JP2005245296A - Gene involving symbiosis with rhizobium and/or mycorrhizal fungi and its utilization - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To isolate/identify genes or proteins involving symbiosis of a plant with rhizobium and/or mycorrhizal fungi and to provide a method for utilizing the genes or the proteins. <P>SOLUTION: Two genes involving symbiosis with rhizobium and/or mycorrhizal fungi were acquired from Lotus japonicus by using a variant which is incomplete to symbiosis with rhizobium and/or mycorrhizal fungi. Since symbiosability with rhizobium and/or mycorrhizal fungi can be imparted to other plants by using these genes and/or the proteins encoded by the genes, these genes and proteins are extremely useful. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to the use of genes involved in the symbiosis between plants and rhizobia and / or mycorrhizal fungi, and the proteins encoded by the genes.

  The filamentous fungi (mycorrhizal fungi) are symbiotic to the roots of many land plants. Mycorrhiza is divided into ectomycorrhizae and endomycorrhizae according to its form, and the most universally seen endomycorrhiza is VA (Vesicular-Arbuscular) mycorrhizal fungi is there. VA mycorrhizal fungi mainly absorb nutrients such as phosphorus in the soil and supply them to plants. VA mycorrhizal fungi increase resistance to soil diseases and drought stress and exhibit little host specificity, so they can co-infect different species of plants and connect plants together.

  Another example of the symbiotic relationship between bacteria and plants as described above is symbiosis between legumes and rhizobia. Rhizobium has a very useful property in the agricultural field of infecting legume plant roots to form nodules and nitrogen fixation. For this reason, many researchers have focused on the symbiotic relationship between rhizobia and legumes.

  In recent years, the isolation of host-side (ie, legume) genes in the legume nodule symbiosis system has finally begun by using model plants such as Lotus japonicus and Medicago truncatula. It is just new. The inventors of the present application have also focused on the legume plant Miyakogusa, which grows naturally in Japan, and induced mutations to try to isolate mutants that caused abnormalities in the rhizobial symbiosis system.

Further, DMI1, DMI2, and DMI3 have been isolated from Taruma palm as genes involved in the rhizobial symbiosis system (see Non-Patent Documents 1 and 2). Among these, the DMI1 gene has recently been isolated as a novel ion channel considered to be essential for induction of calcium spiking, which is considered to be a mechanism of rhizobial symbiosis.
G. Endre et al., Nature 417,962 (2002) Jean-Michel Ane, Gyorgy B. Kiss, Brendan K. Riely, R. Varma Penmetsa, Giles ED Oldroyd, Celine Ayax, Julien Levy, Frederic Debelle, Jong-Min Baek, Peter Kalo, Charles Rosenberg, Bruce A. Roe, Sharon R. Long, Jean Denarie, and Douglas R. Cook, "Medicago truncatula DMI1 Required for Bacterial and Fungal Symbioses in Legumes", Science Feb 27 2004: 1364-1367. Published online February 12, 2004, Volume 303, Number 5662

  As described above, although the symbiotic system with mycorrhizal fungi and rhizobia is very important for many terrestrial plants, the factors involved in this symbiotic system have not been sufficiently specified. That is, a gene encoding a factor involved in the symbiosis between a plant and rhizobia and / or mycorrhizal fungi has not been clarified yet, and its identification has been strongly desired.

  The present invention has been made in view of the above problems, and its purpose is to identify a gene involved in the symbiosis between a plant and rhizobia and / or mycorrhizal fungi, and to obtain the gene or the gene It is to provide a method for producing a plant body imparted with a symbiotic ability with rhizobia and / or mycorrhizal fungi using a protein encoded by

  As a result of intensive studies to solve the above-mentioned problems, the present inventors have produced a mutant having an abnormality in the rhizobial symbiosis system of Lotus japonicus, and the plant, rhizobia and / or mycorrhizal fungus from the mutant Two new genes involved in the symbiosis with can be isolated, and the present invention has been completed.

  That is, the present invention includes the following 1) to 12) as industrially useful substances or methods.

1) A gene encoding the following protein (a) or (b).
(A) A protein comprising the amino acid sequence shown in SEQ ID NO: 1 or 3.
(B) In the above amino acid sequence, the amino acid sequence comprises an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added, and is involved in the symbiosis between plants and rhizobia and / or mycorrhizal fungi Protein.

  2) A gene having the base sequence shown in SEQ ID NO: 2 or 4 as an open reading frame region.

  3) Hybridization under stringent conditions to the nucleotide sequence shown in SEQ ID NO: 2 or 4, or the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1 or 3, or a part of the nucleotide sequence And a gene encoding a protein involved in symbiosis between the plant and rhizobia and / or mycorrhizal fungi.

  4) The gene according to any one of 1) to 3) above, which is derived from Lotus japonicus.

  5) A protein encoded by the gene according to any one of 1) to 4) above.

6) The following protein (a) or (b).
(A) A protein comprising the amino acid sequence shown in SEQ ID NO: 1 or 3.
(B) In the above amino acid sequence, the amino acid sequence comprises an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added, and is involved in the symbiosis between plants and rhizobia and / or mycorrhizal fungi Protein.

  7) An antibody that recognizes the protein according to 5) or 6) above.

  8) A recombinant expression vector containing the gene according to any one of 1) to 4) above.

  9) A transformant comprising a recombinant expression vector containing the gene according to any one of 1) to 4) above.

  10) A plant into which the gene according to any one of 1) to 4) above is introduced, or a progeny of the plant having the same properties, or a tissue thereof.

  11) using the gene according to any one of 1) to 4) above or the protein according to 5) or 6) above, which has a step of imparting symbiotic ability with rhizobia and / or mycorrhizal fungi, Plant production method.

  12) A gene detection instrument using, as a probe, at least a part of the base sequence of the gene according to any one of 1) to 4) or a complementary sequence thereof.

  Since the gene or protein according to the present invention is a factor involved in a symbiotic system with rhizobia and / or mycorrhizal fungi that is very important for land plants, for example, not only legumes but also other land plants On the other hand, by providing symbiotic ability with rhizobia and / or mycorrhizal fungi, symbiotic nitrogen fixation ability can be imparted, or symbiotic nitrogen fixation ability of legumes can be adjusted, or Controlling the symbiotic efficiency between the plant body and the rhizobia, and controlling the mycorrhizal symbiotic ability of the plant body are also possible.

  Embodiments of the present invention will be described below, but the present invention is not limited to the following descriptions.

