IE19930227A1 - Kit for use in amplifying and detecting nucleic acid sequences - Google Patents

Abstract

ABSTRACT The present invention is directed to a kit for the amplification and detection of at least one specific nucleic acid sequence in a sample, which kit comprises in packaged form, a multicontainer unit comprising: (a) primer for each different specific nucleic acid sequence being amplified and detected, selected so as to provide a primer substantially complementary to each strand of each specific sequence such that the extension product synthesized from one primer, when it is separated from its complement, serves as a template for synthesis of an extension product of the other primer; (b) means for synthesizing primer extension products; and (c) means for detecting the amplified sequence or sequences.

Description

KIT FOR USE IN AMPLIFYING AND DETECTING NUCLEIC ACID SEQUENCES The present invention relates to a kit for use in amplifying existing nucleic acid sequences if they are present in the test sample and detecting them if present by using a probe. The invention can be used by employing a process for producing any particular nucleic acid sequence from a given sequence of DNA or RNA in amounts which are large compared to the amount initially present so as to facilitate detection of the sequences. The DNA or RNA may 63 single— or double—stranded, and may be a relatively pure species or a component of a mixture of nucleic acids. The process utilizes arepetitive reaction to accomplish the amplification of the desired nucleic acid sequence.

For diagnostic applications in particular, the target nucleic acid sequence may be only a small portion of the DNA or RNA in question, so that it may be difficult to detect its presence using nonisotopically labeled or end-labeled oligonucleotide probes. Much effort is being expended in increasing the sensitivity of the probe detection systems, but little research has been conducted on amplifying the target sequence so that it is present in quantities sufficient to be readily detectable using currently available methods.

Several methods have been described in the literature for the synthesis of nucleic acids de novo or from an existing sequence.

These methods are capable of producing large amounts of a given nucleic acid of completely specified sequence.

One known method for synthesizing nucleic acids de novo involves the organic synthesis of a nucleic acid from nucleoside derivatives. This synthesis may be performed in solution or on a solid support. One type of organic synthesis is the phosphotriester method, which has been utilized to prepare gene fragments or short genes. In the phosphotriester method, oligonucleotides are prepared '_'E93U2z7 which can then be joined together to form longer nucleic acids. For a description of this method, see Narang, S.A., et al., Meth. Enzymol., 53;, 90 (1979) and U.S. Patent No. 4,356,270. synthesis and cloning of the somatostatin gene.

The patent describes the A second type of organic synthesis is the phosphodiester method, which has been utilized to prepare a tRNA gene.

E.L., et al., Meth. Enzymol., jgi, 109 (1979) for a description of this method. As in the phosphotriester method, the phosphodiester method involves synthesis of oligonucleotides which are subsequently joined See Brown, together to form the desired nucleic acid.

Although the above processes for de novo synthesis may be utilized to synthesize long strands of nucleic acid, they are not very practical to use for the synthesis of large amounts of a nucleic Both expensive equipment and reagents, and have a low overall efficiency. acid. processes are laborious and time-consuming, require The low overall efficiency may be caused by the inefficiencies of the synthesis of the oligonucleotides and of the joining reactions. In the synthesis of a long nucleic acid, or even in the synthesis of a large amount of a shorter nucleic acid, many oligonucleotides would need to be synthesized and many joining reactions would be required.

Consequently, these methods would not be practical for synthesizing large amounts of any desired nucleic acid.

Methods nucleic acids in large small also exist for producing of the These methods involve the cloning of a nucleic acid in the appropriate host appropriate vector which is used to transform the host. amounts from amounts initial existing nucleic acid. inserted into an when the host system, where the desired nucleic acid is is cultured the vector is replicated, and hence more copies of the desired nucleic acid are produced. For a brief description of subcloning nucleic acid fragments, see Maniatis, T., et al., Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, pp. 390— 401 (1982). See also the techniques described in U.S. Patent Nos. ,416,988 and 4,403,036.

Molecular E93022? A third method for synthesizing nucieic acids, described in U.S. Patent No. 4,293,652, is a hybrid of the above-described organic in this the appropriate number of oiigonucieotides to make up the desired nucleic synthesis and molecular cloning methods. process, acid sequence is organically synthesized and inserted sequentially into a vector which is amplified by growth prior to each succeeding insertion.

The process which can be used in the present invention bears some similarity to the molecular cloning method; however, it dpes not involve the propagation of any organism and-thereby avoids the possible hazards or inconvenience which this entails. The process also does not require synthesis of nucleic acid sequences unrelated ‘to the desired sequence, and thereby obviates the need ‘for extensive purification of the product from a complicated biological mixture.

In J.Mol.Biol, 56 (1971), 341-361, Kleppe et al discuss primer extension reactions using templates corresponding to portions of a tRNA gene, in which reactions the primers are used are complementary to substantial parts of corresponding templates and are extended therealong thereby to provide duplex DNAs. copying reactions, involving simple primer These template extension, are termed "repair replication" by the authors. The final paragraph of the article theorises that if duplex DNA denaturation is effected in the presence of appropriate primers, two structures consisting of a full length template strand complexed to a primer could be produced upon cooling, and repair replication achieved by adding DNA polymerase. - The paragraph suggests that this process could be repeated. s 0 IE93022W However, there is no detailed explanation of the precise techniques to be carried out, nor any discussion of which primers are "appropriate", and the possibility of a problem of template renaturation (reforming a duplex) is discussed with the suggestion that, if necessary, strand separation would have to be resorted to with subsequent repair replication. '33 kit of the present invention may be used in a process for amplifying one or more specific nucleic acid sequences present in a nucleic acid or mixture thereof using primers and agents for polymerization and then detecting the amplified sequence. The extension product of one primer when hybridized to the other becomes a template for the production of the desired specific nucleic acid sequence, and vice versa, and the process is repeated as often as is necessary to produce the desired amount of the sequence. This method is expected to be more efficient than the methods described above for DP0dUCl"9 large amounts of nucleic acid from a target sequence and to produce such nucleic acid in a comparatively short period of time. The method is especially useful for amplifying rare species of nucleic acid present in a mixture of nucleic acids for effective detection of such species.

E9302!’ More specifically, the present invention provides a kit for the amplification and detection of at least one specific nucleic acid sequence in a sample, which kit comprises in packaged form, a multicontainer unit comprising: (a) primer for each different specific nucleic acid sequence being amplified and detected, selected so as to provide a primer substantially complementary to each strand of each specific sequence such that W‘ the extension product synthesized from one primer, I when it'is separated from its complement, serves as a template for synthesis of an extension product of the other primer; (b) means for synthesizing primer extension products; and (c) means for detecting the amplified sequence or sequences.

The invention further provides the use of a kit as above for enabling detection and/or characterization of specific nucleic acid sequences associated with infectious diseases such as those caused by bacteria, viruses and protozoan parasites, genetic disorders such as those caused by specific deletions and/or mutations in genomic DNA or cellular disorders such as cancer.

Co—pending European Application No 201184 discloses processes for amplifying nucleic acid sequences, and this Application is divided from European Application No 86 .4. lE93fl227 Figure 1 illustrates a 94 base pair length sequence of human -globin desired to be amplified. The single base pair change which is associated with‘%ickle cell anemia is depicted beneath the 94-mer.

Figure 2 illustrates a photograph of an ethidium bromide- stained polyacrylamide gel demonstrating amplification of the 94-mer contained in human wild—type DNA and in a plasmid containing a 1.9 kb BamHI fragment of the normal 5-globin gene (designated pBR328:HbA). target 94-mer sequence present plasmid be amplified has been treated but not cleaved with Mstll.

Figure 4 illustrates in detail the steps and products of the polymerase chain reaction for amplification of the desired 94-mer sequence of human B-globin for three cycles using two oligonucleotide primers.

Figure 5 represents a photograph of an ethidium bromide- stained polyacrylamide gel demonstrating amplification after four cycles of a 240-mer sequence in pBR328:HbA, where the aliquots are digested with Ncol (Lane 3), MstII (Lane 4) or HinfI (Lane 5). is the molecular weight standard and Lane 2 contains the intact 240-bp Lane 1 product.

Figure 6 illustrates the sequence of the normal (BA) and sickle cell (as) 5-globin genes in the region of the DdeI and Hinfl |E93022I restriction sites, where the single lines for BA mark the position of the Ddel site (CTGAG) and the double bars for BA and 53 mark the position of the Hinfl site (GACTC).

Figure 7 illustrates the results of sequential digestion of normal B-globin using a 40-mer probe and Ddel followed by Hinfl restriction enzymes.

Figure 8 illustrates the results of sequential digestion of sickle B-globin using the same 40-mer probe as in Figure 7 and Ddel followed by Hinfl restriction enzymes. ‘'3 Figure 9_ illustrates a photograph of an ethidium bromide- stained polyacrylamide gel demonstrating the use of the same 40-mer probe as in Figure 7 to specifically characterize the beta-globin human DNA with the alleles present in samples of whole which have been subjected to amplification, hybridization probe, and sequential digestion with Ddel and Hinfl.

Figure 10 illustrates a photograph of a 6% Nusieve agarose gel visualized using ethidium bromide and UV light. This photograph demonstrates amplification of a sub—fragment of a 110-bp amplification product which sub-fragment is an inner nested set within the 110-bp fragment.

The term "oligonucleotide" as used herein in referring to primers, probes, oligomer fragments to be detected, oligomer controls and unlabeled blocking oligomers is defined as a molecule comprised of two or more deoxyribonucleotides or ribonucleotides, preferably more than three. Its exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide.

The term "primer" as used herein refers to an oligonucleotide whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is induced, ‘i.e., ‘in the complementary to a nucleic acid strand is presence of nucleotides and an agent for polymerization such as DNA |E930227 polymerase and at a suitable temperature and pH. The primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to The primer must be sufficiently long to prepare extension products. Preferably, primer is an oligodeoxyribonucleotide. prime the synthesis of extension products in the presence of the agent for polymerization. The exact lengths of the primers will depend on many factors, including temperature and source of primer. For example, depending‘ on the complexity of the target sequence, the oligonucleotide primer typically contains 15-25 or more nucleotides, although Short primer molecules stable it may contain fewer nucleotides. generally require cooler temperatures to form sufficiently hybrid complexes with template.

The herein selected to be "substantially" complementary to the different strands of each specific sequence to be This that the complementary to hybridize with their respective strands. the template. attached to the 5' end of the primer, with the remainder of the primer primers are amplified. means primers must be sufficiently Therefore, primer sequence need not reflect the exact sequence of the For example, a non—complementary nucleotide fragment may be sequence being complementary to the strand. Alternatively, non- complementary bases or longer sequences can be interspersed into the primer, that the complementarity with the sequence of the strand to be amplified to hybridize therewith and thereby form a template for synthesis of the extension product of the other primer. provided primer sequence has sufficient As used herein, the terms "restriction endonucleases" and "restriction enzymes" refer to bacterial enzymes each of which cut double-stranded DNA at or near a specific nucleotide sequence.

