ie, the genomic restriction fragment). A cyclic molecule containing a 14-base moiety derived from each end of

  Longer inserts are made using an enzyme such as MmeI that cuts 20 bases outside of its recognition sequence. However, due to the fact that a 2 base 3 'overhang occurs, the reaction with a DNA polymerase such as the Klenow fragment of DNA polymerase I or T4 DNA polymerase removes 2 bases. In this case, the resulting ligated genomic restriction fragment is 36 bases in length.

5) Preparation of DNA colony template A DNA colony template is prepared using one or more cycles of PCR amplification in the presence of amplification primers. The sequence of the DNA template molecule comprises from the 5 ′ end to the 3 ′ end: the sequence of the first amplification primer in the forward direction; the sequence of the first sequencing primer in the forward direction (this is the first sequence A first recognition site for a type IIS restriction enzyme; a 28-base or 36-base ligated genomic restriction fragment obtained from a size normalization process (to digest genomic DNA) Including half of the recognition site of the restriction enzyme used); second recognition site of type IIS restriction enzyme; sequence of the second sequencing primer in the reverse direction (this is the sequence of the second amplification primer sequence and And the sequence of the second amplification primer in the reverse direction.

  Alternatively, a DNA colony template can be generated by simply restriction digesting the circular molecule obtained in the previous step, using a low-frequency cleavage enzyme that cuts the DNA colony vector outside the region amplified by the amplification primer. Can do.

6) Preparation of DNA colonies The first step for generating DNA colonies is to bind DNA colony template molecules and amplification primers to the solid surface, which can be, for example, functionalized glass or plastic ( For example, the surface of a NucleoLink tube (Nunc, Roskilde, Denmark), etc. The concentration of the DNA colony template and amplification primer molecules is determined after binding, and the concentration of the DNA colony template molecules into the DNA colony using the bound amplification primer. To enable localized amplification and to achieve the desired spacing between different DNA colonies, the surface is covered with a high density of amplification primer molecules and a relatively low density of DNA colony template molecules. like The total number of DNA colonies after amplification must be at least 10 to 20 times the number of different restriction fragments obtained from genomic DNA to ensure proper redundancy.1.4 million genomes In this example, where restriction fragments are generated, approximately 30 million DNA colonies are generated on a 3 square centimeter surface.

  Amplification is performed using isothermal techniques as described in Section 5.3 and PCT Publication No. 02/46456.

7) Sequencing of DNA colonies After amplification, the DNA colonies are made single-stranded by restriction digestion followed by denaturation. A first sequencing primer is then hybridized to the DNA colony vector. The surface is then incubated with a DNA polymerase such as T7 DNA polymerase and a mixture of only one of the four possible nucleotides. The mixture contains both the same type of fluorescently labeled nucleotides and unlabeled nucleotides, so that approximately one out of 10 of the incorporated nucleotides is fluorescently labeled. These labeled nucleotides are incorporated at the 3 ′ end of the primer when they are complementary to the sequence of the molecule within the DNA colony. After the primer extension step, images are taken with a fluorescence microscope (Axiovert 200 (Zeiss, Germany) equipped with an ORCA-ER CCD camera (Hamamatsu, Japan)) and the fluorescence position and intensity of each DNA colony is measured. This approach is repeated in a step-wise fashion by repeating all four different types of nucleotides one at a time. In each step, a predetermined base is used for incorporation and the resulting signal is measured for each DNA colony on the surface. In this step, the fluorescence intensity of a DNA colony incorporating one or more bases is proportionally stronger, whereas the fluorescence intensity of colonies not incorporating a base remains unchanged. By comparing the fluorescence intensity after the incorporation step with the intensity before the incorporation step, the amount of base incorporated into the DNA colony is determined. By tracking the continuous change in fluorescence intensity for each DNA colony and correlating that intensity with the identity of the base used for the extension step, the DNA sequence contained in each DNA colony is determined. .

  The sequencing process is repeated until 28 or 36 bases from the genomic fragment are read. The number of bases sequenced can be reduced by using sequencing primers that extend up to half of the recognition site of the restriction enzyme used for digestion of genomic DNA.

  If necessary, the extended first sequencing primer can be removed by denaturation and washing, and sequencing of the complementary strand can be performed using the second sequencing primer.

8) Restriction sequence tag The sequence obtained from sequencing the DNA colony is processed to identify two restriction sequence tags from each initial genomic restriction fragment. For example, when the enzyme MmeI is used to normalize the size of the ligated restriction fragment, the restriction sequence tag is derived from a length of 18 bases and from half of the restriction sites used for genomic DNA digestion. This is the length minus 3 bases. In the case of BceAI, the restriction sequence tag is 11 bases long.

  These two restriction sequence tags represent the ends of the first genomic restriction fragment. The two tags obtained for each DNA colony are physically close together on the genome (eg, on average 4096 bases apart) and are stored for further use. The position of the tag on the genome is a sequence consisting of 15 bases or 11 bases plus 6 bases of restriction sites of restriction enzymes used for digesting genomic DNA (ie, 21 bases or 17 bases) ).

9) Arrangement of restriction sequence tags and identification of sequence changes associated with the phenotype. Then, using a computer program to identify the different tags and determine the number of each restriction sequence tag for each individual, the restriction sequence tags Are compared. These tags are then compared between individuals to identify sequence changes associated with specific phenotypes in groups and populations of homologous tags. This comparison can be done by statistical analysis known in the art (such as hidden Markov chains or clustering methods). Tags can also be compared to previously obtained tags or to sequences from databases.

  Comparison of restriction sequence tags between the two populations can yield different results. For a given sequence change, the proportion of the two types of genetic changes in population 1 may differ from the proportion in population 2.

  In other examples, the percentage of various types of sequence variation may be similar or identical in the two populations. However, analysis of specific combinations of different genetic variants in individuals from each population may reveal that some combinations of variants are represented at different rates in the two populations. it can.

Examples of tags that could be obtained by the method of the present invention:
For individual 1, the following sequence is determined:
T1a = acgtgtcgatggctgatgggtaggtagt (SEQ ID NO: 13), found 23 times.
T1b = ggtggtgggaatgggattggaaatgttt (SEQ ID NO: 14), found 11 times.
T1c = ggtggtgggaatcggattggaaatgttt (SEQ ID NO: 15), found 8 times.
T1e = ccaaggtgatcggatgtaatggtattgt (SEQ ID NO: 16), found 13 times.
T1f = ccaaggtgatcggaagtaatggtattgt (SEQ ID NO: 17), found 5 times.