(1) The gene according to the present invention and the structure of the protein encoded by the gene The gene according to the present invention is a gene encoding a protein involved in symbiosis with rhizobia and / or mycorrhizal fungi. To explain about "involved in symbiosis with rhizobia and / or mycorrhizal fungi" here, first, "rhizobium" is a microorganism represented by the genus Bradyrhizobium, Mesorhizobium, Rhizobium, Sinorhizobium, A group of microorganisms that invade roots to form nodules and are particularly useful for nitrogen fixation. Bradyrhizobium is a species that coexists with soybean, Mesorhizobium is a species that coexists with Miyakogusa, and Sinorhizobium is a species that coexists with alfalfa. “Mycorrhizal fungi” refers to microorganisms that invade plant roots and form mycorrhiza in any form of ectomycorrhizae, endomycorrhizae or endomycorrhizae, especially nitrogen. It is a microorganism useful for fixing phosphorus and potassium. This gene is an essential gene for symbiosis with these microorganisms. In the present embodiment, as the gene according to the present invention, genes CASTOR (base sequence shown in SEQ ID NO: 2) and POLLUX (sequence) encoding a novel protein involved in symbiosis with rhizobia derived from Lotus japonicus and / or mycorrhizal fungi The base sequence shown in No. 4 will be described.

(1-1) Gene according to the present invention Examples of the gene of the present invention include those encoding the amino acid sequence shown in SEQ ID NO: 1 or 3. However, it is known that a protein having an amino acid sequence modified by addition, deletion and / or substitution with another amino acid of a plurality of amino acids maintains the same function as the original protein. That is, in the present invention, as long as it is a gene encoding a protein involved in symbiosis with rhizobia and / or mycorrhizal fungi, (a) a gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or 3, (B) a protein that is composed of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted, and / or added in the amino acid sequence and that is involved in symbiosis with rhizobia and / or mycorrhizal fungi The gene encoding is also included. Examples of such a gene include a gene having the base sequence shown in SEQ ID NO: 2 or 4 as an open reading frame (ORF). In the present application, the open reading frame region is a region from the start codon to immediately before the stop codon.

  Here, “one or more amino acids are substituted, deleted, inserted, and / or added” means site-directed mutagenesis (Hashimoto-Gotoh, Gene 152, 271-275 (1995), etc.) The number of amino acids (preferably 10 or less, more preferably 7 or less, more preferably 5 or less) that can be substituted, deleted, inserted, and / or added by a known mutant protein production method such as It means being deleted, inserted and / or added. Therefore, the gene encoding the protein (b) is a gene encoding a mutant protein of the protein (a). Further, the “mutation” here means a mutation artificially introduced mainly by a known mutant protein production method, but may be a gene encoding a similar mutant protein isolated and purified from nature. .

  Hereinafter, as a gene according to the present invention, a gene having the nucleotide sequence shown in SEQ ID NO: 2 or 4 (sometimes referred to as CASTOR gene and POLLUX gene, respectively) will be described as an example.

  First, symbiosis between a mycorrhizal fungus and / or a microorganism such as a rhizobia and a plant requires a series of common signal transductions that change the morphology of the plant root cells. Within a few seconds after such symbiotic stimulation, the earliest stage reaction that occurs in plant root cells is a change in intracellular ion concentration caused by a change in calcium concentration called calcium spiking.

  As a gene involved in the symbiosis between microorganisms such as mycorrhizal fungi and / or rhizobia and plants, the present inventors provide a calcium-binding region that seems to function as a gate for regulating the flow of ions from Miyakogusa. Two genes encoding a novel ion channel, CASTOR and POLLUX, were isolated. These two genes appear to be essential for a series of calcium spiking and microbial invasion into plant cells. This will be described in more detail below.

  By recognizing the “Nod-factor”, a symbiotic signal molecule for microorganisms, plant root hairs change their own morphology. For example, the tip of the root hair grows so as to form a curl in order to catch the microcolonies of microorganisms that initiate the formation of the infected thread. Such root hair morphological changes occur after the rapid formation of a transient intracellular concentration gradient of protons, potassium, chlorine, and calcium ions, which occurs approximately 10 minutes before calcium spiking. As shown in the examples described later, the present inventors used a mutant that cannot coexist with microorganisms in order to identify a factor involved in an electrochemical change that occurs in the previous stage of symbiosis.

  Plant mutants with mutations in CASTOR and POLLUX genes show very similar morphology. They cannot form nodules or cannot coexist with mycorrhizal fungi. For example, as shown in FIG. 1, when a root hair having a wild type gene is treated with Mesorhizobium loti or Nod-factor, the tip swells and then branches, but a root hair having a mutant gene also branches by the same treatment. . However, the mutant does not form an infected thread. Similarly, in the symbiosis of mycorrhizal fungi, since the invasion of microorganisms into epidermal cells does not occur well, the infection of fungi does not work.

  In addition, mutants of CASTOR gene or POLLUX gene affect calcium spiking reaction. That is, as shown in FIG. 2, in the wild-type root hairs, the calcium concentration starts to change 10 minutes after the Nod-factor treatment, but in the CASTOR gene or POLLUX gene mutant, calcium spiking does not occur.

  In addition, since root hair branching occurs independently of calcium spiking, reactions in early plants are considered not genetically coupled. These results indicate that CASTOR and POLLUX genes are involved in a fairly early stage in the signal transduction chain that begins with Nod-factor recognition for calcium spiking activation. In addition, in CASTOR gene or POLLUX gene mutants, only root hair divergence and deformation are observed, and curling and infection thread formation are not observed, so CASTOR gene or POLLUX gene is also responsible for appropriate root hair morphological changes. It seems necessary.

  CASTOR and POLLUX genes were cloned by positional cloning and homology. As a result of extensive collection and analysis of microsatellite markers suitable for Lotus japonicus, CASTOR gene and POLLUX gene are located near the bottom end of chromosome 1 and chromosome 6, respectively, and CASTOR gene and POLLUX gene have high homology I understood. The CASTOR gene is a gene having the base sequence (2559 kb) shown in SEQ ID NO: 2 as an ORF, and encodes a protein having the amino acid sequence shown in SEQ ID NO: 1. The POLLUX gene is a gene having the base sequence (2751 kb) shown in SEQ ID NO: 4 as an ORF, and encodes a protein having the amino acid sequence shown in SEQ ID NO: 3.

  Moreover, as shown in FIG.4 (b), it turned out that the homolog of CASTOR gene and POLLUX gene exists in other dicotyledonous plants and monocotyledons. In particular, only one copy was identified in the leguminous plant, Tarumago palm, which has the same genome size as Miyakogusa. Furthermore, when the expression level of the CASTOR gene mRNA was analyzed by RT-PCR at the initial stage of symbiosis in each organ of the plant (FIGS. 4 (c), (d), (e)), the CASTOR gene and the POLLUX gene Is expressed in all organs, with the CASTOR gene being most expressed in uninfected roots and the POLLUX gene being most expressed in nodules. Moreover, the expression of CASTOR gene and POLLUX gene was decreased by M.loti inoculation or Nod-factor treatment (FIGS. 4 (d) and (e)). From these results, it was found that the expression of CASTOR gene is suppressed by the symbiosis of microorganisms.

  The gene according to the present invention includes not only double-stranded DNA but also single-stranded DNA and RNA such as sense strand and antisense strand constituting the gene. The antisense strand can be used as a probe or as an antisense agent. DNA includes, for example, cDNA and genomic DNA obtained by cloning, chemical synthesis techniques, or a combination thereof. Furthermore, the gene according to the present invention includes a sequence such as a sequence of an untranslated region (UTR) and a vector sequence (including an expression vector sequence) in addition to the sequence encoding the amino acid (a) or (b). It may be.