As used herein, the term "DNA polymorphism" refers to condition in which two or more different nucleotide sequences exist at a particular site in DNA. - - lE930227 The term "restriction fragment length polymorphism" ("RFLP") refers to the differences among individuals in the lengths of restriction fragments formed by digestion with a particular restriction endonuclease.

The present invention is directed to a process for amplifying any one or more desired specific nucleic acid sequences Because large amounts of a suspected of being in a nucleic acid. sequence may be produced by this process, the present specific invention may be used for improving the efficiency of cloning DNA or RNA and. for detection thereof.‘ messenger amplifying a target sequence to facilitate In general, the present process involves a chain reaction for producing, in exponential quantities relative to the number of reaction steps involved, at least one specific nucleic acid sequence given (a) that the of the sufficient detail that oligonucleotides can be synthesized which will hybridize to them, and (b) that a available to initiate the chain reaction. ends required sequence are known in small amount of the sequence is The product of the chain reaction will be a discrete nucleic acid‘ duplex with termini corresponding to the ends of the specific primers employed.

Any source of nucleic acid, in purified or nonpurified form, can be utilized as the starting nucleic acid or acids, provided it is suspected of containing the specific nucleic acid sequence desired. Thus, the process may employ, for example, DNA or RNA, including messenger RNA, which DNA or RNA may be single stranded or a DNA-RNA hybrid which contains one A mixture of any of these nucleic double stranded. In addition, strand of each may be utilized. acids may also be employed, or the nucleic acids produced from a previous amplification reaction herein using the same or different primers may be so utilized. The specific nucleic acid sequence to be amplified may be only a fraction of a larger molecule or can be so that the It is-not necessary present initially as a discrete molecule, specific sequence constitutes the entire nucleic acid. that the sequence to be amplified be present initially in a pure form; |E930z it may be a minor fraction of a complex mixture, such as a portion of the B-globin gene contained in whole human DNA or a portion of nucleic acid sequence due to a particular microorganism which organism might fraction of a particular biological constitute only a very minor sample. The starting nucleic acid may contain more than one desired specific nucleic acid sequence which may be the same or different.

Therefore, the present process is useful not only for producing large amounts of one specific nucleic acid sequence, but also for amplifying simultaneously more than one different specific nucleic acid sequence located on the sameror different nucleic acid molecules.

The nucleic acid or acids may be obtained from any source, for example, from plasmids such as pBR322, from cloned DNA or RNA, or including bacteria, yeast, DNA or RNA tissue material such as chorionic villi from natural DNA or RNA from any source, viruses, and higher organisms such as plants or animals. may be extracted from blood, or amniotic cells by a variety of techniques such as that described by Maniatis et al., Molecular Cloning (1982), 280-281.

Any specific nucleic acid sequence can be produced by the present process. It is only necessary that a sufficient number of bases at both ends of the sequence be known in sufficient detail so that two oligonucleotide primers can be prepared which will hybridize to different strands of the desired sequence and at relative positions along the sequence such that an extension product synthesized from one primer, when it is separated from its template (complement), can serve as a template for extension of the other primer into a nucleic acid of defined length. The greater the knowledge about the bases at both ends of the sequence, the greater can be the specificity of the primers for the target nucleic acid sequence, and thus the greater the efficiency of the process. It will be understood that the word primer as used hereinafter may refer to more than one primer, particularly in the case where there is some ambiguity in the information regarding the terminal sequence(s) of the fragment to be amplified. For instance, in the case where a nucleic acid sequence is_inferred from protein sequence information a collection of primers containing representing all possible codon based on sequences variations !’ degeneracy of the genetic code will be used for each strand. One primer from this collection will be homologous with the end of the desired sequence to be amplified.

The oligonucleotide primers may be prepared using any suitable method, such as, for example, the phosphotriester and phosphodiester methods described above, or automated embodiments thereof. In one such automated embodiment diethylphosphoramidites are used as starting materials and may be synthesized as described by 2221859-1862. One method solid support is Beaucage et al., Tetrahedron Letters (1981), for synthesizing vligonucleotides on a modified described in U.S. fiatent No. 4,458,066. primer which has been isolated frmn a biological source (such as a It is also possible to use a restriction endonuclease digest).

The specific nucleic acid sequence is produced by using the nucleic acid containing that sequence as a template. If the nucleic acid contains two strands, it is necessary to separate the strands of the nucleic acid before it can be used as the template, either as a simultaneously with the synthesis of the primer separate step or with helicases are described by Kuhn Hoffinann-Berling, If the original nucleic acid containing the sequence to be amplified is single stranded, its complement is synthesized by adding one or two oligonucleotide primers thereto. If an appropriate single |E95uza! primer is added, a primer extension product is synthesized in the of the primer, an nucleotides below. The complementary to the single-stranded nucleic acid and will hybridize length presence agent for polymerization and the four described product will be partially with the nucleic acid strand to form a duplex of unequal strands that may then be separated into single strands as described above to produce two single separated complementary strands.

Alternatively, two appropriate primers may be added to the single- stranded nucleic acid and the reaction carried out.

If the osjginal nucleic acid constitutes the sequence to be amplified, the primer extension product(s) produced will be completely complementary to the strands of the original nucleic acid and will hybridize therewith to form a duplex of equal length strands to be separated into single-stranded molecules. when the complementary strands of the nucleic acid or acids are separated, whether the single stranded, the strands are ready to be used as a template for nucleic acid was originally double or the synthesis of additional nucleic acid strands. This synthesis can be performed using any suitable method. Generally it occurs in a buffered aqueous solution, preferably at a pH of 7-9, most preferably about 8. Preferably, a molar excess (for cloned nucleic acid, usually about 100021 primer:template, and for genomic nucleic acid, usually about 106:1 primer template) of the two oligonucleotide primers is added to the buffer containing the separated template strands. It is understood, however, that the amount of complementary strand may not be known if the process herein is used for diagnostic applications, so that the amount of primer relative to the amount of complementary strand cannot be determined with certainty. As a practical matter, however, the amount of primer added will generally be in molar excess over the amount of complementary strand (template) when the sequence to be amplified is contained in a mixture of complicated long-chain nucleic acid strands. A large molar excess is preferred to improve the efficiency of the process. coli |E9302 The deoxyribonucleoside triphosphates dATP, dCTP, dGTP and TTP are also added to the synthesis mixture in adequate amounts and the resulting solution is heated to about 90-100°C for from about 1 to minutes, preferably from 1 to 4 minutes. After this heating period the solution is allowed to cool to from 20-40°C, which is preferable for the primer hybridization. To the cooled mixture is added an agent for polymerization, and the reaction is allowed to occur under conditions known in the art. This synthesis reaction may occur at from room temperature up to a temperature above which the agent for polymerization no longer functions efficiently. Thus, for example, if ‘, .

DNA polymerase is used as the agent for polymerization, the temperature is generally no greater than about 45°C. Preferably an amount of dimethylsulfoxide (DMSO) signal or the is effective in detection of the 35—40°C. Most preferably, 5-10% by volume DMSO is present and the temperature is 35- 40°C. are over 110 base pair fragments, such as the HLA DQ-a or -6 genes, an (e.g., 10% by of DMSO is added to the mixture, and the carried at 35~40°C, to obtain detectable results or to enable cloning. is present which temperature is For certain applications, where the sequences to be amplified effective amount volume) amplification reaction is The agent for polymerization may be any compound or systen which will function to accomplish the synthesis of primer extension products, including Suitable this include, for example, E. coli DNA polymerase I, Klenow fragment of E; available DNA polymerases, reverse transcriptase, and other enzymes, including heat- facilitate combination of the nucleotides enzymes. enzymes for purpose DNA polymerase I, T4 DNA polymerase, other stable enzymes, which will in the proper manner to form the primer extension products which are complementary to each nucleic acid strand. Generally, the synthesis will be initiated at the 3' end of each primer and proceed in the 5' direction template strand, until synthesis terminates, producing molecules of different however, which initiate synthesis at the 5‘ end and proceed in the other direction, using the same process as described above. along the lengths. There may be agents, IE9-W227‘ The newly synthesized strand and its complementary nucleic strand form a double—stranded molecule which is in the In the next step, the strands of the acid used succeeding steps of the process. double—stranded molecule are separated using any of the procedures described above to provide single—stranded molecules.

New nucleic acid is synthesized on the single-stranded molecules. Additional inducing agent, nucleotides and primers may be added if necessary for the reaction to proceed under the conditions prescribed above. Again, the synthesis will be initiated at one end proceed along the single After of the oligonucleqgide ,primers and will strands of the template to produce additional nucleic acid. this step, half of the extension product will consist of the specific nucleic acid sequence bounded by the two primers., The steps of strand separation and extension product synthesis can be repeated as often as needed to produce the desired quantity of the specific nucleic acid sequence. As will be described in further detail below, the amount of the specific nucleic acid sequence produced will accumulate in an exponential fashion. when it is desired to produce more than one specific nucleic acid sequence from the first nucleic acid or mixture of nucleic acids, the appropriate number of different oligonucleotide primers are utilized. For example, if two different specific nucleic acid sequences are to be produced, four primers are utilized. Two of the primers are specific for one of the specific nucleic acid sequences and the other two primers are specific for the second specific nucleic acid sequence. In this manner, each of the two different specific sequences can be produced exponentially by the present process. step-wise added, or simultaneously, where all reagents are added at the initial step, or The present invention can be performed in a fashion where after each step new reagents are partially step-wise and partially simultaneous, where fresh reagent is added If a method of separation, such as heat, is employed which will inactivate the agent after a given number of steps. strand for polymerization, as in the case of a heat-labile enzyme, then it is lE950227 necessary to replenish the agent for polymerization after every strand separation The simultaneous method may be utilized when a number of purified components, including an enzymatic means such as step.

In the simultaneous addition to the the strand- helicase, is used for the strand separation step. procedure, the reaction mixture may contain, in nucleic acid strand(s) containing the desired sequence, separating enzyme (e.g., helicase), an appropriate energy source for the strand-separating enzyme, such as rATP, the four nucleotides, the oligonucleotide primers in molar excess, and the inducing agent, e.g., Klenow fragment OQE. coli DNA polymerase I. If heat is denaturation in a-simultaneous process, a heat—stable inducing agent used for such as a thermostable polymerase may be employed which will operate at an elevated temperature, preferably 65-90°C depending on the inducing agent, at which temperature the nucleic acid will consist of single and double strands in equilibrium. For smaller lengths of nucleic acid, lower temperatures of about 50°C may be employed. The upper temperature will depend on the temperature at which the enzyme will degrade or the temperature above which an insufficient level of primer hybridization will occur. Such a heat—stable enzyme is described, e.g., by A. S. Kaledin et al., Biokhimiya, ffli, 644-651 (1980). Each step of the process will occur sequentially notwithstanding the initial presence of all the reagents. Additional materials may be added as necessary. After the appropriate length of time has passed to produce the desired amount of the specific nucleic acid sequence, the reaction may be halted by inactivating the enzymes in any known manner or separating the components of the reaction.

