JP2005168509A - Spliceosome-mediated rna trans-splicing - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a means for in vivo production of a trans-spliced molecule in a selected subset of cells. <P>SOLUTION: An in vivo trans-splicing reaction between a pre-trans-splicing molecule and a pre-mRNA which is uniquely expressed in a specific target cell provides a novel mRNA which is functional as a mRNA or encodes a protein to be expressed in the target cells. The expression product of the mRNA is a protein of therapeutic value to the cell or host organism, a toxin which causes killing of the specific cells or a novel protein not normally present in such cells. The invention further provides PTMs that have been genetically engineered for the identification of exon/intron boundaries of pre-mRNA molecules using an exon tagging method. The PTMs can also be designed to result in the production of chimeric RNA encoding for peptide affinity purification tags which can be used to purify and identify proteins expressed in a specific cell type. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

1. Introduction The present invention provides methods and compositions for making novel nucleic acid molecules by targeted spliceosome trans-splicing. The composition of the present invention is a pretrans designed to mediate a trans-splicing reaction that interacts with a natural target precursor messenger RNA molecule (target pre-mRNA), resulting in the formation of a novel chimeric RNA molecule (chimeric RNA). Contains splicing molecules (PTM). The PTMs of the invention may themselves perform a function, such as inhibition of RNA translation, or encode a protein that complements a defective or inactive protein in the cell or kills a specific cell Engineered to result in production of a novel chimeric RNA encoding the toxin. In general, the target pre-mRNA is selected as a target because it is expressed in a particular cell type and thus provides a means to target the expression of the novel chimeric RNA to the selected cell type. The invention further relates to PTMs that have been genetically engineered to identify exon / intron boundaries of pre-mRNA molecules using exon tagging methods. PTMs can also be designed to result in the production of chimeric RNAs encoding peptide affinity purification tags that can be used to purify and identify proteins expressed in specific cell types. The method of the invention comprises contacting the PTM of the invention with a target pre-mRNA under conditions such that a portion of the PTM is trans-spliced to a portion of the target pre-mRNA to form a novel chimeric RNA molecule. . The methods and compositions of the present invention can be used for the treatment of proliferative diseases such as cancer, or cellular gene regulation, gene repair and suicide gene therapy for the treatment of genetic, autoimmune or infectious diseases. The methods and compositions of the invention can also be used to generate new nucleic acid molecules in plants by targeted spliceosome trans-splicing. For example, targeted trans-splicing can be used to regulate gene expression in plants for treatment of plant diseases, genetic manipulation of disease resistant plants, or expression of desired genes in plants. The methods and compositions of the present invention can also be used to map intron / exon boundaries and to identify novel proteins expressed in any cell.

2. Background of the Invention The DNA sequence of a chromosome contains a coding region (exon) and is usually transcribed into a pre-mRNA containing an intervening non-coding region (intron). Introns are removed from pre-mRNA by a precise process called splicing (Chow et al., 1977, Cell 12: 1-8; and Berget, SM et al., 1977, Proc. Natl. Acad. Sci. USA 74: 3171-3175) . Splicing occurs as a coordinated interaction of several small ribonucleoproteins (snRNPs) and many protein factors that assemble into an enzyme complex known as the spliceosome (Moore et al., 1993, The RNA World, RF Gestland and JF Atkins (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY); Kramer, 1996, Annu. Rev. Biochem., 65: 367-404; Staley and Guthrie, 1998, Cell 92: 315- 326).

Pre-mRNA splicing proceeds by a two-step mechanism. In the first step, the 5 ′ splice site is cleaved to yield a “free” 5 ′ exon and a noose intermediate (Moore, MJ and PA Sharp, 1993, Nature 365: 364-368). In the second step, the 5 ′ exon is linked to the 3 ′ exon, and the intron as a noose product is released accordingly. These steps are catalyzed by a complex of small nuclear ribonucleoproteins and proteins called spliceosomes. These splicing reaction sites are defined by a consensus sequence around the 5 ′ and 3 ′ splice sites. The 5 ′ splice site consensus sequence is AG / GURAGU (where A = adenosine, U = uracil, G = guanine, C = cytosine, R = purine, / = splice site). The 3 ′ splice region consists of three separate sequence elements: a branch point or branch site, a polypyrimidine tract and a 3 ′ splice consensus sequence (YAG). These elements roughly define a 3 ′ splice region, which can contain a 100 nucleotide intron upstream of the 3 ′ splice site. The mammalian branching point consensus sequence is YNYUR A C (where N = any nucleotide, Y = pyrimidine). Underlined A is a branch formation site (BPA = branch point adenosine). The 3 ′ splice consensus sequence is YAG / G. A polypyrimidine tract is usually found between the branch point and the splice site, which is critical for effective branch point utilization and 3 'splice site recognition in mammalian systems (Roscigno, RF et al., 1993). , J. Biol. Chem .. 268: 11222-11229). The first YAG trinucleotide downstream of the branch point and polypyrimidine tract is the most commonly used 3 'splice site (Smith, CW et al., 1989, Nature 342: 243-247).

  In most cases, the splicing reaction occurs within the same pre-mRNA molecule, which is called cis-splicing. Splicing between two independently transcribed pre-mRNAs is called trans-splicing. Trans-splicing was first discovered in trypanosomes (Sutton & Boothroyd, 1986, Cell 47: 527; Murphy et al., 1986, Cell 47: 517), followed by nematodes (Krause & Hirsh, 1987, Cell 49: 753); (Rajkovic et al., 1990, Proc. Natl. Acad. Sci. USA, 87: 8879; Davis et al., 1995, J. Biol. Chem. 270: 21813) and plant mitochondria (Malek et al., 1997, Proc. Natl. Acad Sci. USA 94: 553). In the parasite Trypanosoma brucei, all mRNAs acquire a splice leader (SL) RNA at their 5 'end by trans-splicing. Caenorhabditis elegans also trans-splices the 5 'leader sequence in several genes. This mechanism is suitable for adding a single consensus sequence to many different transcripts.

  The trans-splicing mechanism is almost the same as the conventional cis-splicing mechanism and occurs by two phosphoryl transfer reactions. First, a 2'-5 'phosphodiester bond is formed, resulting in an intermediate having a "Y" -shaped branch that is equivalent to a noose intermediate in the case of cis-splicing. The second reaction, exon ligation, occurs in the same way as conventional cis-splicing. Also, the sequence of the 3 'splice site and some of the snRNPs that catalyze the trans-splicing reaction are very similar to their counterparts involved in cis-splicing.

  Trans-splicing may also refer to a different process in which an intron of one pre-mRNA interacts with an intron of another pre-mRNA to promote recombination of the splice site between two normal pre-mRNAs. is there. This type of trans-splicing was hypothesized to account for transcripts encoding human immunoglobulin variable region sequences linked to endogenous constant regions in transgenic mice (Shimizu et al., 1989, Proc. Natl. Acad. Sci. USA 86: 8020). Furthermore, trans-splicing of c-myb pre-RNA has been demonstrated (Vellard, M. et al., Proc. Natl. Acad. Sci., 1992 89: 2511-2515), and more recently in cultured cells and nuclear extracts. In addition, RNA transcripts from cloned SV40 that were trans-spliced together were detected (Eul et al., 1995, EMBO. J. 14: 3226). However, naturally occurring trans-splicing of mammalian pre-mRNA is considered extremely rare.

  Several groups have used in vitro trans-splicing as a model system to investigate splicing mechanisms (Konarska & Sharp, 1985, Cell 46: 165-171; Solnick, 1985, Cell 42: 157; Chiara & Reed, 1995, Nature 375: 510; Pasman and Garcia-Blanco, 1996, Nucleic Acids Res. 24: 1638). While fairly efficient trans-splicing (30% of cis-spliced analogs) was achieved between RNAs that could base pair with each other, splicing of RNAs that were not linked by base pairing was further 10 times lower. Other in vitro trans-splicing reactions that do not require clear RNA-RNA interactions between substrates are Chiara & Reed (1995, Nature 375: 510), Bruzik JP & Maniatis, T. (1992, Nature 360: 692) And by Bruzik JP and Maniatis, T. (1995, Proc. Nat'l. Acad. Sci. USA 92: 7056-7059). These reactions occur only relatively infrequently and require special elements such as downstream 5 'splice sites or exon splicing enhancers.

  In addition to the splicing mechanism involving the binding of multiple proteins to the precursor mRNA, which serves to correctly cleave and link RNA, the third mechanism includes RNA cleavage and ligation by the intron itself, which is catalytic RNA Called a molecule or ribozyme. This ribozyme cleavage activity is targeted to specific RNAs by incorporating another “hybridization” region into the ribozyme. When hybridized with the target RNA, this ribozyme cleavage catalytic region cleaves the target. Such ribozyme activity has been suggested to be useful for inactivation or cleavage of target RNA in vivo, such as in the treatment of human diseases characterized by the production of foreign or abnormal RNA. The use of antisense RNA has also been proposed as another mechanism for targeting and destroying specific RNAs. In such an example, a small RNA molecule is designed to hybridize with a target RNA and prevent translation of the target RNA by binding to the target RNA, or to cause RNA destruction by nuclease activation.

