JP2005348733A - Prostaglandin reductase - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a polypeptide effective for controlling lipid and glucose metabolism by controlling PPAR (peroxisome proliferator activated receptor) activity and a medicinal composition containing the polypeptide. <P>SOLUTION: The present invention provides an isolated polypeptide not reducing leukotriene B4, but reducing 15-ketoprostaglandin and having a specific sequence or its functional equivalent and a double stranded ribonucleic acid (dsRNA) for inhibiting expression of 15-ketoprostaglandin-▵13-reductase. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to prostaglandin reductase.

  Peroxisome proliferator-activated receptors (PPARs) belong to the group of nuclear receptors that regulate lipid and glucose metabolism. Three mammalian PPARs have been identified, PPAR-α, PPAR-γ and PPAR-δ. When activated by either plant-derived fatty acids or their metabolic derivatives, PPAR induces a cascade of transcription resulting in changes in lipid and glucose metabolism. For example, when activated, PPAR-γ, which is highly expressed in adipose tissue, promotes glucose uptake and lowers blood glucose levels.

  Given its role in lipid and glucose metabolism, PPAR is expected as a target for the treatment of diseases such as type II diabetes, obesity, dyslipidemia, coronary heart disease, inflammatory diseases, and cancer . Synthetic PPAR-γ agonists, i.e., AVANDIA, have been used to treat type II diabetes, and other synthetic PPAR-α agonists, i.e., fibrates, have dyslipidemia. It is used to treat (see, for example, Non-Patent Documents 1 and 2). However, most PPAR therapeutics have limited effectiveness and significant side effects.

Therefore, there is a need to develop drugs that are more effective in controlling lipid and glucose metabolism by modulating PPAR activity.
Lehmann, et al. , J Biol Chem, (1995) 270: 12953-1295. Fruchart, et al. Curr. Opin. Lipdol. (1999) 10: 245-257

  The present invention has been made in view of the above circumstances, and an object thereof is to provide a polypeptide effective for controlling lipid and glucose metabolism by regulating PPAR activity, and a pharmaceutical composition containing the same. And

The above objects are: (1) an isolated polypeptide having the sequence of SEQ ID NO: 1 or a functional equivalent thereof, which does not reduce leukotriene B4 but reduces 15-ketoprostaglandin. (2) an antibody that specifically binds to the isolated polypeptide or a functional equivalent thereof; and (3) having a first strand of polyribonucleotide and a second strand of polyribonucleotide. The first strand is the same as the 19th to 49th contiguous nucleotides of the nucleic acid encoding 15-keto prostaglandin-Δ ¹³ -reductase, and the second strand is complementary to the first strand. This is achieved by double-stranded ribonucleic acid (dsRNA) to inhibit the expression of 15-keto prostaglandin-Δ ¹³ -reductase, which is the target.

  The polynucleotide of the present invention can modulate PPAR activity. For this reason, the polynucleotide of the present invention is a disease such as type II diabetes, obesity, dyslipidemia, coronary heart disease, inflammatory disease, and cancer-related diseases (PPAR-related diseases). Expected to be a drug for treating

  The present invention relates to a method for treating a PPAR-related disease (PPAR-related disease) in a patient by modulating PPAR activity.

According to one aspect of the invention, the present invention provides an isolated polypeptide that reduces 15-keto prostaglandin but not leukotriene B4. Prostaglandins (PG) belong to a group of physiological mediators having a central ring and side chains with various degrees of unsaturation. The type of 15-keto prostaglandin is not particularly limited, and examples thereof include 15-keto PGE ₂ , 15-keto PGE _1, 15-keto PGF _2α , and 15-keto PGF _{1α. 2} is preferred. In this case, leukotrienes belonging to another group of physiological mediators differ from prostaglandins in that they do not have a central ring.

  According to another aspect of the invention, the present invention provides an antibody that specifically binds to the polypeptide described above. The antibody of the present invention may be either a polyclonal antibody or a monoclonal antibody, and may bind to the above-mentioned polypeptide fragment.

