JP2005192418A - Simple method for detecting specific sequence to be detected - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for detecting SNP (single nucleotide polymorphism) or a point mutation of a gene by which the detection accuracy and reproducibility are high and detection can be carried out by simple operation. <P>SOLUTION: This method for detection comprises the following steps. (A) A step of designing an oligonucleotide of an FRET (fluorescence resonance energy transfer) primer so that a specific sequence to be detected is located in the FRET primer, (B) a step of modifying the 5'-terminus or the side of the 5'-terminus of the designed oligonucleotide with a fluorescent substance, modifying the interior of the oligonucleotide chain with a quencher so as to sandwich the specific sequence to be detected and affording the FRET primer, (C) a step of amplifying a target gene containing the specific sequence to be detected by a gene amplifying method, (D) a step of making a restriction enzyme recognizing the specific sequence to be detected act on the resultant amplification product and (E) a step of detecting the presence or absence of the emission of fluorescence at a specified wavelength caused by energy transition in the FRET primer. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a simple detection method of a sequence to be detected, such as a DNA sequence to be detected, a single nucleotide polymorphism (NP) of a gene or a sequence of a point mutation, The present invention relates to a simple detection method of a sequence to be detected, which uses a fluorescence resonance energy transfer (FRET) primer and has high detection accuracy and reproducibility and can be detected by a simple operation.

  As the human figure is different, the genetic code consisting of 3 billion is different in many parts when compared between individuals. This difference in gene code is called gene polymorphism (polymorphism), and single nucleotide polymorphism (SNP) is known as a typical gene polymorphism.

  SNP means a single base difference among a plurality of individuals. There are 3 to 10 million SNP sites in the genome. Some of these SNPs affect the regulation or function of protein expression, and some are considered to be involved in individual differences such as constitution and susceptibility to diseases. Therefore, by obtaining information on the SNP, it is possible to perform medical care (custom-made medical care) according to the personal constitution. For this reason, discovery and identification of SNPs are actively performed, and many SNPs have already been reported.

  To date, many methods for detecting known sequences with SNPs have been reported. For example, the Taqman PCR method is based on a real-time detection PCR method (Non-patent Document 1; Patent Document 1), a template DNA containing a fluorescently labeled allele (allele) -specific oligonucleotide, a SNP to be detected, and Taq DNA polymerase. This is a method using PCR according to (Non-Patent Documents 2 and 3).

  However, when detecting a SNP using the Tuckman PCR method, it is necessary to design the Tacman probe strictly (calculation of Tm), and the design may be difficult depending on the sequence of the template containing the SNP. In addition, non-specific increase in fluorescence intensity is often observed due to mis-annealing and the like, so analysis by a real-time PCR apparatus may be necessary.

  The invader method recognizes and cleaves DNA containing a SNP to be typed, two types of reporter probes and one type of invader probe specific to each allele of the SNP to be typed, and the DNA structure. This is a method using an enzyme having a special endonuclease activity (for example, cleavase) (Non-patent Documents 3 to 5). In the invader method, it is possible to design a probe regardless of the type of SNP. However, in order for cleavase to work, it is necessary to triple the genomic DNA, allele probe and invader probe at the position of the SNP. Therefore, complicated hybridization is required and lacks convenience.

  Furthermore, the SniPer method is based on a technique called RCA (rolling cycle amplification) method, and a complementary strand is formed while a circular single-stranded DNA is used as a template and DNA polymerase (mainly Bst polymerase) moves on it. It synthesizes DNA continuously. According to this method, SNPs can be typed by measuring the presence or absence of a color reaction that occurs when DNA amplification occurs (Non-Patent Documents 6 and 7). However, padlock probe design and ligation reactions are required to make Bst polymerase work. In addition, since single-stranded DNA is continuously synthesized in the RCA method, hybridization with a fluorescent modification probe complementary thereto is necessary, which is complicated.

  Other means for detecting and analyzing SNP include DNA sequencing (base sequence determination), PCR-SSCP (polymerase chain reaction-single strand conformation polymorphism), allele-specific hybridization, DNA chip, and the like. Can be mentioned.