  Until recently, practical applications of targeted trans-splicing to modify specific target genes were limited to mechanisms based on group 1 ribozymes. Targeted trans-splicing with Tetrahymena Group 1 ribozymes has been described in E. coli (Sullenger BA and Cech. TR, 1994, Nature 341: 619-622), mouse fibroblasts (Jones, JT et al., 1996, Nature Medicine 2: 643-648), human fibroblasts (Phylacton, LA et al., Nature Genetics 18: 378-381) and human erythrocyte precursors (Lap et al., 1998, Science 280: 1593-1596) ing. Although many uses of targeted RNA trans-splicing caused by modified group 1 ribozymes have been investigated, the natural mammalian splicing mechanism, splicosome-mediated target trans-splicing, has not been reported so far.

3. SUMMARY OF THE INVENTION The present invention relates to compositions and methods for making novel nucleic acid molecules via spliceosome-mediated targeted trans-splicing. The composition of the present invention is a spliceosome trans-splicing that interacts with a natural target pre-mRNA molecule (hereinafter referred to as “pre-mRNA”) and results in the formation of a novel chimeric RNA molecule (hereinafter referred to as “chimeric RNA”). Contains a pre-trans-splicing molecule (hereinafter “PTM”) designed to mediate the reaction. The method of the invention comprises contacting the PTM of the invention with a natural target pre-mRNA under conditions such that a portion of the PTM is spliced to the natural pre-mRNA to form a novel chimeric RNA. The PTM of the present invention is a novel chimeric RNA generated from a trans-splicing reaction itself, which performs a certain function such as inhibiting RNA translation, or is a protein in which the chimeric RNA is defective or inactive in the cell. Is engineered to encode a protein that complements or a toxin that kills certain cells. In general, the target pre-mRNA is selected because it is expressed in a particular cell type, thereby providing a means for targeting the expression of the novel chimeric RNA to the selected cell type. Target cells include, but are not limited to, cells infected with viruses or other infectious pathogens, benign or malignant neoplasms, or components of the immune system involved in autoimmune disease or tissue rejection. The PTMs of the present invention can also be used to correct genetic mutations known to be involved in genetic diseases. In particular, a double trans-splicing reaction can be used to replace an internal exon. The PTMs of the present invention can also be engineered to tag the exon sequences of mRNA molecules as a way to identify intron / exon boundaries in the target pre-mRNA. The present invention further relates to the use of PTM molecules that are genetically engineered to encode peptide affinity purification tags for use in purifying and identifying proteins expressed in specific cell types. The methods and compositions of the present invention can be used for gene regulation, gene repair and targeted cell death. Such methods and compositions can be used to treat, but are not limited to, genetic diseases, infectious or autoimmune diseases, and proliferative diseases such as cancer and regulation of gene expression in plants.

5. Detailed Description of the Invention The present invention relates to compositions comprising pre-trans-splicing molecules (PTMs) and the use of such molecules to make new nucleic acid molecules. The PTMs of the invention comprise one or more target binding domains designed to specifically bind to pre-mRNA; 3 ′ containing branch points, pyrimidine tracts, and 3 ′ splice acceptor and / or 5 ′ splice donor sites A splice region; and one or more spacer regions that separate the RNA splice site from the target binding domain. The PTMs of the present invention can also be engineered to contain any nucleotide sequence, such as that encoding a translatable protein product.

  The method of the invention comprises contacting the PTM of the invention with a natural pre-mRNA under conditions such that a portion of the PTM is trans-spliced into a portion of the natural pre-mRNA to produce a new chimeric RNA. The target pre-mRNA is selected as the target because it is expressed in a particular cell type and thus provides a mechanism for targeting the expression of the new RNA to the selected cell type. The resulting chimeric RNA may provide the desired function in a particular cell type or produce a gene product. Specific cells include, but are not limited to, those infected with viruses or other infectious pathogens, benign or malignant neoplasms, or components of the immune system involved in autoimmune disease or tissue rejection. Specificity is achieved by modifying the binding domain of PTM to bind to the target endogenous pre-mRNA. The gene product encoded by the chimeric RNA may be any gene including clinically useful genes such as, for example, therapeutic or marker genes and genes encoding toxins.

5.1. Structure of Pre-trans-Splicing Molecules The present invention provides compositions used to create new chimeric nucleic acid molecules by targeted trans-splicing. The PTMs of the invention comprise (i) one or more target binding domains that target PTM binding to pre-mRNA, (ii) branch points, pyrimidine tracts, and 3 ′ splice acceptor and / or 5 ′ splice donor sites 3 A splice region; and (iii) one or more spacer regions that separate the RNA splice site from the target binding domain. The PTM can also be engineered to include any nucleotide sequence encoding a translatable protein product. In yet another embodiment of the invention, the PTM can be engineered to include a nucleotide sequence that inhibits translation of the chimeric RNA molecule. For example, the nucleotide sequence may include a nucleotide sequence that inhibits translation by forming a translation stop codon or secondary structure. Alternatively, the chimeric RNA may act as an antisense molecule, thereby inhibiting translation of the RNA to which it binds.

  The target binding domain of the PTM may comprise a plurality of binding domains that are complementary to the targeting region of the selected pre-mRNA and that are in an antisense orientation. As used herein, a target binding domain is any one that provides binding specificity and tethers pre-mRNA in close proximity so that the nuclear spliceosome processing machinery can trans-splice part of the PTM into part of the pre-mRNA. Is defined as an array of These target binding domains can contain up to several thousand nucleotides. In preferred embodiments of the invention, these binding domains may comprise at least 10-30, up to several hundred nucleotides. As shown herein, the specificity of PTM can be significantly increased by increasing the length of the target binding domain. For example, the target binding domain may comprise hundreds or more nucleotides. Furthermore, the target binding domain may be “linear”, but the RNA is folded to form a secondary structure that can stabilize the complex and thereby increase splicing efficiency. Is also considered good. The second target binding region may be located at the 3 'end of the molecule and can be incorporated into the PTMs of the invention. Absolute complementarity is preferred but not necessary. As used herein, a sequence that is “complementary” to a portion of RNA means a sequence that has sufficient complementarity to hybridize with the RNA to form a stable duplex. Hybridization ability may depend on both the degree of complementarity and the length of the nucleic acid (e.g. Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York reference). In general, the longer the nucleic acid that hybridizes, the more bases that mispair with RNA and still form a stable duplex. One skilled in the art can ascertain the tolerance of duplex mismatch or length by examining the stability of the hybridized hybrid using standard methods.

  When PTM is designed to be used for intron-exon tagging or peptide affinity tagging, the PTM library is engineered to include random nucleotide sequences in the target binding domain. Alternatively, PTMs may be genetically engineered to lack a target binding domain for intron-exon tagging. The goal in creating such a PTM molecule library is that the library contains a population of PTM molecules that can bind to each RNA molecule expressed in the cell. Recombinant expression vectors can be engineered to contain a PTM coding region that includes a restriction endonuclease site that can be used to insert random DNA fragments into the PTM to form a random target binding domain. The random nucleotide sequence to be included in the PTM as a target binding domain includes, but is not limited to, a variety of well known to those skilled in the art, including DNA partial digestion with restriction enzymes, or DNA physical shearing to generate random fragments of DNA. Can be created using different methods. Random binding domain regions can also be created by degenerate oligonucleotide synthesis. These degenerate oligonucleotides have restriction endonuclease recognition sites at each end for the creation of PTM molecule libraries with degenerate binding domains that can be manipulated to facilitate cloning into PTM molecules. it can.

  In addition, the binding may involve other mechanisms, such as triple helix formation, or protein / nucleic acid interactions, such as those in which the PTM is engineered to recognize a specific RNA binding protein, ie, a protein that binds to a specific target pre-mRNA. Can also be achieved. Alternatively, the PTMs of the present invention may be designed to recognize secondary structures such as hairpin structures generated by intramolecular base pairing between nucleotides in RNA molecules.

