JP2005323617A - Method for synthesizing nucleic acid - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a novel method for efficiently amplifying a DNA in a sample by suppressing the action of a PCR inhibitory substance. <P>SOLUTION: In the method for synthesizing a nucleic acid in which an objective gene in a sample is amplified, the action of a PCR inhibitory substance is suppressed by allowing a polyanion and/or an insoluble polymer thereof to exist in a gene amplification reaction liquid. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

The present invention relates to a nucleic acid synthesis method, and more particularly to a nucleic acid synthesis method by a polymerase chain reaction (hereinafter abbreviated as PCR) method.

The PCR method repeats the DNA synthesis reaction by dissociating the DNA strand into single strands, binding the primer across a specific region of the DNA strand, and the action of the DNA polymerase, thereby increasing the target DNA fragment several hundred thousand times. Can be amplified. The PCR method is described in Patent Document 1 which is an invention of Maris et al.

The PCR method can be used as a highly sensitive analysis method for nucleic acids in various samples, and in particular, can be used for the analysis of nucleic acids in samples derived from animal body fluids. Accordingly, the PCR method is used for diagnosis and monitoring of infectious diseases and genetic diseases. Furthermore, the PCR method is also suitable for DNA typing tests in transplantation, parentage testing, medical treatment based on individual genetic information, and the like. In these cases, peripheral blood is often selected for testing.

One disadvantage of the PCR method is that the reaction is inhibited by dyes, proteins, sugars or unknown contaminants. That is, many DNA polymerases including Taq DNA polymerase derived from Thermus aquaticus, which is a typical thermostable DNA polymerase, are strongly inhibited even if trace amounts of biological impurities are mixed in the PCR reaction solution. It is widely known.

Therefore, prior to DNA amplification by the PCR method, a process of separating cells, protozoa, fungi, bacteria, viruses, etc. (hereinafter referred to as gene inclusions) from a test substance, and then extracting nucleic acids from the gene inclusions Is required. As the method, a method in which a gene inclusion body is decomposed with an enzyme, a surfactant, a chaotropic agent, etc., and then a nucleic acid is extracted from the decomposition product of the gene inclusion body using phenol or phenol / chloroform is conventionally used. Has been. Recently, in the process of nucleic acid extraction, ion exchange resins, glass filters, glass beads, reagents having a protein aggregating action, and the like are used.

JP-A-61-274697

However, even if nucleic acid in a sample is purified using these methods, it is difficult to completely remove impurities, and the amount of nucleic acid recovered in the sample is often not constant. Therefore, the subsequent nucleic acid synthesis may not be successful especially when the content of the target nucleic acid in the sample is low. In addition, these purification methods are complicated and time-consuming, and increase the chance of contamination during operation. Therefore, in order to solve these problems, a simpler and more effective sample pretreatment method is desired.

Accordingly, an object of the present invention is to provide a novel method for efficiently amplifying nucleic acid in a sample by suppressing the action of a nucleic acid synthesis inhibitor.

Usually, heparin used as a blood anticoagulant is known as a PCR inhibitor and is not preferable for addition to a sample. However, as a result of intensive studies on these phenomena, we have found that heparin suppresses the action of PCR inhibitors in biological samples. In addition to heparin, other sulfated polysaccharides such as dextran sulfate, sulfated polymers such as polyvinyl sulfate, polyanions such as phosphorylated polymers such as DNA, and insoluble polymers thereof have been found to exhibit the same action. Invented the invention.
In order to solve the above problems, the present invention is characterized in that, in a nucleic acid synthesis method for amplifying a target nucleic acid in a sample, a polyanion and / or an insoluble polymer thereof is added to a nucleic acid amplification reaction solution.

According to the present invention, it has become possible to efficiently amplify a target nucleic acid from a biological sample containing a large amount of PCR inhibitory substances such as serum, plasma, blood, etc., without going through a process of separating and purifying nucleic acid. In addition, according to the present invention, nucleic acid synthesis can be performed simply and quickly, and the chance of contamination can be reduced.

Here, the polyanion means a polymer compound having a repeating structure containing an anion and a salt thereof. Examples of the anion include, but are not limited to, a sulfate group, a sulfite group, a phosphate group, a carboxyl group, and a thiocarboxyl group. Particularly preferred are a polymer compound having a repeating structure containing a sulfate group and a salt thereof (sulfated polymer), and a polymer compound having a repeating structure containing a phosphate group and a salt thereof (phosphorylated polymer).