  The gene according to the present invention is a protein having a homology of 20% or more, preferably 50% or more, more preferably 60% or 70% or more with respect to the amino acid sequence shown in SEQ ID NO: 1 or 3. And a gene encoding a protein involved in the symbiosis with rhizobia and / or mycorrhizal fungi, and the gene also includes nutrition such as control of the symbiotic system with rhizobia and / or mycorrhizal fungi and nitrogen fixing ability. It can be used for the production and breeding of plants with enhanced fixing ability. Here, “homology” is the ratio of the same sequence in the amino acid sequence, and the higher this value, the closer the two are.

  In addition, the gene according to the present invention includes the nucleotide sequence shown in SEQ ID NO: 2 or 4, the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1 or 3, or a part of those nucleotide sequences, for example, the consensus region A gene that encodes a protein that hybridizes to a base sequence encoding 6 or more amino acids under stringent conditions and is involved in symbiosis with rhizobia and / or mycorrhizal fungi is also included. The above “stringency conditions” means that hybridization occurs only when at least 80% identity, preferably at least 95% identity, most preferably at least 97% identity exists between sequences. Means that. Specifically, for example, it can be mentioned that it is obtained by hybridization under conditions of 5 × SSC and 50 ° C.

  The hybridization can be performed by a conventionally known method such as the method described in J. Sambrook et al. Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory (1989). Usually, the higher the temperature and the lower the salt concentration, the higher the stringency (harder to hybridize). An appropriate hybridization temperature varies depending on the base sequence and the length of the base sequence. For example, when a DNA fragment consisting of 18 bases encoding 6 amino acids is used as a probe, a temperature of 50 ° C. or lower is preferable.

  Examples of genes selected by such hybridization include genes derived from nature, such as those derived from plants, such as genes derived from bryophytes, but may be derived from sources other than plants. Further, the gene selected by hybridization may be cDNA or genomic DNA.

(1-2) Protein according to the present invention The protein according to the present invention may be a protein encoded by the gene described in the section (1-1) above. If it is such protein, it has a function in connection with a symbiosis with a plant, a rhizobia, and / or a mycorrhizal fungus. In the present invention, as such a protein, for example, (a) a protein having the amino acid sequence shown in SEQ ID NO: 1 or 3 above, or (b) one or more amino acids in the amino acid sequence are substituted. , Deletions, insertions, and / or additions of amino acid sequences, and proteins involved in symbiosis with rhizobia and / or mycorrhizal fungi.

  Here, as a protein according to the present invention, a protein having the amino acid sequence set forth in SEQ ID NO: 1 or 3 (hereinafter sometimes referred to as CASTOR protein and POLLUX protein, respectively) will be described as an example.

  The CASTOR protein is a 95 kDa protein consisting of 853 amino acid residues having the amino acid sequence shown in SEQ ID NO: 1. The POLLUX protein is a 102 kDa protein consisting of 917 amino acid residues having the amino acid sequence shown in SEQ ID NO: 3. Both these proteins have chloroplast transit peptides consisting of 69 amino acid residues and 57 amino acid residues, respectively, at the N-terminus (TargetP score: 0.953 and 0.959). This suggests that these proteins are localized in the chloroplast.

Moreover, both proteins are very highly homologous as a whole except for the N-terminal region (see FIG. 5 (a)). In rice and Arabidopsis thaliana, a database of putative proteins homologous to these two proteins revealed that both CASTOR and POLLUX proteins were transmembrane proteins with at least four transmembrane regions (TM). . FUGUE (Shi, J., Blundell, TL & Mizuguchi, K. FUGUE: sequence-structure homology recognition using environment-specific substitution tables and structure-dependent gap penalties. J Mol Biol
310, 243-57 (2001).) CASTOR and POLLUX proteins are structurally closest to calcium-gated potassium channels such as human BK and Methanobacterium thermoautotrophicm MTHK. Was found (see FIGS. 5B and 5C). As a result of structural comparison with MTHK analyzed by crystal structure analysis, the TM region located on the side surface of the channel pore was particularly well preserved in the novel protein (see FIG. 5B). This strongly suggested that the novel protein is a multiple bond ion channel.

  Further, as shown in FIG. 5 (b), the most remarkable difference in amino acid sequence between MTHK and both CASTOR and POLLUX proteins is a glycine residue in the filter region. That is, the 61st to 63rd amino acid sequence of MTHK is Gly-Tyr-Gly which is a formal potassium channel motif, whereas in CASTOR and POLLUX protein, the amino acid sequence of the region corresponding to this motif is Ser-Gly-Asn.

  This is important because in the X-ray crystallographic analysis of this potassium channel (MTHK), the 63rd glycine located in the Ramachhandran plot region has been found to be the only accessible glycine. This seems to be a difference. As shown in FIG. 5 (c), according to the homology modeling of the filter region in the CASTOR protein, it can be seen that these differences change both the properties of the pore diameter and the electrostatic property in the ion channel. Therefore, it is considered that CASTOR, POLLUX protein and potassium channels such as MTHK show different ion selectivity.

  However, as shown in FIG. 5 (c), the pore in the center of the ion channel is not blocked by this new amino acid side chain. CASTOR and POLLUX proteins have a region homologous to the RCK domain. The RCK domain controls the conductivity of potassium channels in response to changes in cytoplasmic calcium (Jiang, Y., Pico, A., Cadene, M., Chait, BT & MacKinnon, R. Structure). of the RCK domain from the E. coli K + channel and demonstration of its presence in the human BK channel. Neuron 29, 593-601 (2001).). The homology of these amino acid sequences is considered to be very important because substitution of five amino acid residues in the pore and RCK domain appears as a mutant trait (see FIG. 5 (a) and FIG. 6). ).

  In plants, the three structural classes to which potassium channels belong are determined based on the number of transmembrane regions and the number of pores. Here, CASTOR and POLLUX proteins have different domain structures from ion channels in other plants (4TM), and are presumed to be like KCO channels. However, as shown in FIG. 5, CASTOR and POLLUX proteins have only one pore region between the third and fourth TMs. In addition, the RCK domain is highly homologous to the regulatory regions of prokaryotic K + channels and mammalian BK channels, but differs from previously found plant proteins.

  In addition, CASTOR protein and POLLUX protein cannot complement each other despite showing high homology to each other. Although structurally similar proteins have been shown to function as tetramers, CASTOR and POLLUX proteins, like Shaker-like plant potassium channels, may also form heteromultiplex channels. In Miyakogusa, if CASTOR and POLLUX proteins function as heterotetramers, there remains a question as to why leguminous species such as Taruma have only one channel gene. Is currently under scrutiny for elucidation.

  Thus, the two proteins CASTOR and POLLUX are new ion channels that function as ion gatekeepers and regulate the flow of ions essential for symbiosis with microorganisms. These proteins have an essential role in the symbiosis of mycorrhizal fungi and / or rhizobia. In addition, genes encoding these proteins having high homology with monocotyledonous plants and dicotyledonous plants that do not exhibit nodulation are also present.