The PTM molecule also includes a 3 ′ splice region that includes a branch point, a pyrimidine tract and a 3 ′ splice acceptor AG site and / or a 5 ′ splice donor site. Common sequences for 5 'splice donor sites and 3' splice regions used for RNA splicing are well known in the art (see Moore et al., 1993, The RNA World, Cold Spring Harbor Laboratory Press, p. 303-358). . Furthermore, modified consensus sequences that maintain the ability to function as 5 ′ donor splice sites and 3 ′ splice regions may be used in the practice of the invention. In short, the 5 ′ splice site consensus sequence is AG / GURAGU (where A = adenosine, U = uracil, G = guanine, C = cytosine, R = purine and / = splice site). The 3 ′ splice site consists of three different sequence elements: a branch point or branch site, a polypyrimidine tract and a 3 ′ consensus sequence (YAG). The consensus sequence for mammalian branching points is YNYUR A C (Y = pyrimidine). Underlined A is a branch formation site. The polypyrimidine tract is located between the branch point and the splice site acceptor and is important for various branch point utilization and 3 'splice site recognition.

  In addition, a PTM comprising a 3 ′ receptor site (AG) can be genetically engineered. Such PTMs may further comprise pyrimidine tract and / or branch point sequences.

  Recently, a premessenger RNA intron that begins with dinucleotide AU and ends with dinucleotide AC has been identified and is referred to as the U12 intron. Any sequence that functions as a U12 intron sequence as well as a splice acceptor / donor sequence may be used in the PTM.

  A spacer region that separates the RNA splice site from the target binding domain may also be included in the PTM. This spacer region may have features such as a stop codon that blocks translation of the non-spliced PTM and / or a sequence that facilitates trans-splicing into the target pre-mRNA.

  In a preferred embodiment of the invention, “safety” is incorporated in the spacer, binding domain, or elsewhere in the PTM to prevent non-specific trans-splicing. This is a region of PTM that covers elements of the 3 'and / or 5' splice sites of PTM with relatively weak complementarity and prevents non-specific trans-splicing. The PTM is designed to be fully active without covering the 3 'and / or 5' splice sites upon hybridization of the binding / targeting portion of the PTM.

  “Safety” consists of a complementary stretch of one or more cis sequences that bind weakly to one or both sides of a PTM branch point, pyrimidine tract, 3 ′ splice site and / or 5 ′ splice site (splicing element) (or Can be two separate nucleic acid strands) or can be associated with a part of the splicing element itself. This “safety” binding prevents the splicing element from becoming active (ie, prevents U2 snRNP and other splicing factors from binding to the PTM splice site recognition element). This “safety” binding can be inhibited by exposing the target binding region of the PTM to the target pre-mRNA and activating the PTM splicing elements (making them more likely to be spliced into the target pre-mRNA).

  The PTM of the present invention includes a translatable protein that can bring about an effect such as cell death, or a nucleotide sequence encoding a substance that restores a deficient function or action as a marker. For example, the nucleotide sequence can include a sequence that encodes a gene product that is defective or mutated in a known genetic disease. Alternatively, the nucleotide sequence can encode a marker protein or peptide that can be used to identify or image cells. In yet another embodiment of the invention, the PTM molecule used for affinity purification includes an HIS tag (six consecutive histidine residues) (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88: 8972-8976 ), C-terminus of glutathione-S-transferase (GST) (Smith and Johnson, 1986, Proc. Natl. Acad. Sci. USA 83: 8703-8707) (Pharmacia) or FLAG (Asp-Tyr-Lys-Asp-Asp A nucleotide sequence encoding an affinity tag such as -Asp-Lys) (Eastman Kodak / IBI, Rochester, NY) may be included. Using a PTM containing such a nucleotide sequence produces a chimeric RNA that encodes a fusion protein comprising a peptide sequence normally expressed in cells conjugated with a peptide affinity tag. This affinity tag provides a method for rapid purification and identification of peptide sequences expressed in cells. In a preferred embodiment, the nucleotide sequence may encode a toxin or other protein that provides some function that increases the sensitivity of the cell to subsequent treatments such as irradiation or chemotherapy.

  In a highly preferred embodiment of the invention, the PTM molecule is designed to include a nucleotide sequence encoding diphtheria toxin subunit A (Greenfield, L. et al., 1983, Proc. Natl. Acad. Sci. USA 80: 6853- 6857). Diphtheria toxin subunit A contains enzyme toxin activity and serves to cause cell death when expressed or delivered in human cells. Furthermore, in the present invention, various known peptide toxins such as Pseudomonas toxin, Shiga toxin and exotoxin A may be used, although not limited thereto.

  Additional features either before or after the PTM molecule (eg, to regulate polyadenylation signals or 5 'splice sequences to promote splicing, additional binding regions, "safety" self-complementary regions, additional splice sites, or molecular stability A nucleotide sequence encoding a translatable protein having a protecting group to prevent degradation, etc.).

  Additional features that can be incorporated into the PTMs of the invention include stop codons or other elements in the region between the binding domain and the splice site to prevent expression of the non-spliced pre-mRNA. In another embodiment of the invention, the PTM blocks binding to the original cis 5 'splice site (U5 and / or U1 binding site) to facilitate binding to the 3' target intron or exon. To do so, it can be generated with a second antisense binding domain downstream from the nucleotide sequence encoding the translatable protein.

  Also, PTMs that require a double trans-splicing reaction for the production of chimeric trans-splicing products can be generated. Such PTMs can be used to replace internal exons that can be used to repair RNA. PTMs designed to facilitate two trans-splicing reactions are made as described above, but they contain both a 5 'donor site and a 3' splice acceptor site. In addition, the PTM may contain more than one binding domain and splicer region. These splicer regions may be substituted between multiple binding domains and splice sites, or alternatively between multiple binding domains.

  Additional elements such as 3 'hairpin structures, cyclized RNA, nucleotide base modifications, or synthetic analogs can be incorporated into the PTM to promote or assist nuclear localization and spliceosome integration, as well as intracellular stability .

  Furthermore, when designing a PTM for use in plant cells, it is not necessary to include a conserved branch point sequence or polypyrimidine tract because it is not necessarily an essential sequence for intron processing in plants. However, 3 'splice acceptor and / or 5' splice donor sites are included, such as those required for vertebrate and yeast splicing. Furthermore, splicing efficiency in plants can be increased by including UA-rich intron sequences. One skilled in the art will appreciate that any sequence that can mediate a trans-splicing reaction in plants may be used.

  The PTM of the present invention can be used in a method designed to produce a novel chimeric RNA in a target cell. The method of the invention may be in any form used by those skilled in the art, such as, for example, an RNA molecule, or a DNA vector transcribed into an RNA molecule, comprising delivering a PTM to a target cell, PTM binds to the pre-mRNA and mediates a trans-splicing reaction that results in the formation of a chimeric RNA comprising a portion of the PTM molecule that is spliced into a portion of the pre-mRNA.

5.2. Synthesis of trans-splicing molecules The nucleic acid molecules of the invention can be RNA or DNA or derivatives or modified versions thereof, single-stranded or double-stranded. A nucleic acid encodes a PTM molecule or PTM molecule, whether it consists of deoxyribonucleotides, ribonucleosides, phosphodiester bonds, or modified bonds. Means nucleic acid molecule. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically found bases (adenine, guanine, thymine, cytosine and uracil).

  The RNA and DNA molecules of the present invention can be prepared by any method known in the art for the synthesis of DNA and RNA molecules. For example, nucleic acids may be chemically synthesized using commercially available reagents and synthesizers by methods well known to those skilled in the art (eg, Gait, 1985, Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford, England). Alternatively, RNA molecules can be made by in vitro and in vivo transcription of DNA sequences encoding RNA molecules. Such DNA sequences can be incorporated into a variety of vectors incorporating an appropriate RNA polymerase promoter, such as a T7 or SP6 polymerase promoter. RNA can be produced in high yield via in vitro transcription using plasmids such as SPS65 (Promega Corporation, Madison, Wis.). Furthermore, RNA can be produced using RNA amplification methods such as Q-β amplification.

  Nucleic acid molecules can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve molecular stability, hybridization, transport to cells, and the like. For example, modifying the PTM to reduce the overall charge can improve the uptake of molecules into the cell. Furthermore, modifications can be made that reduce sensitivity to nuclease degradation. Nucleic acid molecules can be peptides (eg, for targeting host cell receptors in vivo) or cell membranes (eg, Letsinger et al., 1989, Proc. Natl. Acad. Sci. USA 86: 6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84: 648-652; see PCT publication W088 / 09810 published December 15, 1988) or blood brain barrier (eg PCT publication W089 / 10134 published April 25, 1988) Agents that aid in transport across, hybridization-induced cleavage agents (see, for example, Krol et al., 1988, BioTechniques 6: 958-976) or intercalating agents (see, for example, Zon, 1988, Pharm. Res. 5: 539- Other attachment groups such as 549) may also be included. For this purpose, the nucleic acid molecule may be conjugated to another molecule, such as a peptide, a hybridization-induced crosslinking agent, a transport agent, a hybridization-induced cleavage agent, and the like. Various other well-known modifications to the nucleic acid molecule can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences of ribo or deoxynucleotides to the 5 'and / or 3' ends of the molecule. In some circumstances where increased stability is desired, nucleic acids having modified intranucleoside linkages such as 2'-O-methylation may be preferred. Nucleic acids containing modified intranucleoside linkages can be synthesized using reagents and methods well known to those skilled in the art (Uhlmann et al., 1990, Chem. Rev. 90: 543-584; Schneider et al., 1990, Tetrahedron Lett. 31: 335 and references cited therein).

