JP2005313159A - Method for cleaning polluted soil or polluted water, and apparatus for cleaning polluted soil or polluted water - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for cleaning polluted soil or polluted water which can purify soil or water polluted by a chemical substance in a short-time and efficient manner. <P>SOLUTION: This method for cleaning polluted soil or polluted water is characterized by comprising the steps of bringing a medium, to which a biofilm can be deposited, into contact with microorganisms capable of decomposing a polluting component to form a biofilm containing microorganisms capable of decomposing the polluting component onto the surface of the medium, and bringing the medium with a biofilm formed thereon into contact with polluted soil or polluted water. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a method for purifying contaminated soil or contaminated water and an apparatus for purifying contaminated soil or contaminated water. More specifically, the present invention relates to contaminated soil or contaminated water contaminated with a chemical substance in a short time and efficiently. The present invention relates to a contaminated soil or contaminated water purification method and a contaminated soil or contaminated water purification apparatus.

With the recent development of science and technology, various chemical substances are used. On the other hand, environmental pollution caused by these chemical substances, in particular, contamination of soil and water such as lakes and ponds has become a problem. For example, oils such as mineral oil, agricultural chemicals, volatile organic compounds, heavy metals, etc. are known as pollutants, and when these pollutants are disposed in the environment (soil or water), they are used for a long time. Many things remain in the environment (soil or water) and can cause various harmful effects.
At present, it is said that there are more than 320,000 industrial sites in the country where the soil is contaminated with chemicals and requires soil purification for reuse. As a method for purifying contaminated soil, a treatment method by physicochemical means such as heating is known, but this method is generally expensive and unsuitable for treating a large amount of soil. Therefore, there is a demand for practical application of biological treatment methods (bioremediation methods) using living organisms, which are excellent in cost performance and capable of treating a large amount of soil, in particular, bioremediation methods using microorganisms. .

  Conventional methods for repairing contaminated soil using microorganisms include 1) land farming method, 2) biopile method, 3) bioslurry method, and 4) biobending method. The above methods 1) to 3) are all methods (transfer treatment method) in which contaminated soil is moved to another place, nutrients and microorganisms are introduced into the contaminated soil, and the contaminants are decomposed and purified. The above method 4) is a so-called in-situ method, in which nutrients and microorganisms are directly injected into the contaminated soil on the spot, so there is no cost for moving the contaminated soil or for reconstitution after purification. Is excellent.

  When the soil contaminated with a chemical substance is purified by the above method 4), a microorganism that decomposes the chemical substance is required. That is, when performing bioremediation using microorganisms, it is necessary to use microorganisms that meet the purpose. In addition, it is necessary to establish a treatment method, that is, a method in which microorganisms easily function (contaminant is easily decomposed). When bioremediation is performed by the conventional in-situ method, a method of injecting microorganisms into contaminated soil and leaving it alone, a method of injecting microorganisms and stirring with a large shovel, or a pile inserted into contaminated soil and aeration And there is a method of feeding nutrients, and there is a problem that the processing takes 90 to 250 days. At least in Japan, effective mineral oil-degrading microorganisms are not on the market, and effective bioremediation methods using microorganisms have not been put into practical use.

  In order to solve the above problem, Japanese Patent Application Laid-Open No. 7-124543 discloses that a microorganism for purifying soil contaminants is held on a carrier containing a superabsorbent polymer and administered to the contaminated soil to purify the contaminated soil. A soil remediation method is disclosed. Japanese Patent Application Laid-Open No. 7-96289 discloses a method for biologically decomposing harmful substances that cause soil contamination. All of the methods disclosed in the above publications utilize the property that the physiological function can be maintained at a high level by forming a group rather than the microorganisms functioning in a single state in nature. . However, the method disclosed in the above publication has a problem that it is difficult to continuously supply nutrients and oxygen. In particular, when the activity of aerobic microorganisms is expected, it is necessary to continuously supply oxygen, and thus the above problem cannot be solved completely.

JP-A-7-124543 JP-A-7-96289

  Therefore, the objective of this invention is providing the purification method of the contaminated soil or contaminated water which can purify the contaminated soil or contaminated water contaminated with the chemical substance in a short time and efficiently.

  As a result of intensive studies to solve the above problems, the present inventors have obtained the knowledge that contaminated soil or contaminated water can be purified by using a medium on which a biofilm is formed.

  The present invention has been made based on the above knowledge, and a biofilm containing a microorganism capable of decomposing a contaminating component on the medium surface by bringing a medium capable of attaching a biofilm and a microorganism capable of decomposing the contaminating component into contact with each other. And a method for purifying contaminated soil or contaminated water, comprising the step of bringing the medium on which the biofilm is formed into contact with contaminated soil or contaminated water.

Further, the present invention includes a step of dispersing microorganisms capable of decomposing contaminating components in contaminated soil or contaminated water, and a step of bringing a medium capable of attaching a biofilm into contact with the contaminated soil or contaminated water. The present invention provides a method for purifying contaminated soil or contaminated water.
As the microorganism, a strain belonging to the genus Pseudomonas that can decompose mineral oil can be used. The microorganism that forms the biofilm is not limited to the microorganism to be dropped, and may be a microorganism having a mineral oil resolution inherent in soil or sewage.
The present invention also includes a step of bringing a medium capable of attaching a biofilm into contact with contaminated soil or contaminated water, supplying microorganisms capable of decomposing contaminating components to the medium, and forming a biofilm containing the microorganisms on the medium. A method for purifying contaminated soil or contaminated water is provided.

In addition, the present invention includes a medium that has at least one hole and at least one protrusion and is formed in a hollow shape to which a biofilm can adhere, microorganisms that can decompose contaminants, oxygen, and nutrients. The present invention provides a contaminated soil or contaminated water purification apparatus comprising a supply device for supplying an object to the medium.
It is preferable that the contaminated soil purification apparatus further includes a device for supplying a biofilm formation promoting substance to a medium to which the biofilm can be attached.
The contaminated soil purification apparatus preferably includes a plurality of media to which the biofilm can be attached.

  ADVANTAGE OF THE INVENTION According to this invention, the purification method of the contaminated soil or contaminated water which can purify the contaminated soil or contaminated water contaminated with the chemical substance in a short time and efficiently is provided. Moreover, according to this invention, the contaminated soil or contaminated water purification apparatus which can purify the contaminated soil or contaminated water contaminated with the chemical substance in a short time and efficiently is provided.