  Among these, the DNA sequencing method includes the Maxam-Gilbert method and the Sanger (dideoxy) method, but currently the dideoxy method is mainly used. Amplify the region of the human gene that you want to analyze using the PCR method (polymirase chain reaction method), and then sequence using the primers used in the PCR method or primers set in the amplified DNA to determine the gene sequence in this region. To do. By performing this operation using different sample DNAs, single nucleotide substitution SNPs and point mutations of the gene are detected.

  The PCR-SSCP method is a PCR method in which a region to be analyzed of a human gene is amplified by the PCR method and then made into a single strand by heat denaturation and electrophoresed in a non-denaturing polyacrylamide gel. A secondary structure (intramolecular hydrogen bond) is formed in each strand of the amplified double-stranded DNA. Since the secondary structure (intramolecular hydrogen bond) taken depends on the difference in single nucleotide sequence, the single nucleotide substitution SNP and point mutation of the gene are detected based on the difference in electrophoresis distance.

  Furthermore, in the allele-specific hybridization method, a region to be analyzed is amplified by the PCR method, and then a PCR product or oligonucleotide probe of about 20 bases is prepared in the membrane (nylon filter) region, and the radioisotope 32P is prepared there. The sample DNA (DNA to be detected) labeled with the above is hybridized. By adjusting hybridization conditions such as temperature at that time, a single basic SNP and a point mutation of the gene are detected by the difference in the intensity of the radioisotope.

  Furthermore, the DNA chip method is almost the same as the allele-specific hybridization method in principle, but a PCR product or oligonucleotide probe of about 20 bases is arranged on a stationary phase (on the substrate) and fluorescently labeled there. Sample DNA (DNA to be detected) is hybridized. By adjusting hybridization conditions such as temperature, single base substitution SNPs and point mutations in human genes are detected by the difference in fluorescence intensity.

  In the case of hybridization in the allele-specific hybridization method, since DNA is weaved with a radioisotope, there is a problem that handling and management of the radioisotope is very expensive. In the case of the DNA chip method, if the fluorescent dye is labeled, the fluorescence is not taken into the DNA with sufficient frequency due to the large molecular structure of the fluorescent dye. Fluorescence fading and fluorescence of the substrate such as glass (fluorescence of the background portion) are problems.

  In view of these problems, Patent Document 2 reports a method for detecting a single nucleotide substitution SNP and a point mutation of a gene, and a new technology relating to a detection device and a detection chip. Similarly to the method, it is necessary to immobilize oligonucleotides serving as probes on a substrate, to hybridize DNA, and to perform washing operations to suppress nonspecific adsorption, and the detection operation is complicated.

  In addition, there is also a PCR-ARMS (Amplification Refractory Mutation System) method in which normal and mutant alleles are discriminated and detected by performing PCR amplification using PCR primers designed so that templates with SNPs can be identified (non-patented). Reference 8). ARMS is also called allele-specific PCR (Non-patent Document 9) or PCR amplification of specific alleles (PASA) (Non-patent Document 10). The main advantage of ARMS is that the amplification and diagnosis steps are combined, making it a time efficient method for routine clinical diagnosis. However, this method of performing the amplification step and the diagnosis step at the same time is as reliable as other methods of performing the two steps separately (for example, a method of performing restriction enzyme analysis after performing PCR: Restriction Fragment Length Polymorphism). Is not expensive.

PCR-RFLP (Non-Patent Documents 11 and 12) is one of the earliest methods used to analyze amplification products because it can be used to identify alleles that have restriction enzyme recognition sequences. In addition, site-directed mutagenesis is used to identify alleles that do not have restriction enzyme recognition sequences, and is adapted to almost all naturally occurring DNA polymorphisms. -RFLP (Artificial-RFLP) has also been reported. However, since RFLP needs to separate and analyze products by gel electrophoresis after a restriction enzyme reaction, the procedure is somewhat complicated.
Japanese Patent Publication No. 6-500021 JP 2001-050931 A Proc. Natl. Acad. Sci. USA, Vol. 88, pp. 7276-7280, August 1991, Biochemistry Livak, KJGenet.Anal. 14, 143 (1999) Morris T. et al., J. Clin. Microbiol. 34, 2933 (1996) Livak, KJ Biomol. Eng. 14, 143-149 (1999) Lyamichev, V. et al., Science, 260,778-783 (1993) Lizardi, PMet al., Nature Genet., 19, 225-232 (1998) Piated, ASet al., Nature Biotech., 16, 359-363 (1998) Newton, CR, Markham, AF (1989) Analysis of any point mutation in DNA.The amplification refractory mutation system (ARMS). Nucleic Acid Res. 17,2503-2516 Proc. Natl. Acad. Sci. USA. 86, 2757-2760 Methods Enzymol. 218, 388-402 Haliassos, A. et al., Nucleic Acids Research, 17: 3606,1989; Haliassos A. et al., Nucleic Acids Research, 17: 8093-8099, 1989 Fumiyoshi Kawakami et al., Cell Engineering, 15: 1637-1643, 1996