  The nucleic acid can be purified by any suitable means as is well known in the art. For example, the nucleic acid can be purified by reverse phase chromatography or gel electrophoresis. Of course, those skilled in the art will appreciate that the purification method will vary somewhat depending on the size of the nucleic acid to be purified.

  When a nucleic acid molecule encoding PTM is used, cloning techniques known in the art can be used for cloning the nucleic acid molecule into an expression vector. Methods of recombinant DNA technology commonly known in the art that can be used are described in Ausubel et al. (Eds.), 1993, Current Protocols in Molecular Biology, John Wiley & Sons, NY; and Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY.

  The DNA encoding the PTM of interest can be engineered into a variety of host vector systems that provide large scale replication of the DNA and also contain the essential elements that direct the transcription of the PTM. The use of such constructs to transfect patient target cells forms complementary base pairs with endogenously expressed pre-mRNA targets, thereby transducing splicing reactions between complexed nucleic acid molecules. A sufficient amount of PTM transcription occurs to facilitate. For example, a vector can be introduced in vivo such that it can be taken up by a cell and direct the transcription of a PTM molecule. Such a vector may be maintained as an episome or integrated into a chromosome as long as it is transcribed to produce the target RNA. Such vectors can be constructed by recombinant DNA techniques standard in the art.

  The vector encoding the PTM of interest may be a plasmid, virus, or other known in the art for use in replication and expression in mammalian cells. Expression of sequences encoding PTMs can be regulated by any promoter known in the art for functioning in mammalian, preferably human cells. Such promoters may be inducible or constitutive. Such promoters include, but are not limited to, the SV40 early promoter region (Benoist, C. and Chambon, P. 1981, Nature 290: 304-310), included in the 3 'long terminal repeat of Rous sarcoma virus. Promoter (Yamamoto et al., 1980, Cell 22: 787-797), herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. USA 78: 1441-1445), regulatory sequences of the metallothionein gene (Brinster et al. 1982, Nature 296: 39-42), CMV virus promoter, human serosa gonadotropin-β promoter (Hollenberg et al., 1994, Mol. Cell. Endocrinology 106: 111-119) and the like. Any type of plasmid, cosmid, YAC or viral vector can be used to create a recombinant DNA construct that can be introduced directly into a tissue site. Alternatively, a viral vector that selectively infects a desired target cell can be used.

  For the use of PTMs encoding peptide affinity purification tags, it is desirable to insert nucleotide sequences containing random target binding sites into the PTM and clone them into selectable mammalian expression vector systems. Several options, including but not limited to selection for expression of herpes simplex virus thymidine kinase, hypoxanthine-guanine phosphoribosyltransferase and adenine phosphoribosyltransferase proteins in tk-, hgprt-, and aprt-deficient cells, respectively A system can be used. Also confers resistance to dihydrofolate transferase (dhfr) conferring resistance to methotrexate, xanthine-guanine phosphoribosyltransferase (gpt) conferring resistance to mycophenolic acid, neomycin (neo) conferring resistance to aminoglycoside G-418, and hygromycin resistance Anti-metabolite resistance based on selection for hygromycin B phosphotransferase (hygro) can be used. In a preferred embodiment of the invention, cultured cells are transformed with a low rate of vector to cells so that there is only one vector or a limited number of vectors in any cell. Vectors used in the practice of the present invention include, but are not limited to, any eukaryotic expression vector including viral expression vectors such as those derived from retrovirus or adeno-associated virus species.

5.3. Use and administration of trans-splicing molecules
5.3.1 Use of PTM molecules for gene regulation, gene repair and targeted cell death The compositions and methods of the present invention have a variety of different uses including gene regulation, gene repair, and targeted cell death. For example, trans-splicing can be used to introduce toxic proteins into cells. Furthermore, PTMs can be engineered to bind to viral mRNA and destroy viral mRNA function, or to destroy any cell that expresses viral mRNA. In yet another embodiment of the invention, the PTM can be engineered to place a stop codon in the detrimental mRNA transcript, thereby reducing the expression of the transcript.

  In one embodiment of the invention, the PTM molecule was designed to bind to papillomavirus RNA and inhibit viral RNA function. Specifically, anti-HPV PTM was designed to specifically target HPV pre-mRNA and result in expression of proteins that are only inhibitory or toxic in HPV-infected cancer cells. Thus, the present invention provides a PTM molecule designed to inhibit the function of papillomavirus RNA. Such papillomaviruses include, but are not limited to, mammalian papillomaviruses including human papillomaviruses.

  Papillomaviruses are a group of small DNA viruses that cause papillomas (warts) in various vertebrates including humans. Furthermore, human papillomavirus is one of the most common causes of sexually transmitted diseases in Japan, and most cervical cancers are related to oncogenic human papillomavirus and express viral mRNAs encoding E6 and E7 oncoproteins To do. Thus, the PTM molecules of the present invention can be used to inhibit the growth of papillomavirus in an infected host.

  Targeted trans-splicing, including double trans-splicing reactions, 3 ′ exon substitutions and / or 5 ′ exon substitutions, can be used to repair or correct transcripts containing truncated or point mutations. The PTMs of the present invention are via a trans-splicing reaction that cleaves the target transcript upstream or downstream of a particular mutation, or upstream of the immature 3 ', and replaces the portion of the transcript containing the mutation with a functional sequence. Designed to correct mutant transcripts.

  Furthermore, a double trans-splicing reaction may be used for selective expression of toxins in tumor cells. For example, PTM can be designed to replace the second exon of the human β-serosa gonadotropin-6 (βhCG6) gene transcript and deliver an exon encoding diphtheria toxin subunit A (DT-A). it can. Expression of DT-A in the absence of subunit B should be toxic only in cells that express the DT-A gene. βhCG6 is a prototypical target for genetic modification by trans-splicing. The sequence and structure of the βhCG6 gene is completely known and the pattern of splicing has been determined. The βhCG6 gene is highly expressed in many types of solid tumors, including many non-germline tumors, but the βhCG6 gene is silent in most normal adult cells. Thus, βhCG6 pre-mRNA is a desirable target for trans-splicing reactions designed to provide tumor-specific toxicity.

  The first exon of the βhCG6 pre-mRNA contains the initiation codon AUG so that it provides the necessary signal for efficient translation of the trans-spliced mRNA and causes minimal interference by proper folding of the DT-A toxin Ideally it encodes only 5 amino acids. A DT-A exon designed to contain a stop codon that prevents the formation of the chimeric protein is engineered to be trans-spliced to the last exon of the βhCG6 gene. The last exon of the βhCG6 gene provides a construct with the appropriate signal to polyadenylate the mRNA and ensure translation.

  Cystic fibrosis (CF) is one of the most common lethal genetic diseases in humans. Based on both genetic and molecular analysis, a gene associated with cystic fibrosis has been isolated and its protein product estimated (Kerem, BS et al., 1989, Science 245: 1073-1080; Riordan et al., 1989 Science 245: 1066-1073; Rommans et al., 1989, Science 245: 1059-1065). The protein product of the CF-related gene is called cystic fibrosis transmembrane regulatory protein (CFTR). In certain embodiments of the invention, the trans-splicing reaction is used to correct a genetic defect in a DNA sequence encoding a cystic fibrosis transmembrane regulatory protein (CFTR), thereby causing the cystic fibrosis transmembrane regulatory protein to The encoding DNA sequence is expressed and functional chloride channels are formed in the patient's airway epithelial cells.

  Population studies have shown that the most common cystic fibrosis mutation is a three nucleotide deletion in exon 10, which encodes the CFTR amino acid sequence at position 508 phenylalanine. As shown in FIG. 15, the trans-splicing reaction was able to correct the deletion at position 508 of the CFTR amino acid sequence. The PTM used to correct the gene deletion contained the CFTR BD intron 9 sequence, spacer sequence, branch point, polypyrimidine tract, 3 'splice site and wild type CFTR BD exon 10 sequence (Figure 13). The successful modification of mutant DNA encoding CFTR using a trans-splicing reaction supports the general application of PTMs for correcting gene defects.