Hereinafter, the present invention will be described in detail.
First, the contaminated soil or contaminated water purification method of the present invention will be described.
The contaminated soil or contaminated water purification method of the present invention forms a biofilm containing microorganisms capable of decomposing contaminating components on the surface of the medium by bringing a medium capable of attaching a biofilm and a microorganism capable of decomposing the contaminating components into contact with each other. And a step of bringing the medium on which the biofilm is formed into contact with contaminated soil or contaminated water.

Contaminated soil or contaminated water means soil or water contaminated with various chemical substances. For example, soil or water contaminated with chemical substances such as oils such as mineral oil, agricultural chemicals, volatile organic compounds, and heavy metals. Means.
The biofilm is a higher-order structure formed by microorganisms attached to the surface of a solid and formed by the microorganisms attached to the surface of the solid. Any medium capable of attaching a biofilm can be used without particular limitation as long as it can attach a biofilm. As such a material, for example, a plastic material or a metal material is used. Examples of the plastic material include polyesters such as polyethylene terephthalate (PET) and polyethylene naphthalate (PEN), polyolefins such as polyethylene and polypropylene, polyamides such as polystyrene and 6,6-nylon, polycarbonate, polyacrylonitrile, and polyimide films. It is done.
Examples of the metal material include nickel (Ni), nickel alloy, iron (Fe), iron alloy, cobalt (Co), and cobalt alloy.
In addition to the above, for example, wood chips, diatomaceous earth, zeolite and the like can be mentioned. In the soil, soil and rock particles may be the medium.
The size and shape of the medium are not particularly limited, and may be any shape, and the size is not particularly limited as long as the size is easy to use.

Moreover, as a medium which can adhere a biofilm, a low-cost thing is preferable, and since it is used in soil or water, a biodegradable thing is especially preferable.
In the contaminated soil or contaminated water purification method of the present invention, a medium capable of attaching a biofilm and a microorganism capable of decomposing the contaminating component are contacted to form a biofilm containing the microorganism capable of decomposing the contaminating component on the surface of the medium. Including the step of
The biofilm is a layered structure formed on the medium by the components constituting the microorganism itself or a polysaccharide secreted by the microorganism as it grows when the medium described above is present. By forming a biofilm, it is considered that it becomes more resistant to environmental stress, and its physiological activity is enhanced, thereby purifying contaminated soil or water.

The microorganism capable of decomposing the contaminating component means a microorganism capable of decomposing the above-described chemical substances such as oils such as mineral oil, agricultural chemicals, volatile organic compounds, and heavy metals. As the microorganism capable of decomposing the contaminating component, a microorganism that easily forms a biofilm is preferably used. As such microorganisms, known microorganisms can be used without particular limitation. Specific examples include microorganisms belonging to the genus Bacillus, microorganisms belonging to the genus Burkholderia, microorganisms belonging to the genus Aeromonas, microorganisms belonging to the genus Aerobacter, genus Acinetobacter Microorganisms belonging to the genus Enterobacter, microorganisms belonging to the genus Escherichia, microorganisms belonging to the genus Gallioela, microorganisms belonging to the genus Leptothrix, microorganisms belonging to the genus Klebsiella, micro Examples include microorganisms belonging to the genus Micrococcus, microorganisms belonging to the genus Nitrosomonas, microorganisms belonging to the genus Salmonella, etc. Further, these microorganisms decompose the mineral oil isolated by the present inventors. , A fungus belonging to the genus Pseudomonas The strain belonging to the genus Pseudomonas isolated by the present inventors is a microorganism that has the ability to decompose mineral oil and easily forms a biofilm, and the present inventors have identified this strain as WatG. WatG is a strain capable of degrading mineral oil, and hereinafter also referred to as “mineral oil-degrading bacteria.” In the present invention, mineral oil is obtained by refining crude oil. This refers to hydrocarbons, such as gasoline, kerosene, light oil, heavy oil, etc. Further, oils mainly composed of hydrocarbons obtained by refining crude oil, such as engine oil and diesel oil In the present invention, it is contained in mineral oil, gasoline contains a lot of aromatic hydrocarbons, and kerosene, light oil and heavy oil contain a lot of aliphatic hydrocarbons. , In particular, can be decomposed efficiently mineral oil carbon atoms contains more aliphatic hydrocarbons 8-23.

  WatG is isolated from water in an old kerosene tank in Hokkaido. For isolation of the WatG strain, a selective medium in which mineral oil (kerosene) was added at a rate of 10 g / L to a minimal salt medium (MSM) was used. When the LB medium is used, the WatG strain can grow at a temperature in the range of 4 ° C. to 50 ° C., and the optimum growth temperature is 30 ° C.

The bacteriological properties of the obtained microorganism were examined, and it was confirmed that it was a strain belonging to the genus Pseudomonas. The results of analysis of 16S-rDNA sequence, WatG strain showed the Pseudomonas aeruginosa and 100% similarity was identified as a novel strain of Pseudomonas aeruginosa. Further, the G + C content of the DNA of WatG strain was about 74%.
The bacteriological properties of the obtained microorganisms were investigated. The resulting mycological properties are moistened below.

[1] Morphological properties (1) Cell shape: rod-like (2) Gram staining: negative [2] Growth state Colonies are round and convex.

[3] Physiological properties (1) Growth temperature: When LB medium is used, it cannot grow at -1 ° C and 55 ° C, but can grow at 4-50 ° C.
(2) Oxygen requirement: aerobic (3) assimilation: assimilate fructose, D-glucose, glycerol, but L-arabinose, lactose, maltose, D-mannose, melibiose, raffinose, sucrose, D-xylose Does not assimilate sorbitol, L-rhamnose, D-cellobiose, inulin.
(4) The G + C content of DNA is about 74%.

  The strain belonging to the genus Pseudomonas can be isolated by screening from an old kerosene tank in Hokkaido, for example, using a minimum salt medium (MSM) containing mineral oil (kerosene) at a rate of 10 g / L. . MSM containing kerosene is a medium containing kerosene as the only carbon source.