  As described above, various studies and proposals have been made regarding SNP detection methods, but each has its own problems, and sufficient techniques have not yet been established. Therefore, there has been a demand for a detection technique that does not have the problems as in the conventional method, is simple in operation, and has high detection result reliability.

  Accordingly, an object of the present invention is to provide a method for detecting a specific sequence to be detected with a simple operation with high detection accuracy and good reproducibility in light of the above-described problems of the prior art.

  As a result of intensive studies to solve the above problems, the present inventors have found that the above object can be achieved by a new method using FRET and RFLP, and have completed the present invention.

That is, the simple detection method of the specific sequence to be detected according to the present invention is as follows.
(A) designing the oligonucleotide of the FRET primer so that the specific sequence to be detected is in the FRET primer;
(B) A step of modifying the fluorescent substance at the 5 ′ end or 5 ′ end side of the designed oligonucleotide and modifying the quenching substance in the oligonucleotide chain so as to sandwich the specific sequence to be detected to obtain a FRET primer When,
(C) amplifying a target gene containing the specific sequence to be detected by a gene amplification method;
(D) allowing the restriction enzyme that recognizes the specific sequence to be detected to act on the obtained amplification product;
(E) detecting the presence or absence of fluorescence generation at a specific wavelength resulting from energy transfer in the FRET primer;
It is characterized by including.

  In the present invention, preferred examples of the specific sequence to be detected include DNA sequences, single nucleotide substitution SNPs, and point mutation sequences. Further, as the gene amplification method in the step (C), a PCR method or a LAMP method can be suitably employed. Furthermore, when there is no restriction enzyme that recognizes the specific sequence to be detected in the step (D), A-RFLP (Artificial-RFLP) using site-directed mutagenesis is preferably employed. Can do. Furthermore, the fluorescent material in the step (B) is preferably FAM, and the quenching material is preferably Dabcyl.

  Specific sequences to be detected, such as DNA sequences, single base substitution SNPs or point mutation sequences (hereinafter collectively referred to as “single base mismatches”), this single base mismatch includes DNA sequences to be examined other than single base mismatches. In the method of the present invention for detecting FMU using a FRET primer, the design of a FRET probe is easier than that of Taqman PCR, invader method, RCA method and the like. In addition, a hybridization process such as DNA chip method and invader method is not required, and furthermore, a restriction enzyme reaction is used for detection of single-base mismatch, so that detection accuracy, reproducibility, and simplicity are easier than in the prior art. It is excellent in the point. Further, compared with the A-RFLP method, it is not necessary to provide a gel electrophoresis step after the restriction enzyme reaction, which is very simple. As described above, in the conventional technique, when detecting a single base mismatch, it was necessary to perform complicated and strict detection. However, in the present invention, a single base mismatch can be detected easily and accurately, and clinical tests are performed. This is a very effective means as a simple diagnostic method in the field.

Hereinafter, embodiments of the present invention will be specifically described.
First, in step (A), as shown in FIG. 1 (A), the FRET primer oligonucleotide is designed so that the sequence of the single-base mismatch to be detected in the target DNA (template DNA) is in the FRET primer. To do.