Examples of the sulfated polymer include sulfated polysaccharides such as heparin and dextran sulfate and salts thereof (generally called sulfated polysaccharides), polyvinyl sulfate and salts thereof, and the like. It is not limited. In addition, although the salt can mention sodium salt, potassium salt, etc., it is not limited to these.
The addition amount of the sulfated polymer varies depending on the type, for example, heparin is 0.1 μg / ml or more, preferably 0.4 μg to 25.6 μg / ml, and dextran sulfate is 0.05 μg / ml. ml or more, preferably 0.12 μg to 7.8 μg / ml, but not limited to these ranges.

Examples of the phosphorylated polymer include, but are not limited to, DNA and RNA. The amount of the phosphorylated polymer added varies depending on the type, but for example, in the case of DNA, it is 0.2 ng or more, preferably 1-1000 ng per 50 μl reaction solution, but is not limited to these ranges.

The polyanion and / or its insoluble polymer may be added to the nucleic acid amplification reaction solution after being added to the sample, or may be added in advance to the nucleic acid amplification reaction solution. In addition, the polyanion and / or its insoluble polymer is not uniformly contained in the nucleic acid amplification reaction solution (for example, the polyanion and / or its insoluble polymer is added to the sample and this sample is added to the reaction solution without stirring) The same effect). The polyanion and / or its insoluble polymer may be used alone or in combination. The insoluble polymer of the polyanion may not be homogeneous, and may be a complex insoluble polymer containing a polyanion or a polyanion bound to a carrier that does not inhibit the nucleic acid synthesis reaction.

Furthermore, the polyanion may be coated on the inner wall of the reaction vessel in contact with the nucleic acid amplification reaction solution, or the vessel itself may be composed of an insoluble polyanion. The coating may be any method such as spin coating or hot dipping, and the thickness of the coating is not particularly limited. In addition, when the container itself is composed of insoluble polyanions, it is molded by injection molding or the like, but is not limited thereto.

In the present invention, the sample refers to a biological sample or a gene inclusion in a biological sample, and the biological sample refers to animal and plant tissue, body fluid, excrement, etc., and the gene inclusion includes cells, protozoa, fungi, It refers to bacteria, viruses, etc. Body fluids include blood, cerebrospinal fluid, saliva, and milk, while excreta includes, but is not limited to, feces, urine, and sweat. Cells include, but are not limited to, white blood cells and platelets in blood.

The nucleic acid amplification reaction solution usually contains a pH buffer solution and salts such as MgCl ₂ and KCl, primers, deoxyribonucleotides, and nucleic acid synthase. Further, the above salts are used by appropriately changing to other salts. In addition, various substances such as proteins such as gelatin and albumin, dimethyl sulfoxide, and surfactants may be added.

The pH buffer is a combination of tris (hydroxymethyl) aminomethane and a mineral acid such as hydrochloric acid, nitric acid, sulfuric acid, etc., and a desirable mineral acid is hydrochloric acid. In addition, various pH buffer solutions such as a pH buffer solution using a combination of tricine, CAPSO (3-N-Cyclohexylamino-2-hydroxypropanesulfonic acid) or CHES (2- (Cyclohexylamino) ethanesulfonic acid) with caustic soda and caustic potash can be used. The pH-adjusted buffer is used at a concentration between 10 mM and 100 mM in the nucleic acid amplification reaction solution.

A primer refers to an oligonucleotide that serves as a starting point for synthesis in the presence of a template, an amplification reagent, and the like. The primer is preferably single-stranded, but double-stranded can also be used. If the primer is double-stranded, it is desirable to make it single-stranded prior to the amplification reaction. The primer can be synthesized by a known method, or can be isolated from the biological world.

Nucleic acid synthase means an enzyme that synthesizes nucleic acid by addition of deoxyribonucleotides, or such a chemical synthesis system. Suitable nucleic acid synthases include E. coli. DNA polymerase I, E. coli Examples include, but are not limited to, the Klenow fragment of Escherichia coli DNA polymerase, T4 DNA polymerase, Taq DNA polymerase, T. litoralis DNA polymerase, Tth DNA polymerase, Pfu DNA polymerase, and reverse transcriptase.

In the present invention, a synergistic effect can be obtained by adjusting the pH of the nucleic acid amplification reaction solution. For example, the pH is 8.1 or more, preferably 8.5 to 9.5 under a temperature condition of 25 ° C.