According to yet another aspect of the invention, the present invention provides a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a polypeptide having 15-ketoprostaglandin-Δ ¹³ -reductase activity, and A DNA vector for encoding is provided. 15-keto prostaglandin-Δ ¹³ -reductase is converted to 13,14-dihydro-15-keto prostaglandin of 15-keto prostaglandin by reducing the Δ ¹³ double bond of prostaglandin. An enzyme that catalyzes 15-keto prostaglandin-Δ ¹³ -reductase is not particularly limited, and examples thereof include 15-keto prostaglandin-Δ ¹³ -reductase / leukotriene B4 12-hydroxydehydrogenase (PGR / LTB4DH) and zinc-binding alcohol dehydrogenase 1 (PGR2 / ZADH1) and the like. dsRNA has two strands of polyribonucleotides. The first strand is the same as the 19th to 49th contiguous nucleotides of the nucleic acid encoding 15-keto prostaglandin-Δ ¹³ -reductase. The second strand is complementary to the first strand. Preferably, at least one end of the dsRNA has an overhang of the 1st to 4th nucleotides. The 15-keto prostaglandin-Δ ¹³ -reductase may be PGR / LTB4DH or PGR2 / ZADH1.

The present invention also encompasses methods for treating PPAR related diseases such as type II diabetes, obesity, dyslipidemia, coronary heart disease, inflammatory diseases, and cancer. The method comprises administering to the patient an effective amount of a 15-keto prostaglandin-Δ ¹³ -reductase modulating agent. A 15-keto prostaglandin-Δ ¹³ -reductase modulator means a molecule or complex of molecules that affects the activity or expression of 15-keto prostaglandin-Δ ¹³ -reductase. The modulator may be 15-keto prostaglandin. Further, the regulator may be an inhibitor that suppresses either the activity or expression of 15-keto prostaglandin-Δ ¹³ -reductase, and examples thereof include the dsRNA described above.

  Hereinafter, the present invention will be described in more detail, but other objects, features, and characteristics of the present invention will become apparent by referring to the following description and preferred embodiments exemplified in the accompanying drawings. Let's go.

The present invention is based on the discovery of 15-keto prostaglandin-Δ ¹³ -reductase 2 (PGR-2), one of the 15-keto prostaglandin-Δ ¹³ -reductase groups. Unexpectedly, it has been found that PPAR activity can be modulated by its substrates and inhibitors. These substrates and inhibitors are useful for treating PPAR related diseases such as type II diabetes, obesity, dyslipidemia, coronary heart disease, inflammatory diseases, and cancer.

  The present invention relates to an isolated polypeptide having the sequence of SEQ ID NO: 1 that reduces 15-keto prostaglandin but not leukotriene B4, or a functional equivalent of said polypeptide. The amino acid sequence (SEQ ID NO: 1) and the deduced nucleotide sequence (SEQ ID NO: 2) are shown below.

  Isolated polypeptide refers to a polypeptide that is substantially free of naturally occurring molecules, and is at least 75% pure (ie, 75-100%) pure by dry weight. Purity can be measured by appropriate standard methods such as, for example, column chromatography, polyacrylamide electrophoresis, or HPLC analysis. Isolated polypeptides of the present invention may be purified from natural sources or produced by recombinant DNA techniques or by chemical methods. The term “functional equivalent” refers to a variant of the isolated polypeptide of SEQ ID NO: 1 that is capable of reducing 15-keto prostaglandin but not leukotriene B4, eg, one or more point mutations. A protein having one or more insertions, a protein having one or more deletions, a protein having one or more truncations, or a protein having any combination of the above. In one embodiment, an isolated polypeptide of the invention or functional equivalent thereof is at least 80% (eg, 85%, 90%, 95%, or 100%, or 80-100% other) Have a sequence corresponding to SEQ ID NO: 1. The polypeptide / protein of the present invention may also be a fusion protein.

15-keto prostaglandin-Δ ¹³ -reductase activity means enzymatic conversion of 15-keto prostaglandin to 13,14-dihydro-15-keto prostaglandin. The method for measuring the specific activity is not particularly limited, and a known method can be used. For example, the specific activity is measured according to the following method. 10 μg of the protein preparation to be assayed is incubated at 37 ° C. in a reaction buffer containing 0.1 M Tris-HCl (pH 7.4), 0.5 mM NADPH, and 0.57 mM 15-keto PGE ₂ . The reaction is carried out in the dark at 37 ° C. for 10 minutes and the reaction is terminated by adding 700 μl of 50 mM potassium hydrogen phthalate and 1% Tween 20 buffer (pH 3.0). Unreacted NADPH is oxidized using 200 μl of a chromogenic reagent containing 790 μM indonitrotetrazolium chloride, 60 μM phenazene methosulfate, and 1% Tween 20. Absorbance at 490 nm is measured using an ELISA plate reader. A standard curve is obtained using a reaction buffer containing serially diluted amounts of NADPH. 90 nmole / min. When the specific activity is greater than or equal to mg protein, the polypeptide is said to have 15-keto prostaglandin-Δ ¹³ -reductase activity.