For individual 2, the following sequence is determined:
T2a = acgtgtcgatggctgatgggtaggtagt (SEQ ID NO: 13), found 18 times.
T2b = ggtggtgggaatgggattggaaatgttt (SEQ ID NO: 14), found 22 times.
T2c = ccaaggtgatcggatgtaatggtattgt (SEQ ID NO: 16), found 15 times.

For individual 3, the following sequence is determined:
T3a = acgtgtcgatggctgatgggtaggtagt (SEQ ID NO: 13), found 20 times.
T3b = ggtggtgggaatcggattggaaatgttt (SEQ ID NO: 15), found 24 times.
T3c = ccaaggtgatcggaagtaatggtattgt (SEQ ID NO: 17), found 17 times.

The following can be determined:
Tag T1a, tag T2a and tag T3a are identical and form group g1 of group-sequence Sg1 = T1a.
Tag T1b and tag T2b are identical and form group g2 of group-sequence Sg2 = T2b.
Tag T1c and tag T3b are identical and form group g3 of group-sequence Sg3 = T1c.
Tag T1e and tag T2c are identical and form group g4 of group-sequence Sg4 = T1e.
Tag T1f and tag T3c are identical and form group g5 of group-sequence Sg5 = T1f.

The following can be recognized:
Sg2 = ggtggtgggaat g ggattggaaatgttt (SEQ ID NO: 14)
Sg3 = ggtggtgggaat c ggattggaaatgttt (SEQ ID NO: 15)
Are identical up to one base, but they are each very different from Sg1, Sg4 and Sg5, and
Sg4 = ccaaggtgatcgga t gtaatggtattgt (SEQ ID NO: 16)
Sg5 = ccaaggtgatcgga a gtaatggtattgt (SEQ ID NO: 17)
Are identical up to one base, but they are each very different from Sg1, Sg2 and Sg3.

  The group G1 formed by Sg2 and Sg3, the group G2 formed by Sg4 and Sg5, and the group G3 formed by group Sg1 can then be created.

Since each individual has two different sets of chromosomes,
(1) Individual 1 possesses 2 copies of Sg1, 1 copy of Sg2, 1 copy of Sg3, 1 copy of Sg4, and 1 copy of Sg5,
(2) Individual 2 possesses 2 copies of Sg1, 2 copies of Sg2, and 2 copies of Sg4,
(3) It can be understood that the individual 3 possesses 2 copies of Sg1, 2 copies of Sg3, and 2 copies of Sg5.

Typical result 1
In group 1,
1000 copies of sequence tag Sg1
327 copies of sequence tag Sg2
673 copies of sequence tag Sg3
521 copies of sequence tag Sg4
479 copies of sequence tag Sg5
Is found.
In group 2,
1000 copies of sequence tag Sg1
345 copies of sequence tag Sg2
665 copies of sequence tag Sg3
502 copies of sequence tag Sg4
498 copies of sequence tag Sg5
Is found.

  It is concluded that these groups are not associated with phenotypic differences between populations because there is no significant difference between the composition of each of Group G1, Group G2 and Group G3 between Group 1 and Group 2. Can be attached.

Typical result 2
In group 1,
1000 copies of sequence tag Sg1
993 copies of sequence tag Sg2
7 copies of sequence tag Sg3
521 copies of sequence tag Sg4
479 copies of sequence tag Sg5
Is found.
In group 2,
1000 copies of sequence tag Sg1
946 copies of sequence tag Sg2
54 copies of sequence tag Sg3
502 copies of sequence tag Sg4
498 copies of sequence tag Sg5
Is found.

  It can be concluded that these groups are not associated with phenotypic differences between populations because there is no significant difference between the composition of groups G1 and G3 between population 1 and population 2. it can. Since there is a significant difference in the composition of group G2 between population 1 and population 2, it can be concluded that this group is related to phenotypic differences between populations. Furthermore, it can be concluded that the probability of belonging to the group 2 is higher for individuals holding the sequence Sg3 than for individuals holding the sequence Sg2.

Typical result 3
In group 1,
1000 copies of sequence tag Sg1
314 copies of sequence tag Sg2
686 copies of sequence tag Sg3
486 copies of sequence tag Sg4
514 copies of sequence tag Sg5
Is found.
In group 2,
1000 copies of sequence tag Sg1
289 copies of sequence tag Sg2
711 copies of sequence tag Sg3
511 copies of sequence tag Sg4
489 copies of sequence tag Sg5
Is found.

  There is no significant difference between the composition of group G1, group G2, and group G3 between group 1 and group 2. However, further analysis of the data can be performed by counting how many individuals carry the following combinations of sequence tags.

  This analysis shows a significant difference in the distribution of sequence tag combinations between population 1 and population 2. It can therefore be concluded that these combinations of sequence tags are associated with phenotypic differences between populations.

7). Cited References All references cited in this specification are specifically and individually described as if each individual publication or patent or patent application is incorporated by reference in its entirety for all purposes. As is indicated, the same in its entirety is hereby incorporated by reference for all purposes.

  Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The specific embodiments described herein are provided by way of example only, and thus the present invention covers the terms of the appended claims, as well as those claims. It shall be limited only by the scope of equivalents covered by the scope of rights.