The process of the invention may be conducted continuously. In one embodiment of an automated process, the reaction may be cycled through a denaturing region, a reagent addition region, present and a reaction region. In another embodiment, the enzyme used for the synthesis of primer extension products can be immobilized in a column.

The other reaction components can be continuously circulated by a pump through the column and a heating coil in series, thus the ’nucleic acids produced can be repeatedly denatured without inactivating the enzyme.

|E930227l The present invention is demonstrated diagrammatically below where double-stranded DNA . sequence [S] comprised of complementary strands [ST] and [S’] is utilized as the During the first and each subsequent reaction cycle containing the desired nucleic acid. extension of each oligonucleotide primer on the original template will produce one new ssDNA molecule product of indefinite length which terminates with only one of the primers. These products, hereafter referred to as "long products," will accumulate in a linear fashion; number of cycles will be that is, the amount present after any proportional to the_pumber of cycles.

The long'products thus produced will act as templates for one or the other of the oligonucleotide primers during subsequent cycles and will produce molecules of the desired sequence [S+] or [S'] These molecules will also function as templates for one or the other of the oligonucleotide primers, producing further [S+] and [S'], and thus a chain reaction can be sustained which will result in the accumulation of [S] at an exponential rate relative to the number of cycles.

By-products formed by oligonucleotide hybridizations other than those intended are not self-catalytic {except in rare instances) and thus accumulate at a linear rate.

The specific sequence to be amplified, [S], can be depicted diagrammatically as: [S+] 5' AAAAAAAAAAXXXXXXXXXXCCCCCCCCCC 3' [S’] 3‘ TTTTTTTTTTYYYYYYYYYYGGGGGGGGGG 5‘ The appropriate oligonucleotide primers would be: Primer 1: GGGGGGGGGG Primer 2: AAAAAAAAAA so that if DNA containing [S] ....zzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz.... ....zzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGGZZzzzzzzzzzzzzzz.... is separated into single strands and its single strands are hybridized to Primers 1 and 2, the following extension reactions can be catalyzed |E9302 by DNA polymerase in the presence of the four deoxyribonucleoside triphosphates: 3‘ 5‘ extends 6*’ GGGGGGGGGG Primer 1 ....zzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCZZzzzzzzzzzzzzzz.... original template strand+ original template strand‘ ....zzzzzzzzzzzzzzzZTTTTTTTTTTYYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzzzz....

"AAAAAAAAAA-———-———————fi> extends - SI 3! Primer 2 On denaturation of the two duplexes formed, the products are: ' S‘ ....zzzzzzzzzzzzzzZZTTTTTTTTTTYYYYYYYYYYGGGGGGGGGG newly synthesized long product 1 ' 3' ....zzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCz2zzzzzzzzzzzzz2.... original template strand | 5| ...zzzzzzzzzzzzzzzZTTTTTTTTTTYYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzzzz.... original template strand" | 3| AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz.... newly synthesized long product 2 If these four strands are allowed to rehybridize with Primers 1 and 2 in the next cycle, agent for polymerization will catalyze the following reactions: Primer 2 5' AAAAAAAAAA-————————————————€> extends to here ’....zzzzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGG 5' newly synthesized long product 1 extends ( GGGGGGGGGG 5' Primer 1 IE9302 Primer 2 5' AAAAAAAAAA } extends '....zzzzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYGGGGGGGGGGzzzzzzzzzz....5' original template strand‘ extends to here ér———————————————-—-GGGGGGGGGG 5' ' AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz..3‘ newly synthesized long product 2 Primer 1 If the strands of the above four duplexes are separated, the following strands are found: ' AAAAAAAAAAXXXXXXXXXXECCCCCCCCC 3' newly synthesized [S ] '....zzzzzzzzzzzzzzzzzzZTTTTTTTTTTYYYYYYYYYYGGGGGGGGGG 5' first cycle synthesized long product 1 '....zzzzzzzzzzzzzzzzzzZTTTTTTTTTTYYYYYYYYYYGGGGGGGGGG 5' newly synthesized long product 1 '....ZZZZZZZZZZZZZZZZZZEAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCZZZZZZZZZ....3' original template strand ' AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCZZZZZzzzzzzzzzzz...3’ newly synthesized long product 2 '..zzzzzzzzzzzzzzZTTTTTTTTTTYYYYYYYYYYGGGGGGGGGGZzzzzzzzzzzzzzzz...5' original template strand" ' TTTTTTTTTTYYYYYYYYYYGGGGGGGGGG 5' newly synthesized [S'] ' AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzz...3' first cycle synthesized long product 2 It is that each strand which terminates with the oligonucleotide sequence of one primer and the complementary sequence SEED of the other is the specific nucleic acid sequence [5] that is desired to be produced.

The steps of this process can be repeated indefinitely, being limited only by the amount of Primers 1 and Z, the agent for polymerization and nucleotides present. For detection, the number of cycles used is that required to produce a detectable signal, an amount |E9302 which will depend, e.g., on the nature of the sample. For example, if the sample is pure or diluted, fewer cycles may be required than if it is a complex mixture. If the sample is human genomic DNA, preferably the number of cycles is from about 10-30.

The amount of original nucleic acid remains constant in the entire process, because it is not replicated. The amount of the long products increases linearly because they are produced only from the original nucleic acid. The amount of the specific sequence increases Thus, the This is the relative amounts specific will become the illustrated of the species exponentially. sequence predominant species! in the following table, which indicates theoretically present after h cycles, assuming 100% efficiency at each cycle: Number of Double Strands After 0 to n Cycles Long Specific Cycle Number Template Products Seouence [S] O 1 - - 1 1 1 0 2 1 2 1 3 1 3 4 1 5 26 1 10 1013 1 15 32,752 1 20 1,048,555 n 1 n (Zn-n-1) when a single-stranded nucleic acid is utilized as the template, only one long product is formed per cycle.

The method herein may be utilized to clone a particular nucleic acid sequence for insertion into a suitable expression vector. The vector may then be used to transform an appropriate host |E9302 organism to produce the gene product of the sequence by standard methods of recombinant DNA technology.

Normally, such cloning would either involve direct ligation into a vector or the addition of oligonucleotide linkers followed by restriction enzyme cleavage. Both of these methods involve, however, the inefficient blunt-end ligation reaction. Also, neither technique would control for the orientation or multiplicity of insertion of the amplified product into the cloning vector.

The amplification process herein may yield a mixture of nucleic acids, resulting from the original template nucleic acid, the expected target amplified products, and various background non-target products. The amplified product can also be a mixture if the original template DNA heterozygous diploid genome or when there contains multiple target sequences, such as in a is a family of related genes.

The primers herein may be modified to assist the rapid and specific cloning of the mixture of DNAS produced by the amplification reaction. In such modification the same or different restriction ends of the primers to result in when cut with the appropriate enzymes, the amplified product can then be easily sites are incorporated at the 5' restriction sites at the two ends of the amplified product. inserted into plasmid or vial vectors and cloned. This cloning allows the analysis or expression of individual amplified products, not a mixture.

Although the same restriction site can be used for both primers, the use of different of the product into the vector with a specific orientation and suppresses sites allows the insertion multiple insertions as well as insertions arising from amplifications based on only one of the two primers. The specific orientation is useful when cloning into single-strand sequencing vectors, when single-strand hybridization probes are used, or when the cloned product is being expressed.

One method to prepare the primers is to choose a primer sequence which differs minimally from the target sequence. Regions in lE9302z7 which each of the primers is to be located are screened for homology to restriction sites appropriate to the desired vector. For example, "CAGTATCCGA..." differs by only one base from one A primer sequence is chosen to match the the target sequence containing a gamhl site. target exactly at its 3‘ end, and to contain the altered sequence and restriction site near its 5' end (for example, "CAGgATCCGA...", where the letter with the sequence). This minimally altered sequence will not interfere with lower case symbolizes a mismatch target the ability of the primer to hybridize to the original target sequence and to initiate pqjymerization. After the first amplification cycle the primer is copied, becomes the target, and matches exactly with new primers. After the amplification process, the products are cleaved with the appropriate restriction enzymes, optionally separated from inhibitors of ligation such as the nucleotide triphosphates and salts by passing over a desalting column or molecular weight chromatography and ligation into a cloning vector such as column, inserted by bacteriophage M13. The gene may then be sequenced and/or expressed using well known techniques.

The second method for preparing the primers involves taking the 3' desired end of the primers from the target sequence and adding the to the 5' For the above example, a liigdlll site could be added to make the sequence "cgaagcttCAGTATCCGA...", where restriction site(s) end of the primer. lower case letters are as described above. The added bases would not contribute to the hybridization in the first cycle of amplification, but would match in subsequent cycles. ‘The final amplified products are then cut with restriction enzyme(s) and cloned and expressed as described above. The gene being amplified may be, for example, human beta-hemoglobin or the human HLA D0, DR or DP-a and -5 genes.

In addition, the process herein can be used for in vitro mutagenesis. The oligodeoxyribonucleotide primers need not be exactly complementary to the DNA sequence which able to to be extended by the polymerase enzyme or by is being amplified. It is only necessary that they be hybridize to the sequence sufficiently well whatever other inducing agent is employed. The "product of a IE9302 polymerase chain reaction wherein the primers employed are not exactly , complementary to the original template will contain the sequence of the primer rather than the template, thereby introducing an in vitro mutation. In further cycles this mutation will be amplified with an undiminished efficiency because no further mispaired primings are required. The mutant thus produced may be inserted into an appropriate vector by standard molecular biological techniques and might confer mutant properties on this vector such as the potential for production of an altered protein.

The process of making an altered DNA sequence as described above could be repeated on the altered DNA using different primers so as to induce further sequence changes. In this way a series of mutated sequences could gradually be produced wherein each new addition to the series could differ from the last in a minor way, but from the original DNA source sequence in an increasingly major way.

In this feasible in a single step due to the inability of a very seriously manner changes could be made ultimately which were not mismatched primer to function.

In addition, the primer can contain as part of its sequence a non-complementary sequence provided that a sufficient amount of the primer contains a sequence which is complementary to the strand to be example, a nucleotide which is not amplified. For sequence complementary to the template sequence (such as, e.g., a promoter, linker, coding sequence, etc.) may be attached at the 5' end of one or both of the primers, and thereby appended to the product of the amplification process. After the extension primer is added, sufficient cycles are run to achieve the desired amount of new template containing the non—complementary nucleotide insert. This allows production of large quantities of the combined fragments in a relatively short period of time (e.g., two hours or less) using a simple technique.