  The above nucleotide sequence, SEQ ID NO: 2, can be used to express the polypeptide of the present invention. By nucleotide sequence is meant a DNA molecule (eg, cDNA or genomic DNA), an RNA molecule (eg, mRNA), or a DNA or RNA analog. DNA or RNA analogs can be synthesized from nucleotide analogs. The nucleic acid molecule may be either single-stranded or double-stranded, but preferably is double-stranded. For the purpose of protein expression, a nucleic acid may be operatively linked to an appropriate regulatory sequence to obtain an expression vector. A vector means a nucleic acid capable of transporting another nucleic acid linked in advance. The vector may be capable of autonomous replication or may be incorporated into host DNA. Although it does not restrict | limit especially as a vector, For example, a plasmid, a cosmid, and a virus becuku are mentioned. A vector may comprise a nucleotide sequence in a form suitable for expression of the nucleic acid in a host cell. Preferably, the vector comprises one or more regulatory sequences linked to the nucleic acid sequence to be expressed by manipulation. The “regulatory sequence” is not particularly limited, and known regulatory sequences can be used in the same manner, and examples thereof include promoters, enhancers, and other expression or control elements (eg, polyadenylation signal). Regulatory sequences also include sequences that cause constitutive expression of the nucleotide sequence, as well as tissue-specific regulatory and / or derived sequences. The design of the expression vector can vary depending on factors such as the choice of the host cell to be transformed and the expression level of the desired protein. The polypeptide of the present invention can be produced by introducing the expression of the vector into a host cell. Host cells containing the nucleic acids are also encompassed within the scope of the present invention. The host cell is not particularly limited as long as it can introduce and express the nucleic acid. For example, E. coli cells, Sf9 insect cells (for example, using baculovirus expression vectors), yeast cells, and Mammalian cells can be mentioned. See, for example, Goeddel, (1990) Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA. The method for producing the polypeptide of the present invention is not particularly limited. For the above purpose, the host cell is cultured in an appropriate medium under conditions capable of expressing the polypeptide encoded by the nucleic acid of the present invention. Alternatively, a method for purifying a polypeptide from a cell culture medium can be used. Alternatively, the nucleotide sequence may be transcribed and translated in vivo using, for example, a T7 promoter regulatory sequence and T7 polymerase.

The polypeptide can be used to obtain antibodies in animals. An antibody may be obtained from a fragment of a polypeptide. Methods for making monoclonal and polyclonal antibodies and fragments thereof in animals are known in the art. See, for example, Harlow and Lane, (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York. The term “antibody” refers to a complete molecule, as well as Fab, F (ab ′) ₂ , Fv, scFv (single chain antibody), and dAb (domain antibody; Ward, et. Al. (1989) Nature, 341, 544) and the like.

  The method for producing the antibody is not particularly limited, but for example, the following method can be preferably used. However, it is not limited to the following method. The polypeptide of the present invention is coupled to a carrier protein such as KLH, mixed with an adjuvant, and further injected into a host animal. The antibody produced in this animal is then purified by peptide affinity chromatography. The host animal used at this time is not particularly limited, but generally rabbits, mice, guinea pigs, and rats are used. Various adjuvants can be used to improve the immune response, and the type of adjuvant varies depending on the species of the host and is not particularly limited. For example, Freund's adjuvant (complete and incomplete), inorganic gel such as aluminum hydroxide, lysolecithin , Pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and surfactants such as dinitrophenol. Useful human adjuvants are not particularly limited, and examples thereof include BCG (bacille Calmette-Guerin) and Corynebacterium parvum.