  Next, in step (B), the fluorescent substance is modified at the 5 'end of the designed oligonucleotide, and the quencher is modified in this oligonucleotide chain so as to sandwich a single base mismatch. At this time, the 3 'end side is used for the extension reaction in the amplification reaction in the step (C), and is left unmodified. In general, Taqman probes and molecular beacons are inactivated by phosphorylation or the like at the 3 'end so as not to cause an extension reaction. In the state shown in FIG. 1A, since FRET occurs, even if light having a specific wavelength is applied to the fluorescent material (for example, light of about 490 nm when the fluorescent material is FAM), fluorescence is emitted. There is no.

  FIG. 1B shows the sequence of the actually prepared FRET primer, which is modified with 6-FAM as a fluorescent substance at the 5 'end and Dabcyl as a quencher within the chain. In this sequence, the 9th base T counted from the 5 'end is a single base mismatch, and the underlined sequence (ACGTGT) is a recognition sequence for the restriction enzyme Af1 III. The modification of the fluorescent substance is not limited to the 5 'end, and the same effect can be obtained even on the 5' end side of the designed oligonucleotide as shown in FIG. 1 (C).

  As a fluorescent substance for modifying the 5 ′ end or 5 ′ end, in addition to FAM, HEX, TET, Fluorescein, Cy3, Cy3.5, Cy5, Cy5.5, TAMRA, ROX, Texas Red, Oregon Green, etc. Many known ones can be used and should not be particularly limited. In addition to Dabcyl, examples of the quenching material include Black Hole Quencher, TAMRA, and the like, and any material that causes energy transfer is not particularly limited.

  Next, in step (C), a target DNA containing a single base mismatch is amplified by a gene amplification method. As such a gene amplification method, a gene amplification method utilizing primer annealing, extension reaction, etc. can be widely adopted, and should not be particularly limited, but is not limited to PCR (Polymerase Chain Reaction) method and LAMP (Loop mediated) A known method such as isothermal amplification method can be suitably employed. FIG. 2A shows a process in which target DNA is amplified by a DNA amplification reaction such as PCR using the prepared FRET primer. By the operation of this amplification step, an amplification product containing the FRET primer shown in FIG. 2 (B) is obtained.

  Next, in step (D), a restriction enzyme that recognizes a sequence containing a single base mismatch is allowed to act on the obtained amplification product at the restriction enzyme site shown in FIG. At this time, as shown in “1. No mismatch” in FIG. 3 (B), a DNA sequence serving as a template having a restriction enzyme recognition sequence is cleaved by the restriction enzyme, and energy transfer in the FRET primer does not occur. Fluoresce. On the other hand, when the template DNA does not have a recognition sequence, as shown in “2. Mismatch” in FIG. 3B, energy transfer within the FRET primer occurs and fluorescence occurs without being cleaved by a restriction enzyme. There is nothing. Based on the difference between the two, a single base mismatch can be detected. In FIG. 3B, an example is shown in which fluorescence is emitted when there is no single-base mismatch and when it is quenched, a restriction enzyme that recognizes a sequence containing a mismatch is designed during FRET primer design. By using it, it is possible to show fluorescence when there is a mismatch.

  Further, when a restriction enzyme that recognizes a DNA sequence to be detected is not found, a known A-RFLP method using site-directed mutagenesis is effective (see Non-Patent Documents 11 and 12). Incorporating artificial mismatches in advance so that restriction sequences can be recognized when designing FRET primers, almost all sequences can be handled, and single-base mismatches can be easily detected.

Therefore, application examples of fluorescence detection of single-base mismatches targeting the ε4 gene of human apolipoprotein E (Human apoliporotein E) according to the present invention will be described below.
Apolipoprotein E (ApoE) is one of the main apolipoproteins constituting lipoproteins. ApoE is a gene encoded on chromosome 19 and synthesized as a protein consisting of 317 amino acids, but the signal peptide consisting of 18 amino acids at the N-terminal is separated and a mature protein consisting of 299 amino acids (molecular weight) : About 34,000).

  There are three alleles (alleles) of ε2, ε3, and ε4 in the ApoE gene, and there are three isoforms of E2, E3, and E4 corresponding to each. There is a difference in amino acids at positions 112 and 158 between these isoforms. ApoE3 is a normal type and ApoE4 is considered a risk factor for Alzheimer's disease (AD). ApoE2 has a low binding force with the receptor and causes hyperlipidemia.