  Hemophilia A is an X-linked hemorrhage disorder characterized by a deficiency in the activity of factor VIII, an important component of the coagulation cascade. The prevalence of hemophilia A is approximately 1 in 5,000 to 10,000 men. Affected individuals suffer from joint and muscle bleeding, are easy to bruise, and have prolonged bleeding from the wound. Hemophilia A results from various mutations in the factor VIII gene. This gene consists of 26 exons and spans 186 kb. About 95% of hemophilia A patients with identified mutations have point mutations in the gene. In certain embodiments of the invention, a trans-splicing reaction is used to correct a genetic defect in the DNA sequence encoding factor VIII, whereby the DNA sequence encoding factor VIII protein is expressed and functional in the patient's plasma. A clotting factor is formed. The PTMs of the present invention can be engineered to repair any exon or combination of exons of interest for the purpose of correcting a defect in the coding region of the factor VIII gene.

  Genetic studies have shown that the most common factor VIII mutations occur. As shown in FIG. 46, the trans-splicing reaction was able to correct mutations in the Factor VIII amino acid sequence. Mutations were made by inserting the neomycin gene between exon 16 and intron 16 of the mouse gene, interrupting the exon 16 open reading frame, and removing the 3 'splice donor site of intron 16. The PTM used to correct the gene defect contained a Factor VIII exon 16-24 coding sequence, a spacer sequence, a branch point, a polypyrimidine tract, and a 3 ′ receptor splice (FIG. 44A). The successful modification of mutant DNA encoding factor VIII using a trans-splicing reaction further supports the general application of PTMs for correcting gene defects.

  The methods and compositions of the invention can also be used to regulate gene expression in plants. For example, trans-splicing may be used to place the expression of any engineered gene under the original regulation of the selected target plant gene, thereby regulating the expression of the engineered gene. Truss splicing can also be used to prevent the expression of engineered genes in non-host plants or to convert endogenous gene products into more desirable products.

  In certain embodiments of the invention, trans-splicing can also be used to regulate the expression of insecticidal genes that produce Bt toxins (Bacillus thuringiensis). For example, a PTM can be designed so that it is trans-spliced into an injury response gene (pre-mRNA) that is expressed only after an insect damages a plant. In this way, all plant cells have the Bt gene in the PTM, but these cells produce Bt only where the insects injured the plant. The rest of the plant makes little or no Bt. PTM can trans-splice the Bt gene into any selected gene with the desired expression pattern. In addition, it should be possible to target PTM so that edible parts of the plant do not produce Bt.

  One advantage of using PTM is that the time and effort spent identifying and reconfiguring the appropriate regulatory sequences upstream of the engineered gene, because PTM has acquired the original gene control element of the target gene. Is reduced. Thus, expression of genes regulated by PTM should occur only in plant cells containing the target pre-mRNA. Because consumers do not want to eat proteins made from recombinant genes, trans-splicing can alleviate resistance to genetically modified plants by targeting genes that are not expressed in the edible part of the plant or pollen. The edible part of such crops needs to be tested for the absence of genetically modified proteins.

  PTM can also be targeted to host cell-specific sequences that do not exist in other plants. Therefore, even if the gene (DNA) encoding PTM jumps to other plant species, the PTM gene does not have an appropriate target for trans-splicing. Thus, trans-splicing provides a “fail-safe” mode that prevents the gene from “jumping” to other plant species, and the PTM gene can be found in engineered plant hosts containing the appropriate target pre-mRNA. Only expressed. It cannot be expressed in plants that have not been manipulated.

  Trans-splicing also provides a more efficient pathway for converting one gene product into another. For example, trans-splicing ribozymes and chimeric oligos can be incorporated into the corn genome to modify the ratio of saturated and unsaturated oils. Trans-splicing can also be used to convert one gene product to another.

  For example, encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the composition, receptor-mediated endocytosis (eg, Wu and Wu, 1987, J. Biol. Chem. 262: 4429 -4432), nucleic acid construction as part of retroviruses and other vectors, DNA injection, electroporation, calcium phosphate mediated transfection and various other delivery systems are known and compositions of the invention Can be used to introduce into a cell.

  These compositions and methods can be used to treat cancer and other serious viral infections, autoimmune diseases, and other medical conditions in which modification or removal of specific cell types is beneficial. These compositions and methods also provide genes encoding functional bioactive molecules to cells of patients with hereditary genetic disease whose expression of the defective or mutated gene product results in a normal phenotype. It can also be used.

  In a preferred embodiment, to promote PTM function, a nucleic acid comprising a sequence encoding PTM is administered by gene delivery and expression in a host cell. In this embodiment of the invention, the nucleic acid mediates the action by promoting PTM production. Any method of gene delivery to host cells available in the art can be used according to the present invention. For a review of gene delivery methods, see Strauss, M. and Barranger, JA, 1997, Concepts in Gene Therapy, by Walter de Gruyter & Co., Berlin; Goldspiel et al., 1993, Clinical Pharmacy 12: 488-505; Wu and Wu , 1991, Biotherapy 3: 87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 33: 573-596; Mulligan, 1993, Science 260: 926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62: 191-217; 1993, TIBTECH 11 (5): 155-215. An example method is described below.

  Delivery of the nucleic acid to the host cell can be direct (i.e., when the host is directly exposed to the nucleic acid or vector carrying the nucleic acid) or indirectly (i.e. Or after transplantation into a host). These two approaches are known as in vivo or ex vivo gene delivery, respectively.

  In certain embodiments, the nucleic acid is administered directly in vivo, where it is expressed to produce PTM. This can be done, for example, by constructing it as part of an appropriate nucleic acid expression vector and administering it to be intracellular, or by infection with, for example, defective or attenuated retroviruses (US Pat. No. 4,980,286). Or by direct injection of naked DNA, or by the use of microparticle bombardment (e.g., gene guns; Biolistic, Dupont), or coating with lipids or cell surface receptors or transfection agents, or liposomes, Administer by encapsulating in microparticles or microcapsules, or by binding to a peptide known to enter the nucleus, or by binding to a ligand that undergoes receptor-mediated endocytosis ( For example, Wu and Wu, 1987 , J. Biol. Chem. 262: 4429-4432) and any of a number of methods known in the art.

  In certain embodiments, viral vectors containing PTM can be used. For example, retroviral vectors modified to delete retroviral sequences that are not necessary for packaging of the viral genome and integration into host cell DNA can be used (Miller et al., 1993, Meth. Enzymol. 217: 581- 599). Alternatively, adenovirus or adeno-associated virus vectors can be used for gene delivery to cells or tissues (for review of adenovirus-based gene delivery, see Kozarsky and Wilson, 1993, Current Opinion in Genetics and Development 3: 499-503).

  Another approach to gene delivery into cells involves introducing genes into tissue culture cells by methods such as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection. Usually, the introduction method involves the introduction of a selectable marker into the cells. These cells are then placed under selection to isolate those cells that have taken up and are expressing the transgene. The resulting recombinant cells can be delivered to the host by various methods known in the art. In preferred embodiments, the cells used for gene delivery are those of the host cell itself.

  The present invention also provides a pharmaceutical composition comprising an effective amount of PTM or a nucleic acid encoding PTM and a pharmaceutically acceptable carrier. In certain embodiments, “pharmaceutically acceptable” refers to a pharmacy that is approved by a federal or state government regulatory agency or that is commonly used for the United States Pharmacopeia or other animal, more preferably for humans. Means that it is listed. “Carrier” refers to a diluent, adjuvant, excipient or vehicle with which the therapeutic is administered. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E.W. Martin.

  In certain embodiments, the pharmaceutical composition is (1) endogenous in a host that lacks the protein, for example, is genetically defective, biologically inactive or poorly active, or is poorly expressed. Diseases or disorders where the protein or function is absent or low (compared to normal or desirable), or (2) the convenience of PTMs that inhibit the function of a particular protein by in vitro or in vivo assays. Is administered in a disease or disorder. The activity of the protein encoded by the chimeric mRNA resulting from the trans-splicing reaction mediated by the PTM is obtained, for example, from a host tissue sample (e.g., from a biopsy tissue) and in vitro mRNA or protein level, expressed in the expressed chimeric mRNA. It can be easily detected by assaying for structure and / or activity. Thus, but not limited to, an immunoassay that detects and / or visualizes the protein encoded by the chimeric mRNA (eg, Western blot, immunoprecipitation followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis, immune tissue) And / or hybridization assays that detect the formation of chimeric mRNA expression by detecting and / or visualizing the presence of the chimeric mRNA (e.g., Northern assay, dot blot, in situ hybridization and reverse transcription PCR, etc.) And many other methods standard in the art can be used.