  Polyclonal antibodies, a heterogeneous population of antibody molecules, are present in the serum of immunized subjects. A method for producing a monoclonal antibody, which is a homogeneous population of antibodies against the polypeptide of the present invention, is not particularly limited, but can usually be prepared using standard hybridoma technology (eg, Kohler et al. (1975) Nature 256, 495; Kohler et al. (1976) Eur J Immunol 6, 511; Kohler et al. (1976) Eur J Immunol 6, 292; and Hammerling et al. (1981) See Monoclonal Antibodies and T Cell Hybridomas, Elsevier, NY ). In particular, monoclonal antibodies produce antibody molecules by continuous cell passage systems in culture media such as those described in Kohler et al. (1975) Nature 256, 495 and US Pat. No. 4,376,110. Technology; human B cell hybridoma technology (Kosbor et al. (1983) Immunol Today 4, 72; Cole et al. (1983) Proc. Natl. Acad Sci. USA 80, 2026); and EBV hybridoma technology (Cole et al. (1983) Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Such antibodies may be of any immunoglobulin class such as IgG, IgM, IgE, IgA, IgD, and subclasses thereof. The hybridoma producing the antibody of the present invention may be cultured in vitro or in vivo. The ability to produce monoclonal antibodies in vivo at high titers is a particularly useful production method.

In addition, techniques developed for the production of “chimeric antibodies” may be used. See, for example, Morrison et al. (1984) Proc. Natl. Acad. Sci. USA 81, 6851; Neuberger et al. (1984) Nature 312, 604; and Takeda et al. (1984) Nature 314: 452. A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Alternatively, techniques described for the production of single chain antibodies (US Pat. Nos. 4,946,778 and 4,704,692) can be applied to generate phage libraries of single chain Fv antibodies. Also good. Single chain antibodies are formed by linking the heavy and short fragments of the Fv region via an amino acid bridge. Furthermore, antibody fragments are obtained by known methods and are not particularly limited. For example, such fragments include F (ab ′) ₂ fragments that can be produced by pepsin digestion of antibody molecules, and Fab fragments obtained by reducing disulfide bridges of F (ab ′) ₂ fragments. The antibody may also be humanized by known methods. For example, monoclonal antibodies with the desired binding specificity may be commercially humanized (Scotgene, Scotland; and Oxford Molecular, Palo Alto, Calif.). Fully human antibodies, such as fully human antibodies expressed in transformed animals, are also encompassed by the present invention (eg, Green et al. (1994) Nature Genetics 7, 13; and US Pat. No. 5 , 545,806 and 5,569,825).

Double-stranded ribonucleic acid (dsRNA) is also encompassed by the present invention. This dsRNA can be used to inhibit the expression of 15-keto prostaglandin-Δ ¹³ -reductase. Thus, PPAR-related diseases can be treated by administering dsRNA to the patient. The term “dsRNA” refers to a double-stranded ribonucleic acid that silences gene expression by degradation of the target RNA sequence, a process known as RNA interference (RNAi). RNAi has been used in a wide variety of animal models (eg, C. elegans, zebrafish, and mouse embryos) and other biological systems (eg, explanted chicken neuronal cells and mammalian cell cultures). Used to silence gene expression. See, for example, WO 99/32619, WO 00/44914, WO 00/44914, WO 00/44895, WO 00/63364, and WO 01/36646 A1.

  The RNA of the present invention can be synthesized by techniques known in the art. For example, Caruthers et al., 1992, Methods in Enzymology 211, 3-19, Wincott et al., 1995, Nucleic Acids Res. 23, 2677-2684, Wincott et al., 1997, Methods Mol. Bio. 74, 59 Brennan et al., 1998, Biotechnol Bioeng., 61, 33-45, and Brennan, US Pat. No. 6,001,311. RNA can also be transcribed from and isolated from expression vectors using standard techniques. The RNA or vector of the present invention can be delivered to target cells using methods known in the art. See, for example, Akhtar et al., 1992, Trends Cell Bio. 2, 139. For example, RNA or vectors may be introduced into cells using liposomes, hydrogels, cyclodextrins, biodegradable nanocapsules, or bioadhesive microspheres. Alternatively, the RNA or vector may be delivered locally by direct injection or using an infusion pump. Another approach is to use various transport and carrier systems, for example, using conjugates and biodegradable polymers.

