JP2005176809A - Oligonucleotide and method for detecting lactobacillus plantalum by using the same as primer - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for detecting Lactobacillus plantalum, species-specifically by using a PCR (polymerase chain reaction) method. <P>SOLUTION: An oligonucleotide synthesized by using a nucleotide sequence encoding 16Sr RNA of the Lactobacillus plantalum, as a target so as to become complemental to a part of the nucleotide and having base sequences expressed by a sequence number 1 or 2 is used as a primer in detecting the Lactobacillus plantalum. Sequence number 1: (5')GAACGAACTCTGGTATTGGATTG(3'), Sequence number 2: (5')GCGGTCCAAGTTGTTATGC(3'). <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a method for detecting Lactobacillus plantarum. More specifically, a polymerase chain reaction method (hereinafter abbreviated as PCR method) is performed using a synthetic oligonucleotide having a specific base sequence as a primer, and an extension product of the amplified primer is detected. The present invention relates to a method for specifically detecting plantarum.

  Lactobacillus plantarum (Lactobacillus plantarum) is a lactobacillus having both acid resistance and salt resistance, and has traditionally caused sporadic bacterial accidents in acidic foods. Some Lactobacillus plantarums are slow to grow on plate media, which are used in normal bacterial tests, and require some time for detection. Thus, growth media have been studied for some time, but since slow growth is an inherent property of this bacterium, a drastic solution has been difficult.

Under such circumstances, a rapid detection method by PCR targeting a DNA sequence encoding 16S rRNA (hereinafter referred to as 16S rDNA) is known, and identification of a specific bacterial species of the genus Lactobacillus using this detection method And analysis has been done. For example, JP-A-7-289295 (Patent Document 1) and JP-A-10-210980 (Patent Document 2) include Lactobacillus brevis and Lactobacillus casei (harmful beer bacteria). Lactobacillus casei) and JP-A-10-234377 (Patent Document 3) disclose a rapid detection method by PCR of Lactobacillus sp., Which is a harmful bacterium of beer.
JP 7-289295 A JP-A-10-210980 JP-A-10-234377

  However, for Lactobacillus plantarum, which is a specific species of Lactobacillus genus bacteria, a rapid detection method by the PCR method has not yet been proposed, and a novel method for detecting Lactobacillus plantarum by the PCR method has been proposed. Development of primers is desired.

  An object of the present invention is to develop a new primer for detecting Lactobacillus plantarum by the PCR method so that Lactobacillus plantarum can be rapidly detected against such a conventional situation. To do.

  In the Lactobacillus plantarum, the present inventor searches for a region where the 16S rDNA sequence is conserved at the species level and is different from the sequence of other strains, and targets a specific sequence in the region. In order to complete the present invention, the present inventors have newly developed a primer to be used and found that Lactobacillus plantarum can be detected satisfactorily by using the primer in the PCR method or can be distinguished from other species of the genus Lactobacillus. It came.

That is, the present invention is an oligonucleotide chemically synthesized to target a nucleotide sequence encoding 16S rRNA of Lactobacillus plantarum and to be complementary to a part of the nucleotide sequence, The nucleotide sequence shown in number 1 or 2
(5´) GAACGAACTCTGGTATTGGATTG (3´) (SEQ ID NO: 1)
(5´) GCGGTCCAAGTTGTTATGC (3´) (SEQ ID NO: 2)
An oligonucleotide is provided.

  In addition, the present invention is a primer comprising two oligonucleotides that are chemically synthesized so as to target a nucleotide sequence encoding Lactobacillus plantarum 16S rRNA and to be complementary to a part of the nucleotide sequence. A primer for detecting Lactobacillus plantarum, at least one of which consists of an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 1 or 2, and in particular, the two oligonucleotides are bases shown in SEQ ID NO: 1 Provided is a Lactobacillus plantarum detection primer comprising an oligonucleotide having a sequence and an oligonucleotide having a base sequence represented by SEQ ID NO: 2.

  Furthermore, the present invention provides a method for detecting Lactobacillus plantarum by adding the above-mentioned primer to a sample, performing primer extension reaction and amplification of the target nucleotide sequence by PCR, and detecting the nucleotide sequence.

  According to the present invention, high detection sensitivity and selectivity can be obtained in detecting Lactobacillus plantarum by PCR. In addition, it is not necessary to take into account the growth of different species and bacteria of the same species in the sample, and Lactobacillus plantarum can be easily detected without requiring skill.

  The PCR method performed by the present invention for detecting Lactobacillus plantarum is based on the Polymerase Chain Reaction method (Science, 230, 1350 (1985)) developed by Saiki.

  In the present invention, Lactobacillus plantarum is specified by the genus name and species name of the standard strain when the standard strain is used. In addition, when a non-standard strain is used, it is a commercially available identification kit after confirming the form (gram positive bacillus) peculiar to Lactobacillus bacteria and properties (catalase negative, non-spore formation or anaerobic) by conventional methods. By identification using “Api 50CHL (sold by Nihon Biomeryu Co., Ltd.)”.