FIG. 6 illustrates a method for identifying restriction sequence tags associated with a phenotype. Fig. 4 illustrates one embodiment of the present invention for determining restriction sequence tags. Fig. 4 illustrates one embodiment of the present invention for determining restriction sequence tags. One embodiment for determining restriction sequence tags by generating restriction fragments from the genome of an organism using restriction enzymes that cut on both sides of the recognition site is shown. One embodiment for determining restriction sequence tags by generating restriction fragments from the genome of an organism using restriction enzymes that cut on both sides of the recognition site is shown. One embodiment for determining restriction sequence tags by using type IIs endonuclease to generate restriction fragments from the genome of an organism is shown. One embodiment for determining restriction sequence tags by using type IIs endonuclease to generate restriction fragments from the genome of an organism is shown. One embodiment for determining restriction sequence tags by using double digestion (ie, rare cutter followed by high frequency cutter) to generate restriction fragments from the genome of the organism is shown. One embodiment for determining restriction sequence tags by using double digestion (ie, rare cutter followed by high frequency cutter) to generate restriction fragments from the genome of the organism is shown. FIG. 4 shows another embodiment for determining restriction sequence tags by using double digestion (ie, a first restriction enzyme and multiple second restriction enzymes) to generate restriction fragments derived from the genome of an organism. . FIG. 4 shows another embodiment for determining restriction sequence tags by using double digestion (ie, a first restriction enzyme and a number of second restriction enzymes) to generate restriction fragments derived from the genome of an organism. . FIG. 4 shows another embodiment for determining restriction sequence tags by using double digestion (ie, a first restriction enzyme and a number of second restriction enzymes) to generate restriction fragments derived from the genome of an organism. . FIG. 4 shows another embodiment for determining restriction sequence tags by using double digestion (ie, a first restriction enzyme and a number of second restriction enzymes) to generate restriction fragments derived from the genome of an organism. . FIG. 4 shows another embodiment for determining restriction sequence tags by using double digestion (ie, a first restriction enzyme and a number of second restriction enzymes) to generate restriction fragments derived from the genome of an organism. . FIG. 4 shows another embodiment for determining restriction sequence tags by using double digestion (ie, a first restriction enzyme and a number of second restriction enzymes) to generate restriction fragments derived from the genome of an organism. . The production of short DNA tags from cloned DNA fragments is shown. A long DNA fragment is cloned between the two BsmFI sites of the circular vector. BsmFI digestion leaves only the short DNA tag bound to the vector. After self-ligation, the circular vector contains an insert formed by a pair of tags, regardless of the length of the original DNA fragment insert. The analysis results of the product after the first ligation are shown. Λ phage DNA digested with Sau3AI was ligated with a BamHI digested / dephosphorylated first production vector. For analysis, the product was amplified by PCR using primers adjacent to the insertion site. The analysis result of the product after the second ligation is shown. The same sample as in FIG. 9B is further processed to normalize its size by BsmFI digestion and self-ligation to yield a circular vector. This product was amplified by PCR for analysis. An expected peak of 132 bp is observed. The analysis result of the 2nd coupling product obtained by the simplified reaction is shown. A plasmid containing only one insert was treated with BsmFI and self-ligated after Klenow enzyme treatment to generate blunt ends. For analysis, the product was amplified by PCR. No bands corresponding to fragments smaller than the correct size were observed. Figure 2 shows some possibilities for cloning DNA generated by digestion using two different enzymes into a second production vector. The analysis results of in vitro cloning into the second production vector are shown. ΛDNA digested with MspI and SphI was inserted into a vector digested with SphI and AccI. After digestion with BsmFI, a second ligation resulted in a normalized size insert, ie, a restriction sequence tag. The PCR product obtained by amplifying the last ligation reaction was analyzed. Only the correct size band was observed. The analysis result of the first ligation reaction when λDNA digested with AluI and SphI is inserted into a vector digested with HincII and SphI is shown. After PCR amplification for analysis, as expected, fragments of various sizes were observed using an Agilent 2100 Bioanalyzer DNA1000 chip for analysis. The strongest peak is the size marker. FIG. 10D shows the same sample analysis results as in FIG. 10C after the second connection. After PCR amplification for analysis, only one fragment of the expected size was observed using an Agilent 2100 Bioanalyzer DNA1000 chip. Peaks corresponding to size markers are shown in the figure. FIG. 4B shows a template preparation of HindIII and RsaI digested DNA using the single restriction sequence tag method illustrated in FIG. 4A. FIG. 4B shows a template preparation of HindIII and RsaI digested DNA using the single restriction sequence tag method illustrated in FIG. 4A. Shown are aliquots collected after various steps and analyzed by autoradiography. Lane 1: PCR product of complete DNA colony vector size (350 bp); Lanes 2-6: Lambda genomic DNA; Lanes 7-10: Human genomic DNA; Lanes 3 and 7: Numerous after ligation to short arm Lanes 4 and 8: size normalization is observed after digestion with MmeI; lanes 5, 6, 9 and 10: after ligation with long arm and therefore expected A DNA colony vector having a defined size. A DNA colony of λDNA is shown. DNA colonies of λ DNA (left column) or human DNA DNA colonies (first three images in the right column) are shown. These DNA colonies were then sequenced in situ using the method of WO 98/44152 to identify restriction sequence tags. Shows the creation of blunt ends from 3 ′ overhangs (exemplified for PstI digests) and partial filling of 5 ′ overhangs (exemplified for MspI digests) by Klenow polymerase in the presence of dCTP .

Claims (102)