  As described above, CASTOR protein and POLLUX protein are similar to DMI1 protein derived from Taruma palm (Non-patent Document 2) that has already been reported as an ion channel involved in the symbiosis between plants and microorganisms. It seems that only a part of the amino acid sequence of the DMI1 protein and the base sequence of the gene are disclosed. For this reason, it is difficult to determine whether the protein according to the present invention and the DMI1 protein have the same function, but a new function not disclosed in the report of the DMI1 protein is related to the present invention. Protein has.

  First, since the protein according to the present invention has a chloroplast migration signal on the N-terminal side as described above, it is considered that the protein is localized in the chloroplast. In addition, there is only one DMI1 protein as the homologue of the protein according to the present invention in Taruma palm. Usually, when homologous genes possessed by one plant species retain their functions (that is, the mutation causes a phenotypic difference), it is apparent that these genes have distinct roles. That is, as in the present invention, it has been clarified that the CASTOR gene and the POLLUX gene were isolated and identified from the same plant species, and that only one DMI1 gene exists as a homologue in Taruma palm. Is considered to have very great biological significance. In addition, while the protein according to the present invention has a calcium binding region and an RCK domain, it has not been reported that the DMI1 protein has these domains. As described above, by isolating and identifying the protein according to the present invention and analyzing its function, it was possible to clarify various useful information that was not sufficient for the DMI1 protein report alone. Thus, it can be said that isolating and identifying the protein or gene according to the present invention has very important significance as an invention.

  In addition, the protein according to the present invention may be in a state where the gene described in the above section (1-1) is introduced into a host cell and the protein is expressed in the cell. It may be in a separated and purified state. Further, depending on the expression conditions in the host cell, the protein according to the present invention may be a fusion protein linked to other proteins. Furthermore, the protein according to the present invention may be chemically synthesized.

  The protein according to the present invention may be a polypeptide in which amino acids are peptide-bonded, but is not limited thereto, and may be a complex protein containing a structure other than a polypeptide. Such a polypeptide may be included. Examples of the case where the polypeptide is added include a case where the protein according to the present invention is epitope-tagged by His, Myc, Flag or the like.

(2) Gene and protein acquisition method according to the present invention The gene and protein acquisition method (production method) according to the present invention is not particularly limited, but representative methods include the following methods. Can do.

(2-1) Gene Acquisition Method The gene acquisition method according to the present invention is obtained by screening a cDNA library, for example, for a gene having a native base sequence, as specifically shown in the Examples described later. .

  Moreover, as a method for obtaining the gene according to the present invention, a method using an amplification means such as PCR can be mentioned. For example, among the cDNA sequences of the gene according to the present invention, primers are prepared from the 5 ′ side and 3 ′ side sequences (or their complementary sequences), and genomic DNA (or cDNA) or the like is prepared using these primers. By performing PCR or the like as a template and amplifying a DNA region sandwiched between both primers, a large amount of DNA fragments containing the gene according to the present invention can be obtained.

  Further, based on gene sequence information, a polynucleotide having the sequence may be synthesized using known chemical synthesis.

  A DNA encoding a protein having a modified amino acid sequence can be synthesized using a conventional site-directed mutagenesis or PCR method based on a DNA having a native nucleotide sequence. For example, a DNA fragment to be modified is obtained by restriction enzyme treatment of native cDNA or genomic DNA, which is used as a template, and site-directed mutagenesis or PCR is performed using a primer into which a desired mutation is introduced. A DNA fragment into which a desired modification is introduced is obtained. Thereafter, the DNA fragment into which this mutation has been introduced may be ligated with a DNA fragment encoding another part of the target enzyme. Alternatively, in order to obtain a DNA encoding an enzyme consisting of a shortened amino acid sequence, for example, an amino acid sequence longer than the target amino acid sequence, for example, a DNA encoding a full-length amino acid sequence is cleaved with a desired restriction enzyme, and the result When the obtained DNA fragment does not encode the entire target amino acid sequence, a DNA fragment consisting of the missing portion sequence may be synthesized and ligated.

  In addition, the obtained gene is expressed using a gene expression system in Escherichia coli or yeast and, for example, the function of the protein is measured to confirm whether or not the obtained gene encodes the target protein. be able to. Furthermore, by expressing the gene, a protein involved in symbiosis with the rhizobia and / or mycorrhizal fungi that are gene products can be obtained.

  Furthermore, a gene involved in symbiosis with rhizobia and / or mycorrhizal fungi in other organisms can be cloned using an antibody against part or all of the amino acid sequence shown in SEQ ID NO: 1 or 3.

(2-2) Protein Acquisition Method The method for acquiring the protein according to the present invention (protein production method) is not particularly limited. For example, first, cells, tissues, etc. that express the protein according to the present invention. And a simple purification method. The cells and tissues that express the protein according to the present invention may be naturally occurring types, for example, cells or tissues infected with a recombinant baculovirus. The purification method is not particularly limited, and the host transformed with the expression vector containing the gene according to the present invention is cultured, cultivated or raised as described above, and the culture is subjected to, for example, filtration or centrifugation according to a conventional method. The target protein may be recovered and purified by cell disruption, gel filtration chromatography, ion exchange chromatography or the like.

  In addition, as a method for obtaining the protein according to the present invention, a method using a gene recombination technique or the like may be mentioned. In this case, for example, a method in which the gene according to the present invention is incorporated into a vector or the like, then introduced into a host cell so that it can be expressed by a known method, and the protein obtained by translation in the cell is purified is employed. can do. Specific methods such as gene introduction (transformation) and gene expression will be described later.

  Alternatively, a protein involved in symbiosis with rhizobia and / or mycorrhizal fungi can also be obtained using an antibody that recognizes part or all of the protein having the amino acid sequence shown in SEQ ID NO: 1 or 3. . Furthermore, genes involved in symbiosis with rhizobia and / or mycorrhizal fungi of other organisms can also be cloned using antibodies.

  When introducing a foreign gene into the host in this way, there are various expression vectors and hosts that incorporate a promoter that functions in the host for the expression of the foreign gene, so choose the one that suits your purpose. do it. The method for purifying the produced protein varies depending on the host used and the nature of the protein, but the target protein can be purified relatively easily by using a tag or the like.

  The method for producing the mutant protein is not particularly limited. For example, site-directed mutagenesis (Hashimoto-Gotoh, Gene 152, 271-275 (1995), etc.), a method of introducing a point mutation into a base sequence using PCR method, or a method of creating a mutant protein, or by inserting a transposon A well-known mutant protein production method such as a mutant strain production method can be used. By using these methods, the base sequence of the cDNA encoding the protein of (a) above is prepared by modifying so that one or more bases are substituted, deleted, inserted, and / or added. can do. Moreover, you may utilize a commercially available kit for preparation of a mutein.

  In addition, the method for obtaining a protein according to the present invention is not limited to the above-described method, and may be chemically synthesized using, for example, a commercially available peptide synthesizer. Other examples include cell-free protein synthesis solutions (Proc. Natl. Acad. Sci. USA, 78, 5598-5602 (1981), J. Biol. Chem., 253, 3753-3756 (1978), etc. ) May be used to synthesize the protein according to the present invention from the gene according to the present invention.