  As a specific identification method, a bacterial solution is prepared according to the identification kit, and this bacterial solution is added to “API 50CHL medium (sold by Nihon Biomelieu Co., Ltd.)” to prepare an inoculum solution. Next, after inoculating this inoculum solution into the tube portion of “Api 50CHL plate (Nihon Biomelieu Co., Ltd.)”, mineral oil is overlaid. Cover the plate and incubate at 35 ° C. for 48 hours. After culturing, each biochemical property is judged by the change in color of the medium, and identified with APILAB Plus (sold by Nihon Biomelieu).

  In the case where the species name identified using the “Api 50CHL (sold by Nihon Biomeryu Co., Ltd.)” identification group differs from the group estimated from 16S rDNA analysis using homology search software: BLAST, the present invention Then, based on the species name identified using the “Api 50CHL (sold by Nihon Biomeryu Co., Ltd.)” identification kit.

Homology search software: A specific group estimation method by 16S rDNA analysis using blast (BLAST) is as follows. First, isolation of single colonies and pure culture, followed by hot water extraction of DNA, sterilization purification Suspend colonies in water and heat at 100 ° C. with a hot water bath for 10 minutes. Next, the following two oligonucleotides [Journal of Bacteriology, 173 (2), p697-703 (1991)], which are common primers for all regions encoding 16S rRNA,
(5´) AGAGTTTGATCATGGCTCAG (3´) (SEQ ID NO: 3)
(5´) GGTTACCTTGTTACGACTT (3´) (SEQ ID NO: 4)
After PCR using the hot water extract as a template for DNA (because a sequence part that is highly conserved in bacteria is used as a primer, DNA of about 1400 base pairs encoding 16S rRNA is amplified even in unknown bacteria. And electrophoresis of the PCR product to confirm the amplification of about 1400 base pairs of DNA encoding 16S rRNA. Next, the base sequence of the PCR product is decoded with “DNA Sequencer ABI PRISM 16 Capillary (ABI)”. By using the homology search software: BLAST of Japan DNA Data Bank (DDBJ), a base sequence having high homology with the base sequence is searched, and a group is estimated.

In the present invention, as a primer used for detecting Lactobacillus plantarum by PCR, the oligonucleotide of the present invention having a specific base sequence, that is, a nucleotide sequence encoding 16S rRNA of Lactobacillus plantarum is targeted. , An oligonucleotide chemically synthesized so as to be complementary to a part of the nucleotide sequence, the base sequence shown in SEQ ID NO: 1 or 2
(5´) GAACGAACTCTGGTATTGGATTG (3´) (SEQ ID NO: 1)
(5´) GCGGTCCAAGTTGTTATGC (3´) (SEQ ID NO: 2)
An oligonucleotide consisting of

  As a result of detailed analysis of the nucleotide sequence of Lactobacillus plantarum and heterologous and heterologous 16S rDNA, the oligonucleotide sequence represented by these SEQ ID NOs: 1 or 2 is conserved among different strains of Lactobacillus plantarum, It has been determined by finding regions that are completely distinguished from allogeneic as well as different species.

  The oligonucleotide of the present invention is composed of any one of the nucleotide sequences represented by SEQ ID NO: 1 or 2. However, deoxyribose and base constituting the oligonucleotide may be added with other molecules or a part of them. Those in which the moiety is modified by substitution with another molecule are also included. For example, in the oligonucleotide of the present invention, the oligonucleotide encoding 16S rRNA of Lactobacillus plantarum is amplified by PCR, and then the 5 ′ end of the oligonucleotide used as a primer is simplified in order to simplify the detection of the oligonucleotide. Are labeled with a fluorescent dye, fluorescein isothiocyanate (FITC). In addition, it is possible to bind biooxidase to the 5 'end and bind peroxidase covalently bonded to avidin, or antisense by replacing oxygen in phosphoric acid bonding between deoxyribose skeletons with sulfur atoms. Included.

  Among the primers consisting of the base sequence of SEQ ID NO: 1 or 2 of the present invention, those consisting of SEQ ID NO: 1 are normal strand primers, and those consisting of SEQ ID NO: 2 are reverse strand primers.

  When the oligonucleotide of the present invention is used as one of a pair of primers for detecting Lactobacillus plantarum by PCR, the other primer used in combination with the primer is SEQ ID NO: 1 of the present invention. The primer consisting of can be used in combination with a known reverse strand primer, and the primer consisting of SEQ ID NO: 2 can be used in combination with a known normal strand primer, but an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2 It is preferable to use an oligonucleotide having a base sequence represented by the above as a pair of primers.