As a medium for culturing the mineral oil-degrading bacterium, a natural medium or a synthetic medium may be used as long as these strains can grow. The medium may be a solid medium or a liquid medium. The medium used includes a carbon source, a nitrogen source, an inorganic substance, and the like. As the carbon source, mineral oil may be used, and in addition, carbohydrates such as glucose that are usually used for culturing microorganisms are used. Examples of the nitrogen source include organic nitrogens such as yeast extract, meat extract, peptone and various amino acids, and inorganic nitrogen such as ammonium nitrate and ammonium sulfate. Any of the nitrogen source and the carbon source may be used alone or in combination of two or more. As other inorganic substances, for example, potassium salts, magnesium salts, iron salts, calcium salts and the like are appropriately used as necessary. Examples of the medium to be used include LB medium and 0.1% yeast extract-containing MSM medium. The method for culturing mineral oil degrading bacteria of the present invention may be a normal method. For example, the culture temperature is preferably 20 to 40 ° C, more preferably 25 to 35 ° C. Moreover, it is preferable that the pH of a culture medium shall be 6-8, and it is still more preferable that it is 7 vicinity. Further, the culture is preferably carried out under aerobic conditions by performing shaking culture or aeration and stirring.
In the following description, it is described that it is effective to form a biofilm while supplying oxygen. However, the above-described WatG can grow even under anaerobic conditions in the presence of nitrate. Therefore, by using WatG in the presence of nitrate, biofilm formation can be promoted without supplying oxygen.

There is no particular limitation on the method for bringing a medium capable of attaching a biofilm into contact with a microorganism capable of degrading a contaminating component, and forming a biofilm containing a microorganism capable of degrading the contaminating component on the medium. A biofilm can be formed by dispersing the medium in the medium in which the microorganism is dispersed and stirring the medium, and then leaving the medium at a temperature in a range where the microorganism can grow.
In addition, when forming a biofilm, you may supply a biofilm formation promotion substance in the said culture medium. Examples of such biofilm formation promoting substances include so-called autoinducer compounds such as N- (3-oxododecanoyo) homoserine lactone. However, the autoinducer is synthesized by the microorganisms that form the biofilm itself, and the higher the density of the microorganisms, the higher the content, so supplementing the necessary nutrients to promote biofilm formation. It is effective to increase the growth ability of microorganisms by, for example. Also, supplying oxygen is effective because the formation of biofilm is promoted. Alternatively, a hollow shape having small pores may be used as a medium, and a compound that generates oxygen by contact with a microbial nutrient and water may be placed, and the hollow shape may be disposed in soil or water. By placing such a hollow shape in soil or water, oxygen is generated by the action of the compound, so that the biofilm is forced on the surface of the hollow shape without artificially supplying air (oxygen). Is done. Examples of such a drug include ORC manufactured by Regenesis.

The contaminated soil or contaminated water purification method of the present invention includes the step of bringing the medium on which the biofilm is formed, obtained as described above, into contact with the contaminated soil or contaminated water. There is no restriction | limiting in particular as a method of making a medium contact with contaminated soil or contaminated water, It can implement by adding a medium to contaminated soil or contaminated water, and stirring.
According to the above-described contaminated soil or contaminated water purification method of the present invention, since a biofilm containing microorganisms that decompose the contaminating components is formed on the surface of the medium, the contaminating components in the soil or water are efficiently decomposed, and the short-term In between, contaminated soil or contaminated water can be purified.

Moreover, the contaminated soil or contaminated water purification method according to another embodiment of the present invention includes a step of dispersing microorganisms capable of decomposing contaminating components in contaminated soil or contaminated water, and a medium to which a biofilm can be attached. A step of contacting with soil or contaminated water.
The microorganism capable of decomposing the contaminating component and the medium capable of attaching the biofilm are the same as those described above.
In the present embodiment, a biofilm formation promoting substance may be mixed in soil or water, or a biofilm formation promoting substance may be applied in advance to a medium to which biofilm can be attached. . Moreover, the formation of a biofilm is promoted by supplying oxygen, which is effective. Further, as a medium to which a biofilm can be attached, a hollow shape having small pores is used as a medium, and the above-described compound that generates oxygen by contact with nutrients of microorganisms and water is added. You may arrange | position in soil or water.

  In the present embodiment, after a microorganism capable of decomposing a contaminating component is dispersed in contaminated soil or contaminated water, a medium capable of attaching a biofilm is contacted. In this way, a biofilm containing microorganisms capable of decomposing contaminating components is formed on the surface of the medium by bringing the medium capable of attaching the biofilm into contact with the contaminated soil or contaminated water. Efficiency increases. That is, since a biofilm containing microorganisms that separate contaminating components is formed on the surface of the medium, the contaminating components in the soil or water are efficiently decomposed, and the contaminated soil or contaminated water can be purified in a short period of time.

Moreover, when using this invention for purification | cleaning of contaminated soil, the contact with the medium which can adhere a biofilm and soil can also be performed as follows, for example.
After the microorganisms capable of decomposing the contaminating components are dispersed in the contaminated soil, a borehole is drilled in the contaminated soil, and a plastic material capable of attaching a biofilm is injected into the borehole. The injection of the plastic material may be performed using a nozzle or a pipe. Insert a nozzle or pipe into the borehole and inject plastic material under pressure. Examples of the plastic material to be used include polymers such as ethylene, propylene, butene, octene, olefin resins including copolymers such as EVA and EEA, styrene, polymers of acrylate esters and copolymers thereof, styrene Examples thereof include styrene resins including copolymers such as acrylonitrile and styrene acrylonitrile butadiene, resins such as polycarbonate, polyoxymethylene, and polyamide. In the present invention, biodegradable ones are preferably used. The plastic material injected into the boring hole is solidified to have a form like a plant root. Microorganisms dispersed in the soil form a biofilm on the surface of the solidified plastic material and decompose the contaminated components in the soil.
If necessary, microorganisms capable of decomposing contaminating components may be additionally injected into the soil or near the solidified plastic material.

Next, a contaminated soil or contaminated water purification method according to another embodiment will be described.
The method for purifying contaminated soil of the present invention comprises a step of bringing a medium capable of attaching a biofilm into contact with the contaminated soil, supplying microorganisms capable of decomposing contaminating components to the medium, and forming a biofilm containing the microorganisms on the medium. It is characterized by including.
In the contaminated soil purification method of the present invention, first, a medium capable of attaching a biofilm is brought into contact with the contaminated soil.
Examples of the medium to which the biofilm can be attached include those described above, and a medium having at least one hole and at least one protrusion and formed in a hollow shape is preferably used. In the present embodiment, it is preferable to supply microorganisms capable of decomposing contaminating components to the medium, and further supply oxygen and nutrients. However, oxygen is supplied by supplying pores and then supplied. It is preferable because oxygen passes through the medium and escapes into the soil, and the periphery of the medium becomes an aerobic condition. In addition, since the supplied nutrients diffuse around the medium, the surface of the medium becomes rich in nutrients and a biofilm is easily formed. In addition, the provision of the projecting portion is preferable because the surface area of the medium is increased and the area of the portion where the biofilm is formed is increased. The form of the protruding part may be any form, for example, a needle-like form.