(3) Antibody according to the present invention The antibody according to the present invention comprises the protein described in the above section (1-2), for example, the protein of (a) or (b) above, or a partial protein thereof, or a partial peptide as an antigen. As long as it is an antibody obtained as a polyclonal antibody or a monoclonal antibody by a known method. Known methods include those described in the literature (Harlow et al., “Antibodies: A laboratory manual (Cold Spring Harbor Laboratory, New York (1988))”, Iwasaki et al., “Monoclonal antibody hybridoma and ELISA, Kodansha (1991)”. The antibody thus obtained can be used for detection and measurement of the protein of the present invention.

(4) Recombinant vector according to the present invention The recombinant expression vector according to the present invention is a gene of the present invention encoding the gene described in the above section (1-1), for example, the protein of the above (a) or (b). It contains a gene. For example, a recombinant expression vector into which cDNA is inserted can be mentioned. For the production of the recombinant expression vector, a plasmid, phage, cosmid or the like can be used, but it is not particularly limited. In addition, a manufacturing method may be performed using a known method.

  The specific type of vector is not particularly limited, and a vector that can be expressed in a host cell (host cell) may be appropriately selected. That is, according to the type of the host cell, a promoter sequence may be appropriately selected in order to reliably express the gene, and this and the gene according to the present invention incorporated into various plasmids may be used as an expression vector.

  In order to confirm whether or not the gene according to the present invention has been introduced into the host cell, and further whether or not it is reliably expressed in the host cell, various markers may be used. For example, a gene deleted in the host cell is used as a marker, and a plasmid or the like containing this marker and the gene according to the present invention is introduced into the host cell as an expression vector. Thereby, the introduction of the gene according to the present invention can be confirmed from the expression of the marker gene. Alternatively, the protein according to the present invention may be expressed as a fusion protein. For example, the green fluorescent protein GFP (Green Fluorescent Protein) derived from Aequorea jellyfish may be used as a marker, and the protein according to the present invention may be expressed as a GFP fusion protein. Good.

  The host cell is not particularly limited, and various conventionally known cells can be suitably used. Specifically, as a prokaryote, a conventional host such as a bacterium, for example, a bacterium belonging to the genus Escherichia, for example, Escherichia coli, a microorganism belonging to the genus Bacillus, for example, Bacillus subtilis, or the like is used. Can do. As eukaryotic hosts, lower eukaryotes such as eukaryotic microorganisms such as yeast or filamentous fungi can be used. Examples of the yeast include microorganisms belonging to the genus Saccharomyces, such as Saccharomyces cerevisiae, and examples of the filamentous fungi include microorganisms belonging to the genus Aspergillus, such as Aspergillus oryzae and Aspergillus niger. niger) and microorganisms belonging to the genus Penicillium. Furthermore, animal cells or plant cells can be used, and various plant cells such as legumes and gramineous plants can be used as plant cells, and cell systems such as mice, hamsters, monkeys, humans, etc. can be used as animal cells. Is used. Furthermore, insect cells such as silkworm cells or adult silkworms themselves are also used.

  The recombinant expression vector of the present invention contains expression control regions such as a promoter and terminator, an origin of replication and the like depending on the type of host into which they are to be introduced. Conventional promoters such as trc promoter, tac promoter, and lac promoter are used as promoters for bacterial expression vectors, and examples of yeast promoters include glyceraldehyde 3-phosphate dehydrogenase (GAPDH) promoter and PH05 promoter. As the promoter for filamentous fungi, for example, amylase, trpC and the like are used. As a promoter for animal cell hosts, viral promoters such as SV40 early promoter and SV40 rate promoter are used. An expression vector can be prepared according to common usage using restriction enzymes, ligases and the like. In addition, transformation of a host with an expression vector can be performed according to a conventional method.

  A method for introducing the expression vector into a host cell, that is, a transformation method is not particularly limited, and a conventionally known method such as an electroporation method, a calcium phosphate method, a liposome method, a DEAE dextran method, or a microinjection method is preferably used. Can be used.

(5) Transformant According to the Present Invention The transformant according to the present invention encodes the gene according to the present invention described in the section (1-1) above, for example, the protein of (a) or (b) above. A transformant having a gene introduced therein. Here, “gene introduced” means that the gene is introduced into a target cell (host cell) so as to be expressed by a known genetic engineering technique (gene manipulation technique). The “transformant” means not only cells / tissues / organs but also individual organisms.

  Examples of the method for producing a transformant (production method) according to the present invention include a method for transforming the recombinant expression vector described in the above section (4). That is, a transformant can be produced by a method having at least a step of constructing the above recombinant expression vector and a step of introducing the recombinant expression vector into a host. In addition, the organism to be transformed is not particularly limited, and examples thereof include various microorganisms and plants exemplified in the host cell. In addition, if a promoter or vector is selected, animals and insects can be transformed.

  The transformant herein includes a plant into which the gene of the present invention has been introduced, or a progeny of the plant having the same properties, or a tissue or seed thereof.

(6) Gene detection instrument according to the present invention The gene detection instrument according to the present invention uses at least a part of the base sequence or its complementary sequence in the gene according to the present invention as a probe. The gene detection instrument can be used for detection and measurement of the expression pattern of the gene according to the present invention under various conditions.

  Examples of the gene detection instrument according to the present invention include a DNA chip in which the probe that specifically hybridizes with the gene of the present invention is immobilized on a substrate (carrier). Here, the “DNA chip” mainly means a synthetic DNA chip using a synthesized oligonucleotide as a probe, but also includes an affixed DNA microarray using a cDNA such as a PCR product as a probe.

  The sequence used as a probe can be determined by a conventionally known method for specifying a characteristic sequence from a cDNA sequence. Specifically, for example, SAGE: Serial Analysis of Gene Expression method (Science 276: 1268, 1997; Cell 88: 243, 1997; Science 270: 484, 1995; Nature 389: 300, 1997; US Pat. No. 5,695,937) Etc.

  In addition, what is necessary is just to employ | adopt a well-known method for manufacture of a DNA chip. For example, when a synthetic oligonucleotide is used as an oligonucleotide, the oligonucleotide may be synthesized on a substrate by a combination of a photolithography technique and a solid phase DNA synthesis technique. On the other hand, when cDNA is used as an oligonucleotide, it may be pasted on a substrate using an array machine.

  Similarly to a general DNA chip, a perfect match probe (oligonucleotide) and a mismatch probe in which one perfect base substitution is performed in the perfect match probe may be arranged to further improve the accuracy of gene detection. Furthermore, in order to detect different genes in parallel, a plurality of types of oligonucleotides may be fixed on the same substrate to constitute a DNA chip.

(7) Utilization method (usefulness) of gene and protein according to the present invention
Up to this point, we have mainly described the rhizobia derived from Lotus japonicus and / or the proteins involved in symbiosis with mycorrhizal fungi and the gene encoding the protein. Instead, other genes and proteins involved in symbiosis with rhizobia and / or mycorrhizal fungi are also included. Below, the utilization method of the gene which concerns on this invention, protein, etc. is demonstrated.