The procedure of the nucleic acid synthesis method of the present invention is not different from the usual method except that a polyanion and / or an insoluble polymer thereof is added to the reaction solution. For example, when the PCR method is used as a nucleic acid synthesis method, first, a target double-stranded DNA fragment to be amplified is converted into a single-stranded DNA by heat denaturation (dynalation step). Next, a primer sandwiching the region to be amplified is hybridized (annealing step). Next, a DNA polymerase is allowed to act in the presence of four types of deoxyribonucleotides (dATP, dGTP, dCTP, dTTP) to perform a primer extension reaction (polymerization step).

(Experimental example 1)
In an experimental system in which human plasma was directly added to a PCR reaction solution to perform PCR, the effect of adding heparin, a kind of sulfated polysaccharide, was examined. The PCR reaction solution contained 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl ₂ , 200 μM each of dATP, dCTP, dGTP and dTTP, 0.4 μM each primer, 1.25 units / 50 μl Taq DNA polymerase (TaKaRa Taq: Takara shuzo , Kyoto, Japan). The template DNA is 3 fg of PUC18 plasmid DNA, the PCR primer is an oligonucleotide having a plus chain base sequence (RV-M: SEQ ID NO: 1) of PUC18 plasmid DNA and an oligonucleotide having a minus chain base sequence. Nucleotides (M13-47: SEQ ID NO: 2) were used. Primer sequences are as follows, and as a result of PCR using these two types of primers, an amplification product of 150 bp can be obtained.
RV-M: 5′GAGCGGATAACAATTTCACACAGGG3 ′
M13-47: 5 ′ CGCCAGGGTTTCCCAGTCACGAC3 ′

PCR was performed at 94 ° C. for 3 minutes, followed by 40 cycles of 94 ° C. for 30 seconds, 55 ° C. for 1 minute, 72 ° C. for 1 minute, and finally 72 ° C. for 7 minutes.
After completion of PCR, 5 μl of the reaction solution was used for electrophoresis and detection in 0.5 μg / ml ethidium bromide-added TAE (40 mM Tris-acetate, 1 mM EDTA) solution containing 2.5% agarose.

1 μl of human plasma and various concentrations of heparin sodium salt (Heparin Sodium: Wako, Osaka, Japan) were added to the PCR reaction solution (50 μl), and the electricity of the amplified product when PCR was performed using PUC18 plasmid DNA as a template. The electropherogram is shown in FIG. In the figure, M is a molecular weight marker (250 ng φX174-RF DNA cut with HincII), 1 is no heparin sodium salt added, 2 is 0.025 μg / ml, 3 is 0.05 μg / ml, 4 is 0.1 μg / ml, 5 Is 0.2 μg / ml, 6 is 0.4 μg / ml, 7 is 0.8 μg / ml, 8 is 1.6 μg / ml, 9 is 3.2 μg / ml, 10 is 6.4 μg / ml, 11 is 12.8 μg / ml, 12 is 25.6 μg / ml, 13 is 51.2 μg / ml, and 14 is the result when PCR is performed with 102.4 μg / ml added.
It has been shown that PCR amplification products can be obtained by adding heparin. Good results have been obtained when heparin sodium salt is added in an amount of 0.1 μg / ml (lane 4) or more, particularly 0.4 μg to 25.6 μg / ml (lanes 6 to 12).

(Experimental example 2)
This example is an experiment in which PCR was performed by adding serially diluted human blood directly to the reaction solution in the presence or absence of 0.8 μg / ml heparin sodium salt, which had good amplification efficiency in Experimental Example 1. is there. The composition of the PCR reaction solution used for the reaction is the same as in Experiment 1 except for the template DNA and the primers.
DNA in blood as template DNA, oligonucleotide having a plus strand base sequence (GH20: SEQ ID NO: 3) located in the human β-globin gene region and oligonucleotide having a minus strand base sequence as PCR primers Nucleotides (GH21: SEQ ID NO: 4) were used. Primer sequences are as follows, and as a result of PCR using these two types of primers, an amplification product of 408 bp can be obtained.
GH20: 5'GAAGAGCCAAGGACAGGTAC3 '
GH21: 5′GGAAAATAGCCAATAGGGCAG3 ′
The conditions for PCR and the conditions for electrophoresis after PCR are the same as in Experimental Example 1.