In the contaminated soil or contaminated water purification method in the present embodiment, microorganisms capable of decomposing contaminating components are supplied to the medium described above. The microorganisms that can decompose the contaminating components are the same as those described above.
In the contaminated soil or water purification method of the present invention, it is preferable to form a biofilm by supplying the microorganism, oxygen and nutrients to the medium. Biofilms are naturally formed by microorganisms (resident bacteria) that live in the soil, but in order to promote the formation of biofilms, microorganisms that can easily form biofilms and that can degrade contaminating components It is preferable to supply oxygen and nutrients. Biofilms are rarely formed of a single microbial species, and therefore, when microorganisms supplied to the medium and microorganisms that live in the soil come together to form microbial communities and form biofilms. Conceivable.

  There is no restriction | limiting in particular in the supply amount to the said medium of a microorganism, What is necessary is just to supply sufficient quantity for a biofilm to be formed. In addition, the microorganisms may be supplied only temporarily, but may be supplied in several times until the biofilm is formed.

  Moreover, there is no restriction | limiting in particular also about supply_amount | feed_rate of oxygen and a nutrient, What is necessary is just to supply a sufficient quantity to promote formation of a biofilm. By supplying oxygen and nutrients, the surroundings of the medium become aerobic, rich in nutrients, promotes the formation of biofilms, and promotes the degradation of contaminating components in the soil. It is preferable to supply nutrients without interruption. In addition, since oxygen is generated without interruption by using the above-described compound that generates oxygen by contact with nutrient substances and water, it is effective to use such a compound.

In the contaminated soil or contaminated water purification method according to the present embodiment, it is preferable to further supply a biofilm formation promoting substance to the medium. As the biofilm formation promoting substance, those mentioned above are used. The biofilm formation-promoting substance is produced by the microorganism itself and does not necessarily need to be supplied.
The contaminated soil or contaminated water purification method of the present invention can be implemented by the contaminated soil or contaminated water purification apparatus of the present invention, which will be described later.
According to the contaminated soil or contaminated water purification method of the present invention, a biofilm containing microorganisms that decompose the contaminating components is formed on the surface of the medium, so that the contaminating components in the soil or water are efficiently decomposed and contaminated in a short period of time. Soil or contaminated water can be purified.

  Next, the case where the soil is purified will be described for the contaminated soil or contaminated water purification method according to another embodiment. The present embodiment includes a step of bringing a medium capable of attaching a biofilm into contact with contaminated soil, supplying microorganisms capable of decomposing contaminating components to the medium, and forming a biofilm containing the microorganisms on the medium. The medium that can adhere to the biofilm is brought into contact with the contaminated soil as follows.

  A borehole is drilled in the soil, and a plastic material capable of attaching a biofilm is injected into the borehole. The injection of the plastic material may be performed using a nozzle or a pipe. Insert a nozzle or pipe into the borehole and inject plastic material under pressure. Examples of the plastic material to be used include polymers such as ethylene, propylene, butene and octene, olefin resins including copolymers such as EVA and EEA, styrene, acrylate polymers and copolymers thereof, styrene Examples thereof include styrene resins including copolymers such as acrylonitrile and styrene acrylonitrile butadiene, and resins such as polycarbonate, polyoxymethylene, and polyamide. In the present invention, biodegradable ones are preferably used. The plastic material injected into the borehole is solidified into a form having a spread like a plant root. Next, microorganisms capable of decomposing the contaminating components are supplied to the solidified plastic material. The plastic material is capable of forming a biofilm. The biofilm of the microorganism is formed, and the contaminating components in the soil are decomposed.

  Next, the case where the soil is purified will be described for the contaminated soil or contaminated water purification method according to another embodiment. The present embodiment includes a step of bringing a medium capable of attaching a biofilm into contact with contaminated soil, supplying microorganisms capable of decomposing contaminating components to the medium, and forming a biofilm containing the microorganisms on the medium. The medium that can adhere to the biofilm is brought into contact with the contaminated soil as follows.

A boring hole is drilled in the soil, and the boring hole is filled with a medium having high water permeability and capable of attaching a biofilm. Examples of such a medium include wood chips, shells, charcoal, zeolite, rice bran, rice fir and the like. Next, a microorganism capable of decomposing the contaminating component is supplied in the vicinity of the borehole to form a biofilm on the surface of the medium.
By filling such a highly permeable medium, the mineral oil in the soil is washed away by water from rainwater or water spray from the ground, and the water collects in the borehole due to the difference in permeability. The biofilm formed on the medium surface decomposes mineral oil in the soil.

Next, the contaminated soil or contaminated water purification apparatus of the present invention will be described.
The contaminated soil or contaminated water purification apparatus of the present invention has a medium that has at least one hole and at least one protrusion and is formed in a hollow shape to which a biofilm can be attached, and decomposes contaminating components. And a supply device for supplying the obtained microorganism, oxygen and nutrients to the medium.

The contaminated soil or contaminated water purification apparatus of the present invention will be described with reference to the drawings. FIG. 1 is a diagram showing an example of a contaminated soil or contaminated water purification apparatus of the present invention.
The contaminated soil or contaminated water purification apparatus 10 shown in FIG. 1 includes a biofilm adhesion member 18 that is a medium to which a biofilm can adhere, and microorganisms, oxygen, and nutrients that can decompose the contaminated components into the biofilm adhesion member 18. A supply device (not shown) is provided. A plurality of biofilm adhesion members 18 are provided.

  The supply device includes a microorganism supply pipe 12 for supplying microorganisms to the biofilm attachment member 18, an oxygen supply pipe 14 for supplying oxygen, and a nutrient supply pipe 16 for supplying nutrients. Yes.