  The present invention also provides a pharmaceutical composition comprising an effective amount of PTM or a nucleic acid encoding PTM and a pharmaceutically acceptable carrier. In certain embodiments, “pharmaceutically acceptable” refers to a pharmacy that is approved by a federal or state government regulatory agency or that is commonly used for the United States Pharmacopeia or other animal, more preferably for humans. Means that it is listed. “Carrier” refers to a diluent, adjuvant, excipient or vehicle with which the therapeutic is administered. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E.W. Martin. In certain embodiments, it may be desirable to administer the pharmaceutical composition of the invention locally to the area in need of treatment. This includes, but is not limited to, for example, local infusion during surgery, such as topical application in combination with post-surgical medicinal materials, injections, catheters, suppositories, or implants (implants are shear sialastic) of porous, non-porous, or gelatinous materials, including membranes such as membranes or fibers. There are other controlled release drug delivery systems such as nanoparticles, sustained release polymers, and matrix materials such as hydrogels.

  PTM is administered in an amount effective to produce the desired effect on the targeted cells. An effective dose of PTM can be determined by techniques well known to those skilled in the art focusing on parameters such as biological half-life, bioavailability and toxicity. The amount of the composition of the invention that is effective depends on the nature of the disease or disorder being treated and can be determined by standard clinical techniques. Furthermore, in vitro assays may be used as desired to help determine optimal dosage ranges.

  The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the pharmaceutical composition of the present invention, optionally with a container, such container being a pharmaceutical or It can be recognized in a form prescribed by government agencies that regulate the manufacture, use or sale of biological products, and this recognition reflects the approval of the government agency for manufacture, use or sale for administration in humans.

5.3.2 Use of PTM molecules for exon tagging Given the current efforts to sequence and characterize the genomes of humans and other organisms, methods are needed to facilitate such characterization. Most of the information currently available from genome mapping and sequencing comes from complementary DNA (cDNA) libraries generated by reverse transcription of mRNA into cDNA. Unfortunately, this process lacks information about intron sequences and exon / intron boundary locations.

  The invention comprises (i) contacting a pre-trans-splicing molecule and a pre-mRNA molecule under conditions such that a portion of the pre-trans-splicing molecule is trans-spliced to a target pre-mRNA to form a chimeric mRNA (ii) Amplifying the chimeric mRNA molecule, (iii) selectively purifying the amplified molecule, and (iv) determining the nucleotide sequence of the amplified molecule and thereby determining the intron-exon boundary. A method for mapping exon-intron boundaries of pre-mRNA molecules.

  In certain embodiments of the invention, PTMs can be used in trans-splicing reactions to locate exon-intron boundaries of pre-mRNA molecules. The PTM used for intron-exon boundary mapping has a structure similar to that in Section 5.1 above. Specifically, a PTM is a target binding domain designed to bind many pre-mRNAs, (ii) a 3 'splice region containing a branch point, pyrimidine tract and 3' splice acceptor site, or 5 'splice donor site, (iii) a spacer region that separates the mRNA splice site from the target binding domain, and (iv) a tag region that is trans-spliced into the pre-mRNA. Alternatively, the PTM used to locate the exon-intron boundary can be engineered to contain no target binding domain.

  For intron-exon mapping, the PTM is engineered to include a target binding domain containing a random nucleotide sequence. This random nucleotide sequence contains at least 15-30 up to several hundred nucleotide sequences that can bind to and anchor the pre-mRNA, so that the nuclear spliceosome processing machinery is part of the PTM (tag or marker). Region) can be trans-spliced into part of the pre-mRNA. PTMs containing short target binding domains or containing inosine bind to pre-mRNA molecules under non-stringent conditions. Furthermore, strong branch point sequences and pyrimidine tracts serve to enhance non-specificity of PTM trans-splicing.

  Random nucleotide sequences used as target binding domains in PTM molecules can be generated using a variety of different methods including, but not limited to, partial digestion of DNA with restriction endonucleases or physical shearing of DNA. Can do. The use of such random nucleotide sequences is designed to create a vast array of PTM molecules with different binding activities for each target pre-mRNA expressed in the cell. A random library of oligonucleotides can be synthesized using appropriate restriction endonuclease recognition sites at each end for cloning genetically engineered PTM molecules into plasmid vectors. When random oligonucleotides are ligated and expressed, a random PTM binding library is obtained.

  In certain embodiments of the invention, an expression library encoding a PTM molecule comprising a target binding domain comprising a random nucleotide sequence can be generated using a variety of methods well known to those skilled in the art. Ideally, this library is complex enough to contain PTM molecules that can interact with each target pre-mRNA expressed in the cell.

  By way of example, FIG. 9 is a schematic diagram of two forms of PTM that can be used to map intron-exon boundaries. The left PTM can be non-specifically spliced into the pre-mRNA 3 'splice site, while the right PTM can be trans-spliced into the pre-mRNA 5' splice site. The result of trans-splicing between the PTM and the target pre-mRNA results in the production of a chimeric mRNA molecule having a specific nucleotide sequence “tag” at either the 3 ′ or 5 ′ end of the original exon.

  After selective purification, a DNA sequencing reaction is performed using primers that begin within the tag nucleotide sequence of the PTM and proceed to the tagged exon sequence. The sequence immediately after the last nucleotide of this tag nucleotide sequence represents an exon boundary. For identification of intron-exon tags, the trans-splicing reaction of the present invention can be performed either in vitro or in vivo using methods well known to those skilled in the art.

5.3.3. Use of PTM molecules for the identification of proteins expressed in cells In yet another embodiment of the present invention, a trans-splicing reaction mediated by PTM is expressed in cells, previously detected. Can be used to identify unknown proteins that were not. This method is particularly difficult to detect by two-dimensional electrophoresis or other methods because of the small protein size, or low protein concentration, or because the two-dimensional electrophoresis shows a similar movement pattern to other proteins. It is particularly useful for identifying proteins that cannot be detected.

  The present invention relates to (i) a pretrans-splicing molecule and a pre-mRNA molecule containing a nucleotide sequence encoding a random target binding domain and a peptide tag, wherein a part of the pre-trans-splicing molecule is converted to a part of the target pre-mRNA. Contacting it under conditions such that it is trans-spliced to form a chimeric mRNA encoding the fusion polypeptide, or separating it by gel electrophoresis and (ii) affinity purifying the fusion polypeptide, and (iii) fusion It relates to a method of identifying a protein expressed in a cell comprising determining the amino acid sequence of the protein.

  In order to identify proteins expressed in cells, the PTMs of the present invention can be obtained from (i) a target binding domain comprising a randomized nucleotide sequence, (ii) a branch point, a pyrimidine tract and a 3 ′ splice acceptor site and / or Or genetic manipulation to include a 3 'splice region containing a 5' splice donor site, (iii) a spacer region that separates the PTM splice site from the target binding domain, and (iv) a nucleotide sequence encoding a marker or peptide affinity purification tag To do. Such peptide tags include, but are not limited to, HIS tag (6 histidine consecutive residues) (Janknecht et al., 1991 Proc. Natl. Acad. Sci. USA 88: 8972-8976), glutathione-S- Transferase (GST) (Smith, DB and Johnson, KS, 1988, Gene 67:31) (Pharmacia) or FLAG (Kodak / IBI) tag (Nisson, J. et al., J. Mol. Recognit., 1996, 5: 585 -594).

  As a result of such a trans-splicing reaction using PTM, a chimeric mRNA molecule encoding a fusion protein comprising a protein sequence normally expressed in cells bound to a marker or peptide affinity purification tag is formed. A desirable goal of such a method is to provide a method by which every protein synthesized in a cell receives a marker or peptide affinity tag, thereby identifying each protein expressed in the cell.

  In certain embodiments of the invention, a PTM expression library is generated that encodes a PTM having various target binding domains comprising random nucleotide sequences. A desirable goal is to create a PTM expression library that is complex enough to produce a PTM that can bind to each pre-mRNA expressed in the cell. In a preferred embodiment, this library is cloned into a mammalian expression vector so that there is one or at most several vectors per cell.

To identify the expression of the chimeric protein, host cells are transformed with this PTM library and plated so that individual colonies containing one PTM vector can be grown and purified. Single colonies are selected, isolated and grown in an appropriate medium, and labeled chimeric protein exon fragments are separated from other cellular proteins using, for example, affinity purification tags. For example, affinity chromatography can include the use of antibodies that specifically bind to a peptide tag such as a FLAG tag. Alternatively, when an HIS tag is used, the fusion protein is purified using a Ni ²⁺ nitriloacetic acid agarose column that selectively elutes the bound peptide eluted with a buffer containing imidazole. When GST tag is used, the fusion protein is purified using glutathione-S-transferase agarose beads. These fusion proteins can then be eluted in the presence of free glutathione.