A method for determining genome-wide sequence changes associated with the phenotype of one or more individual organisms, comprising:
I) Creating a set of restriction sequence tags for each individual organism of said one or more individual organisms by a method comprising A) and B) below A) To generate a set of restriction fragments Digesting nucleic acid from each said individual organism using one or more first restriction enzymes; and B) determining a set of restriction sequence tags for each said individual organism; Wherein the set of restriction sequence tags includes one or more restriction sequence tags for each of the restriction fragments, and each of the one or more restriction sequence tags includes a sequence in a corresponding restriction fragment; and II) Grouping the restriction sequence tags for the one or more individual organisms into one or more restriction sequence tags, each of which comprises a homologous restriction sequence tag. The method comprising,
The method wherein the one or more restriction sequence tags identify sequence changes associated with the organism. Said step of determining said set of restriction sequence tags comprises:
B1) ligating the restriction fragment in the set of restriction fragments with a first engineered nucleic acid to obtain a set of first circular nucleic acid fragments, wherein the first engineered nucleic acid is Comprising a predetermined nucleotide sequence comprising one or more recognition sites for a second restriction enzyme, wherein the recognition site is positioned and oriented such that the second restriction enzyme cuts within the restriction fragment;
B2) digesting the first circular nucleic acid fragment with the second restriction enzyme;
B3) modifying the ends generated by the second restriction enzyme to allow ligation;
B4) ligating the ends generated by the second restriction enzyme to create a set of second circular nucleic acid fragments; and B5) at least a portion of each of the restriction fragments in the second circular nucleic acid. The method of claim 1, wherein the method comprises sequencing and determining the set of restriction sequence tags.   The method of claim 2, wherein each of the one or more recognition sites is located near an end of the first engineered nucleic acid.   4. The method of claim 2 or 3, wherein each of the one or more recognition sites is located less than 25 nucleotides from the end of the first engineered nucleic acid.   5. The method according to any one of claims 2 to 4, wherein each of the one or more recognition sites is located 0-5 nucleotides away from the end of the first engineered nucleic acid.   The method according to any one of claims 2 to 5, wherein the second restriction enzyme is a type IIS endonuclease.   The method according to any one of claims 2 to 6, further comprising the step of immobilizing and amplifying the nucleic acid fragment contained in the second circular nucleic acid fragment on a solid surface before the step B5).   The step of fixing and amplifying is performed by generating colonies of the nucleic acid fragments in the second circular nucleic acid fragment on the solid surface, wherein each of the colonies is the second circular nucleic acid fragment 8. The method of claim 7, comprising a plurality of immobilized single stranded DNA molecules comprising one of said nucleic acid fragments in. The colony
i) linearizing said second circular nucleic acid fragment to produce a linearized fragment;
ii) providing a solid surface comprising a plurality of colony primers immobilized to the solid surface at the 5 'end, wherein each said colony primer is against the sequence at the 3' end of said linearized fragment A sequence that is capable of hybridizing;
iii) denaturing the linearized fragment to yield a single stranded fragment;
iv) annealing the single stranded fragment to the immobilized colony primer;
v) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
vi) denature the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
vii) annealing the immobilized single stranded fragment to the immobilized colony primer; and viii) said step v) such that each colony is present at a specific location on the solid surface. 9. A method according to claim 8, produced by a method comprising repeating step vii). The colony
i) linearizing said second circular nucleic acid fragment to produce a linearized fragment;
ii) mixing said linearized fragment with a colony primer, wherein each said colony primer has a sequence capable of hybridizing to the sequence at the 3 ′ end of said linearized fragment. Including;
iii) attaching the linearized fragment and colony primer to the solid surface at the 5 ′ end to yield an immobilized linearized fragment and an immobilized colony primer;
iv) denature the immobilized linearized fragment to yield an immobilized single stranded fragment;
v) annealing the immobilized single stranded fragment to an immobilized colony primer to obtain an annealed single stranded fragment;
vi) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
vii) denature the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
viii) annealing the immobilized single stranded fragment to an immobilized colony primer; and ix) said step v) so that each colony is present at a specific location on the solid surface. -Repeating step viii);
9. The method of claim 8, wherein the method is caused by a method comprising: The colony
i) linearizing said second circular nucleic acid fragment to produce a linearized fragment;
ii) mixing said linearized fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said linearized fragment And the concentration of the colony primer is adjusted so that amplification of the bound linearized fragment can occur;
iii) attaching the linearized fragment and colony primer to the solid surface at the 5 ′ end to yield an immobilized linearized fragment and an immobilized colony primer;
iv) adding an amplification solution containing polymerase and nucleotides to the solid surface such that the colonies, each present at a specific location on the solid surface, are isothermally generated;
9. The method of claim 8, wherein the method is caused by a method comprising: The sequencing is
i) hybridization of sequencing primers to the colonies;
ii) performing primer extension with one labeled nucleotide;
iii) detecting for each said position the amount of labeled nucleotide incorporated into the extended primer; and iv) determining a portion of the respective nucleotide sequence of said colony, steps ii) and Repeating step iii);
The method according to any one of claims 9 to 11, which is performed by a method comprising:   13. The method of claim 12, wherein the labeled nucleotide is a fluorescently labeled nucleotide and the detection involves detecting the fluorescence intensity of the labeled nucleotide. The first restriction enzyme cleaving both sides of the recognition site in a manner such that the cleavage site includes a portion of the sequence that is not part of the recognition site, and determining the set of restriction sequence tags; ,
B1) modifying the ends generated by the first restriction enzyme to allow ligation;
B2) ligating the restriction fragments in the set of restriction fragments with a first engineered nucleic acid comprising a predetermined nucleotide sequence to obtain a set of first circular nucleic acid fragments; and B3) the first The method of claim 1, wherein the method is performed by a method comprising sequencing at least a portion of each of the restriction fragments in a circular nucleic acid to determine the set of restriction sequence tags.   The method according to claim 14, further comprising the step of immobilizing and amplifying the nucleic acid fragment contained in the second circular nucleic acid fragment on a solid surface before the step B3).   The steps of fixing and amplifying are performed by generating colonies of the nucleic acid fragments in the first circular nucleic acid fragment on the solid surface, wherein each of the colonies is in the first circular nucleic acid fragment 16. The method of claim 15, comprising a plurality of immobilized single stranded DNA molecules having one of the nucleic acid fragments. The colony
i) linearizing said first circular nucleic acid fragment to produce a linearized fragment;
ii) providing a solid surface comprising a plurality of colony primers immobilized to the solid surface at the 5 'end, wherein each said colony primer is against the sequence at the 3' end of said linearized fragment A sequence that is capable of hybridizing;
iii) denaturing the linearized fragment to yield a single stranded fragment;
iv) annealing the single stranded fragment to the immobilized colony primer;
v) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
vi) denature the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