A microorganism storage tank (not shown) is connected to the microorganism supply pipe 12, and microorganisms stored in the microorganism storage tank are supplied to the biofilm adhesion member 18 through the microorganism supply pipe 12. As the microorganism, those capable of decomposing contaminating components in the soil are used, and for example, the aforementioned strains belonging to the genus Pseudomonas capable of decomposing mineral oil can be used.

  An air blower (not shown) is connected to the oxygen supply pipe 14, and oxygen emitted from the air blower passes through the oxygen supply pipe 14 and is supplied to the biofilm attachment member 18. The oxygen supplied from the oxygen supply pipe 14 to the biofilm may be normal air, but oxygen gas, high-pressure compressed air, or the like may be used.

A nutrient storage tank (not shown) is connected to the nutrient supply pipe 16, and the nutrient stored in the nutrient storage tank is supplied to the biofilm attachment member 18 through the nutrient supply pipe 16. As a nutrient, a product containing a carbon source, a nitrogen source and an inorganic substance necessary for the growth of microorganisms is preferable. For example, the carbon source includes saccharides such as glucose, and the nitrogen source includes yeast extract, meat extract, peptone, organic nitrogen such as various amino acids, inorganic nitrogen such as ammonium nitrate, ammonium sulfate, etc. Examples of other inorganic substances include potassium salts, magnesium salts, iron salts, calcium salts and the like. These nutrients are usually dissolved or suspended in water and supplied to the biofilm attachment member 18.
The timing and amount of supplying microorganisms, oxygen, and nutrients to the biofilm attachment member 18 can be controlled by the supply device, and can also be automatically controlled.

  Although not shown in the figure, the biofilm formation promoting substance may be supplied to the biofilm adhesion member 18 in the contaminated soil or contaminated water purification apparatus of the present invention. Examples of the biofilm formation promoting substance include those described above. It is preferable that the timing and amount of supplying the biofilm formation promoting substance to the biofilm adhesion member 18 can be controlled by the supply device, as in the case of microorganisms, oxygen, and nutrients.

Next, the biofilm adhesion member 18 will be described with reference to the drawings. FIG. 2 is an enlarged view of the biofilm attachment member.
As shown in FIG. 2, the biofilm attachment member 18 includes a hollow member 30 having a large number of holes 32, and the hollow member 30 is provided with a large number of protruding portions 34. In the contaminated soil purification apparatus of the present invention, microorganisms are first supplied to the biofilm attachment member 18, and then oxygen and nutrients are supplied to the biofilm attachment member 18. The microorganisms supplied to the biofilm adhesion member 18 grow by oxygen and nutrients, and become a biofilm together with the microorganisms that lived in the soil. The biofilm is formed on the surface of the biofilm attachment member 18. The biofilm is first formed on the inside of the hollow member 30, but gradually increases, and the biofilm is formed on the outside from the hole 32, and then formed on the protrusion 34. Since the protrusions 34 are provided, the area where the biofilm is formed is increased, and it is considered that the effect of purifying the contaminated soil or the contaminated water is improved.

  Although there is no restriction | limiting in particular in the magnitude | size of the biofilm adhesion member 18, Usually, a diameter is about 4-30 mm, Preferably it is about 8-20 mm, Length is 20-300 cm normally, Preferably 30-200 cm. The size of the hole 32 is not particularly limited, but is usually about 0.5 to 10 mm, preferably about 1 to 6 mm. In the biofilm attachment member 18 shown in FIG. 2, the protruding portion 34 is a needle-like member, but is not limited to this shape, and may have any shape. When the projecting portion 34 is a needle-like member, the size thereof is not particularly limited, but usually the diameter is about 0.2 to 4 mm, preferably about 0.4 to 2 mm, and the length is Usually, it is about 2-30 mm, Preferably it is about 4-20 mm.

Moreover, as a material of a biofilm adhesion member, a plastic material, a metal material, etc. are used, for example. Examples of the plastic material include polyesters such as polyethylene terephthalate (PET) and polyethylene naphthalate (PEN), polyolefins such as polyethylene and polypropylene, polyamides such as polystyrene and 6,6-nylon, polycarbonate, polyacrylonitrile, and polyimide films. It is done.
Examples of the metal material include nickel (Ni), nickel alloy, iron (Fe), iron alloy, cobalt (Co), and cobalt alloy.
In addition to the above, for example, wood chips, diatomaceous earth, zeolite and the like can be mentioned.

  A biofilm containing microorganisms that decompose contaminants is formed on the biofilm adhesion member, and the contaminants around the biofilm adhesion member are decomposed by the action of microorganisms in the biofilm. The biofilm adhering member shown in FIG. 2 has a hole 32, the oxygen supplied from the supply device makes the surroundings of the biofilm adhering member aerobic, and the nutrient is around the biofilm attaching member. Therefore, microorganisms around the biofilm adhering member can be activated, and the contaminants can be decomposed continuously.

  In addition, as a biofilm adhesion member, it is not limited to what is shown in FIG. 2, For example, what is shown in FIG. 3 may be used. FIG. 3 is a cross-sectional view of a biofilm adhesion member of a contaminated soil purification apparatus according to another embodiment. In the biofilm adhering member shown in FIG. 3, the protruding portion 20 is formed in a hollow shape. By adopting such a shape, the surface area of the biofilm adhering member is further increased, so that the amount of biofilm formed is further increased.

  The contaminated soil or contaminated water purification apparatus of the present invention has the above-described configuration, but the size of the entire apparatus can be appropriately designed according to the purpose. In consideration of transporting to contaminated soil at the time of use, it is preferable that the contaminated soil purification apparatus has a transportable size. The contaminated soil or contaminated water purification apparatus 10 shown in FIG. 1 will be described as an example. The size of the supply apparatus is about 50 to 200 cm in length on one side and about 10 to 30 cm in thickness. If it is this size, transportation is easy. However, the contaminated soil or contaminated water purification apparatus of the present invention is not limited to the above-mentioned size. The contaminated soil or contaminated water purification apparatus of the present invention may be assembled and integrated after the members are transported to a required place.

  The processing capacity of the contaminated soil or contaminated water purification apparatus of the present invention is determined by its size, and may be determined by the area of the soil to be purified. Moreover, when purifying a large area of soil, ponds, lakes, or the like, a plurality of the contaminated soil or contaminated water purification devices of the present invention can be prepared and used.