  The gene or protein according to the present invention is involved in the symbiosis between plants and rhizobia and / or mycorrhizal fungi, and is conserved in many land plants. Therefore, by introducing these genes into a host (plant body), for example, a plant body imparted with symbiotic ability with rhizobia and / or mycorrhizal fungi can be produced. Other than this, for example, a method for adjusting symbiotic nitrogen fixation ability of legumes, a method for imparting symbiotic nitrogen fixation ability other than legumes, a method for controlling the symbiotic efficiency between plant bodies and rhizobia, plants It is considered that it can be applied to a production method of a plant having a new function such as a method for regulating the mycorrhizal symbiosis ability of the body.

  Needless to say, symbiosis with rhizobia and mycorrhizal fungi is very important for plants in terms of fixing nutrients, so this method is very valuable in terms of agriculture and plant breeding. it is conceivable that.

  In the case of carrying out any of the above methods, it is only necessary to include a step of using the gene, protein, or recombinant vector according to the present invention, and other specific configurations, conditions, materials, etc. It is not limited. For example, it is only necessary to include a step of transforming the recombinant vector according to the present invention in a state in which it can be expressed in a host plant. Further, for example, both the CASTOR gene and the POLLUX gene may be introduced into the host, or only one of the genes may be introduced.

  In addition, using the gene according to the present invention described above, a method for regulating the symbiotic nitrogen fixing ability of legumes, a method for imparting symbiotic nitrogen fixing ability other than legumes, a plant body and a rhizobia A plant obtained by carrying out a method for controlling the symbiotic efficiency and a method for controlling the mycorrhizal symbiosis ability of the plant is also included in the present invention.

  Examples of plants that can be transformed include not only legumes but also sesame, rice, forsythia, tobacco, Arabidopsis thaliana, barley, wheat, rapeseed, potato, tomato, poplar, banana, eucalyptus, sweet potato, soybean , Alfalfa, lupine, corn, cauliflower, rose, chrysanthemum, carnation, goldfish grass, cyclamen, orchid, eustoma, freesia, gerbera, gladiolus, gypsophila, kalanchoe, lily, pelargonium, geranium, petunia, torenia, tulip, etc. However, it is not limited to these.

  In addition, “using a gene or protein” includes cases where the gene or protein is used under various conditions such as in vivo, in vitro, and ex vivo.

  Embodiments will be described below in more detail with reference to the accompanying drawings. Of course, the present invention is not limited to the following examples, and it goes without saying that various aspects are possible in detail. Further, the present invention is not limited to the above-described embodiments, and various modifications can be made within the scope shown in the claims, and the present invention is also applied to the embodiments obtained by appropriately combining the disclosed technical means. It is included in the technical scope of the invention.

[Experimental methods and materials]
(1) Plant material.
Ljsym71-1, Ljsym71-2 23, N5, N10, 29-2A (MK, unpublished data), Ljsym4-2 11, Ljsym22-1, Ljsym23-1, Ljsym23-2 10 and SL3251-2, SL820-3, SL1715 -2, SL1966-3, and SL3169-3 mutants were isolated from Miyakogusa B-129Gifu by EMS mutation treatment. G00472, G00716, G00862 (derived from B-129), and M89-27 (derived from MG-20) were obtained by screening from regenerated plants originating from the cultured cells of Lotus japonicus. The Ljsym4-1 mutant was produced by T-DNA transformation of C. japonica B-129Gifu, but not inserted into the gene.

(2) Root hair deformation assay
The root hair morphological change treatment is described in a paper (Niwa, S. et al. Responses of a model legume Lotus japonicus to lipochitin oligosaccharide nodulation factors purified from Mesorhizobium loti JRL501. Mol. Plant-Microbe Interact. 14, 848-856 (2001). ). Briefly, seedlings grown for 3 days were cultured with M. loti TONO and grown on filter paper placed on agar medium (B & D, lack of nitrogen source) for 3 days. After adding Nod-factor, seedlings grown for 2 days were grown for 1 day on agar-covered slide glass dipped in B & D liquid medium. Thereafter, 10 ⁻⁷ M Nod-factor was added and further cultured for 24 hours. The roots were stained with 0.001% Toluidin Blue and observed under a binocular microscope.

(3) Caspiking
Seedlings of Lotus japonicus germinated, harvested and microinjected with Oregon Green Dextran staining (Harris, JM, Wais, R. & Long, SR Rhizobium-induced calcium spiking in Lotus japonicus. Molecular Plant-Microbe Interactions 16, 335 -341 (2003).) Fluorescence was analyzed using a Nikon TE2000U inverted microscope linked to a Hamamatsu Photonics digital CCD camera. The wavelength of excitation light at 488 nm with an 11 nm bandpass was selected using an Optoscan Monochromator (Cairn Research, Faversham, Kent, UK) and a 545 nm emission filter was used. Images were collected every 5 seconds using MetaFluor software with an exposure time of 200 milliseconds. The waveform was created using Microsoft Excel. After microinjection, root hairs were removed 20 minutes before the addition of Nod-factor, and only cells showing intracellular changes in the active state were used for analysis. Nod-factor was added directly to the culture chamber to a final concentration of 10 ⁻⁸ M.

(4) Positional cloning
The CASTOR gene is obtained as a result of mating the Lotus japonica B-129 Gifu mutants Ljsym71-2, N5, Ljsym4-2, or G00472, G00716, and MG-20 Miyakojima, and the hybrid of Ljsym4-2 and L. filicaulis. In addition, 6 independent F2 mapping populations were used for mapping. The size of each F2 population is 1563 (Ljsym71-2), 190 (N5), 180 (Ljsym4-2x MG-20), 40 (G00472 & G00716), and 1514 (Ljsym4-2 x L. filicaulis). As a whole, 3527 F2 individuals were analyzed using a marker on the side of the CASTOR gene. POLLUX was mapped using 531 F2 individuals obtained by crossing Ljsym23-2 and MG20 and 409 F2 individuals obtained by crossing Ljsym23-1 and L. filicaulis.

(5) Southern blot and expression analysis.
The 573 bp fragment of the CASTOR gene was amplified using primer 1: TCAAAGAAGGATTACGAGGA (base sequence shown in SEQ ID NO: 5) and primer 2: AATTTTACCACCATAAGATGC (base sequence shown in SEQ ID NO: 6). Genomic DNA (10 μg) was extracted from the leaves and cut with XbaI or BamHI. Probe labeling and signal detection were performed using AlkPhos Direct (Amersham).