Moreover, the process herein may be used to synthesize a nucleic acid fragment from an existing nucleic acid fragment which is shorter than its product (called the core segment) using certain IE93022W ends of which are complementary to or substantially complementary to _the 3' of the separating the strands of the original shorter nucleic acid fragments, primers the 3' ends single strands produced by and the 5' ends of which primers contain sequence information to be appended to the core segment. This process comprises: (a) treating the strands of said existing fragment with two oligonucleotide primers under conditions such that an extension product of each primer is synthesized which is complementary to each nucleic acid strand, wherein said primers are selected so as to be substantially comp&ementary to the 3' end of each strand of said existing fragment such that the extension product synthesized from one primer, when it is separated from its complement, can serve as a template for synthesis of the extension product of the other primer, and wherein each primer contains, at its 5' end, a sequence of nucleotides which are not complementary to said existing fragment and which correspond to the two ends of the nucleic acid fragment being synthesized; (b) separating the primer extension products from the templates on which they were synthesized to produce single-stranded molecules; and (c) treating the single-stranded molecules generated from step (b) with the primers of step (a) under conditions such that a product using each of the single step (b) intermediate double-stranded which has been incorporated the nucleotide sequence present end of one of the oligonucleotide primers, and two full-length double- of which has ends of both of primer extension is- synthesized strands produced in as a template so as to produce two nucleic acid molecules, into each of in the 3‘ stranded nucleic acid molecules, into each been incorporated the nucleotide sequence present in the 5' the oligonucleotide primers; (d) repeating steps (b) and (c) for a sufficient number of times to produce the full-length double-stranded molecules_ in an effective amount; v-.‘.'!/ lE930zz7 (e) treating the strands of the product of step (d) with two primers so as to lengthen the product of step (d) on both ends; and (f) repeating steps (a)-(d) using the product of step (d) as the core fragment and two oligonucleotide primers which are complementary or substantially complementary to the 3' ends of the single strands produced by separating the strands of the product of step (d).

Steps (b) and (c) often as usually at least Sftimes, to produce the required amount of the full- are repeated as necessary, length double-stranded product to synthesize the final product (i.e., the effective amount). In addition, the core segment may be obtained as the product of a previous amplification cycle. The product produced in step (d) may be purified before a new cycle of extension and amplification, or used directly by employing the reaction mixture containing the product.

If the 3' ends of the primers are not exactly complementary to the 3' ends of the single strands of the original shorter nucleic acid, the core fragment of the product will not be exactly the same as information resident in the original shorter nucleic the sequence acid. Therefore, mutants of the original nucleic acid may be made by using primers which are substantially complementary at their 3' ends to the 3' ends of the single strands of the original shorter nucleic acid.

If restriction site linkers are incorporated into the primers, then the amplified double-stranded products can be digested with the appropriate restriction enzymes and ligated directly into an M13 The M13 plaques containing the specific amplified target sequences can be identified vector for rapid cloning and sequencing. by hybridizing plaque lift filters with a probe specific for the target sequence.

The method herein may also be used to enable detection and/or characterization of specific nucleic acid sequences associated with infectious diseases, genetic disorders or cellular disorders such |E930227‘ as cancer, e.g., oncogenes. Amplification is useful when the amount of nucleic acid available for analysis is very small, as, for example, in the prenatal, diagnosis’ of sickle cell anemia using DNA obtained Amplification is particularly useful if such an from fetal cells. analysis is to be done on a small sample using non—radioactive detection techniques which may be inherently insensitive, or where radioactive techniques are being employed but where rapid detection is desirable.

For purposes of this invention genetic diseases may include specific deletions.and/or mutations in genomic DNA from any organism, such as, e.g., sickle cell anemia, cystic fibrosis, a-thalassemia, 5- thalassemia, and the like. Sickle cell anemia can be readily detected via oligomer restriction analysis or a RFLP—like analysis following amplification of the appropriate DNA sequence by the present method. a-Thalassemia can be detected by the absence of a sequence, and 5- detected by the linked to a thalassemia can be presence of a polymorphic restriction site closely mutation which causes the disease.

All of these genetic diseases may be detected by amplifying the appropriate sequence and analyzing it by Southern blots without using radioactive probes. In such a process, for example, a small sample of DNA from, e.g., amniotic fluid containing a very low level of the desired sequence is amplified, cut with a restriction enzyme, and analyzed via a Southern blotting technique. radioactive probes is facilitated by the high level of the amplified The use of non- signal.

In another embodiment a small sample of DNA may be amplified to a convenient level and then a further cycle of extension reactions performed wherein nucleotide derivatives which are readily detectable (such as 32P-labeled or biotin labeled nucleoside triphosphates) are into the DNA product, which may be analyzed by restriction and electrophoretic separation or any other An example of this technique in a model system is incorporated directly final appropriate method. demonstrated in Figure 5. -globin DNA.

IE93lD227* In a further embodiment, demonstrated in a model system in Figure 3, the nucleic acid may be exposed to a particular restriction endonuclease prior to amplification. Since a sequence which has been cut cannot be amplified, the appearance of an amplified fragment, despite prior restriction of the DNA sample, implies the absence of a site for the endonuclease within the amplified sequence. The presence or absence of an amplified sequence can be detected by an appropriate method.

A practical application of this technique can be illustrated by its use in facnLitating the detection of sickle cell anemia via the oligomer restriction technique described herein and in Saiki et al., disease which is caused by a single base pair change in the sixth Sickle cell anemia is a hemoglobin codon of the 5-globin gene, Figure 6 illustrates the sequences of normal and sickle cell B-globin genes in the region of their polymorphism, where the single bars mark the location of a Ddel site in the normal gene and where the double bars mark the present only location of a Hinfl site which is non-polymorphic and thus present in both the normal and sickle cell alleles. Figure 7 illustrates the process of oligomer restriction of normal B—globin DNA using a probe spanning both restriction sites and labeled where the asterisk appears. (The probe is preferably labeled at the end which is fewer base pairs from the restriction site than the other end of the probe.) The DNA, amplified as provided herein, is denatured and annealed to the labeled probe. The amplification may be carried out (35-40°C) in the of dimethyl sulfoxide to minimize formation of secondary structure. The enzyme Qge} cleaves the DNA at the reformed Qggj site and generates a labeled at elevated temperatures presence octamer. Under the conditions used in the test the octamer is short enough to dissociate from the duplex. The subsequent addition of the enzyme jfigfl has no effect on the now single-stranded octamer. Figure 8 illustrates the same process applied to the sickle cell allele of $- The enzyme_DdgI cannot cleave the duplex formed by the amplified DNA and the labeled probe because of the 'A-A base pair mismatch. The enzyme Hinfl, however, does restrict the hybrid and a lE93U2labeled trimer is produced. In practice the method can diagnose the DNA of an individual as being either homozygous for the wild type, homozygous for the sickle type or a heterozygous carrier of the sickle cell trait, since a specific signal is associated with the presence of either allele. Use of this above-described method to amplify the pertinent sequence allows for a rapid analysis of a single copy gene using a probe with only a single 32P label.

Various infectious diseases can be diagnosed by the presence in clinical samples of specific DNA sequences characteristic of the These include bacteria, such as Salmonella, the hepatitis causative microorganism. viruses, and parasites, U.S.

Patent 4,358,535 issued to Falkow describes the use of specific DNA Chlamydia, Neisseria; viruses, such as such as the Plasmodium responsible for malaria. hybridization probes for the diagnosis of infectious diseases. A problem inherent in the Falkow procedure is that a relatively small number of pathogenic organisms may be present in a clinical sample from an infected patient and the DNA extracted from these may constitute only a very small fraction of the total DNA in the sample. Specific amplification of suspected sequences prior to immobilization and hybridization detection of the DNA samples could greatly improve the sensitivity and specificity of these procedures.

Routine clinical use of DNA probes for the diagnosis of infectious diseases would be simplified considerably if non- radioactively labeled probes could be employed as described in EP 63,879 to Ward. In this procedure biotin-containing DNA probes are detected by chromogenic enzymes linked to avidin or biotin-specific is convenient, but relatively antibodies. This type of detection insensitive. The combination of specific DNA amplification by the present method and the use of stably labeled probes could provide the convenience and sensitivity required to make the Falkow and ward procedures useful in a routine clinical setting.

In addition, the probe may be a biotinylated probe in which the biotin is attached to a spacer arm of the formula: ‘ lE93fl2z7 H I —Y—(CH2)2—O-E(CH2)X0]y-CH2CH2—N— where Y is O, NH or N-CHO, x is a number from 1 to 4, and y is a number from 2 to 4. The spacer arm is in turn attached to a psoralen moiety of the formula: The psoralen moiety intercalates into and crosslinks a "gapped circle" probe as described by Courage-Tebbe et al., Biochim. Biophys. Acta, (1982) 1-5, wherein the single-stranded hybridization region of the gapped circle spans the region contained in the primers.

The amplification process can also be utilized to produce sufficient quantities of DNA from a single copy human gene such that detection by a simple non-specific DNA stain such as ethidium bromide can be employed so as to make a DNA diagnosis directly.

In addition to infectious diseases and pathological abnormalities in the genome of organisms, the process herein can also be used to detect DNA polymorphism which may not be detecting associated with any pathological state.

The following examples are offered by way of illustration and are not intended to limit the invention in any manner. In these examples all percentages are by weight if for solids and by volume if in degrees Celsius unless for liquids, and all temperatures are otherwise noted.

EXAMPLE 1 A 25 base pair sequence having the nucleotide sequence ' CCTCGGCACCGTCACCCTGGATGCT 3' 3' GGAGCCGTGGCAGTGGGACCTACGA 5' contained on a 47 base pair FokI restriction fragment of pBR322 obtainable from ATCC was prepared as follows. A Fokl digest of pBR3 F‘ U‘ England Biolabs |E9307.27’ containing the 47—bp fragment was produced by digesting pBR322 with £95} in accordance with the conditions suggested by the supplier, New Inc. The primers which were utilized were 5' d(CCTCGGCACCG) 3' and 5‘ d(AGCATCCAGGGTG) 3', and were prepared using conventional The following ingredients were added to 33 pl of buffer which consisted of 25 mM potassium phosphate, 10 mM 2433 pmoles of each of the primers described above, 2.4 pmoles of the fog} digest of pBR322, 12 nmoles of dATP, 22 nmoles of dCTP, 19 nmoles of dGTP and nmoles of TTP. techniques. magnesium chloride and 100 mM sodium chloride at pH 7.5: The mixture was heated to 85°C for five minutes and allowed to cool to ambient temperature. Five units of the Klenow fragment of . coli DNA polymerase I were added and the temperature was maintained for 15 minutes. After that time, the mixture was again heated to 85°C for five minutes and allowed to cool. Five units of the Klenow fragment were again added and the reaction was carried out for 15 minutes. The heating, cooling and synthesis steps were repeated eleven more times.

After the final repetition, a 5 pl aliquot was removed from This was heated to 85°C for three minutes and of a-P32 the reaction mixture. allowed to cool to ambient temperature. 12.5 onoles deoxycytidine triphosphate and 5 units of Klenow fragment were added The labeled products were examined by polyacrylamide gel electrophoresis. The Fog} digest was labeled in a similar fashion and served as a control The only heavily labeled band visible and the reaction was allowed to proceed for 15 minutes. and molecular weight markers. after the 13 cycles was the intended 25 base pair sequence.

EXAMPLE 2 The desired sequence to be amplified was a 94 base pair sequence contained within the human beta-globin gene and spanning the figtll nucleotide sequence shown in Figure 1.