Hereinafter, the present invention will be described in more detail with reference to examples. Needless to say, the scope of the present invention is not limited to such examples.
Example 1

<Isolation of mineral oil degrading bacteria>
Mineral oil-degrading bacteria were isolated from water collected from an old kerosene tank in Hokkaido. First, 1 ml of the collected water was transferred to a 50 ml flask containing 10 ml of a minimal salt medium (MSM medium) supplemented with 0.1% by mass yeast extract. The flask was then shaken using a swirl shaker and incubated at 30 ° C. for 2 weeks. The obtained culture broth was diluted with MSM medium to concentrations of 10 ⁻¹ , 10 ⁻² , and 10 ⁻³ . In order to isolate mineral oil degrading bacteria from these dilutions, an agar medium in which kerosene was added to MSM medium at a rate of 10 g / L was used as a selective medium. In the MSM medium used, NH ₄ NO ₃ was 0.4% by mass, KH ₂ PO ₄ was 0.47% by mass, Na ₂ HPO ₄ was 0.0119% by mass, and CaCl ₂ .2H ₂ O was used as a salt. 0.001% by mass, 0.1% by mass of MgSO ₄ .7H ₂ O, and 0.0015% by mass of FeSO ₄ are contained. Moreover, the only carbon source contained in the agar medium used for isolation is only the kerosene added. The diluted solution was diluted on the selective medium and cultured at a temperature of 30 ° C. until colonies were observed. Individual colonies grown were streaked on a selective medium, and this subculture was repeated several times to isolate and purify mineral oil-degrading bacteria. The resulting mineral oil degrading bacterium was named WatG.
In addition, when the LB medium was used, the WatG strain was able to grow in the range of 4 ° C. to 50 ° C., and the optimum growth temperature was 30 ° C.

Example 2
Microorganism Identification WatG was identified by general biochemical and molecular phylogenetic analysis methods.
For molecular phylogenetic analysis, 16S ribosomal DNA was amplified by PCR. In the PCR method, a reverse primer having a complete DNA of a fungus as a template and a base sequence represented by SEQ ID NO: 1 (AGAGTTTGATCCCTGGCT) and a base sequence represented by SEQ ID NO: 2 (AAGGAGGTGATCCCGCCCCA) as a forward template And were used. The thermal conditions for PCR amplification were preheating for 5 minutes at 94 ° C., followed by denaturation at 94 ° C. for 1 minute, annealing at 55 ° C. for 1 minute and extension at 72 ° C. for 1.5 minutes for 30 cycles. . The PCR product was sequenced after purification. The resulting sequences were checked against the relevant bacterial 16S rRNA sequence quoted from the database.
As a result, the WatG 16S rRNA gene sequence was 100% identical to that of Pseudomonas aeruginosa.

Example 3
The morphological characteristics WatG were gram-stained and observed with a microscope. The result was a gram-negative bacilli. Moreover, the colony was circular and convex. Colony growth was not observed at 4 ° C and 40 ° C.

Example 4
Biochemical characteristics When an assimilation test of a carbon source was performed according to a conventional method, the WatG strain was found to be fructose, glucose, glycerol, L-valine, L-alanine, L-histidine, L-glutamic acid, L-lysine, L-leucine, L-asparagine, L-glycine and L-proline were assimilated, but L-arabinose, lactose, maltose, mannose, melibiose, raffinose, sucrose, xylose, sorbitol, rhamnose, cellobiose, inulin, L-tryptophan and L-threonine Not assimilated.
WatG was an aerobic strain.

Example 5
Harvested analysis cultured strain of 16S-rDNA and DNA base composition, the standard means (Sambrook J, other (1989) Molecular Cloning:. A laboratory Manual, 2 nd edn ColdSpring Harbor, NY: Cold Spring Harbor Laboratory) chromosome by DNA was purified. Specifically, bacterial cells are suspended in Tris-EDTA buffer (pH 8.0) and dissolved in lysozyme (final concentration: 2 mg / mL) and sodium dodecyl sulfate (final concentration: 0.5%) to lyse the bacterial cells. It was. DNA was recovered from the lysate by phenol-chloroform extraction, and subjected to RNase treatment, CTAB treatment and ethanol precipitation to obtain purified DNA. In addition, ethanol precipitation was performed twice.
The DNA base composition, ie, guanine + cytosine (G + C) content, was measured by high performance liquid chromatography according to the method described in Kumagai, M. (1980) J. Mol. Biol 16, 111-120. For Pseudomonas aeruginosa JCM5962 ^T strain, the guanine + cytosine content was similarly measured.
The guanine + cytosine (G + C) content of WatG was 73.6%, and the Pseudomonas aeruginosa JCM5962 ^T strain was 67.2%.

Example 6
<Decomposition of mineral oil by WatG>
The diesel oil decomposition WatG was pre-cultured overnight at 30 ° C. using LB medium. In a 50 mL screw cap flask, WatG was inoculated into MSM medium supplemented with 1% (volume ratio) of diesel oil as mineral oil, and this sample was 20 ° C. (average soil temperature in Japan is around 20 ° C.) ) For 2 weeks. After completion of the culture, the residual mineral oil from the culture solution is dichloromethane (manufactured by Wako Chemical Co., Ltd.) containing 3 mg / mL n-dodecane (C12) (manufactured by Kanto Chemical Co., Ltd.) (in the culture solution and the like). The gas chromatograph (GC353B, manufactured by GL sciences) equipped with a flame ionization detector and a capillary column (TC-1, 30 m × 0.25 mm, manufactured by GL sciences) was analyzed. Helium was used as the carrier gas. The column temperature was initially set to 50 ° C. and then increased to 270 ° C. at a rate of 5 ° C./min. The temperature of the detector was set at 290 ° C. FIG. 4 shows the gas chromatographic analysis results of the samples before and after the culture. In FIG. 4, (A) is the result of culturing without inoculating WatG, and (B) is the result of inoculating WatG. As is clear from FIG. 4, the peaks indicating hydrocarbons of C11 to C23 (excluding C12) derived from diesel oil were hardly observed in the culture medium after culturing, and that diesel oil was decomposed by WatG. Indicated.
The decomposition rate of mineral oil is the difference between the sum of peaks indicating hydrocarbons of C11 to C23 (excluding C12) detected from the sample before culture and the corresponding peak detected from the sample after culture. It was calculated as the amount of mineral oil decomposed. The results are shown in Table 1.