The experimental results (electrophoresis diagram) are shown in FIG. In the figure, M represents a molecular weight marker, 1, 5 represents blood 0.5%, 2, 6 represents 0.25%, 3, 7 represents 0.125% added, and 4 and 8 represent PCR results without addition. 1-4 are the results of PCR in the absence of heparin sodium salt and 5-8 are in the presence. According to this experimental example, it can be seen that the amplification product can be detected with high sensitivity even when PCR is performed by directly adding blood to the reaction solution by suppressing the action of the PCR inhibitory substance with heparin.

(Experimental example 3)
In an experimental system in which human serum was directly added to a PCR reaction solution to perform PCR, the effect of adding dextran sulfate, which is a kind of sulfated polysaccharide, was examined. The composition of the PCR reaction solution used for the reaction and the electrophoresis conditions after PCR are the same as in Experimental Example 1. The PCR was preheated at 94 ° C. for 4 minutes and 30 seconds, followed by 40 cycles at 94 ° C. for 30 seconds, 58 ° C. for 1 minute, 72 ° C. for 1 minute, and finally at 72 ° C. for 7 minutes.

Add 1 μl of human serum and various concentrations of dextran sulfate sodium salt (average molecular weight 5,500) (Sodium Dextran Sulfate, Nacalai tesque, Kyoto, Japan) to the PCR reaction solution (50 μl), and use PUC18 plasmid DNA as a template. Fig. 3 shows an electrophoretogram of the amplified product when PCR is performed. In the figure, M is a molecular weight marker, 1 is dextran sulfate sodium salt 100 μg, 2 is 25 μg, 3 is 6.3 μg, 4 is 1.6 μg, 5 is 390 ng, 6 is 97 ng, 7 is 24 ng, 8 is 6.1 ng, and 9 is 1.52 ng, 10 is 0.38 ng, 11 is 0.095 ng, 12 is 0.023 ng, and 13 is the result when PCR is performed without addition. 14 is a positive control to which neither human serum nor dextran sulfate sodium salt is added.
When PCR was performed with dextran sulfate sodium salt added at 390 ng to 6.1 ng (lanes 5-8), amplification products were detected.
From the above results, it has been clarified that dextran sulfate has an effect of suppressing the action of a PCR inhibitory substance in serum and recovering the reaction.

The concentration at which the effect was observed in this experimental example was in the range of 0.12 μg / ml (6.1 ng / 50 μl) to 7.8 μg / ml (390 ng / 50 μl), but from other experiments, the concentration of dextran sulfate used was It has been confirmed that the effective concentration range varies depending on the molecular weight and the amount of serum added, and the effective concentration range is not limited to the above range.

(Experimental example 4)
The effect of adding dextran sulfate was examined in an experimental system in which PCR was performed by directly adding human blood to a PCR reaction solution. The composition of the PCR reaction solution used for the reaction was the same as in Experimental Example 2, the PCR conditions were the same as in Experimental Example 3 except that the annealing temperature was set to 55 ° C., and the electrophoresis conditions after PCR were the same as in Experimental Example 1. It is the same.

Fig. 4 shows the electrophoretogram of the amplified product when PCR was performed using 0.05 µl of human blood and various concentrations of dextran sulfate sodium salt in the PCR reaction solution (50 µl) and using DNA in the blood as a template. Show. In the figure, M is a molecular weight marker, 2 is dextran sulfate sodium salt not added, 3 is 10 μg, 4 is 2.5 μg, 5 is 0.625 μg, 6 is 156 ng, 7 is 39 ng, 8 is 9.76 ng, 9 is 2.44 ng, 10 Shows the results when PCR was performed with 0.61 ng added. 1 is a negative control to which neither blood nor dextran sulfate sodium salt is added.
When dextran sulfate sodium salt is added from 156 ng to 2.44 ng (lanes 6-9) and PCR is performed, amplification products can be detected.

From the above results, it has been clarified that dextran sulfate has an effect of suppressing the action of a PCR inhibitory substance in blood and recovering the reaction. The concentration at which the effect was observed in this experimental example was in the range of 0.049 μg / ml (2.44 ng / 50 μl) to 3.1 μg / ml (156 ng / 50 μl), but from other experiments, the concentration of dextran sulfate used was It has been confirmed that the effective concentration range varies depending on the molecular weight and the amount of serum added, and the effective concentration range is not limited to the above range.

(Experimental example 5)
In an experimental system in which PCR is performed by directly adding human plasma to a PCR reaction solution, the effect of adding polyvinyl sulfate, which is a kind of sulfated polymer, was examined. The composition of the PCR reaction solution and the electrophoresis conditions after PCR are the same as in Experimental Example 1, and the PCR conditions are the same as in Experimental Example 3.