  As described above, ApoE differs in amino acids at positions 112 and 158. That is, there are two single base mismatches on the apoE gene. Therefore, as shown in FIG. 4A, when a target gene is amplified, FRET primers each modified with two fluorescent dyes having different wavelengths are used for both forward and reverse primers. For example, the forward FRET primer (112) is a 520 nm fluorescent dye, and the reverse FRET primer (158) is a 580 nm fluorescent dye.

  When DNA is amplified under this condition and cleaved with a restriction enzyme, the isoform of ApoE can be identified (FIG. 4B). For example, ε2 can be detected when the restriction enzyme AflIII is used, and ε4 can be detected when HhaI is used.

  Thus, various known mismatches can be detected by designing FRET primers and selecting restriction enzymes. FIG. 5 shows changes in the fluorescence intensity of the restriction enzyme reaction using AflIII. As shown in FIG. 4B, AflIII is a restriction enzyme that cleaves ε2,3. As a result of amplifying and cleaving the sample DNA using the FRET primer, it can be seen from FIG. 5 that the fluorescence intensity is increased. From this result, it can be seen that the sample DNA has ε2 or ε3.

Hereinafter, the present invention will be specifically described based on a fluorescence detection experiment example of single base mismatch targeting the ε4 gene of human apolipoprotein E.
Experimental example 1
FRET primer: 6-FAM-AGGACGTGTGCGGCCGCCT (-Dabcyl) GTT was used as a forward primer and CCAGGCGCTTCTGCAGGTCATCGG was used as a reverse primer to amplify the apolipoprotein E gene by PCR under the following conditions.
PCR condition 95 ° C-2min
40 cycles of 98 ℃ -15sec and 68 ℃ -15sec

PCR reaction solution (25 μl scale)
10 × R-PCR buffer 2.5 μl
250 mM Mg ²⁺ solution 0.2 μl
0.75 μl of dNTP mixture
10 μM 6-FAM-AGGACGTGTGCGGCCGCCT (-Dabcyl) GTT 1.25 μl
10 μM CCAGGCGCTTCTGCAGGTCATCGG 1.25 μl
Human female genomic DNA 2.0 μl
16.8 μl of H ₂ O
Ex Taq (5 U / μl) 0.25 μl

  Next, the sample obtained by PCR was cleaved with the restriction enzyme AflIII under the following reaction conditions. At this time, in order to observe the fluorescence intensity change due to the cleavage of the FRET primer, measurement was performed using a smart cycler which is a real-time PCR apparatus. For comparison, the same experiment was also performed without human genomic DNA (template) and without restriction enzyme AflIII.

Afl III reaction conditions 37 ° C.-60 min

Afl III reaction solution 10 × NEB buffer 2.5 μl
100 × BSA 0.25 μl
Afl III 0.25U
9.5 μl of H ₂ O
PCR amplification product 12.5 μl

  The obtained result is shown in FIG. In FIG. 6, template (+) / (−) means PCR with or without human genomic DNA (template), and restriction enzyme (+) / (−) represents restriction enzyme reaction with or without restriction enzyme (Afl III). Meaning. From the graph shown in FIG. 6, it was found that as a result of the restriction enzyme (Afl III) reaction, the fluorescence intensity changed only in the sample in which PCR amplification was observed.

Experimental examples 2 and 3
The apolipoprotein E gene was amplified by PCR under the following conditions using AGGACGTGTGCGGCCGCCTGGT as a forward primer and FRET primer: 6-FAM-CCAGGCGCTTCT (-Dabcyl) GCAGGTCATCGG as a reverse primer.
PCR condition 95 ° C-2min
40 cycles of 98 ℃ -15sec and 68 ℃ -15sec

PCR reaction solution (25 μl scale)
10 × R-PCR buffer 2.5 μl
250 mM Mg ²⁺ solution 0.2 μl
0.75 μl of dNTP mixture
10 μM AGGACGTGTGCGGCCGCCTGTT 1.25 μl
10 μM 6-FAM-CCAGGCGCTTCT (-Dabcyl) GCAGGTCATCGG 1.25 μl
Human female genomic DNA 2.0 μl
16.8 μl of H ₂ O
Ex Taq (5 U / μl) 0.5 μl

  Next, the sample obtained by PCR was cleaved with the restriction enzyme Hae II under the following reaction conditions (Experimental Example 2). A similar experiment was conducted using Hha I under the following reaction conditions (Experimental Example 3). For comparison, an experiment was also conducted in the case of no restriction enzyme treatment.