vii) annealing the immobilized single stranded fragment to the immobilized colony primer;
viii) repeating steps v) to vii) so as to produce the colonies each present at a specific location on the solid surface;
17. The method of claim 16, wherein the method is caused by a method comprising: The colony
i) linearizing said first circular nucleic acid fragment to produce a linearized fragment;
ii) mixing said linearized fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said linearized fragment ;
iii) attaching the linearized fragment and colony primer to the solid surface at the 5 ′ end to yield an immobilized linearized fragment and an immobilized colony primer;
iv) denature the immobilized linearized fragment to yield an immobilized single stranded fragment;
v) annealing the immobilized single stranded fragment to an immobilized colony primer to obtain an annealed single stranded fragment;
vi) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
vii) denature the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
viii) annealing the immobilized single stranded fragment to an immobilized colony primer; and ix) said step v) so that each colony is present at a specific location on the solid surface. -Repeating step viii);
17. The method of claim 16, wherein the method is caused by a method comprising: The colony
i) linearizing said first circular nucleic acid fragment to produce a linearized fragment;
ii) mixing said linearized fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said linearized fragment And the concentration of the colony primer is adjusted so that amplification of the bound linearized fragment can occur;
iii) attaching the linearized fragment and colony primer to the solid surface at the 5 ′ end to yield an immobilized linearized fragment and an immobilized colony primer;
iv) adding an amplification solution containing polymerase and nucleotides to the solid surface such that the colonies, each present at a specific location on the solid surface, are isothermally generated;
17. The method of claim 16, wherein the method is caused by a method comprising: The sequencing is
i) hybridization of sequencing primers to the colonies;
ii) performing primer extension with one labeled nucleotide;
iii) detecting for each said position the amount of labeled nucleotide incorporated into the extended primer; and iv) determining a portion of each sequence of said colony, steps ii) and steps repeating iii);
The method according to any one of claims 17 to 19, which is performed by a method comprising:   21. The method of claim 20, wherein the labeled nucleotide is a fluorescently labeled nucleotide and the detection involves detecting the fluorescence intensity of the labeled nucleotide. Said step of determining said set of restriction sequence tags comprises:
B1) ligating the restriction fragments in the set of restriction fragments with a first engineered nucleic acid to obtain a set of first nucleic acid fragments, wherein the first engineered nucleic acid is Comprising a predetermined nucleotide sequence comprising a recognition site for two restriction enzymes, wherein the recognition site is positioned and oriented such that the second restriction enzyme cuts within the restriction fragment;
B2) digesting the first nucleic acid fragment with the second restriction enzyme;
B3) modifying the ends generated by the second restriction enzyme to allow ligation;
B4) ligating the end generated by the second restriction enzyme with a second engineered nucleic acid comprising a predetermined nucleotide sequence to produce a second nucleic acid fragment; and B5) the second The method of claim 1, wherein the method is performed by a method comprising sequencing at least a portion of each of the restriction fragments in a nucleic acid fragment to determine the set of restriction sequence tags.   23. The method of claim 22, wherein the recognition site of the second restriction enzyme is located near the end of the first engineered nucleic acid.   24. The method of claim 22 or 23, wherein the recognition site is located less than 25 nucleotides from the end of the first engineered nucleic acid.   25. The method of any one of claims 22-24, wherein the recognition site is located 0-5 nucleotides away from the end of the first engineered nucleic acid.   26. The method according to any one of claims 22 to 25, wherein the second restriction enzyme is a type IIs endonuclease.   27. The method according to any one of claims 22 to 26, further comprising immobilizing and amplifying the nucleic acid fragment in the second nucleic acid fragment on a solid surface prior to step B5).   The step of fixing and amplifying is performed by generating colonies of the nucleic acid fragment in the second nucleic acid fragment on the solid surface, wherein each of the colonies is the nucleic acid in the second nucleic acid fragment 28. The method of claim 27, comprising a plurality of immobilized single stranded DNA molecules having one of the fragments. The colony
i) providing a solid surface comprising a plurality of colony primers immobilized to the solid surface at the 5 ′ end, wherein each said colony primer is relative to the sequence at the 3 ′ end of said second nucleic acid fragment Including sequences that are capable of hybridizing;
ii) denature the second nucleic acid fragment to produce a single stranded fragment;
iii) annealing the single stranded fragment to the immobilized colony primer;
iv) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
v) denaturing the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
vi) annealing the immobilized single stranded fragment to the immobilized colony primer;
vii) repeating the above steps iv) to vi) so that each of the colonies is present at a specific position on the solid surface;
30. The method of claim 28, caused by a method comprising: The colony
i) mixing said second nucleic acid fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said second nucleic acid fragment;
ii) attaching said second nucleic acid fragment and colony primer to a solid surface at the 5 ′ end to yield an immobilized nucleic acid fragment and an immobilized colony primer;
iii) denaturing the immobilized nucleic acid fragment to yield an immobilized single stranded fragment;
iv) annealing the immobilized single stranded fragment to an immobilized colony primer to obtain an annealed single stranded fragment;
v) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
vi) denature the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
vii) annealing the immobilized single stranded fragment to the immobilized colony primer; and viii) the above step iv) so that each colony is present at a specific location on the solid surface. Repeat step vii);
30. The method of claim 28, caused by a method comprising: The colony
i) mixing said second nucleic acid fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said second nucleic acid fragment; and , The concentration of the colony primer is adjusted so that amplification of the bound second nucleic acid fragment can occur;
iii) linking said second nucleic acid fragment and colony primer to a solid surface at the 5 ′ end to produce an immobilized second nucleic acid fragment and an immobilized colony primer;
iv) adding an amplification solution containing polymerase and nucleotides to the solid surface such that the colonies, each present at a specific location on the solid surface, are isothermally generated;
30. The method of claim 28, caused by a method comprising: The sequencing is
i) hybridization of sequencing primers to the colonies;
ii) performing primer extension with one labeled nucleotide;
iii) detecting, for each said position, the amount of labeled nucleotide incorporated into the extended primer; and iv) steps ii) and steps to determine a portion of each sequence of said colony repeating iii);
32. The method of any one of claims 29 to 31, wherein the method is performed by a method comprising:   35. The method of claim 32, wherein the labeled nucleotide is a fluorescently labeled nucleotide and the detection involves detecting the fluorescence intensity of the labeled nucleotide. The first restriction enzyme is a rare cutter and the step of determining the set of restriction sequence tags comprises:
B1) ligating the restriction fragments in the set of restriction fragments with a first engineered nucleic acid comprising a predetermined nucleotide sequence to obtain a set of first nucleic acid fragments;
B2) Digesting the first nucleic acid fragment with one or more second restriction enzymes to obtain a second restriction fragment, wherein the second restriction enzyme is the first restriction enzyme Are different and do not cleave within the first engineered nucleic acid;