Various amounts of human plasma were added directly to the PCR reaction solution (50 μl), and PCR was performed using PUC18 plasmid DNA as a template in the presence or absence of 1 ng of polyvinylsulfuric acid potassium salt (Nacalai tesque). An electropherogram of the amplification product when performed is shown in FIG. In the figure, M is a molecular weight marker, 1 is 2 μl of plasma, 2 is 1 μl, and the following 3 to 10 are the results when PCR was carried out by directly adding plasma, which was reduced in volume in the order of 2 times, to the reaction solution. Yes. In addition, 11 is a result when plasma is not added. In the case of adding polyvinyl sulfate potassium salt (A in the figure), the PCR product was detected at an addition amount of 0.5 μl or less of plasma (lane 3), but in the case of no addition (B in the figure), 0.0125 μl ( Lane 5) PCR products are detected with the following addition amount. This indicates that by adding polyvinyl sulfate to the PCR reaction solution, it is possible to cope with about four times the amount of a PCR inhibitor in plasma compared to the case where it is not added.

(Experimental example 6)
In an experimental system in which PCR was performed by directly adding human serum to a PCR reaction solution, the effect of adding DNA, a kind of phosphorylated polymer, was examined.
The composition of the PCR reaction solution and the electrophoresis conditions after PCR are the same as in Experimental Example 1, and the PCR conditions are the same as in Experimental Example 3.

FIG. 6 shows an electrophoretogram of amplification products when 1 μl of human serum and various concentrations of human genomic DNA were added to the PCR reaction solution (50 μl) and PCR was performed using PUC18 plasmid DNA as a template. In the figure, M is a molecular weight marker, 1 is DNA 100 ng, 2 is 10 ng, 3 is 1 ng, 4 is 0.1 ng, 5 is 0.01 ng, and 6 is no addition.
PCR products are detected when PCR is performed with 1 ng (lane 3) or more of DNA added to the PCR reaction solution. The above results show that the action of serum-derived PCR inhibitory substances was suppressed by adding DNA and performing PCR.

(Experimental example 7)
In an experimental system in which human plasma was directly added to a PCR reaction solution to perform PCR, the effect of adding dextran sulfate gel, which is a kind of insoluble polymer of polyanion, was examined. The composition of the PCR reaction solution used for the reaction is the same as in Experiment 1 except for the template DNA and the primers.

As template DNA, cDNA reverse-transcribed from 1000 copies of control RNA (Takara shuzo) having a tetracycline resistance gene sequence derived from pBR322 plasmid, and as a PCR primer, an oligonucleotide having a plus-strand base sequence located in the tetracycline resistance gene region (F-1, Takara shuzo: SEQ ID NO: 5) and an oligonucleotide having a minus chain base sequence (R-1, Takara shuzo: SEQ ID NO: 6) were used. Primer sequences are as follows, and as a result of PCR using these two types of primers, an amplification product of 462 bp can be obtained.
F-1: 5 ′ CTCGTCGCCTCGCATCTTGGA3 ′
R-1: 5'CGGCACCCTGCTCTACGAGTTG3 '
The PCR conditions were the same as in Experimental Example 1 except that the annealing temperature was set to 64 ° C., and the electrophoresis conditions after PCR were the same as in Experimental Example 1.

Amplification when PCR was performed using 0.125 μl of human plasma and various amounts of dextran sulfate sulfate gel (Dextran beads, sulfated D5650: SIGMA, Missouri, USA) added to the PCR reaction solution (50 μl) The electropherogram of the product is shown in FIG. Since this dextran sulfate gel had lactose added as a stabilizer, it was washed with distilled water and dried. In the figure, M is a molecular weight marker, 1 is no dextran sulfate gel added, 2 is 0.2 μg, 3 is 0.4 μg, 4 is 0.8 μg, 5 is 1.6 μg, 6 is 3.2 μg, 7 is 6.3 μg, 8 is 12.5 μg , 9 shows the results when PCR was performed with 25 μg and 10 with 50 μg added.