CASTOR gene expression was analyzed by quantitative RT-PCR using the following primers.
・ Polyubiquitin gene
(ATGCAGATCTTCCGTCAAGACCTTGAC / ACCTCCCCTCAGACGAAGGA) (SEQ ID NO: 7 / SEQ ID NO: 8)
・ LjENOD40-1
(CCTCTGAACCAATCCATCAAATCCA / GTGGAGGAGTGTGAGAGGTGACAGC) (SEQ ID NO: 9 / SEQ ID NO: 10)
・ CASTOR gene
(ATGGTGGCCTTGACATAAG / AGTGACGACGTATAACAGCA) (SEQ ID NO: 11 / SEQ ID NO: 12)
Total RNA was extracted using RNeasy Mini kit (Qiagen) and treated with DNase I (Takara). Real-time RT-PCR was performed with GeneAmp 5700 (Applied Biosystems) using Quantitect SYBR Green RT-PCR kit (Qiagen). Expression levels were normalized based on both polyubiquitin transcripts.

(6) Computer analysis.
The sequence was analyzed using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) and GENSCAN v.1.0 (http://genes.mit.edu/GENSCAN.html). Clustal W (http://www.ebi.ac.uk/clustalw/) was used for multi-alignment and evolutionary tree. Target protein and transmembrane region estimation is available in TargetP v.1.01 (http://www.cbs.dtu.dk/services/TargetP/) and TMHMM v.2.0 (http://www.cbs.dtu.dk) /services/TMHMM-2.0/). Domain and structural analysis is available from Pfam (http://www.sanger.ac.uk/Software/Pfam/) and FUGUE v.2.0 (http://www-cryst.bioc.cam.ac.uk/~fugue /) Both.

〔Experimental result〕
FIG. 1 is a graph showing the results of examining root hair reaction induced by inoculation with Mesorhizobium loti TONO or Nod-factor (NFs) treatment. The wild-type (B-129 Gifu) and CASTOR mutant root hairs were inoculated with M. loti TONO (panels b and e) and treated with NFs of 10 ⁻⁷ M (panels c and f). Show. Panels a and d show wild type and Ljsym71-1 controls, respectively. As shown in panel b, when wild type was inoculated with M. loti TONO, curling occurred in the root hairs (part indicated by an arrow in the figure). In addition, as shown in panel e, the Ljsym71-2 mutant inoculated with M. loti TONO includes root hair expansion (part indicated by arrowhead in the figure), tip growth (part indicated by double arrowhead in the figure), Bifurcations (portions indicated by small arrows in the figure) were observed. In addition, as shown in panels c and f, when wild-type and Ljsym71-1 mutants were treated with NFs, root hair morphological changes were induced in each. The scale bar is 50 μm.

FIG. 2 is a diagram showing an analysis result of calcium spiking in root hair. This experiment was carried out on one root hair in a wild type (B-129 Gifu) or mutant seedling body having an allele of Ljsym4-1, Ljsym23-1, or Ljsym23-2. About 20 minutes after injection of Oregon green dextran, the root hair was a calcium sensitive pigment; NFs was added at 10 ^-8 M. The fluorescence intensity was measured at intervals of 5 seconds and graphed. As a result, as shown in FIG. 2, the mutant used in this experiment did not cause calcium spiking for at least 60 minutes.

  FIG. 3 is a diagram schematically showing the positional cloning of CASTOR and POLLUX genes, and (a) is a diagram showing a gene map in the vicinity of the CASTOR gene locus. The position of the marker on the line is indicated by a distance (cM) on the map. The number of recombinant plants in the map population is indicated.

  (B) shows a physical map of the CASTOR locus. BAC and TAC (LjT) clones are derived from B-129 and MG-20, respectively. The BAC ends are shown as open elliptical TB21R, closed elliptical TA3F, closed rectangular TB7F, closed diamond TC1F, open rectangular TB2R. The “inverted region” between B-129 and MG-20 extends to 145 kb and is 0 cM from the CASTOR locus. Only the TB7R marker is located 240 kb north from the boundary of the CASTOR locus.

  And as shown in (c), the candidate gene was identified. In addition, the symbol in a figure shows the following proteins. LRRPK (leucine-rich repeat protein kinase), 26SP (26S proteasome regulatory subunit 7), RE (retro-element), EP (Avr9 / Cf-9 elicited protein), PUM (pumilio-family RNA-binding protein), RHZF ( Ring H2 zinc finger protein), PME (pectin methyl esterase), IF2 (initiation factor 2 subunit), OXY (oxydoreductase), PP (polyprotein), MYB (myb family protein), GAG (gag-pol polyprotein), FIP (VirF -interacting protein FIP1), ANK (ankyrin-like protein), REV (reverse transcriptase), no description (hypothetical protein).

  (D) is a diagram showing the exon-intron structure of the CASTOR gene. cDNA splicing resulted in multiple alternative splicing variants. Four bases are inserted into the 3 'end of the first exon, and nine bases are inserted into the 5' end of the second exon. The seventh intron was conserved in 15 out of 17 cDNA clones.

  Moreover, (e)-(f) is a figure which shows the genomic region around a POLLUX gene. (E) is a diagram showing a genetic map and a physical map of the POLLUX locus. The position of the marker in the mapping population and the number of recombinant plants are indicated. BAC and TAC (LjT) clones are derived from B-129 and MG-20. Candidate genes were identified on TAC clone LjT45B09. Moreover, the symbol in a figure shows the following proteins. WD40 (WD40 repeat protein), NifU (NifU like putative N-fixing protein), PPR (pentatricopeptide repeat protein), DNA BP (DNA binding protein family), LRR-PK (leucine-rich repeat protein kinase), no description (hypothetical protein).

  (F) is a diagram showing the exon-intron structure of the POLLUX gene. One alternative splicing site was detected upstream of exon 10.

  The full-length cDNA sequence corresponding to the CASTOR and POLLUX genes was obtained by RACE (rapid amplification of cDNA ends) at the 5 'and 3' ends and cDNA sequencing. The arrangement of cDNA in the genomic sequence was found to consist of 12 exons for both genes (Fig. 3d, f). Both genes are subject to alternative splicing as revealed by sequence analysis of cDNA clones.

  FIG. 4 is a diagram showing the results of Southern hybridization and RT-PCR analysis of CASTOR gene. (A) is a figure which shows the result of having performed the Southern hybridization of the CASTOR gene with respect to the wild type (B-129 Gifu) and the CASTOR mutant (N-5, G00472, and G00716). As shown in the figure, in the wild type and N-5 (point mutation allele), two distinct bands were detected by CASTOR probe (CAS, POL). This indicates that there are two highly homologous genes. However, in the case of deletion mutants such as G00472 and G00716, only one of these fragments was detected.

  (B) is a diagram showing the results of Southern hybridization of CASTOR gene for legumes and non-legumes. Genomic DNA was cleaved with XbaI in the case of (a), and BamHI in the case of (b). As shown in the figure, one or two copies of CASTOR-POLLUX homolog are present in other dicotyledonous plants and monocotyledonous plants. In particular, only one copy was identified in the leguminous plant, Tarumago palm, which has the same genome size as Miyakogusa. In other words, we found that CASTOR gene homologs exist not only in legumes but also in plants other than legumes.

  (C) is a diagram showing the results of examining the expression of CASTOR gene in various organs of Lotus japonicus B-129 Gifu. In addition, in this figure, the relative quantity compared with the non-infected root is shown. As shown in the figure, it was found that the mRNA of CASTOR gene was most well expressed in uninfected root hair. It was also found that the POLLUX gene was most expressed in the nodules.