The sequence has the site involved in sickle cell anemia.

/"‘\ |E930227‘ The following two oligodeoxyribonucleotide primers were prepared by the method described below: ' CACAGGGCAGTAACG 3' Primer A and 5‘ TTTGCTTCTGACACA 3' Primer B Automated Synthesis Procedures: The diethylphosphoramidites, synthesized according to Beaucage and Caruthers (Tetrahedron Letters (1981) 22 1859-1862) were sequentially condensed to a nugleoside derivatized controlled pore glass support using a Biosearch-SAM-1. The procedure included detritylation with trichloroacetic acid in dichloromethane, condensation using benzotriazole as activating proton donor, and capping with acetic anhydride and dimethylaminopyridine in tetrahydrofuran and pyridine.

Cycle time was approximately 30 minutes. Yields at each step were essentially quantitative and were determined by collection and spectroscopic examination of the dimethoxytrityl alcohol released during detritylation.

Oligodeoxyribonucleotide Deprotection and Purification Procedures: The solid support was removed from the column and exposed to 1 ml concentrated ammonium hydroxide at room temperature for four in a closed tube. The support was then removed by filtration the the protected oligodeoxynucleotide was brought to 55°C for five hours. hours and solution containing partially Ammonia was removed and the residue was applied to a preparative polyacrylamide gel. Electrophoresis was carried out at 30 volts/cm for 90 minutes after which the band containing the product was identified by UV shadowing of a fluorescent plate. The band was excised and eluted with 1 ml distilled water overnight at 4°C.

Altech RP18 acetonitrile in 1% ammonium acetate buffer at pH 6.0.

This solution was applied 7-13% gradient of The elution was to an column and eluted with a monitored by UV absorbance at 260 nm and the appropriate fraction quantitated by UV fixed evaporated to dryness at room temperature in a vacuum centrifuge. absorbance in a collected, volume and 0 2 2 7 Oligodeoxyribonucleotides: Test labeled with Characterization of aliquots of the polynucleotide kinase and y—32P-ATP. The autoradiography of 14-20% polyacrylamide 45 minutes at 50 This Base composition was determined by purified oligonucleotides were 32P labeled compounds were gels after examined by volts/cm. procedure electrophoresis for verifies the molecular weight. digestion of the oligodeoxyribonucleotide to nucleosides by use of venom diesterase and bacterial alkaline phosphatase and subsequent separation and quantitation of the derived nucleosides using a reverse phase HPLC column and a 10% acetonitrile, 1% ammonium acetate mobile phase. " . Source of DNA A. Extraction of whole Human Hild—Type DNA Human normal 5-globin was extracted from the cell line Molt4 (obtained from Human Genetic Mutant Cell GM2219c) described by Stetler et al., Proc. Nat. Acad. Sci. . genomic DNA homozygous for using the technique (1982), 79:5955- Repository and identified as . Construction of Cloned Globin Genes May 25, 1984. i:—, |E9302 Each recombinant plasmid was transformed into and propagated in E. coli MM294 (ATCC No. 39,607).

C. Digestion of Cloned Globin Genes with Mstll for and bovine serum albumin III. Polymerase Chain Reaction To 100 pl of buffer consisting of 60 mM sodium acetate, 30 mM Tris acetate and 10 mM magnesium acetate at pH 8.0 was added 2 pl of a solution containing 100 picomoles of Primer A (of the Sequence d CACAGGGCACTAACG)), 100 picomoles of Primer B (of the (TTTGCTTCTGACACA)) and 1000 picomoles each of dATP, dCTP, dGTP and T9. In addition, one of the following sources of DNA described above sequence d T was added: pg whole human wild-type DNA (Reaction I) 0.1 picomole pBR328:HbA (Reaction II) 0.1 picomole pBR328:HbS (Reaction III) 0.1 picomole pBR328:HbA/MstII (Reaction IV) 0.1 picomole pBR328:HbS/MstII (Reaction V) No target DNA (Reaction VI) Each resulting solution was heated to 100°C for four minutes and allowed to cool to room temperature for two minutes, whereupon 1 pl containing four units of Klenow fragment of E. coli DNA polymerase was added. Each reaction was allowed to proceed for 10 minutes, after which the cycle of adding the primers, nucleotides and DNA, heating, cooling, adding polymerase, and reacting was repeated nineteen times for Reaction I and four times for Reactions II-VI. lE9302 Four microiiter aiiquots of Reactions I and II removed before the first cycie and after the iast cycie of each reaction were appiied to a 12% poiyacryiamide gei 0.089 M in Tris-borate buffer at pH 8.3 and 2.5 mM in EDTA. for four hours, transferred to a nyion membrane serving as soiid phase support and probed with a 5'—32P-iabeied 40 bp synthetic fragment, The gei was eiectrophoresed at 25 voits/cm prepared by standard techniques, of the sequence 'd(TCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAG)3' in 30% formamide, 3 x SSPE, 5 x Denhardt's, 5% sodium dodecyi suifate at pH 7.4. for Reactions I and II.

Figureii is an autoradiograph of the probed nyion membrane Lane 1 is 0.1 picomoie of a 58-bp synthetic is compiementary to the above fragment controi one strand of which probe. Lane 2 is 4 pi of Reaction I prior to the first ampiification cycie. Lane 3 is 4 pi of Reaction I after the 20th ampiification cycie. Lane 4 is 4 pi of Reaction II after five ampiification cycies. Lane 5 is a moiecuiar weight standard consisting of a 535} (New Engiand Bioiabs) digest of pBR322 (New Engiand Bioiabs) iabeied with aipha-32P—dNTPs and poiymerase. Lane 3 shows that after twenty cycies the reaction mixture I contained a iarge amount of the specific of the proper Reaction mixture II after five cycies aiso contained this sequence moiecuiar weight and no other detectabie products. product, as weii as the starting nucieic acid and other products, as shown by Lane 4.

To 5.0 pi aiiquots of Reactions II-VI after the fourth cycie were added 5 pmoies of each primer described above. The soiutions were heated to 100°C for four minutes and aiiowed to equiiibrate to room temperature. Three pmoies each of aipha-32P—dATP, aipha—32P— dCTP, aipha-32P—dGTP and aipha-32P-TTP and four units of Kienow fragment were added. The reaction, in a finai voiume of 10 pi and at the sait concentrations given above, was aiiowed to proceed for 10 minutes. The poiymerase activity was terminated by heating for 20 minutes at 60°C. a 12% poiyacryiamide gei 0.089 M in Tris-borate buffer at pH 8.3 and 2.5 m in EDTA. The gei was eiectrophoresed at 25 voits/cm for four hours after which autoradiography was performed.

Four pi aiiquots of Reactions II-VI were ioaded onto |E9302Figure 3 is an autoradiograph of the electrophoresis. Lane 1 is a molecular weight standard, Lane 2 is Reaction II, Lane 3 is Reaction III, Lane 4 is Reaction IV and Lane 5 is Reaction V. Another lane for Reaction VI with no DNA as control had no images in any of the lanes. It can be seen from the figure that the 94-bp fragment predicted from the target DNA was present only where intact 3-globin DNA sequences were available for amplification, i.e., pBR328:HbA (Lane ), pBR328:HbS (Lane 3) and pBR328:HbS/MstII (Lane 5). Mstll digestion cuts pBR328:HbA in the 94—mer sequence rendering it incapable of being amplified, and the 94—mer band does not appear in Lane 4. In contrast, the 94-mer sequence in pBR328:HbS does not cut when the plasmid is digested with Mstll and thus is available for amplification as shown in Lane 5.

Figure 4 illustrates the chain reaction for three cycles in amplifying the 94-bp sequence. PCO1 and PC02 are Primers A and B.

The numbers on the right indicate the cycles, whereas the numbers on the left indicates the cycle number in which a particular molecule was produced.

EXAMPLE 3 This example illustrates amplification of a 110 bp sequence spanning the allelic MstII site in the human hemoglobin gene.

A total of 1.0 microgram whole human DNA, 100 picomoles d(ACACAACTGTGTTCACTAGC) and 100 picomoles d(CAACTTCATCCACGTTCACC) the primers having been prepared by the technique of Example 2, were dissolved in 100 pl of a solution which was: 1.5 mM in each of the four deoxyribonucleoside triphosphates mM in Tris acetate buffer at pH 7.9 60 mM in sodium acetate mM in magnesium acetate .25 mM in dithiothreitol |E9302 The solution was heated to 100°C for one minute and brought rapidly to 25°C for one minute, after which was added 2.5 units Klenow fragment of DNA polymerase. The polymerase reaction was allowed to proceed for two minutes at 25°C, after which the cycle of heating, cooling, adding Klenow, and reacting was repeated as often as desired. with a 70% efficiency at each cycle, 15 cycles resulted in the synthesis of 1.4 femtomoles of the desired 110 bp fragment of the B-globin gene. - _ EXAMPLE 4 This example illustrates amplification of a 240 bp sequence spanning the allelic MstI1 site in the human hemoglobin gene. This sequence contains Ncol, Hinfl and Mstll restriction sites.

To 100 pl of a mixture of 60 mM sodium acetate, 30 mM Tris acetate and 10 mM magnesium acetate at pH 8.0 containing 0.1 pmole pBR328:HbA was added 2 pl of Solution A containing: pmoles d(GGTTGGCCAATCTACTCCCAGG) primer 100 pmoles d(TAACCTTGATACCAACCTGCCC) primer 1000 pmoles each of dATP, dCTP, dGTP and TTP The two primers were prepared by the technique described in win 20 Example 2. The solution was heated to 100°C for four minutes and iii‘ allowed to cool in ambient air for two minutes, after which was added pl containing four units Klenow fragment of E. coli DNA polymerase. The reaction was allowed to proceed for 10 minutes after which the cycle of solution A addition, heating, cooling, adding polymerase, and reacting was repeated three times. To a 5.0 pl aliquot of the reactions was added 5 picomoles of each oligonucleotide primer described above. The solution was heated to 100°C for four minutes and allowed to come to ambient temperature, after which 3 picomoles each of the alpha-32P-labeled deoxyribonucleoside triphosphates and 4 units Klenow fragment were added. The reaction, in a final volume of 10 pl and at the salt concentrations given above, was allowed to proceed for 10 minutes. The polymerase activity was |E930227 _ terminated by heating for 20 minutes at 60°C. Two pl aliquots were digested with Neg}, jgggl, or iflnfl and loaded onto a 12% polyacrylamide gel 0.089 M in Tris-borate buffer at pH 8.3 and 2.5 mM in EDTA. The gel was electrophoresed at 25 volts/cm for four hours ' and autoradiography was performed. Figure 5 illustrates the autoradiograph of the electrophoresis, where Lane 1 is the molecular weight standard, Lane 2 is without digestion with enzyme (240 bp intact), Lane 3 is digestion with jggg (131 and 109 bp), Lane 4 is digestion with fistll (149 and 91 bp), and Lane 5 is digestion with fli_n_fI (144 and 96‘bp). The autoradiograph is consistent with the amplification of the 240 bp sequence.