Example 7
Decomposition of engine oil Culture was performed in the same manner as in Example 6 except that engine oil was used instead of diesel oil. Further, the residual mineral oil in the culture broth was analyzed in the same manner as in Example 6. About the decomposition rate of mineral oil, it computed considering the peak which shows the hydrocarbon of C13-C23 (except C12). The results are shown in Table 1.

Example 8
Cultivation was carried out in the same manner as in Example 6 except that A heavy oil was used instead of decomposing diesel oil . Further, the residual mineral oil in the culture broth was analyzed in the same manner as in Example 6. FIG. 5 shows the gas chromatographic analysis results of the samples before and after the culture. In FIG. 5, (A) is the result of culturing without inoculating WatG, and (B) is the result of inoculating WatG. As is clear from FIG. 5, the peaks indicating C11 to C23 hydrocarbons (except C12) derived from heavy oil are hardly seen after the culture, indicating that the heavy oil was decomposed by WatG. About the decomposition rate of mineral oil, it computed considering the peak which shows the hydrocarbon of C13-C23 (except C12). The results are shown in Table 1.

Comparative Example 1
A degradation test was conducted in the same manner as in Example 6 except that Pseudomonas aeruginosa JCM5962 ^T strain was used instead of WatG. FIG. 6 shows the results of gas chromatographic analysis of the samples before and after the culture. In FIG. 6, (A) is the result of shaking culture for 2 weeks without inoculating the Pseudomonas aeruginosa JCM5962 ^T strain, and (B) is the result of inoculating the Pseudomonas aeruginosa JCM5962 ^T strain. FIG. 6 shows that the Pseudomonas aeruginosa JCM5962 ^T strain does not have the ability to decompose diesel oil.

Example 9
Decomposition of diesel oil in soil Diesel oil was added to 2 g of soil to a concentration of 1% by mass. This soil was inoculated with WatG and cultured at 20 ° C. for 1 week. After culturing, the residual mineral oil in the soil was prepared by adding 6 iL of 3 mg / mL n-dodecane (C12) (manufactured by Kanto Chemical Co., Ltd.) as an internal standard to the soil, and then adding 2 mL of dichloromethane (Wako Chemical ( The product was extracted using The extract was analyzed by gas chromatography under the same conditions as in Example 6. FIG. 7 shows the gas chromatographic analysis results of the samples before and after the culture. In FIG. 7, (A) is the result of culturing without inoculating WatG, and (B) is the result of inoculating WatG. As is clear from FIG. 7, the peaks indicating hydrocarbons of C10 to C22 (excluding C12) derived from diesel oil are considerably small after cultivation, and WatG decomposes diesel oil even in soil conditions. I understand that. About the decomposition rate of mineral oil, it calculated for the peak which shows the hydrocarbon of C10-C22 (except C12). The decomposition rate was 20 to 40%.

Example 10
<Biofilm formation test>
2 g of soil was put in a test tube, and diesel oil was added so as to be 2% by mass with respect to this soil. Next, as a medium, charcoal powder (Dodomatsu Charcoal, trade name “Morita no Kitaro”: manufactured by Support Oty Co., Ltd.), fuel charcoal (usually commercially available) or zeolite (Co-Corporation) The product name “Tokachi Zeolite” manufactured by Rentem was added to the soil at a ratio of 10 mg to 2 g of the soil. In addition, as for charcoal powder, fuel charcoal, and zeolite, those having a size of 1 to 2 mm × 1 to 2 mm × 3 to 5 mm were used.

On the other hand, a culture solution obtained by the Pseudomonas aeruginosa WatG incubated 16 hours at 30 ° C. in LB medium, was added to a 10% by weight based on the weight of the soil. Subsequently, culture was performed at a temperature of 20 ° C. for 2 weeks. After culturing for 2 weeks, the total oil in the soil was extracted with 2 mL of dichloromethane-ethanol (1: 1), and diesel oil in the soil was analyzed by gas chromatography in the same manner as in Example 6. In addition, as a control, the same test was carried out for the case where the medium and WatG were not added, and the case where the medium was not added and WatG was added. The test was performed using four test tubes, and the average was obtained.
Table 2 shows the analysis results of diesel oil. The numbers in the table are the decomposition rates (mass%) of diesel oil, and represent the ratio (mass%) of the reduced mass of diesel oil to the mass of diesel oil added first.

As is clear from Table 2, the decomposition rate was 28.5% by mass for the case where neither the medium nor Pseudomonas aeruginosa WatG was added. This is probably because the diesel oil naturally evaporated and decreased because the microorganisms were not added, but it was not actually decomposed.
In the case where Pseudomonas aeruginosa WatG was added and the medium was not added, the decomposition rate was 55.8% by mass. Moreover, what added charcoal powder, fuel charcoal, or a zeolite as a medium had the decomposition rate of 65.1 mass%, 65.8 mass%, and 61.0 mass%, respectively. It can be seen that when charcoal powder, fuel charcoal or zeolite is added as a medium, the decomposition rate of diesel oil is improved as compared with the case where no medium is added. From this result, it is clear that the decomposition activity of mineral oil is increased by allowing a medium capable of forming a biofilm to coexist with WatG. This result is considered that the biofilm was formed in the medium which can form a biofilm which exists in soil, and the biofilm was formed, so that the decomposition activity of mineral oil was improved. In the following examples, the presence or absence of biofilm formation was tested.

Example 11
2 g of the soil cultured in Example 10 was collected, mixed with 4 mL of phosphate buffer (10 mM sodium phosphate containing 130 mM NaCl: pH 7.2), vortexed for 30 seconds, and then for 30 seconds. Sonication was performed. After standing for 10 minutes, 1 mL of the upper liquid was recovered and centrifuged at 10,000 xg for 10 minutes. The upper layer was removed and the precipitate was resuspended in the above phosphate buffer (0.5 mL). This was centrifuged again at 10,000 xg for 10 minutes to obtain a precipitate obtained as a biofilm fraction. When a liquid culture solution of P. aeruginosa WatG alone was used, the same treatment was performed after removing the medium by centrifugation.

  Subsequently, the biofilm fraction obtained as described above was fixed by treatment in 4% paraformaldehyde dissolved in a phosphate buffer at 4 ° C. for 4 to 8 hours. After fixation, the biofilm fraction or cells were washed with a phosphate buffer cooled to 4 ° C. to remove paraformaldehyde. The fixed sample was stored at −20 ° C. in 100 μL phosphate buffer-ethanol (1: 1).