  After purification of the chimeric protein, analysis is performed to determine the amino acid sequence of the fusion protein. The amino acid sequence of the fusion protein is determined using techniques well known to those skilled in the art, such as Edman degradation followed by amino acid analysis using HPLC, mass spectrometry or amino acid analysis. Once identified, the peptide sequence is compared to sequences available in protein databases such as GenBank. If the partial peptide sequence is known, no further analysis is performed. If the partial protein sequence is unknown, a more complete sequencing of the protein can be performed to determine the total protein sequence. If the fusion protein contains only a portion of the full length protein, the nucleic acid encoding the full length protein can be isolated using conventional methods. For example, for use as a probe or PCR primer for screening a cDNA library, oligonucleotide primers can be generated based on partial protein sequences.

6. Examples: Generation of trans-splicing molecules The following sections describe the generation of PTMs and demonstration that such molecules can mediate trans-splicing reactions to produce chimeric mRNA molecules.

太字のヌクレオチドは、正常なBP、PPTおよび3'スプライス部位に対する突然変異を示す。分岐部位Aは下線で示す。イタリックのヌクレオチドはPTMのBP配列をマスクするためにセーフティーBDに導入された誤対合を示す。 6.1. Materials and methods
6.1.1. Construction of pre-mRNA molecule Plasmids containing wild-type diphtheria toxin subunit A (DT-A, wild-type accession number # K01722) and DT-A mutant (CRM 197, no enzyme activity) are Dr. Obtained from Virginia Johnson, Food and Drug Administration, Bethesda, Maryland (Uchida et al., 1973 J. Biol. Chem 248: 3838). For in vitro experiments, DT-A was amplified with primers: DT-1F (5'-GGCGCTGCAGGGCGCTGATGATGTTGTTG), and DT-2R (5'-GGCGAAGCTTGGATCCGACACGATTTCCTGCACAGG), digested with PstI and HindIII, and digested with PstI and HindIII It was cloned into pBS (-) vector (Stratagene, La Jolla, CA). Individual PTMs were constructed using the resulting clone pDTA. (1) pPTM +: targeting construct. Prepared by inserting IN3-1 (5'AATTCTCTAGATGCTTCACCCGGGCCTGACTCGAGTACTAACTGGTACCTCTTCTTTTTTTTCCTGCA) and IN2-4 (5'-GGAAAAAAAAGAAGAGGTACCAGTTAGTACTCGAGTCAGGCCCGGGTGAAGCATCTAGAG) primers into pDTA digested with EcoRI and Pstl. (2) pPTM + Sp: Same as pPTM + except that it has a 30 bp spacer sequence between BD and BP. pPTM + was digested with XhoI and made by ligating spacer S (5′-TCGAGCAACGTTATAATAATGTTC) and spacer AS (5′-TCGAGAACATTATT ATAACGTTGC) in the oligonucleotide. For in vivo studies, the EcoRI and HindIII fragments of pcPTM + Sp were cloned under the control of the CMV promoter of the mammalian expression vector pcDNA3.1 (Invitrogen). Also, methionine at codon 14 was changed to isoleucine, preventing translation initiation. The resulting plasmid was named pcPTM + Sp. (3) pPTM + CRM: Same as pPTM + Sp except that wild type DT-A was replaced with CRM mutant DT-A (T. Uchida et al., 1973, J. Biol. Chem. 248: 3838). This was generated by PCR amplification of a DT-A mutant (mutation in G52E) using primers DT-1F and DT-2R. For in vivo studies, the EcoRI HindIII fragment of PTM + CRM was cloned into pc3.1DNA to obtain pcPTM + ARM. (4) PTM-: non-targeting construct. Made by digesting PTM + with EcoRI and Pst I, gel purification to remove the binding domain, and then ligating oligonucleotides IN-5 (5'-ATCTCTAGATCAGGCCCGGGTGAAGCCCGAG) and IN-6 (5'-TGCTTCACCC GGGCCTGATCTAGAG) . (5) PTM-Sp is the same version as PTM- except that it has a 30 bp spacer sequence at the PstI site. Similarly, splice mutants [Py (−) AG (−) and BP (−) Py (−) AG (−)] and safety mutants [PTM + SF− Pyl, PTM + SF-Py2, PTM + SFBP3 and PTM + SFBP3-Pyl] were constructed (see 1).

Bold nucleotides indicate mutations to normal BP, PPT and 3 'splice sites. Branch site A is underlined. Italicized nucleotides indicate mismatches introduced into Safety BD to mask the BP sequence of PTM.

  The dual trans-splicing PTM construct (DS-PTM) also binds to the 3 'end of the toxin coding sequence of PTM + SF, a second target binding complementary to the 5' splice site and the second intron of the βHCG pre-mRNA. A domain was added (FIG. A).

6.1.2. ΒHCG6 target pre-mRNA
To produce the target pre-mRNA in vitro, the SacI fragment of βHCG gene 6 (Accession No. # X00266) was cloned into pBS (−). This produced a 805 bp insert derived from nucleotides 460-1265, including the 5 'untranslated region, the start codon, exon 1, intron 1, exon 2, and most of intron 2. For in vivo studies, EcoRI and BamHI fragments were cloned into a mammalian expression vector (pc3.1 DNA) to produce βHCG6.

6.1.3. Preparation of mRNA
In in vitro splicing experiments, THC mRNA polymerase (Pasman & Garcia-Blanco, 1996, Nucleic Acids Res. 24: 1638) was used to translate plasmid DNA digested with BamHI and HindIII, respectively, by in vitro translation. The globin pre-mRNA and various PTM mRNAs were synthesized. The synthesized mRNA was purified by electrophoresis on a denaturing polyacrylamide gel, and the product was cut out and eluted.

6.1.4. In vitro splicing
PTM and target pre-mRNA were annealed by heating at 98 ° C and then slowly cooling to 30-34 ° C. Each reaction has a final volume of 12.5 μl, 4 μl of annealed mRNA complex (target 100 ng and PTM 200 ng), 1 × splice buffer (2 mM MgCl ₂ , 1 mM ATP, 5 mM creatinine phosphate, and 40 mM KCl) and HeLa splice nuclear extract 4 μl of (Promega) was included. Incubate the reaction at 30 ° C for the indicated time and stop the reaction by adding the same amount of high salt buffer (7M urea, 5% SDS, 100 mM LiCl, 10 mM EDTA and 10 mM TrisHCl, pH 7.5). I let you. The nucleic acid was purified by extraction with phenol: chloroform: isoamyl alcohol (50: 49: 1) and ethanol precipitation.

6.1.5. Reverse transcription-PCR reaction
RT-PCR analysis was performed using the EZ-RT PCR kit (Perkin-Elmer, Foster City, CA). Each reaction contains 10 ng of cis or trans-spliced mRNA, or 1-2 μg of total mRNA, 0.1 μl each of 3 ′ and 5 ′ specific primers, 0.3 mM each dNTP, 1 × EZ buffer (50 mM bicine, 50 μl reaction volume). 115 mM potassium acetate, 4% glycerol, pH 8.2), 2.5 mM magnesium acetate and 5 U of rTth DNA polymerase. After reverse transcription at 60 ° C. for 45 minutes, PCR amplification of the resulting cDNA was performed as follows: initial denaturation 94 ° C. 30 seconds 1 cycle, denaturation 94 ° C. 18 seconds, 60 ° C. 40 seconds annealing and 25 cycles of stretching followed by 7 min final stretching at 70 ° C. The reaction products were separated by electrophoresis on an agarose gel.

The primers used in this study were:
DT-1F: GGCGCTGCAGGGCGCTGATGATGTTGTTG
DT-2R: GGCGAAGCTTGGATCCGACACGATTTCCTGCACAGG
DT-3R: CATCGTCATAATTTCCTTGTG
DT-4R: ATGGAATCTACATAACCAGG
DT-5R: GAAGGCTGAGCACTACACGC
HCG-R2: CGGCACCGTGGCCGAAGTGG
Bio-HCG-F: ACCGGAATTCATGAAGCCAGGTACACCAGG
β-globulin-F: GGGCAAGGTGAACGTGGATG
β-globulin-R: ATCAGGAGTGGACAGATCC

6.1.6. Cell proliferation, transfection and mRNA isolated human lung cancer cell line H1299 (ATCC Accession No. # CRL-5803) to 37 ℃, 5% C0 ₂ environment, in RPMI medium supplemented with 10% fetal calf serum Allowed to grow. Cells were transfected with pcSp + CRM (CRM is a non-functional toxin), a vector expressing PTM, or the vector alone (pcDNA3.1) using Lipofectamine reagent (Life Technologies, Gaithersburg, MD). The assay was scored for neomycin resistant (neo ^r ) colony formation 2 weeks after transfection. Four neo ^r colonies were selected and expanded under continued neo selection. Total cellular mRNA was isolated using RNA Exol (BioChain Institute, Inc., San Leandro, Calif.) And used for RT-PCR.