EXAMPLE 5 This example illustrates use of the process herein to detect sickle cell anemia by sequential digestion.

Synthesis and Phosphorylation of 0ligodeoxyribonucleotides A labeled DNA probe, R506, of the sequence: ' *CTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGG 3' where * indicates the label, and an unlabeled blocking oligomer, RS10, of the sequence ggg 20 3' GACAGAGGTCACCTCTTCAGACGGCAATGACGGGACACCC 5' which has three base pair mismatches with RS06 were synthesized according to the procedures provided in Example 2(1) The probe RS06 was labeled by contacting five pnole thereof with 4 units of T4 polynucleotide kinase (New England Biolabs) and 50 pmole y‘32P-ATP (New England Nuclear, about 7200 Ci/mmole) in a 40 ul reaction volume containing 70 mM Tris buffer (pH 7.6), 10 mM MgCl,, 1.5 mM spermine, and 2.5 mM dithiothreitol for 90 minutes at 37°C.‘ The total volume was then adjusted to 100 pl with 25 mM EDTA and purified according to the procedure of Maniatis et al., Molecular Cloning (1982), 464-465 over a 1 ml Bio Gel P-4 spin dialysis column from BioRad equilibrated with Tris-EDTA (TE) buffer (10 mM Tris buffer, 0.1 mM EDTA, pH 8.0).

The labeled probe was further purified by electrophoresis on a 18% -'14 E‘: IE930z polyacrylamide gel (19:1 acrylamide BIS, BioRad) in Tris-boric acid- EDTA (TBE) buffer (89 mM Tris, 89 mM boric acid, 2.5 mM EDTA, pH 8.3) for 500 vhr. After localization by autoradiography, the portion of the gel containing the labeled probe was excised, crushed and eluted into 0.2 ml TE buffer overnight at 4°C. TCA precipitation of the reaction product indicated that the specific activity was 4.9 Ci/mmole and the final concentration was 20 pmole/ml.

The unlabeled RS10 used at a concentration of 200 pmole/ml. blocking oligomer was lymphoid cell lines Molt4, SC-1 and GM2064 using essentially the method of Stetler et al., PNAS (1982), Z23 5966-5970 (for Molt4) and Maniatis et al., Molecular Cloning (1982), 280-281.

Molt4 (Human Mutant Cell GM2219C) is a T cell line homozygous for normal B-globin, and SC-1, deposited with ATCC on March 19, 1985, sickle cell allele.

Repository, is an EBV-transformed B cell line homozygous for the GM2064 (Human Mutant Cell Repository, GM2064) was originally isolated from an individual homozygous for hereditary persistance of fetal hemoglobin (HPFH) and contains no beta- or delta- lines were maintained in RPMI-1540 globin gene sequences. All cell with 10% fetal calf serum.

Isolation of Human Genomic DNA from Clinical Blood Samples A clinical blood sample designated CH12 from a known sickle cell carrier (AS) was obtained from Dr. Bertram Lubin of Children's Hospital in Oakland, California. Genomic DNA was prepared from the buffy coat fraction, which is composed primarily of peripheral blood lymphocytes, using a modification of the procedure described by Nunberg et al., Proc. Nat. Acad. Sci., 15, 5553-5556 (1978).

The cells were resuspended in 5 ml Tris-EDTA-NaCJ (TEN) buffer (10 mM Tris buffer pH 8, 1 mM EDTA, 10 mM NaCl) and adjusted to 0.2 mg/ml proteinase K, 0.5% SDS, and incubated overnight at 37°C. lE9502 Sodium perchlorate was then added to 0.7 M and the lysate gently shaken for 1-2 hours at room temperature. The lysate was extracted with 30 ml phenol/chloroform (1:1), then with 30 ml chloroform, and precipitation of the nucleic acids. The pellet of TE buffer and RNase A added to 0.005 After digestion for one hour at 37°C, the DNA was extracted followed by ethanol was resuspended in 2 ml mg/ml. once each with equal volumes of phenol, phenol/chloroform, and chloroform, and ethanol precipitated. The DNA was resuspended in 0.5 ml TE buffer and the concentration was determined by absorbance at 260 nm.

‘C Polymerase Chain Reaction to Amplify Selectively B-Globin Sequences Two micrograms of genomic DNA was amplified in an initial 100 pl reaction volume containing 10 mM Tris buffer (pH 7.5), 50 mM NaCl, 10 mM MgCl2, 150 d(CACAGGGCACTAACG), and 150 pmole of d(CTTTGCTTCTGACACA) and overlayed with about 100 pl prevent evaporation.

Primer A of the of the mineral oil to pmole of sequence Primer B sequence Each DNA sample underwent 15 cycles of amplification where one cycle is composed of three steps: 1) Denature in a heat block set at 95°C for two minutes.

) Transfer immediately to a heat block set at 30°C for two minutes to allow primers and genomic DNA to anneal.

) Add 2 pl of a solution containing 5 units of the Klenow fragment of E. coli DNA polymerase I (New England Biolabs), 1 nmole each of dATP, dCTP, dGTP and TTP, in a buffer composed of 10 mM Tris (pH 7.5), 50 mM NaCl, 10 mM MgCl2, and 4 mM dithiothreitol. This extension reaction was allowed to proceed for 10 minutes at 30°C.

After the final reaction was terminated by heating at 95°C for two minutes. cycle, the The mineral oil was extracted with .2 ml of chloroform and discarded. The final reaction volume was 130 lE93022n '. hybridization/Digestion of Amplified Genomic DNA with Probes and Ddel/Hinfl of the amplified genomic DNA was precipitated and of TE Ten microliters (containing the pre-amplification equivalent Forty-five microliters ethanol resuspended in an equal volume buffer. of 154 ng of genomic DNA) was dispensed into a 1.5 ml Microfuge tube and 20 pl of TE buffer to a final The sample was overlayed with mineral oil and denatured at 95°C for 10 minutes. Ten microliters of 0.6 M NaCl containing 0.02 pmole of labeled RS06 probe was added to the tube, mixed gently, and immediately transferred to a 56°C heat block for one hour. Four microliters of unlabeled RS10 blocking (0.8 added and the continued for an additional 10 minutes at the same temperature. microliters of 60 mM MgCl2/0.1% BSA and 1 pl of Dog} (10 units, New England Biolabs) were added and the reannealed DNA was digested for 30 at 56°C. was then added and incubated for another 30 minutes. The mM EDTA and 6 pl volume of 30 pl. oligomer pmole) was hybridization Five minutes One microliter of Hinfl (10 units, New England Biolabs) reaction was stopped by the addition of 4 pl tracking dye to a final volume of 61 pl.

The mineral oil was extracted with 0.2 ml chloroform, and 18 pl of the reaction mixture (45 ng genomic DNA) was loaded onto a 30% polyacrylamide (19:1, Bio Rad) in a SE200 The gel was electrophoresed at approximately 300 volts for mini-gel Hoeffer apparatus. one hour until the bromphenol blue dye front migrated to 3.0 cm off- origin. The top 1.5 cm of the gel was removed and the remaining gel was exposed for four days with one intensification screen at -70°C.

Discussion of Photograph (Figure 9) Each lane contains 45 ng of amplified genomic DNA. Lane A contains Moltd DNA; Lane B, CH12; Lane C, SC-1; and Lane 0, GM2064.

Molt4 represents the genotype of a normal individual with two copies of the BA gene per cell (AA), CH12 is a clinical sample from a sickle cell carrier with one BA and one 53 gene per cell (AS), and SC-1 represents the genotype of a sickle cell individual with two copies of lE9302 the 55 gene per cell (SS). GM2064, which contains no beta- or delta- globin sequences, is present as a negative control.

As seen in the photograph, the l31g1—cleaved, BA-specific octamer is present only in those DNA's containing the BA gene (Lanes A and B) and the iflgfl-cleaved, BS-specific trimer is present only in those DNA's containing the B5 gene (Lanes 8 and C).

(Lane 8) carrier and is distinguishable from a normal individual (Lane A) with The presence of both trimer and octamer is diagnostic for a sickle cell only octamer and a sickle cell afflicted individual (Lane C) with only trimer. .

As a comparison, repeating the experiment described above using that the increased the sensitivity of detection by at least 1000 fold. non-amplified genomic DNA revealed amplification EXAMPLE 6 This illustrates direct detection of a totally unpurified single copy gene in whole human DNA on gels without the example need for a labeled probe. -bp fragment from a sequence in the first exon of the beta-globin gene was This Using the technique described in Example 3, a amplified from 10 micrograms of whole human DNA after 20 cycles. 110-bp fragment produced after 20 cycles was easily visualized on gels stained with ethidium bromide.

The sequence was not amplified when it was first cut with the restriction enzyme Qdg} unless, as in the beta-globin S allele, the sequence does not contain the restriction site recognized by the enzyme.

EXAMPLE 7 A. A total of 100 fmoles pBR328 containing a 1.9 kb insert from the human beta-globin A allele, 50 nmoles each alpha—32P—dNTP at 500 Ci/mole, and 1 nmole of each of the primers used in Example 3 were dissolved in a solution containing 100 pl 30 mM Tris-acetate at pH 7.9, 60 mM sodium acetate, 100 mM dithiothreitol, and 10 mM magnesium lE9302z7 This solution was brought to 100°C for two minutes and cooled to 25°C for one minute.

Klenow fregment of E. coli DNA polymerase I and 0.09 units inorganic pyrophosphatase was added to pyrophosphate in the reaction mixture, and the reaction was allowed to acetate.

A total of 1 pl containing 4.5 units prevent the possible‘ build-up of proceed for two minutes at 25°C, after which the cycle of heating, cooling, adding enzyme, and reacting was repeated nine times. Ten-pl and added to 1 pl 600 mM EDTA after each Each was analyzed on a 14% polyacrylamide gel in 90 aliquots were removed synthesis cycle. mM Tris-borate and 2.5 mM EDTA at pH 8.3 and 24 volts/cm for 2.5 hours. The completed gel was soaked for 20 minutes in the same buffer with the addition of 0.5 pg/ml original buffer, and photographed in UV light using a red filter. ethidium bromide, washed with the The 110-bp fragment produced was excised from the gel under light and the radiation. An attempt to fit the data to an equation of the form: pmoles/10 pl = 0.01 [(1+y)N-yN-1], where N represents the number of ultraviolet incorporated 32P counted by Cerenkov cycles and y the fractional yield per cycle, was optimal with y = 0.619. This indicates that a significant amplification is occurring.

. The above experiment was repeated except that 100 nmoles of each dNTP was added to a 100 pl radiolabel was employed, and aliquots were not removed at each cycle. After 10 cycles the reaction was terminated by boiling for two minutes and reaction, no rehybridization was performed at 57°C for one hour. The sequence of the 110-bp product was confirmed by subjecting 8 pl aliquots to restriction analysis by addition of 1 pl bovine serum albumin (25 mg/ml) and 1 pl of the appropriate restriction enzyme {fl1nfI,_finlI, jgggl, figgj) and by reaction at 37°C for 15 hours. PAGE was performed as described above.