By modulating the activity or expression of 15-keto prostaglandin-Δ ¹³ -reductase, PPAR-related diseases can be treated. “Treatment” refers to altering, altering, altering, altering, or altering a PPAR-related disease, a symptom of such disease, or a predisposition to developing such a disease. ), Affect these, ameliorate or prevent them, suffer from PPAR related diseases, have symptoms of such diseases, or such diseases Administering one or more of the 15-keto prostaglandin-Δ ¹³ -reductase modulators, ie, 15-keto prostaglandin-Δ ¹³ -reductase substrates and inhibitors, to a predisposed patient Means. “Effective amount” means the amount necessary to confer a therapeutic effect on the treated patient. Examples of 15-keto prostaglandin-Δ ¹³ -reductase include 15-keto PGE ₂ , 15-keto PGE ₁ , 15-keto PGF _2α , 15-keto PGF _1α , and analogs of these structures, 15-keto PGE ₂ .

  Examples of PPAR-related diseases (or disorders or conditions) include type II diabetes, hyperglycemia, low glucose tolerance, Syndrome X, insulin resistance, Obesity, lipid disorder, dyslipidemia, hyperlipidemia, hyperglycemia, hyperglyceridemia, hypercholesterolemia, low HDL levels, high LDL levels, atherosclerosis (and subsequent) Onset, eg, angina, lameness, heart attack or heart attack, vascular restenosis, irritable bowel syndrome, inflammatory disease (eg, inflammatory colitis, rheumatoid arthritis, Crohn's disease, ulcerative colitis, degenerative joint , Multiple sclerosis, asthma, vasculitis, ischemia / reperfusion injury, frostbite or adult respiratory distress syndrome, etc.), pancreatitis, neurodegenerative diseases, retinopathy, neoplastic conditions, cancer (eg Prostate cancer, stomach cancer, breast cancer, bladder cancer, lung cancer or colon cancer, or adipocyte cancer such as liposarcoma), angiogenesis, Alzheimer's disease, skin failure (eg acne, psoriasis, dermatitis, eczema, Or keratosis, etc.), hypertension, ovarian hyperandrogenemia, osteoporosis, osteopenia and the like. However, it is not limited to the above.

  For the purpose of treating PPAR related diseases, a pharmaceutical composition comprising a 15-keto prostaglandin-Δ13-reductase modulator and a pharmaceutically acceptable carrier can be administered to a patient in need of such treatment. In this case, the administration method of the pharmaceutical composition is not particularly limited, but for example, orally, by intravenous infusion, or subcutaneously, intramuscularly, intrathecally, intraperitoneally, intrarectally, intravaginally, intranasally. And can be administered by injection or implantation into the stomach, into the trachea, or into the lungs.

  The pharmaceutical composition may be used as a solution or suspension in a non-toxic acceptable diluent or solvent. In such a case, the solution is a solution in 1,3-butanediol. Acceptable vehicles and solvents that can be used are not particularly limited, and known ones can be used, and specific examples include mannitol, water, Ringer's solution, and isotonic sodium chloride solution. In addition, non-volatile oils are also conventionally used as solvents or suspending media, which can be used in the same way, with non-limiting examples of non-volatile oils including, for example, synthetic mono- or diglycerides. is there. Fatty acids such as oleic acid and glyceride derivatives thereof are useful for the preparation of injectables, and also natural pharmaceutically acceptable oils can be used, for example olive oil or castor oil, which are especially polyoxyethyl The modified form is preferred. These oil solutions or suspensions may also contain long-chain alcohol diluents or dispersants, carboxymethylcellulose, or similar dispersants. Or other commonly used surfactants such as tweens or spans, or other similar emulsifiers or bios commonly used in the manufacture of pharmaceutically acceptable solids, liquids or other dosage forms A bioavailability enhancer may be used for formulation purposes.

  The required dosage will vary depending on the route of administration; the nature of the formulation; the nature of the patient's illness; the size, weight, surface area, age and sex of the patient; other drugs administered; and the judgment of the attending physician. A suitable dose is 0.01 to 100.0 mg / kg. Given the different available compositions and the different effectiveness of different routes of administration, it is expected that the required dosage can vary widely. These dosage level variations can be adjusted using standard empirical procedures for optimality known in the art. In particular for oral delivery, encapsulation of the composition in a suitable delivery vehicle (eg, polymer microparticles or implantable devices) increases delivery efficiency.