It has been shown that PCR amplification products can be obtained by adding dextran sulfate gel. Good results have been obtained when dextran sulfate gel is added in an amount of 1.6 μg (lane 5) or more, particularly 3.2 to 25 μg (lanes 6 to 9).
The amount in which the effect was recognized in this experimental example was in the range of 1.6 μg to 50 μg per 50 μl of the reaction solution. However, the range of effective amount is different depending on the difference in the rate of introduction of sulfate groups into the dextran sulfate gel used. Because of the variation, the effective amount is not limited to the above range.

(Experimental example 8)
In this example, serially diluted plasma was directly added to the reaction solution in the presence or absence of 12.5 μg / 50 μl of dextran sulfate gel, which had good amplification efficiency in Experimental Example 7, and the pBR322-derived tetracycline resistance gene This is an experiment in which PCR was performed using cDNA as a template. The composition of the PCR reaction solution used for the reaction and the PCR conditions were the same as in Experimental Example 7, and the electrophoresis conditions after PCR were the same as in Experimental Example 1.
FIG. 8 shows an electrophoretogram of the amplification product when 12.5 μg of dextran sulfate gel and serially diluted human plasma were added to the PCR reaction solution (50 μl) and PCR was performed using cDNA as a template.
In the figure, M is a molecular weight marker, 1, 7 is no plasma added, 2, 8 is 0.063%, 3, 9 is 0.125%, 4, 10 is 0.25%, 5, 11 is 0.5%, 6, 12 is 1% added Shows the results when PCR was performed. In addition, 1-6 are dextran sulfate gel additive-free, 7-12 are dextran sulfate gel added.

According to this experimental example, it can be understood that the amplification product can be detected with high sensitivity even when PCR is carried out by directly adding plasma to the reaction solution by suppressing the action of the PCR inhibitory substance with dextran sulfate gel.
From the results of Experimental Examples 7 and 8, it can be seen that the action of the inhibitor can be suppressed not only when the polyanion is added to the reaction solution as a solution but also when an insoluble polyanion is added. This is effective not only when insoluble polyanion is added as a gel as in this example, but also when the polyanion is coated on the inner wall of the reaction vessel in contact with the reaction solution or when the vessel itself is composed of insoluble polyanion. is there.

Electrophoretic diagram of PCR performed by adding 1 μl of human plasma and heparin sodium salt of different concentration to the PCR reaction solution (50 μl) Electrophoretic diagram of PCR in which human blood was serially diluted and added to the reaction solution with and without 0.8 μg / ml heparin sodium salt, which had good amplification efficiency in Experimental Example 1. Electrophoresis diagram of PCR performed by adding 1 μl of human serum and dextran sulfate sodium salt with different concentrations to the PCR reaction solution (50 μl) Electrophoretic diagram of PCR performed by adding 0.05 μl of human blood and dextran sulfate sodium salt with different concentrations to the PCR reaction solution (50 μl) Electrophoretic diagram of PCR performed by adding various amounts of human plasma and 1 ng potassium polyvinyl sulfate to the PCR reaction solution (50 μl) Electrophoresis diagram of PCR performed by adding 1 μl of human serum and human genomic DNA of different concentrations to the PCR reaction solution (50 μl) Electrophoretic diagram of PCR performed by adding 0.125 μl of human plasma and different amounts of dextran sulfate gel to the PCR reaction solution (50 μl) Electrophoresis in which PCR was performed by serially diluting human plasma and adding it to the reaction solution when adding or not adding 12.5 μg / ml dextran sulfate gel, which had good amplification efficiency in Experimental Example 7. Figure.

Claims (5)

In a nucleic acid synthesis method for amplifying a target nucleic acid in a sample, a polymer compound (polyanion) having a repetitive structure containing an anion in a nucleic acid amplification reaction solution and a salt thereof (hereinafter collectively referred to as a polyanion) and / or A nucleic acid synthesis method comprising adding the insoluble polymer. 2. The nucleic acid synthesis method according to claim 1, wherein the polyanion is a polymer compound having a repeating structure containing a sulfate group (polysulfate) and a salt thereof (hereinafter collectively referred to as a sulfated polymer). The nucleic acid synthesis method according to claim 2, wherein the sulfated polymer is polyvinyl sulfate and a salt thereof. In a nucleic acid synthesis method for amplifying a target nucleic acid in a sample, a polyanion is coated on the inner wall of a reaction vessel in contact with a nucleic acid amplification reaction solution, or the vessel itself is composed of an insoluble polyanion. The nucleic acid synthesis method according to claim 1, wherein the sample is a biological sample or a gene inclusion in the biological sample, and the sample is directly added to the nucleic acid amplification reaction solution.

Images