EXAMPLE 8 This example illustrates the use of different primers to amplify various fragments of pBR328 and 322.

|E95022ll A. The experiment described in Example 7A was repeated except using the following primers: d(TTTGCTTCTGACACAACTGTGTTCACTAGC) and d(GCCTCACCACCAACTTCATCCACGTTCACC) to produce a 130-bp fragment of pBR328. in Example 7A was repeated except using the following primers: d(GGTTGGCCAATCTACTCCCAGG) and d(TGGTCTCCTTAAACCTGTCTTG) to produce a 262-bp fragment of pBR328. The reaction time was 20 minutes per cycle.

. The experiment described C. The experiment described in Example 88 was repeated except that 100 fmbles of an MstII digest of pBR328 containing a 1.9 kb insert from the human beta-globin S allele was used as initial This plasmid was cleaved several times by Mstll but not addition, template. inside the sequence to be amplified. In the primers employed were as follows: d(GGTTGGCCAATCTACTCCCAGG) and d(TAACCTTGATACCAACCTGCCC) to produce a 240-bp fragment.

. The experiment described in Example 78 was repeated that 100 fmoles Nrul digest of pBR322 was template, 200 nmoles of each dNTP were used in the 100 pl reaction, except of an used as and the primers were: d(TAGGCGTATCACGAGGCCCT) and d(CTTCCCCATCGGTGATGTCG) to produce a 500-bp fragment from pRR322. Reaction times were 20 minutes per cycle at 37°C. Final rehybridization was 15 hours at °C. Electrophoresis was on a 4% agarose gel.

EXAMPLE 9 This example illustrates the invention process wherein an in vitro mutation is introduced into the amplified segment.

A. A total of 100 fmoles of pBR322 linearized with NruI, 1 nmole each of the primers: d(CGCATTAAAGCTTATCGATG) and d(TAGGCGTATCACGAGGCCCT) IE93U2 designed to produce a 75-bp fragment, 100 nmole each dNTP, in 100 pl 40 mM Tris at pH 8, 20 mM in MgCl2, 5 mM in dithiothreitol, and 5 mg/ml bovine serum albumin were combined. The mixture was brought to °C for one minute, cooled for 0.5 minutes in a water bath at 23°C, whereupon 4.5 0.09 pyrophosphatase were added, and a reaction was allowed to proceed for units Klenow fragment and units inorganic cooling, adding enzymes, and reacting was The tenth terminated by freezing and an 8—pl aliquot of the reaction mixture was three minutes. The cycle of heating, repeated nine times. reaction cycle was applied to a 4% agqgose gel visualized with ethidium bromide.

Example 9A was repeated . The‘ experiment described in except that the oligonucleotide primers employed were: d(CGCATTAAAGCTTATCGATG) and d(AATTAATACGACTCACTATAGGGAGATAGGCGTATCACGAGGCCCT).

These 101-bp nucleotides of which (in the second listed primer) are not present in pBR322. These nucleotides represent the sequence of the T7 promoter, which was appended to the 75-bp sequence from pBR322 by using the extension. The primers are designed to produce a fragment, 26 primer with 20 complementary bases and a 26-base 5' procedure required less than two hours and produced two picomoles of the relatively pure 101-bp fragment from 100 fmoles of pBR322.

The T7 promoter can be used to initiate RNA transcription.

T7 polymerase may be added to the 101-bp fragment to produce single- stranded RNA.

C. The experiment described in Example 8D was repeated except that the oligonucleotide primers employed were as follows: d(TAGGCGTATCACGAGGCCCT) and d(CCAGCAAGACGTAGCCCAGC) to produce a 1000~bp fragment from pBR322.

D. The experiment described in Example 9C was repeated except that the oligonucleotide primers employed were as follows: d(TAGGCGTATCACGAGGCCCT) and _ - d(AATTAATACGACTCACTATAGGGAGATAGGCGTATCACGAGGCCCT) |E9502 so as to produce a 1026-bp fragment, 26 nucleotides of which (in the second listed primer) are not present in pBR322 and represent the T7 promoter described above. The promoter has been inserted adjacent to a 1000—bp fragment from pBR322.

The results indicate that a primer which is not a perfect match to the template able to hybridize sufficiently to be enzymatically extended produces a long sequence but which is nonetheless product which contains the sequence of the primer rather than the corresponding sequence of the original template. The long product serves as a template for the second primer to introduce an in vitro this undiminished efficiency, because no further mispaired primings are mutation. In further cycles mutation is amplified with an required. In this case, a primer which carries a non-complementary extension on its 5' end was used to insert a new sequence in the product adjacent to the template sequence being copied.

EXAMPLE 10 This example illustrates employing nested sets of primers to decrease the background in the amplification of single copy genes. whole human DNA homozygous for the wild-type 5-globin allele was subjected to twenty cycles of amplification as follows: A total of 10 pg DNA, 200 picomoles each of the primers: d(ACACAACTGTGTTCACTAGC) and d(CAACTTCATCCACGTTCACC) and 100 nanomoles each dNTP in 100 pl of 30 mM Tris-acetate pH 7.9, 60 mM sodium acetate, 10 mM dithiothreitol, and 10 mM magnesium acetate were heated to 100°C for one minute, cooled to 25°C for one minute, and treated with 2 units Klenow fragment for two minutes. The cycle of heating, cooling and adding Klenow was repeated 19 times. A ten—pl aliquot was removed from the reaction mixture andi subjected to a further ten cycles of amplification using each of the primers: d(CAGACACCATGGTGCACCTGACTCCTG) and d(CCCCACAGGGCAGTAACGGCAGACTTCTCC), — - E95022? which amplify a S8-bp fragment contained within the 110-bp fragment produced This accomplished by diluting the 10-pl aliquot into 90 pl of the fresh above. final ten cycles of amplification was Tris-acetate buffer described above containing 100 nanomoles each dNTP and 200 pmoles of each primer. Reaction conditions were as above.

After ten cycles a 10-pl aliquot (corresponding to 100 nanograms of the original DNA) was applied to a 6% NuSieve (FMC Corp.) agarose gel and visualized using ethidium bromide.

Figure 10 illustrates this gel illuminated with UV light and photographed through a red filter as is known in the art. Lane 1 is molecular weight markers. Lane 2 is an aliquot of the reaction described above. Lane 3 is an aliquot of a reaction identical to that described above, except that the original wild-type DNA was cleaved with Ddei prior to amplification. Lane 4 is an aliquot of a reaction identical to that described above, except that human DNA homozygous for the treated with Ddel amplification (the sickle allele does not contain a Ddel site in the sickle betaglobin allele was prior to fragment being amplified here). Lane 5 is an aliquot of a reaction identical to that described above, except that salmon sperm DNA was substituted for human DNA. identical to that described above, except that the aliquot was treated with Qde} after amplification (jggg should convert the 58—bp wild—type Lane 7 is an aliquot of the (the 58-bp Lane 6 is an aliquot of a reaction product into 27-and 31-bp fragments).

Lane 4 material treated with Ddel after amplification sickle product contains no DdeI site).

Detection of a 58-bp fragment representative of a single~ copy gene from one microgram of human DNA using only ethidium bromide staining of an agarose gel requires an amplification of about 500,000- fold. oligonucleotide primers herein.

This was nested sets of accomplished by using the two The first set amplifies the 110-bp fragment and the inner nested set amplifies a sub-fragment of this product up to the level of convenient detection shown in Figure 10.

This contained procedure of smaller within the amplification process and contained in the extension products of the using primers amplifying a sequence sequence being amplified in the previous p__: U! beta-globin locus resorting to either non-radioisotopic methodology EXAMPLE 11 The present process is expected to be useful in detecting, in a patient DNA sample, a specific sequence associated with an infectious disease,,such as, e.g., Chlamydia using a biotinylated formula: where Y is O, NH or N-CHO, x is a number from 1 to 4, and y is a number from 2 to 4. Detection of the biotinyl groups on the probe may be accomplished using a streptavidin—acid phosphatase complex commercially obtainable from Enzo Biochem Inc. using the detection procedures suggested by the manufacturer in its brochure. The hybridized probe is seen as a spot of precipitated stain due to the binding of the subsequent reaction catalyzed by acid phosphatase, which produces a precipitable dye. detection complex, and the EXAMPLE 12 In this example, the process of Example 7 was basically used to amplify a 119 base pair fragment on the human 5-hemoglobin gene using the primers: '-CTTCTGcaQCAACTGTGTTCACTAGC-3' '-CACaAgCTTCATCCACGTTCACC-3' (GH18) (GH19) lE930z27 prepared as described in previous examples. lE9302 lE930z Amplification and Cloning After twenty cycles of amplification of 1 microgram of human genomic DNA isolated from the cell line Molt 4 as described in Example 2, 1/14th of the reaction product was hybridized to the labeled 5- RSO6, of the using the glovin specific oligonucleotide probe, sequence 5'- CTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGG-3' restriction. methods Following solution with DdeI restriction digestion conditions as described above, to produce an 8- described above for oligomer hybridization, the reaction mixture was treated under base pair oligonucheotide. The amount of this 8-base pair product is proportional to the amount of amplified product produced. The digestion products were resolved on a 30% polyacrylamide gel and visualized by autoradiography. that the amplification was comparable in efficiency to that of amplification with PC03 (5'-ACACAACTGTGTTCACTAGC-3') and PCO4 CCACTTGCACCTACTTCAAC-3'), which are complementary to the negative and positive strands, respectively, of the wild-type B-globin.

Analysis of the autoradiogram revealed primers (5'- sample was which is publicly available from Boehringer-Mannheim.

The entire ligation mixture was transformed into jg; strain JM103, which is publicly available from BRL in Bethesda, MD. followed for transformed strain is described in Messing, J. (1981) Third Cleveland Symposium on Macro- molecules:Recombinant DNA, ed. A. Walton, Elsevier, Nnsterdam, 143- .

The procedure preparing the The transformation mixture was plated onto x-gal media for screening via plaque hybridization with nylon filters. The filters were probed with a B-globin-specific oligonucleotide probe R524 of the coli lE93fl?27‘ sequence 5'-CCCACAGGGCAGTAACGGCAGACTTCTCCTCAGGAGTCAG—3' to determine the number of B—globin inserts. The filters were then reprobed with the primer P004 to determine the total number of inserts.

Plating and Screening Table II The filters were probed with the primer PC04 to determine the summarizes the plating and plaque hybridization data. percentage of inserts resulting from amplification and cloning; 1206 clear plaques (90% of total number of clear plaques) hybridized to the primer.

RS24. primer-positive plaques is approximately 1%.