  The pharmaceutical composition as described above may be formulated into dosage forms according to different administration routes using known methods. For example, for oral administration applications, the pharmaceutical composition can be formulated into capsules, gel seals, or tablets. Capsules may contain standard pharmaceutically acceptable materials such as gelatin or cellulose. Tablets can be formulated according to known methods, such as by compressing a mixture of the composition with a solid carrier and a lubricant. The solid carrier is not particularly limited, and a known solid carrier can be used, and examples thereof include starch and sugar bentonite. The composition may also be administered in the form of hard shell tablets or capsules containing binders such as lactose or mannitol, known fillers and tableting agents. The pharmaceutical composition may be administered via a parenteral route. Examples of parenteral dosage forms include aqueous solutions of active agents, isotonic saline or 5% glucose solutions, or other known pharmaceutically acceptable excipients. Cyclodextrins, or other solubilizers known in the art, may be used as pharmaceutical excipients for the purpose of delivering therapeutic agents.

The effectiveness of the pharmaceutical composition can be evaluated both in vitro and in vivo. In brief, the ability of a pharmaceutical composition to inhibit 15-keto prostaglandin-Δ ¹³ -reductase activity or expression in vitro may be tested. For in vivo studies, the pharmaceutical composition may be injected into an animal (eg, a mouse model) and then evaluated for its therapeutic effect. Based on the results obtained, an appropriate dosage range and route of administration can be determined.

  The following specific examples are illustrative only and should not be construed as limiting in any way the remainder of the disclosure. Moreover, it will be understood by those skilled in the art that the present invention can be implemented in its full scope without consuming any additional effort based on the description in the present specification. All references cited herein are hereby incorporated by reference in their entirety.

Identification of a novel 15-keto prostaglandin-Δ ¹³ -reductase In order to identify genes that are up-regulated during lipogenesis, mRNA differential expression analysis was performed using mouse 3T3-L1 cells. To induce lipogenesis, 3T3-L1 cells were treated with 1 μM dexamethasone and grown at 37 ° C. for 10 days. In 3T3-L1 cells collected on day 10 of induction, 199 nucleotide fragments were isolated and found to be highly expressed. The sequence of the fragment was confirmed to be identical to the two entries in GenBank, namely the segments of AK021033 and AK020666.

  The full-length cDNA sequence corresponding to the coding region of the gene was named mouse PGR-2. The sequence was isolated and cloned from 3T3-L1 adipocytes as follows. PGR-2 cDNA was amplified by PCR and ligated into a pGEM-T easy vector (Promega) using T4 DNA ligase (Promega). The sequences of the forward and reverse primers for PGR-2 cDNA amplification were 5′-CGG TAT AGC TTG GGA CGC TA-3 ′ (SEQ ID NO: 3) and 5′-TGC ATG TTA AGA ATC TTT GTG G-3, respectively. '(SEQ ID NO: 4). The resulting construct (pTE-PGR-2) was then sequenced with T7 and SP6 polymerase. Subsequently, the coding region of the PGR-2 open reading frame was subcloned into the expression vector pCMV-Tag2B (Stratagene). To construct pFLAG-PGR-2, pTE-PGR-2 as a template and two oligonucleotides 5′-AAC TGA AGC TTC AAG TGA TGA TCA TA-3 ′ (SEQ ID NO: 5) as primers And 5'-AGC TCT CCC ATA TGG TCG ACC T-3 '(sequence number 6) was used, PCR reaction was performed, and the HindIII-SalI fragment of PGR-2 was obtained. The PCR product thus obtained was then introduced into the HindIII-SalI site of pCMV-Tag2B to obtain a pFLAG / PGR-2 fusion construct. Finally, the pGEX-PGR-2 construct was prepared by ligating the HindIII-XhoI fragment of pFLAG / PGR-2 into the pGEX-4T-3 vector cleaved with SmaI and XhoI (Pharmacia). did.

  The deduced amino acid sequence of mouse PGR-2, that is, SEQ ID NO: 1 is as described above. The mouse PGR-2 was found to be homologous to two proteins: (1) human ZADH1 (Genbank accession number: NM152444) (homology: ~ 92%), and (2) PGR / LTB4DH or PGR -1 (homology: ~ 54%).