The presence or absence of biofilm formation was confirmed by in situ hybridization. The biofilm fraction obtained as described above was dissolved on ice, and the liquid was removed by centrifugation (10,000 × g, 10 minutes). The resulting precipitate was resuspended in an appropriate amount of phosphate buffer-ethanol (7: 3). 8 μL of the sample was placed on a slide glass and dried at a temperature of 46 ° C. for 10 minutes. 50, 80, 98% ethanol was continuously added to this sample for dehydration and finally air-dried at room temperature. Hybridization was performed using a hybridization buffer (0.9 M NaCl, 20 mM Tris HCl). [pH 7.2], 0.01% sodium dodecyl sulfate, 20% formamide) at 46 ° C. for 16 hours. As a fluorescent probe for labeling bacteria, Eub338 (Amann et al., J. Bacteriol. 172: 762-770, 1990) labeled with fluorescein isothiocyanate (FITC) was used. The excitation light and fluorescence wavelengths of FITC are 490 and 520 nm, respectively. As the probe, 5′-GCTGCCTCCCGTAGGAGT-3 ′ (SEQ ID NO: 3) corresponding to the sequence 338-355 of the E. coli rRNA gene was used. The final concentration of the probe was 5 ng μl / L. In addition, the washing was carried out in advance with a washing solution (20 mM Tris-hydrochloric acid [pH 7.2], 0.01% sodium dodecyl sulfate, 0.225 mM NaCl) at 48 ° C. for 20 minutes. SlowFade after washing the glass slide by immersing it in deionized water for 10 seconds Samples were prepared using a light antifade kit (Molecular Probes, Eugene, Oreg. USA).

The obtained specimen was observed under a microscope using a confocal laser microscope (model LSM 510: manufactured by Zeiss) having excitation light wavelengths of 488 nm (Ar laser) and 543 nm (He—Ne laser). Image processing and analysis were performed using standard software provided by Zeiss. The processed image is Adobe Photoshop 3.0J (Adobe Systems Incorporated, Mountain View, Calif. USA).

  The result of microscopic observation is shown in FIG. FIG. 8 is a photograph showing the result of in situ hybridization. FIG. 8A is the result of culturing with charcoal powder added as a medium. FIG. 8B is the result of culturing with fuel charcoal as a medium. FIG. 8C shows the result of culturing with addition of zeolite, and FIG. 8D shows the result of culturing without adding the medium. Moreover, FIG. 8E is the result of having performed without adding a probe about the soil which added charcoal powder as a medium, and is a negative control by which fluorescence is not observed.

  As is clear from FIGS. 8A and 8B, when charcoal powder and fuel charcoal were used, high intensity fluorescence was observed, confirming the formation of a firm biofilm. Further, in FIG. 8C, since fluorescence was observed in a region having a high fluorescence intensity but a relatively small size, formation of a biofilm was observed when zeolite was used. It was found that the structure of biofilm was different from the case of using charcoal. Further, as apparent from FIG. 8D, it can be seen that when no medium is added, the fluorescence intensity is very weak, the range of the structure showing fluorescence is not clear, and no biofilm is formed. FIG. 1E is a negative control and no fluorescence was observed.

It is a figure which shows an example of the contaminated soil purification apparatus of this invention. It is a figure which shows the elements on larger scale of a biofilm adhesion member. It is sectional drawing of the biofilm adhesion member which the contaminated soil purification apparatus concerning other embodiment has. It is a gas chromatogram of the dichloromethane extract before culture | cultivation of the sample containing diesel oil, and after culture | cultivation. It is a gas chromatogram of the dichloromethane extract before culture | cultivation of the sample containing heavy oil. It is a gas chromatogram of the dichloromethane extract before and after culture | cultivation of the sample containing diesel oil when P. aeruginosa JCM5962 ^T was used as a control. It is a gas chromatogram of the dichloromethane extract before culture | cultivation of the soil containing a diesel oil after culture | cultivation. FIG. 8 is a photograph showing the results of in situ hybridization.

Explanation of symbols

DESCRIPTION OF SYMBOLS 10 Contaminated soil purification apparatus 12 Microorganism supply pipe 14 Oxygen supply pipe 16 Nutrient supply pipe 18 Biofilm adhesion member 30 Hollow member 32 Hole 34 Projection

Claims (10)

A step of contacting a medium capable of attaching a biofilm with a microorganism capable of degrading a contaminating component to form a biofilm containing a microorganism capable of degrading the contaminating component on the surface of the medium; and a medium on which the biofilm is formed. A method for purifying contaminated soil or contaminated water, comprising a step of contacting with contaminated soil or contaminated water. Contaminated soil or contamination characterized by comprising the steps of dispersing microorganisms capable of degrading contaminating components in contaminated soil or contaminated water, and contacting a medium capable of attaching a biofilm with the contaminated soil or contaminated water. Water purification method. The contaminated soil or contaminated water purification method according to claim 1 or 2, wherein the microorganism is a strain belonging to the genus Pseudomonas that can decompose mineral oil. A step of bringing a medium capable of attaching a biofilm into contact with contaminated soil or contaminated water, supplying a microorganism capable of decomposing a contaminating component to the medium, and forming a biofilm containing the microorganism on the medium. Contaminated soil or contaminated water purification method. The medium has at least one hole and at least one protrusion and is formed in a hollow shape, and a biofilm is obtained by supplying the microorganism, oxygen, and nutrients to the medium. The contaminated soil or contaminated water purification method according to claim 4, which is formed. The method for purifying contaminated soil or contaminated water according to claim 2, wherein a biofilm formation promoting substance is further supplied to the medium. The contaminated soil or contaminated water purification method according to any one of claims 4 to 6, wherein the microorganism is a strain belonging to the genus Pseudomonas that can decompose mineral oil. A medium having at least one hole and at least one protrusion, formed in a hollow shape and capable of attaching a biofilm;
A contaminated soil or contaminated water purification apparatus comprising: a supply device that supplies microorganisms, oxygen, and nutrients capable of decomposing contaminating components to the medium. The contaminated soil or contaminated water purification apparatus according to claim 8, further comprising an apparatus for supplying a biofilm formation promoting substance to the medium to which the biofilm can be attached. The contaminated soil or contaminated water purification apparatus according to claim 8 or 9, comprising a plurality of media to which the biofilm can be attached.

Images