Fifteen gflaques hybridized to the 5-globin specific probe The percentage of B-globin positive plaques among the amplified TABLE 11 Blue No 8—Globin Plate No. Plagues 1nserts* Inserts** Inserts 1 28 25 246 1 2 29 18 222 2 3 11 26 180 0 4 24 20 192 5 22 27 185 5 6 39 21 181 3 TOTAL 158 132 1206 15 % of plaques containing amplified sequences which contain B-globin insert = 15/1206 x 100 = 1.24% % of total plaques which contain p-globin insert = ca.1% /1496 x 100 = % of total plaques which contain amplified sequences = 1206/1496 x 100 = 0.8% * Clear plaques which do not hybridize to primer PCO4 ** Clear plaques which hybridize to primer PC04 Restriction Enzyme and Southern Blot Analysis DNA from phage DNA minipreparation of three B-globin positive and two p-globin negative (but PC04 primer positive) MstII digestion of DNA from M13 clones containing the amplified B-globin plaques were analyzed by restriction enzyme analysis. fragment ‘should generate a characteristic 283 base-pair fragment. Following MstII IE930z digestion, the three 5-globin positive clones all produced the predicted 283 base pair fragment, while the two clones which were positive only with the primer produced larger fragments.

The only bands which clones. the B-globin probes.

Sequence Analysis Ten B-globin positive clones which were shown by restriction enzyme analysis to contain the B-globin insert were sequenced using the M13—dideoxy Of the ten identical to the 5-globin wild-type sequence. The other clone was identical to the o—globin gene which had been shown to be amplified to sequencing method. clones, nine were only a small degree by the 8-globin primers.

In conclusion, the modified linker primers were nearly as efficient as the unmodified primers in amplifying the 5-globin sequence. The primers were able to facilitate insertion of amplified DNA into cloning vectors. Due to the amplification of other segments of the genome, only 1% of the clones contained hemoglobin sequences.

Nine of the ten clones were found to be identical to the published B-globin sequence, showing that the technique amplifies genomic DNA with high fidelity. One clone was found to be identical with the published o-globin sequence, confirming that the primers are 3-globin their having significant specific for the gene despite sequence homology with 6-globin. when cloning was carried out with a 267 base pair fragment only when °C) of the effective dimethylsulfoxide was cloning was (10% by B-globin gene, present volume at ‘in the amplification procedure. lE950z Restriction site—modified primers were also used to amplify and clone and partially sequence the human N-ras oncogene and to clone 240-base pair segments of the HLA DQ—a and DQ-B genes. All of these amplifications were carried out in the presence of 10% by volume dimethylsulfoxide at 37°C.

DQ-5 genes were much more specific for their intended targets than were the than discrete band on an ethidium bromide stained agarose gel, produced In addition, the HLA DQ-a primers produced up to 20% of The primers for amplifying HLA DQ-a and -globin and DR—B primers, which, rather giving a only a smear. clones, with amplified inserts which contained the desired HLA target fragment, whereas 'fi% oi the sequence. The HLA DQ-a and DQ-8 gene cloning was only effective when the DMSO was present and the temperature was elevated.

B-globin clones contained the target EXAMPLE 13 This example illustrates the use of the process herein to gene of 494 oligonucleotides of 74 base pairs each. prepare the TNF base pairs starting from two PRIMERS The primers employed were prepared by the method described in Example 2 and are identified below, each being 74 mers.

(TNIO) 5'-CCTCGTCTACTCCCAGGTCCTCTTCAAGGGCCAAGGCTGCCCCGACTATGTGCTCCTCA- CCCACACCGTCAGCC-3' (TNl1) 5'-GGCAGGGGCTCTTGACGGCAGAGAGGAGGTTGACCTTCTCCTGGTAGGAGATGGCGAAG— CGGCTGACGGTGTGG-3' (LL09) 5'-CCTGGCCAATGGCATGGATCTGAAAGATAACCAGCTGGTGGTGCCAGCAGATGGCCTGT— ACCTCGTCTACTCCC—3' (LL12) 5'-CTCCCTGATAGATGGGCTCATACCAGGGCTTGAGCTCAGCCCCCTCTGGGGTGTCCTTC- GGGCAGGGGCTCTTG-3' (TN08) 5'-TGTAGCAAACCATCAAGTTGAGGAGCAGCTCGAGTGGCTGAGCCAGCGGGCCAATGCCC- TCCTGGCCAATGGCA—3' (TN13) 5'-GATACTTGGGCAGATTGACCTCAGCGCTGAGTTGGTCACCCTTCTCCAGCTGGAAGACC- CCTCCCTGATAGATG-3' lE93fl2 (LL07) 5'-CCTTAAGCTTATGCTCAGATCATCTTCTCAAAACTCGAGTGACAAGCCTGTAGCCCATG— TTGTAGCAAACCATC-3' (TN14) 5'-GCTCGGATCCTTACAGGGCAATGACTCCAAAGTAGACCTGCCCAGACTCGGCAAAGTCG- AGATACTTGGGCAGA-3' ‘ OVERALL PROCEDURE . Ten cycles of the protocol indicated below were carried out using primers TN1O and TNI1, which interact as shown in the diagram below, step (a).

E II. A total of 2 pl added to the primers LL09 and LL12. carried out for 15 cycles, so that the primers would interact with the of the reaction mixture from Part I above was The protocol described below was product of Part I as shown in the diagram below, step (b).

III. A total of 2 pl of the reaction mixture from Part II above was added to the primers TNO8 and TN13.

Carried out for 15 cycles, 50 that the primers would interact with the The protocol described below was product of Part II as shown in the diagram below, step (C).

IV. A total of 2 pl of the reaction mixture from Part III above was added to the primers LL07 and LL14. carried out for 15 cycles, so that the primers would interact with the The protocol described below was product of Part III as shown in the diagram below, step (d).

PROTOCOL Each reaction contained 100 pl of: 2 mM of each of dATP, dCTP, DGTP and TTP 3 pH of each of the primers used at that step x (30 mM Tris-acetate, 60 mM Na- acetate, 10 mM Mg-acetate, 2.5 mM dithiothreitol) Each cycle constituted: polymerase buffer, lE930z27 ) 1 min. in boi1ing water 2) 1 min. coo1ing at room temperature ) add 1 p1 (5 units) of the K1enow fragment of DNA polymerase ) a11ow the po1ymerization reaction to proceed for 2 min.

For the next cyc1e start again at step 1.

D IAGRAM E : TN10 —.———_; <————— 5' TN11 ___————-———€>xxxxxxx product from Part I‘ xxxxxxxxxx( ~«..». xxxxxxxxxxxxxxxxxxx T 5' LL12 on1y the sequence between 5' of LL09 and 5' of LL12 wi11 be fu11 Iength. The strands that con- tain TN10 and TN11 have non- growing 5' ends. Thus...

I 5' TN14 {same intermediate schema as (b) and (c) 1 ' LL07 V -————fi9XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXKXXXXXXXXXXXXX xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxe——————— ‘ TN14 (TNF gene) Deposit of Materiais The ceii line SC-1 (CTCC #0082) was deposited on March 19, 1985 with the American Type Cuiture Coiiection (ATCC), 12301 Parkiawn 20852 USA, with ATCC CRL#8755. The deposit of SC-1 was made pursuant to a contract between the ATCC and the Corporation. The Drive, Rockviiie, Maryiand Accession No. assignee of this appiication, Cetus contract with ATCC patent provides for permanent avaiiabiiity of the progeny of this ceii line to the pubiic on the issuance of the U.S. patent describing and identifying the deposit or the publications or upon the iaying open to the public of any U.S. or foreign patent application, whichever comes first, and for avaiiabiiity of the progeny of this ceii line to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 CFR $122 and the Commissioner's ruies pursuant thereto ‘E93022’ assignee of the present application has agreed that if the cell line on deposit should die or be lost or destroyed when cultivated under suitable conditions, it will be promptly replaced on notification with a viable culture of the same cell line.

In summary, the present invention is seen to provide a process for detecting sequences in nucleic acids by first amplifying one or more specific nucleic acid sequences using a chain reaction in which primer extension products are produced which can subsequently act as templates for further primer extension reactions. The process is especially usefigl in detecting nucleic acid sequences which are initially present in only very small amounts. Also, the amplification process can be used for molecular cloning.

Claims (15)

1. A kit for the amplification and detection of at least one specific nucleic acid sequence in a sample, which kit comprises in packaged form, a multicontainer unit comprising: (a) primer for each different specific nucleic acid sequence being amplified and detected, selected so as to provide a primer substantially complementary to each strand of each specific sequence such that the exgension product synthesized from one primer, when it is separated from its complement, serves as a template for synthesis of an extension product of the other primer; (b) means for synthesizing primer extension products; and (c) means for detecting the amplified sequence or sequences.

2. A kit according to claim 1 characterized in that the primers are selected so as to be substantially complementary to the different strands of a specific nucleic acid sequence which is contained within a larger sequence.

3. A kit according to any one of claims 1 to 2 characterized in that the primers are selected so as to be substantially complementary to the different strands of a specific nucleic acid sequence which is DNA or RNA, including messenger RNA, which DNA or RNA may be single- stranded or double-stranded, or is a DNA-RNA hybrid.

4. A kit according to any one of claims 1 - 3 characterized in that the primers are selected so as to be substantially complementary to the different strands of a specific nucleic acid sequence which is genomic DNA.

5. A kit according to any one of claims 1 — 4 characterized in that it comprises a collection of primers for each strand of the specific nucleic acid being amplified and detected, at least one of said primers is substantially complementary to said strand.

6. A kit according to any one of claims 1 - 5 characterized in that the primers contain about 10 - 25 u nucleotides_or more.

7. A kit according to any one of claims 1 - 6 characterized in that at least one of the primers contains a nucleotide sequence attached to the 5'—end which sequence is non-complementary to the corresponding strand of the specific nucleic acid being amplified and detected.

8. A kit according to any one of claims 1 — 6 characterized in that at least one of the primers is interspersed with bases or a nucleotide sequence which bases or nucleotide sequence are non—complementary to the corresponding strand of the specific nucleic acid being amplified and detected.

9. A kit according to any one of claims 1 - 6 characterized in that each primer contains a restriction site which is the same as or different from a restriction site on another primer.

10. A kit according to any one of claims 1 - 9 characterized in that they further comprise an enzyme from the class known as helicases.

11. A kit according to any one of claims 1 - |E9302 comprising an enzyme selected from E. coli DNA polymerase I, Klenow fragment of E. coli DNA polymerase I, T4 DNA polymerase, another DNA polymerase, reverse transcriptase, and heat-stable enzymes.

12. A kit according to any one of claims 1 - 11 comprising readily detectable nucleotides.

13. A kit according to any one of claims 1 - 12 characterized in that the means for detecting the amplified sequence or sequences comprise a labelled '3 probe.

14. The use of a kit according to any one of claims 1 — 13 for enabling detection and/or characterization of ' specific nucleic acid sequences associated with infectious diseases such as those caused by bacteria, viruses and protozoan parasites, genetic disorders such as those caused by specific deletions and/or mutations in genomic DNA or cellular disorders such as cancer.

15. A kit according to claim 1, substantially as hereinbefore described. F. R. KELLY & co., AGENTS FOR THE APPLICANTS.