  (D) shows the results of examining the induction of NIN gene, CASTOR gene, and POLLUX gene expression from 0 to 48 hours after inoculation with M. loti. (E) shows the results of examining the induction of NIN gene, CASTOR gene, and POLLUX gene expression from 0 to 48 hours after NFs treatment. This figure shows the relative amount compared to the untreated root. As shown in the figure, the expression level of NIN gene increased with time regardless of M. loti inoculation or NFs treatment, whereas the expression level of CASTOR gene and POLLUX gene However, it was found that there was no increase with either M. loti inoculation or NFs treatment, but it decreased over time. This seems to indicate that symbiosis suppresses CASTOR gene expression.

  FIG. 5 shows the structure, domain and homologue of CASTOR protein or POLLUX protein, and (a) shows the local sequence homology between CASTOR and POLLUX protein. TM represents a transmembrane helix, and RCK represents a region homologous to the region controlling conductivity found in the potassium channel. The location and type of mutations involved in symbiosis are indicated on the CASTOR protein sequence. As shown in the figure, CASTOR and POLLUX proteins were found to have high homology.

  (B) shows the alignment of the filter region and inner helix region of CASTOR, POLLUX protein and plant homologue of MTHK. This arrangement forms the central part of the pore shown in FIG. As shown in the figure, it was found that CASTOR and POLLUX proteins and MTHK plant homologs had high homology in the filter region and the inner helix region.

  (C) is a figure which shows the virtual structure of the ion pore of CASTOR protein. The X-ray crystal structure of MTHK is shown on the left side, and the homology model is shown on the right side. The Gly61 and Gly63 residues in the crystal structure and the corresponding Ser and Asn residues in the CASTOR protein are calculated in space-filling mode to calculate the effect of substitution of these amino acid residues on the pore diameter and electrostatic properties. It is shown. As shown in the figure, it can be said that the CASTOR protein ion pore and the MTHK ion pore are similar.

  (D) is a diagram showing a phylogenetic tree of CASTOR and POLLUX homologs (Clustal W). O. sativa_1 is rice (estimated from AK068216), O. sativa_2 is also rice (estimated from AK072312, L179Q), M. truncatula (estimated cDNA from genomic sequence AC140550) is A. thaliana (At5g49960) is Arabidopsis It is. As shown in the figure, it was found that CASTOR and POLLUX homologs are conserved in various land plants. Furthermore, it was found that the homologue in Taruma palm corresponds to POLLUX and is slightly different from CASTOR systematically.

  FIG. 6 shows a table summarizing mutants having mutations in CASTOR and POLLUX genes. As shown in the figure, as a result of genomic DNA sequencing, 16 mutants having mutations in the CASTOR gene are all non-silence mutants, that is, mutations involving substitution, deletion, insertion, etc. of amino acid sequences. all right. In addition, four independent mutants obtained by tissue culture lack a region having a size of 1 bp to 20 kb or more, and do not have the retrotransposon insertion found in other somatic mutants.

  As described above, since the genes and the like according to the present invention are essential factors for the symbiosis with rhizobia and / or mycorrhizal fungi, by using such genes and the like, the symbiotic system between plants and microorganisms is controlled, There is an advantage that a more useful plant body can be produced. Therefore, the present invention can be used in the fields of agriculture and plant breeding and related industries.

It is a figure which shows the result investigated about the reaction of the root hair induced | guided | derived by inoculation of Mesorhizobium loti TONO, or Nod-factor (NFs) treatment. It is a figure which shows the analysis result of the calcium spiking in a root hair. It is a figure which shows typically the positional cloning of CASTOR and POLLUX gene, (a) is a figure which shows the genetic map of the vicinity of CASTOR locus, (b) is a figure which shows the physical map of CASTOR locus, (C) is a diagram showing the periphery of the candidate gene, (d) is a diagram showing the exon-intron structure of the CASTOR gene, and (e)-(f) are diagrams showing the genomic region around the POLLUX gene. is there. (A) is a diagram showing the results of Southern hybridization of CASTOR gene to wild type (B-129 Gifu) and CASTOR mutants (N-5, G00472, and G00716), (b) FIG. 6 is a diagram showing the results of Southern hybridization of CASTOR gene for legumes and plants other than legumes, and (c) examined the expression of CASTOR gene in various organs of Lotus japonicus B-129 Gifu It is a figure which shows a result, (d) is a figure which shows the result of having investigated the induction | guidance | derivation expression of the NIN gene, CASTOR gene, and POLLUX gene from 0 to 48 hours after inoculating M. loti, e) is a figure which shows the result of having investigated the induction | guidance | derivation induction | guidance | derivation of the NIN gene, CASTOR gene, and POLLUX gene from 0 to 48 hours after NFs treatment. (A) is a figure which shows the homology of the local arrangement | sequence between CASTOR and POLLUX protein, (b) shows alignment of the filter area | region and inner helix area | region of the plant homologue of CASTOR, POLLUX protein, and MTHK. (C) is a figure which shows the virtual structure of the ion pore of CASTOR protein, (d) is a figure which shows the phylogenetic tree of CASTOR and POLLUX homolog. A table summarizing mutants having mutations in the CASTOR and POLLUX genes is shown.

Claims (12)

A gene encoding the protein (a) or (b) below.
(A) A protein comprising the amino acid sequence shown in SEQ ID NO: 1 or 3.
(B) In the above amino acid sequence, the amino acid sequence comprises an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added, and is involved in the symbiosis between plants and rhizobia and / or mycorrhizal fungi Protein.   A gene having the base sequence shown in SEQ ID NO: 2 or 4 as an open reading frame region.   Hybridizes under stringency conditions to the base sequence shown in SEQ ID NO: 2 or 4, or the base sequence encoding the amino acid sequence shown in SEQ ID NO: 1 or 3, or a part of the base sequence; A gene encoding a protein involved in symbiosis between a plant and rhizobia and / or mycorrhizal fungi.   The gene according to any one of claims 1 to 3, which is derived from Lotus japonicus.   A protein encoded by the gene according to any one of claims 1 to 4. The following protein (a) or (b).
(A) A protein comprising the amino acid sequence shown in SEQ ID NO: 1 or 3.
(B) In the above amino acid sequence, the amino acid sequence comprises an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added, and is involved in the symbiosis between plants and rhizobia and / or mycorrhizal fungi Protein.   An antibody that recognizes the protein according to claim 5 or 6.   A recombinant expression vector containing the gene according to any one of claims 1 to 4.   The transformant containing the recombinant expression vector containing the gene of any one of Claims 1-4.   A plant into which the gene according to any one of claims 1 to 4 is introduced, or a progeny of the plant having the same properties, or a tissue thereof.   A plant having a step of imparting symbiosis with rhizobia and / or mycorrhizal fungi using the gene according to any one of claims 1 to 4 or the protein according to claim 5 or 6. Production method. The gene detection instrument which used the at least one part base sequence in the gene of any one of Claims 1-4, or its complementary sequence as a probe.