  The PCR method itself using a pair of primers on the normal strand side and the reverse strand side to amplify an oligonucleotide specific for Lactobacillus plantarum can follow a known method. That is, by first heat-treating the sample, the double-stranded DNA in the sample is separated into single strands, and a set of primers is allowed to act on this to specifically hybridize with the complementary oligonucleotide sequence of the sample. Next, the region downstream of the primer is selectively synthesized in the presence of DNA polymerase and four deoxyribonucleotide triphosphates (dNTPs). By repeating this operation for about 20 to 40 cycles, a specific oligonucleotide in the sample can be amplified as a primer extension product. In addition, this amplification can be confirmed by electrophoresis, chromatography, or the like, which makes it possible to easily and reliably detect Lactobacillus plantarum in a sample.

  Examples of specimens to which this PCR method is applied include acidic foods such as mayonnaise and dressing, materials for these foods, patient vomit, feces, and the like.

(1) Preparation of Specimen In order to confirm that the primer of the present invention is specific for Lactobacillus plantarum, various bacteria shown in the vertical column in Table 1 were used for enrichment. A plate medium was inoculated and cultured. The bacterial cells were scraped off, suspended in 0.85% saline, heated for 10 minutes in boiling water, DNA was extracted, and the centrifuged supernatant was used as a specimen. The bacterial concentration in this suspension was about 10 ⁷ cfu / ml.

(2) Primer synthesis The oligonucleotide having the nucleotide sequence of SEQ ID NO: 1 or 2 as a normal-strand or reverse-strand primer targeting the nucleotide sequence encoding Lactobacillus plantarum 16S rRNA by the phosphoramidite method Synthesized.

(3) Preparation of reaction solution and PCR reaction 5 μl of reaction buffer concentrated 10 times in 5 μl of sample solution (Takara Ra Taq, Buffer supplied by Takara Shuzo Co., Ltd.), 4 types of deoxyribonucleotide triphosphates (dNTP) 4 μl of a mixed solution (Takara Ra Taq, manufactured by Takara Shuzo Co., Ltd.), as shown in Table 1, 20 pmol of oligonucleotide consisting of the base sequence of SEQ ID NO: 1 as a normal strand primer, SEQ ID NO: as a reverse strand primer 20 pmol of an oligonucleotide having a base sequence of 2 and 0.25 μl of DNA polymerase (TaKaRa Taq, manufactured by Takara Shuzo Co., Ltd.) were added to make 50 μl with water.

  A process consisting of thermal modification (94 ° C., 1 minute), annealing (55 ° C., 1 minute), and polymerization reaction (72 ° C., 1 minute) was defined as one cycle, and this was repeated for 35 cycles.

  In order to see whether or not the nucleotide sequence was amplified in the reaction solution, agarose gel electrophoresis and staining with ethidium bromide were performed. That is, electrophoresis was performed using a 3% agarose gel in TBE buffer at 100 volts for 30 minutes. Next, the gel was taken out, immersed in an aqueous solution of ethidium bromide of 0.5 μg / ml for 30 minutes, dyed, developed with a transilluminator, and photographed with a polaroid camera. In this case, the length of the detected nucleotide sequence fragment was calculated by relative comparison by flowing together DNA fragments having a known base pair number during electrophoresis.

The results are shown in Table 1. + In Table 1 indicates that an amplification product having a size corresponding to about 160 base pairs was observed. Depending on the strain, insertion or deletion of base pairs has occurred in the 16S rDNA sequence that can be amplified, and the size of the amplified DNA can vary.

[Table 1-A]

[Table 1-B]

  The brackets in Table 1 are groups estimated by 16S rDNA analysis using homology search software: BLAST.

  From the results of Table 1, it can be seen that according to the present invention, Lactobacillus plantarum can be detected in a species-specific manner.

  The oligonucleotide, the primer of the present invention, and the detection method by PCR using this primer are useful for detecting Lactobacillus plantarum in various samples including foods such as acidic foods or food materials. Become.

Claims (4)

Oligonucleotide chemically synthesized to target a nucleotide sequence encoding 16S rRNA of Lactobacillus plantarum and complementary to a part of the nucleotide sequence, as shown in SEQ ID NO: 1 or 2 Base sequence
(5´) GAACGAACTCTGGTATTGGATTG (3´) (SEQ ID NO: 1)
(5´) GCGGTCCAAGTTGTTATGC (3´) (SEQ ID NO: 2)
An oligonucleotide characterized by comprising: A primer comprising two oligonucleotides which are chemically synthesized to target a nucleotide sequence encoding Lactobacillus plantarum 16S rRNA and to be complementary to a part of the nucleotide sequence, at least one of which is claimed A primer for detecting Lactobacillus plantarum, comprising an oligonucleotide having the base sequence represented by SEQ ID NO: 1 or 2 according to Item 1. The primer for Lactobacillus plantarum detection according to claim 2, wherein the two kinds of oligonucleotides comprise an oligonucleotide having the base sequence represented by SEQ ID NO: 1 and an oligonucleotide having the base sequence represented by SEQ ID NO: 2. A lactobacillus characterized by adding the primer according to claim 2 or 3 to a sample, performing primer extension reaction and amplification of a target nucleotide sequence by PCR (Polymerase Chain Reaction) method, and detecting the nucleotide sequence.・ Method of detecting plantarum.