  In 3T3-L1 cells, PGR-2 expression increased during lipogenesis. Maximum expression was observed 6 days after induction of lipogenesis. At this point, a high accumulation of lipid droplets in the fat cells was observed. The tissue distribution of PGR-2 was determined. PGR-2 was highly expressed in adipose tissue. In both homozygous and heterozygous db / db mice, the amount of PGR-2 mRNA in omental fat was significantly higher than in wild type mice.

  According to standard techniques, mouse PGR-2 was recombinantly expressed in E. coli as a GST fusion protein. The recombinant PGR-2 protein thus obtained was used to determine substrate specificity and enzyme kinetics.

The enzyme activity was determined as follows. 10 μg of recombinant mouse PGR-2 protein was incubated at 37 ° C. in a reaction buffer containing 0.1 M Tris-HCl (pH 7.4), 0.5 mM NADPH, and 0.57 mM 15-keto PGE ₂ did. The reaction was carried out in the dark at 37 ° C. for 10 minutes, and the reaction was stopped by adding 700 μL of a buffer solution (pH 3.0) containing 50 mM potassium hydrogen phthalate and 1% Tween 20. Unreacted NADPH was oxidized by the addition of 200 μL of a colorant containing 790 μM indonitrotetrazolium chloride, 60 μM phenazene methosulfate, and 1% Tween 20. Absorbance at 490 nm was measured with an ELISA plate reader. A standard line was generated using a reaction buffer containing a series of diluted amounts of NADPH.

The substrate specificity of PGR-2 was determined by the method described above except that 15-keto PGE ₂ was replaced with 6 prostaglandin substrates (3 of which were downstream metabolites) or leukotriene B4. 15-keto PGE ₁ , 15-keto PGE _1α and 15-keto PGF _2α reacted specifically with PGR-2. In contrast, 6-keto PGF ₁ , PGF ₂ , 11b-PGF _2α , 13,14-dihydro-15-keto PGF ₂ , 13,14-dihydro-15-keto PGD ₂ , 13,14-dihydro-15— No specific activity was detected from keto PGE ₂ and leukotriene B4.

According to kinetics studies, PGR-2 is 15 keto PGE ₂ 13,14-dihydro-15-to-keto PGE _2, followed by 15-keto _PGF 1, 15-keto PGE _1, and 15 it has been shown that most efficiently catalyzes the conversion of keto PGF _2. Unlike PGR / LTB4DH, PGR-2 used NADPH as a cofactor much more efficiently than NADH.

  In 3T3-L1 cells, the protein expression level of PGR-2 was upregulated during lipogenesis. Maximum levels of PGR-2 protein were detected in fully differentiated adipocytes. In the early stages of lipogenesis, PPAR-γ was significantly induced. Low PGR-2 expression was localized in the nucleus of preadipocytes. Higher PGR-2 expression was distributed in the cytoplasm of differentiated adipocytes.

  The effect of PGR-2 expression on the regulation of PPAR-γ transcription in human Hep3B cells expressing endogenous human PPAR-α and -γ was also investigated. Overexpression of PGR-2 in Hep3B cells was found to suppress PPAR-mediated transcriptional activity. This transcriptional activity was also suppressed even after Hep3B cells were stimulated with a PPAR-γ agonist, ie BRL49653. Similar results were obtained for 3T3-L1 cells.

It was investigated the effect of prostaglandins for PPAR-gamma activity in prostaglandin adipocytes. After treatment with medium that induces cell differentiation, 14 μM 15-keto PGE ₂ , 13,14-dihydro-15-keto PGE ₂ , 15-keto PGF _2α , 13,14-dihydro-15-keto PGF _2α , Alternatively, 3T3-L1 cells were treated from day 2 to day 4 of adipogenesis with BRL49653, a 4.5 μM PPAR-γ agonist. Forman et al. Cell (1995) 83: 803-812. On day 6, lipid droplet aggregates were stained with Oil Red O for observation. 15-keto PGE2 efficiently promoted lipogenesis at a level comparable to BRL49653. After differentiation induction for 2 days, 3T3-L1 cells were transfected with a reporter gene. Both 15-keto PGE ₂ and 15-keto PGF _2α significantly promoted endogenous PPAR activity. In contrast, the corresponding downstream metabolites, ie, 13,14-dihydro-15-keto PGE ₂ and 13,14-dihydro-15-keto PGF _2α , did not increase PPAR activity.