Hae II reaction conditions 37 ° C.-60 min

Hae II reaction solution 10 × M buffer 2.5 μl
Hae II 0.5 μl
9.5 μl of H ₂ O
PCR amplification product 12.5 μl

Hha I reaction conditions 37 ° C.-60 min

Hha I reaction solution 10 × TA buffer 2.5 μl
10 × BSA 2.5 μl
Hha I (5000 U / ml) 0.5 μl
7.0 μl of H ₂ O
PCR amplification product 12.5 μl

  FIG. 7 shows the results of Experimental Example 2 and FIG. 8 shows the results of Experimental Example 3. From these graphs, it was found that the fluorescence intensity changed only for the samples in which PCR amplification was observed as a result of the respective restriction enzyme reactions.

From the above experimental examples 1 to 3, it was found that only when there was a sequence recognized by the restriction enzyme, the DNA amplified by the FRET primer was cleaved and the fluorescence intensity changed.
Next, PCR was performed from actual blood (whole blood) using FRET primers, and changes in fluorescence intensity were examined when the amplification product was cleaved with a restriction enzyme (Hae II).

Experimental Example 4
The apolipoprotein E gene was amplified by a PCR method under the following conditions using AGGACGTGTGCGGCCGCCTGGT as a forward primer and FRET primer: 6-FAM-CCAGGCGCTTCT (-Dabcyl) GCAGGTCATCGG as a reverse primer.

PCR reaction solution (25 μl scale)
5 × Amp direct G / C 5.0 μl
5 × Amp Addition-4 5.0 μl
0.75 μl of dNTP mixture (10 mM each)
10 μM AGGACGTGTGCGGCCGCCTGTT 2.5 μl
10 μM 6-FAM-CCAGGCGCTTCT (-Dabcyl) GCAGGTCATCGG 2.5 μl
Whole blood 0.5 μl
0.75 μl of H ₂ O
Ex Taq (5 U / μl) 0.5 μl
2.5% PVP 7.5 μl

  Next, the sample obtained by PCR was cleaved using the restriction enzyme Hae II under the following conditions.

Hae II reaction condition 10 × M buffer 2.5 μl
Hae II 0.5 μl
9.5 μl of H ₂ O
PCR amplification product 12.5 μl

Hae II reaction conditions 37 ° C.-60 min

  As a result, as shown in FIG. 9, it was found that even when whole blood was used, a change in fluorescence intensity was obtained only when a sample having a sequence recognized by the restriction enzyme used was present.

Experimental Example 5
The apolipoprotein E gene was amplified by the PCR method using AGGACGTGTGCGGCCGCCTGGT as a forward primer, FRET primer: 6-FAM-CCAGGCGCTTCT (-Dabcyl) GCAGGTCATCGG and FAM-modified primer: 6-FAM-CCAGGCGCTTCTGCAGGTCATCGG, respectively. For comparison, the same experiment was performed for the FAM-Dabcyl-modified one without restriction enzyme Hae II.

PCR reaction solution (25 μl scale)
10 × R-PCR buffer 2.5 μl
250 mM Mg ²⁺ solution 0.2 μl
0.75 μl of dNTP mixture
10 μM AGGACGTGTGCGGCCGCCTGTT 1.25 μl
Human female genomic DNA 2.0 μl
16.8 μl of H ₂ O
Ex Taq (5 U / μl) 0.5 μl
For FRET primer

In the reaction solution,
10 μM 6-FAM-CCAGGCGCTTCT (-Dabcyl) GCAGGTCATCGG 1.25 μl
In case of FAM modified primer 10 μM 6-FAM-CCAGGCGCTTCTGCAGGTCATCGG 1.25 μl
Was added respectively.

  Next, the sample obtained by PCR was cleaved under the following conditions using restriction enzyme Hae II.