B3) ligating the end of the second restriction fragment with a second engineered nucleic acid comprising a predetermined nucleotide sequence to produce a set of second nucleic acid fragments; and B4) the second restriction fragment The method of claim 1, wherein the method is performed by a method comprising sequencing at least a portion of each of the restriction fragments in a nucleic acid fragment to determine the set of restriction sequence tags.   The method according to claim 34, wherein the rare cutter recognizes a 6-base recognition sequence.   The method according to claim 34, wherein the rare cutter recognizes a recognition sequence of 8 bases or a recognition sequence of more than 8 bases.   37. The method of any one of claims 34 to 36, further comprising immobilizing and amplifying the nucleic acid fragment in the second nucleic acid fragment on a solid surface prior to step B4).   The step of fixing and amplifying is performed by generating colonies of the nucleic acid fragment in the second nucleic acid fragment on the solid surface, wherein each of the colonies is the nucleic acid in the second nucleic acid fragment 38. The method of claim 37, comprising a plurality of immobilized single stranded DNA molecules having one of the fragments. The colony
i) providing a solid surface comprising a plurality of colony primers immobilized to the solid surface at the 5 ′ end, wherein each said colony primer is relative to the sequence at the 3 ′ end of said second nucleic acid fragment Including sequences that are capable of hybridizing;
ii) denature the second nucleic acid fragment to produce a single stranded fragment;
iii) annealing the single stranded fragment to the immobilized colony primer;
iv) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
v) denaturing the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
vi) annealing the immobilized single stranded fragment to the immobilized colony primer;
vii) repeating the above steps iv) to vi) so that each of the colonies is present at a specific position on the solid surface;
40. The method of claim 38, wherein the method is caused by a method comprising: The colony
i) mixing said second nucleic acid fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said second nucleic acid fragment;
ii) attaching said second nucleic acid fragment and colony primer to a solid surface at the 5 ′ end to yield an immobilized second nucleic acid fragment and an immobilized colony primer;
iii) denaturing the immobilized second nucleic acid fragment to yield an immobilized single stranded fragment;
iv) annealing the immobilized single stranded fragment to an immobilized colony primer to obtain an annealed single stranded fragment;
v) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
vi) denature the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
vii) annealing the immobilized single stranded fragment to the immobilized colony primer; and viii) the above step iv) so that each colony is present at a specific location on the solid surface. Repeat step vii);
40. The method of claim 38, wherein the method is caused by a method comprising: The colony
i) mixing said second nucleic acid fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said second nucleic acid fragment; and The concentration of the colony primer is adjusted so that amplification of the bound second nucleic acid fragment can occur;
iii) linking said second nucleic acid fragment and colony primer to a solid surface at the 5 ′ end to produce an immobilized second nucleic acid fragment and an immobilized colony primer;
iv) adding an amplification solution containing polymerase and nucleotides to the solid surface such that the colonies, each present at a specific location on the solid surface, are isothermally generated;
40. The method of claim 38, wherein the method is caused by a method comprising: The sequencing is
i) hybridization of sequencing primers to the colonies;
ii) performing primer extension with one labeled nucleotide;
iii) detecting, for each said position, the amount of labeled nucleotide incorporated into the extended primer; and iv) steps ii) and steps to determine a portion of each sequence of said colony repeating iii);
42. A method according to any one of claims 39 to 41 performed by a method comprising:   43. The method of claim 42, wherein the labeled nucleotide is a fluorescently labeled nucleotide and the detection involves detecting the fluorescence intensity of the labeled nucleotide. The step of determining the set of restriction sequence tags comprises:
B1) ligating the restriction fragments in the set of restriction fragments with a first engineered nucleic acid comprising a predetermined nucleotide sequence to obtain a set of first nucleic acid fragments;
B2) digesting the first nucleic acid fragment with a second restriction enzyme to obtain a second restriction fragment, wherein the second restriction enzyme is different from the first restriction enzyme; Does not cleave within the first engineered nucleic acid;
B3) ligating the end of the second restriction fragment with a second engineered nucleic acid comprising a predetermined nucleotide sequence to produce a set of second nucleic acid fragments; and B4) the second restriction fragment The method of claim 1, wherein the method is performed by a method comprising sequencing at least a portion of each of the restriction fragments in a nucleic acid fragment to determine the set of restriction sequence tags.   45. The method of claim 44, further comprising repeating step B2) to step B4) for each of a plurality of different second restriction enzymes.   46. The method of claim 45, further comprising immobilizing and amplifying the nucleic acid fragment in the second nucleic acid fragment on a solid surface prior to step B4).   The step of fixing and amplifying is performed by generating colonies of the nucleic acid fragment in the second nucleic acid fragment on the solid surface, wherein each of the colonies is the nucleic acid in the second nucleic acid fragment 47. The method of claim 46, comprising a plurality of immobilized single stranded DNA molecules having one of the fragments. The colony
i) providing a solid surface comprising a plurality of colony primers immobilized to the solid surface at the 5 ′ end, wherein each said colony primer is relative to the sequence at the 3 ′ end of said second nucleic acid fragment Including sequences that are capable of hybridizing;
ii) denature the second nucleic acid fragment to produce a single stranded fragment;
iii) annealing the single stranded fragment to the immobilized colony primer;
iv) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
v) denaturing the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
vi) annealing the immobilized single stranded fragment to the immobilized colony primer;
vii) repeating the above steps iv) to vi) so that each of the colonies is present at a specific position on the solid surface;
48. The method of claim 47, wherein the method is caused by a method comprising: The colony
i) mixing said second nucleic acid fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said second nucleic acid fragment;
ii) attaching said second nucleic acid fragment and colony primer to a solid surface at the 5 ′ end to yield an immobilized nucleic acid fragment and an immobilized colony primer;
iii) denaturing the immobilized nucleic acid fragment to yield an immobilized single stranded fragment;
iv) annealing the immobilized single stranded fragment to an immobilized colony primer to obtain an annealed single stranded fragment;
v) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
vi) denature the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
vii) annealing the immobilized single stranded fragment to the immobilized colony primer; and viii) the above step iv) so that each colony is present at a specific location on the solid surface. Repeat step vii);
48. The method of claim 47, wherein the method is caused by a method comprising: The colony
i) mixing said second nucleic acid fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said second nucleic acid fragment; and , The concentration of the colony primer is adjusted so that amplification of the bound second nucleic acid fragment can occur;
iii) linking said second nucleic acid fragment and colony primer to a solid surface at the 5 ′ end to produce an immobilized second nucleic acid fragment and an immobilized colony primer;
iv) adding an amplification solution containing polymerase and nucleotides to the solid surface such that the colonies, each present at a specific location on the solid surface, are isothermally generated;
48. The method of claim 47, wherein the method is caused by a method comprising: The sequencing is
i) hybridization of sequencing primers to the colonies;
ii) performing primer extension with one labeled nucleotide;
iii) detecting for each said position the amount of labeled nucleotide incorporated into the extended primer; and iv) determining a portion of each sequence of said colony, steps ii) and steps repeating iii);