  The luciferase reporter gene was transfected into 3T3-L1 cells along with the ligand binding domain of PPAR-α, PPAR-γ or PPAR-δ fused to the DNA binding domain of yeast GAL4. 15-keto PGE2 and 15-keto PGGF2α activated PPAR-γ and, to a lesser extent, PPAR-α.

The ability of 15-keto PGE2 to induce lipogenesis-specific PPAR-γ target genes, ie, IRS-1 and -2, was evaluated. In 3T3-L1 cells, sufficient amounts of PPAR-γ1 and PPAR-γ2 proteins were detected when treated with insulin and dexamethasone and not when treated with methylisobutylxanthine (MIX) alone. Addition of 15-keto PGE ₂ and MIX with insulin and dexamethasone significantly promoted PPAR-γ1 and PPAR-γ2 expression. 15-keto PGE2 and BRL49653 strongly induced the expression of aP2, an adipocyte-specific marker, even in the absence of MIX. In the presence of insulin and dexamethasone, treatment with BRL49653 dramatically increased IRS-2 expression. 15-keto PGE2 promoted the expression at the same level as MIX. IRS-1 expression was induced by either insulin / dexamethasone or MIX. The ligands of PPAR-gamma such as 15-keto PGE ₂ and BRL49653, the amount of IRS-1 protein did not increase.

The expression of PGR-2 was silenced using the 15-keto prostaglandin-Δ ¹³ -reductase inhibitor RNA interference (RNAi) approach. Two strands of small interfering RNA (siRNA), namely gaugucaguauuaccggaug (SEQ ID NO: 7) and gucaagaguga gaccucuu (SEQ ID NO: 8) are first annealed and then oligos into 3T3-L1 fibroblasts or differentiated preadipocytes It was introduced by transfection using Perfectamine (Invitrogen). Transfection of siRNA duplex reduced PGR-2 expression. In other experiments, siRNA duplex transfection increased the transcriptional activity of PPAR-γ. Therefore, PPAR-γ activity can be regulated through suppression of PGR-2 expression by RNA interference.

Other Embodiments All features disclosed in this specification may be used in any combination. Each feature disclosed in this specification may be replaced by another feature that achieves the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.

  From the above description, those skilled in the art can easily determine the essential features of the present invention, and various changes and modifications can be made without departing from the spirit and scope of the present invention. Can be adapted to different applications and conditions. Thus, other embodiments are also within the claims.

Claims (11)

  An isolated polypeptide having the sequence of SEQ ID NO: 1 or a functional equivalent thereof, which does not reduce leukotriene B4 but reduces 15-keto prostaglandin.   2. The isolated polypeptide of claim 1, or a functional equivalent thereof, having a sequence that is at least 80% identical to SEQ ID NO: 1.   3. The isolated polypeptide of claim 2, or a functional equivalent thereof, having a sequence that is at least 90% identical to SEQ ID NO: 1.   2. The isolated polypeptide of claim 1 or a functional equivalent thereof, wherein the polypeptide has the sequence of SEQ ID NO: 1. The isolation according to any one of claims 1 to 4, wherein the 15-keto prostaglandin is 15-keto PGE ₂ , 15-keto PGE ₁ , 15-keto PGF _2α , or 15-keto PGF _1α. Polypeptides or functional equivalents thereof. 15-keto prostaglandins, 15-keto is PGE _2, a polypeptide or functional equivalent thereof isolated according to claim 5.   An antibody that specifically binds to the isolated polypeptide of any one of claims 1 to 4 or a functional equivalent thereof.   The antibody according to claim 7, which is a monoclonal antibody. A first strand of polyribonucleotide and a second strand of polyribonucleotide, wherein the first strand is the 19th to 49th nucleic acid encoding 15-keto prostaglandin-Δ ¹³ -reductase. A double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of 15-keto prostaglandin-Δ ¹³ -reductase, which is the same as a contiguous nucleotide and the second strand is complementary to the first strand ). The ribonucleic acid according to claim 9, wherein the 15-keto prostaglandin-Δ ¹³ -reductase is PGR / LTB4DH. 15-keto prostaglandin - [delta ¹³ - reductase is PGR2 / ZADH1, ribonucleic acid according to claim 9.