Hae II reaction condition 10 × M buffer 2.5 μl
Hae II 0.5 μl
9.5 μl of H ₂ O
PCR amplification product 12.5 μl

Hae II reaction conditions 37 ° C.-60 min

  As can be seen from the results shown in FIG. 10, after amplification of DNA using the FAM-modified primer, the amplified product was cleaved with the restriction enzyme Hae II, and no change was observed in the fluorescence intensity. On the other hand, in the case of the FRET primer in which Dabcyl was modified in the chain, the fluorescence intensity was amplified by the restriction enzyme reaction. From this result, it was found that FRET was generated by modifying FAM and Dabcyl on the prepared primer.

  In the field of clinical testing, analysis technology that can be used on the spot, such as medical care and nursing care, has been sought as a counter electrode for large analytical instruments. In particular, sensor technology that enables on-site analysis and detection (POCT: point of care testing) as represented by portable blood glucose level sensors includes clinical tests in home medicine, patient self-tests, initial diagnosis, Since it can be used in various cases such as emergency processing and monitoring during surgery, there is a very high demand. Furthermore, in recent years, with the advancement of gene analysis technology and μTAS, attention has been paid to rapid genetic diagnosis by POC such as infectious diseases and genetic diseases. Many of these genetic diagnoses are due to mutations in specific gene sequences, and the single-base mismatch detection method of the present invention is extremely effective against such mutations. In addition, rapid genetic diagnosis by POC has many limitations such as accuracy, simplicity, low cost, and safety, and sensor technology that covers this has not yet appeared. However, the single-base mismatch detection method using the FRET primer of the present invention satisfies the above-mentioned many limitations, and can be said to be a very important technique for constructing a POC sensor.

It is a conceptual diagram which shows the design of a FRET primer. It is a conceptual diagram which shows the process of amplifying DNA by a gene amplification method using a FRET primer. It is a conceptual diagram which shows the cutting | disconnection of the amplification product containing the FRET primer by a restriction enzyme. It is a conceptual diagram which shows the fluorescence detection of the single base mismatch which targeted the apolipoprotein E ((epsilon) 4). It is a graph which shows the relationship between reaction time and fluorescence intensity which shows the detection result of apolipoprotein E ((epsilon) 2 or (epsilon) 3). It is a graph which shows the relationship between reaction time and fluorescence intensity which shows the detection result of the apolipoprotein E of Experimental example 1. It is a graph which shows the relationship between reaction time and fluorescence intensity which shows the detection result of the apolipoprotein E of Experimental example 2. It is a graph which shows the relationship between reaction time and fluorescence intensity which shows the detection result of the apolipoprotein E of Experimental example 3. It is a graph which shows the detection result at the time of using the whole blood of Experimental example 4, and shows the relationship between reaction time and fluorescence intensity. It is a graph which shows the relationship between reaction time and fluorescence intensity which shows the detection result at the time of changing the modification form of the primer of Experimental example 5. FIG.

Claims (6)

(A) designing the oligonucleotide of the FRET primer such that the specific sequence to be detected is in the FRET primer;
(B) A step of modifying the fluorescent substance at the 5 ′ end or 5 ′ end side of the designed oligonucleotide and modifying the quenching substance in the oligonucleotide chain so as to sandwich the specific sequence to be detected to obtain a FRET primer When,
(C) amplifying a target gene containing the specific sequence to be detected by a gene amplification method;
(D) allowing the restriction enzyme that recognizes the specific sequence to be detected to act on the obtained amplification product;
(E) detecting the presence or absence of fluorescence generation at a specific wavelength resulting from energy transfer in the FRET primer;
A simple method for detecting a specific sequence to be detected, comprising:   The simple detection method according to claim 1, wherein the specific sequence to be detected is a DNA sequence, a single base substitution SNP, or a point mutation sequence.   The simple detection method according to claim 1 or 2, wherein the gene amplification method in the step (C) is a PCR method or a LAMP method.   The simple detection method according to any one of claims 1 to 3, wherein an A-RFLP method using site-directed mutagenesis is used when there is no restriction enzyme that recognizes the specific sequence to be detected in the step (D). .   The simple detection method according to claim 1, wherein the fluorescent substance in the step (B) is FAM.   The simple detection method according to any one of claims 1 to 5, wherein the quenching substance in the step (B) is Dabcyl.

Images