51. A method according to any one of claims 48 to 50 performed by a method comprising:   52. The method of claim 51, wherein the labeled nucleotide is a fluorescently labeled nucleotide and the detection involves detecting the fluorescence intensity of the labeled nucleotide. Said step of determining said set of restriction sequence tags comprises:
B1) ligating the restriction fragments in the set of restriction fragments with a first engineered nucleic acid to obtain a set of first circular nucleic acid fragments, wherein the first engineered nucleic acid is A predetermined nucleotide sequence including a recognition site for a second restriction enzyme and two recognition sites for a third restriction enzyme, wherein the recognition site for the second restriction enzyme is the 2 of the third restriction enzyme. Disposed between two recognition sites, wherein the recognition site of the third restriction enzyme is positioned and oriented such that the third restriction enzyme cuts within the restriction fragment, and the second restriction enzyme and The third restriction enzymes are different from each other;
B2) digesting the first nucleic acid fragment with the second restriction enzyme to obtain a set of second nucleic acid fragments;
B3) ligating the ends of the second restriction fragment to create a set of second circular nucleic acid fragments; and B4) sequencing at least a portion of each of the restriction fragments in the third circular nucleic acid fragment. The method of claim 1, wherein the method is performed by a method comprising determining and determining the set of restriction sequence tags. After step B3)
B5) digesting the second circular nucleic acid fragment with the third restriction enzyme to produce a set of third nucleic acid fragments;
B6) modifying the ends generated by the third restriction enzyme to allow ligation; and B7) ligating the ends of the third nucleic acid fragment to form a set of third circular nucleic acid fragments. 54. The method of claim 53, further comprising the step of making.   54. The method of claim 53, further comprising repeating step B1) to step B4) for each of a plurality of different second restriction enzymes.   56. The method of any one of claims 53 to 55, wherein each of the recognition sites is located near the end of the first engineered nucleic acid.   57. The method of any one of claims 53 to 56, wherein each of the recognition sites is located less than 25 nucleotides away from the end of the first engineered nucleic acid.   58. The method of any one of claims 53 to 57, wherein each of the recognition sites is located 0 to 5 nucleotides away from the end of the first engineered nucleic acid.   59. The method according to any one of claims 53 to 58, wherein the second restriction enzyme is a type IIs endonuclease.   60. The method of claim 59, further comprising immobilizing and amplifying nucleic acid fragments in the second circular nucleic acid fragment on a solid surface prior to step B4).   The steps of fixing and amplifying are performed by generating colonies of the nucleic acid fragments in the second circular nucleic acid fragment on the solid surface, wherein each of the colonies is in the second circular nucleic acid fragment 61. The method of claim 60, comprising a plurality of immobilized single stranded DNA molecules having one of the nucleic acid fragments. The colony
i) linearizing said second circular nucleic acid fragment to produce a linearized fragment;
ii) providing a solid surface comprising a plurality of colony primers immobilized on the solid surface at the 5 ′ end, wherein each said colony primer is against the sequence at the 3 ′ end of said linearized fragment A sequence that is capable of hybridizing;
iii) denaturing the linearized fragment to yield a single stranded fragment;
iv) annealing the single stranded fragment to the immobilized colony primer;
v) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
vi) denature the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
vii) annealing the immobilized single stranded fragment to the immobilized colony primer;
viii) repeating steps v) to vii) so as to produce the colonies each present at a specific location on the solid surface;
62. The method of claim 61, caused by a method comprising: The colony
i) linearizing said second circular nucleic acid fragment to produce a linearized fragment;
ii) mixing said linearized fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said linearized fragment ;
iii) attaching the linearized fragment and colony primer to the solid surface at the 5 ′ end to yield an immobilized linearized fragment and an immobilized colony primer;
iv) denature the immobilized linearized fragment to yield an immobilized single stranded fragment;
v) annealing the immobilized single stranded fragment to an immobilized colony primer to obtain an annealed single stranded fragment;
vi) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
vii) denature the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
viii) annealing the immobilized single stranded fragment to an immobilized colony primer; and ix) said step v) so that each colony is present at a specific location on the solid surface. -Repeating step viii);
62. The method of claim 61, caused by a method comprising: The colony
i) linearizing said second circular nucleic acid fragment to produce a linearized fragment;
ii) mixing said linearized fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said linearized fragment And the concentration of the colony primer is adjusted so that amplification of the bound linearized fragment can occur;
iii) attaching the linearized fragment and colony primer to the solid surface at the 5 ′ end to yield an immobilized linearized fragment and an immobilized colony primer;
iv) adding an amplification solution containing polymerase and nucleotides to the solid surface such that the colonies, each present at a specific location on the solid surface, are isothermally generated;
62. The method of claim 61, caused by a method comprising: The sequencing is
i) hybridization of sequencing primers to the colonies;
ii) performing primer extension with one labeled nucleotide;
iii) detecting for each said position the amount of labeled nucleotide incorporated into the extended primer; and iv) determining a portion of the respective nucleotide sequence of said colony, steps ii) and Repeating step iii);
65. A method according to any one of claims 62 to 64, wherein the method is performed by a method comprising:   66. The method of claim 65, wherein the labeled nucleotide is a fluorescently labeled nucleotide and the detection involves detecting the fluorescence intensity of the labeled nucleotide. Said step of determining said set of restriction sequence tags comprises:
B1) ligating the restriction fragment in the set of restriction fragments with a first engineered nucleic acid to obtain a set of first nucleic acid fragments, wherein the first engineered nucleic acid is the A predetermined nucleotide sequence comprising a recognition site for a second restriction enzyme that is different from the first restriction enzyme;
B2) digesting the first nucleic acid fragment with the second restriction enzyme to obtain a set of second nucleic acid fragments;
B3) ligating the ends of the second restriction fragment to create a set of first circular nucleic acid fragments; and B4) sequencing at least a portion of each of the fourth nucleic acid fragments, thereby The method of claim 1, wherein the method is performed by a method comprising determining the set of restriction sequence tags. After step B3)
B5) digesting the first circular nucleic acid fragment with a third restriction enzyme different from the first and second restriction enzymes to produce a set of third nucleic acid fragments;
B6) modifying the ends generated by the third restriction enzyme to allow ligation; and B7) ligating the ends of the third nucleic acid fragment to form a set of second circular nucleic acid fragments. 68. The method of claim 67, further comprising the step of making.   68. The method of claim 67, further comprising repeating step B1 to step B4) for each of a plurality of different second restriction enzymes.   70. The method of claim 69, further comprising immobilizing and amplifying the nucleic acid fragment in the first circular nucleic acid fragment on a solid surface prior to step B4).   The steps of immobilizing and amplifying are performed by generating colonies of the nucleic acid fragments in the first circular nucleic acid fragment on the solid surface, wherein each of the colonies in the first circular nucleic acid fragment 71. The method of claim 70, comprising a plurality of immobilized single stranded DNA molecules having one of the nucleic acid fragments. The colony
i) linearizing said first circular nucleic acid fragment to produce a linearized fragment;
ii) providing a solid surface comprising a plurality of colony primers immobilized to the solid surface at the 5 'end, wherein each said colony primer is against the sequence at the 3' end of said linearized fragment A sequence that is capable of hybridizing;
iii) denaturing the linearized fragment to yield a single stranded fragment;
iv) annealing the single stranded fragment to the immobilized colony primer;
v) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
vi) denature the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
vii) annealing the immobilized single stranded fragment to the immobilized colony primer;
viii) repeating steps v) to vii) so as to produce the colonies each present at a specific location on the solid surface;
72. The method of claim 71, wherein the method is caused by a method comprising: The colony
i) linearizing said first circular nucleic acid fragment to produce a linearized fragment;
ii) mixing said linearized fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said linearized fragment ;
iii) attaching the linearized fragment and colony primer to the solid surface at the 5 ′ end to yield an immobilized linearized fragment and an immobilized colony primer;
iv) denature the immobilized linearized fragment to yield an immobilized single stranded fragment;
v) annealing the immobilized single stranded fragment to an immobilized colony primer to obtain an annealed single stranded fragment;
vi) performing a primer extension reaction using the annealed single stranded fragment as a template to generate an immobilized double stranded nucleic acid fragment;
vii) denature the immobilized double stranded nucleic acid fragment to yield an immobilized single stranded fragment;
viii) annealing the immobilized single stranded fragment to an immobilized colony primer; and ix) said step v) so that each colony is present at a specific location on the solid surface. -Repeating step viii);
72. The method of claim 71, wherein the method is caused by a method comprising: The colony
i) linearizing said first circular nucleic acid fragment to produce a linearized fragment;
ii) mixing said linearized fragment with a colony primer, wherein each said colony primer comprises a sequence capable of hybridizing to a sequence at the 3 ′ end of said linearized fragment And the concentration of the colony primer is adjusted so that amplification of the bound linearized fragment can occur;
iii) attaching the linearized fragment and colony primer to the solid surface at the 5 ′ end to yield an immobilized linearized fragment and an immobilized colony primer;
iv) adding an amplification solution containing polymerase and nucleotides to the solid surface such that the colonies, each present at a specific location on the solid surface, are isothermally generated;
72. The method of claim 71, wherein the method is caused by a method comprising: The sequencing is
i) hybridization of sequencing primers to the colonies;
ii) performing primer extension with one labeled nucleotide;
iii) detecting, for each said position, the amount of labeled nucleotide incorporated into the extended primer; and iv) steps ii) and steps to determine a portion of each sequence of said colony repeating iii);
75. A method according to any one of claims 72 to 74 performed by a method comprising:   76. The method of claim 75, wherein the labeled nucleotide is a fluorescently labeled nucleotide and the detection involves detecting the fluorescence intensity of the labeled nucleotide.   The method according to any one of the preceding claims, wherein in step A), the method further comprises digesting the set of restriction fragments with a plurality of different first restriction enzymes.   A method according to any one of the preceding claims, wherein each said group consists of restriction sequence tags having at least 60% homology.   79. The method of claim 78, wherein each said group consists of restriction sequence tags having at least 70% homology.   80. The method of claim 79, wherein each said group consists of restriction sequence tags having at least 80% homology.   81. The method of claim 80, wherein each said group consists of restriction sequence tags having at least 90% homology.   84. The method of claim 81, wherein each said group consists of restriction sequence tags having at least 99% homology. A method for determining genome-wide sequence variation among a plurality of different phenotypes, comprising:
A) determining, for each population of organisms, a set of restriction sequence tags by the method of any one of the preceding claims, wherein said population of organisms has said plurality of different phenotypes Each contains one or more organisms;
B) A method comprising comparing various said sets of restriction sequence tags between organisms of different phenotypes to determine one or more sequence changes associated with different phenotypes.   84. The method of claim 83, further comprising, after the step B), mapping the one or more restriction sequence tags to the genome sequence of the organism to identify the genomic location of the one or more restriction sequence tags. the method of.   77. The method of any one of claims 45-52, 55-66, and 69-76, wherein the plurality of different second restriction enzymes is comprised of at least three different restriction enzymes. A method for determining genome-wide sequence variation among a plurality of different phenotypes, comprising:
A) determining, for each population of organisms, a set of restriction sequence tags by the method of claim 85, wherein said population of organisms is one or more for each of said plurality of different phenotypes. Including organisms of
B) A method comprising comparing various said sets of restriction sequence tags between organisms of different phenotypes to determine one or more sequence changes associated with different phenotypes.   87. The method of claim 86, further comprising, after the step B), mapping the one or more restriction sequence tags to the genome sequence of the organism to identify the genomic location of the one or more restriction sequence tags. the method of.   77. The method of any one of claims 45-52, 55-66, and 69-76, wherein the plurality of different second restriction enzymes is comprised of at least 10 different restriction enzymes. A method for determining genome-wide sequence variation among different phenotypes, comprising:
A) determining, for each population of organisms, a set of restriction sequence tags according to the method of claim 88, wherein said population of organisms is one or more for each of said plurality of different phenotypes. Including organisms of
B) A method comprising comparing various said sets of restriction sequence tags between organisms of different phenotypes to determine one or more sequence changes associated with different phenotypes.   90. The method of claim 89, further comprising, after the step B), mapping the one or more restriction sequence tags to the genome sequence of the organism to identify the genomic location of the one or more restriction sequence tags. the method of.   83. The method according to any one of claims 1 to 82, wherein the one or more individual organisms are humans.   83. The method of any one of claims 1 to 82, wherein each said set of restriction fragments comprises at least 10 different restriction fragments.   83. The method of any one of claims 1 to 82, wherein each said set of restriction fragments comprises at least 100 different restriction fragments.   83. The method of any one of claims 1 to 82, wherein each said set of restriction fragments comprises at least 1000 different restriction fragments.   83. The method according to any one of claims 1 to 82, wherein each said set of restriction fragments comprises at least 10,000 different restriction fragments.   83. The method according to any one of claims 1 to 82, wherein each said set of restriction fragments comprises at least 100,000 different restriction fragments. 83. The method of any one of claims 1 to 82, wherein each said set of restriction fragments comprises at least 10 < ⁶ > different restriction fragments. Each of the set of restriction fragment comprises at least 10 ⁷ different restriction fragment, method of any one of claims 1 to 82. 83. The method according to any one of claims 1 to 82, wherein each said set of restriction fragments comprises at least 10 < ⁸ > different restriction fragments.   The method according to any one of the preceding claims, wherein step I) is performed on one individual.   The method according to any one of the preceding claims, wherein said step II) of grouping restriction sequence tags further comprises comparing said restriction sequence tag to a reference sequence.   102. The method of claim 101, wherein the reference sequence comprises the organism's genomic sequence.

Images