6.1.7. Trans-splicing in tumors of nude mice
Eleven nude mice were injected with 1 × 10 ⁷ H1299 human lung tumor cells left and right into the dorsal abdominal subcutaneous region (1 day except for B10, B11 and B12) (Day 1). On day 14, mice are anesthetized with or without pcβHCG6 or pcPTM + Sp with or without several-direction electroporation (T820, BTX Inc., San Diego, CA) A total volume of 100 μl of saline containing 100 μg of pcSp + CRM was injected. Black ink was also added to the solution injected into the tumor on the right to mark the needle trajectory. After 48 hours the animals were sacrificed, the tumors removed and immediately frozen at -80 ° C. For analysis, 10 mg of each tumor was homogenized and mRNA was isolated using the Dynabeads mRNA direct kit (Dynal) according to the manufacturer's instructions. Purified mRNA (2 μl out of a total volume of 10 μl) was subjected to RT-PCR using βHCG-F and DT-5R primers as described at the beginning. All samples were reamplified using DT-3R, nested DT-A primer and biotinylated βHCG-F, and these products were analyzed by electrophoresis on a 2% agarose gel. Samples that produced bands were treated with M280 streptavidin dynabeads to give single stranded DNA and sequenced using a toxin-specific primer (DT-3R).

6.2. Results
6.2.1. Synthesis of PTM
An exon encoding an 18nt target binding domain (complementary to βHCG6 intron 1), a 30 nucleotide spacer region, a branch point (BP) sequence, a polypyrimidine tract (PPT), and diphtheria toxin subunit A (DT-A). A prototype trans-splicing mRNA molecule pcPTM + Sp (FIG. 1A) containing an AG dinucleotide at the immediately upstream 3 ′ splice site was constructed (Uchida et al., 1973, J. Biol. Chem. 248: 3838). Subsequently, the DT-A exon was modified to remove the translation start site at codon 14. Since PTM constructs are designed to be maximally active to demonstrate trans-splicing, they are effective 3 'splice elements (yeast BP and mammalian PPT) (Moore et al., 1993, In The mRNA World, RF Gesteland and JF Atkins (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press), including βHCG6 pre-mRNA (Talmadge et al., 1984, Nucleic Acids Res. 12: 8415) It was chosen as a model target because it is expressed in cells, with some exceptions such as pituitary gland and gonadal, but not in normal adult cells (Acevedo et al., 1992, Cancer 76: 1467; Hoon et al. , 1996, Int J. Cancer 69: 369; Bellet et al., 1997, Cancer Res. 57: 516) As shown in FIG. 1C, pcPTM + Sp has its binding with the 3 ′ end of βHCG6 intron 1 Targets by forming a normal Watson-Crick base pair by domain Intron 3 'to mask the splice signal. This feature is designed to promote trans-splicing between the target and the PTM.

  HeLa nuclear extracts were used with established splicing procedures (Pasman & Garcia-Blanco, 1996, Nucleic Acids Res. 24: 1638) to determine if the PTM construct was able to enter the βHCG6 pre-mRNA target. In vitro trans-splicing products were detected by RT-PCR using primers specific for the chimeric mRNA molecule. The product presumed to be a successful trans-splicing reaction is a chimeric mRNA comprising an exon from pcPTM + Sp encoding DT-A immediately following the first exon of βHCG6 (FIG. 1C). Such chimeric mRNAs were easily detected by RT-PCR using primers βHCG-F (βHCG6 exon 1 specific) and DT-3R (DT-A specific, FIG. 2A lanes 1-2). No product of 466 bp was seen at 0 hours or in the absence of ATP, indicating that this reaction was both ATP and time dependent.

  The target binding domain of pcPTM + Sp contained 18 nucleotides complementary to βHCG6 intron 1 pre-mRNA, indicating efficient trans-splicing (FIG. 2A lanes 1-2). When using non-targeting PTM-Sp containing a non-complementary 18 nucleotide “non-binding domain”, the trans-splicing efficiency was reduced by at least 8 fold (FIG. 2, lanes 3-4). The trans-splicing efficiency of PTM mRNA with or without a spacer between the binding domain and BP was also compared. This experiment demonstrated that trans-splicing efficiency was significantly increased by the addition of a spacer (FIG. 2B lanes 2 + 5). To facilitate recruitment of the splicing factors required for efficient trans-splicing, some space is required between the 3 'splice site and the double-stranded secondary structure created by the binding domain / target interaction. I think that the.

  To investigate the effect of PTM length on trans-splicing specificity, shorter PTMs were synthesized from PTM plasmids cut with AccI (see FIG. 1). This removed 479 nucleotides from the 3 ′ end of the DT-A coding sequence. FIG. 2B shows the trans-splicing ability of the short targeting PTM (+) (lanes 10-12) as compared to the non-targeting short PTM (−) (lanes 14-17). Short PTM +, on the other hand, produced substantially more trans-splicing product (FIG. 2B lane 12) than non-targeting short PTM (FIG. 2B lane 17). These experiments indicate that longer PTMs may have a higher ability to mediate trans-splicing non-specifically.

6.2.2. Accuracy of trans-splicing mediated by PTM spliceosome
To confirm whether the trans-splicing between pcPTM + Sp and βHCG6 target was correct, RT-PCR amplification products were produced using 5 ′ biotinylated βHCG-F and non-biotinylated DT-3R primers. This product was converted to single stranded DNA and directly sequenced with primer DT-3R (DT-A specific reverse primer) using the method of Mitchell and Merril (1989, Anal. Biochem. 178: 239). Trans-splicing occurs exactly between putative splice sites (Figure 3), and during splicing, conventional pre-mRNA can be invaded by engineered PTM constructs, and this reaction is accurate It was confirmed that.

  Furthermore, alternative trans-splicing of double spliced PTM (DS-PTM) was seen (FIG. 8B). DS-PTM can result in trans-splicing by contributing to either the 3 ′ or 5 ′ splice sites. It is also possible to construct a DS-PTM that would allow double ex-splicing at both the 3 'and 5' sites simultaneously to allow exon substitution. FIG. 8B shows that the 5 ′ splice site is most active in this construct when the target βHCG pre-mRNA: DS-PTM is at a concentration of 1: 1. At a ratio of 1: 6, the 3 'splice site is more active.

6.2.3. The 3 'splice site is essential for PTM trans-splicing. Generally, the 3' splice site is 1) a BP sequence located 5 'to the acceptor site, 2) a PPT consisting of a short chain of pyrimidine residues, and 3) Contains three elements of the YAG trinucleotide splice site acceptor at the intron-exon boundary (Senapathy et al., 1990, Cell 91: 875; Moore et al., 1993). It is known that splicing does not decrease or occur when one of these sequence elements is deleted or altered (Aebi et al., 1986; Reed & Maniatis 1988, Genes Dev. 2: 1268; Reed, 1989, Genes Dev. 3: 2113; Roscigno et al., 1993, J. Biol. Chem. 268: 11222; Coolidge et al., 1997, Nucleic Acids Res. 25: 888). The role of these conserved elements in targeted trans-splicing was experimentally addressed. In one case [(BP (-) Py (-) AG (-)] replaced all three cis elements (BP, PPT and AG dinucleotide) with random sequences: PPT and 3 'splice site acceptor We constructed another splicing mutant [(Py (−) AG (−)] that was mutated and replaced with a random sequence, and there is no construct that can support in vitro trans-splicing (FIG. 2A lanes 5-5). 8) This suggests that the PTM trans-splicing process requires functional BP, PPT and AG acceptors at the 3 ′ splice site, as in the case of normal cis-splicing.

6.2.4. Development of “safety” splice sites to increase specificity To improve the level of target specificity achieved by inclusion of binding domains or shortening of PTM, target binding domains of some PTM constructs Modified to create an intramolecular stem that masks the 3 'splice site (referred to as "Safety PTM"). Safety by part of the binding domain that partially base pairs with the PTM 3 'splice site region or sequences adjacent to it, thereby blocking access of the spliceosome component to the PTM 3' splice site prior to target capture A stem is formed (FIG. 4A, PTM + SF). Base pairing between the free part of the PTM binding domain and the βHCG6 target region releases the safety stem, splicing factors such as U2AF to the PTM 3 ′ splice site and initiating trans-splicing (FIG. 4B).

  This concept was tested in a splicing reaction containing either PTM + SF (safety) or pcPTM + Sp (linear) and both target (βHCG6) and non-target (β-globin) pre-mRNA. These spliced products were then analyzed by RT-PCR and gel electrophoresis. Using βHCG-F and DT-3R primers, specific for reactions containing either βHCG target and linear PTM (pcPTM + Sp, Fig. 5 lane 2) or safety PTM (PTM + SF, Fig. 5 lane 8) A typical 196 bp trans-splicing band was shown. Comparison of target trans-splicing between linear PTM (Figure 5 lane 2) and safety PTM (Figure 5 lane 8) shows that safety PTM was less efficient in trans-splicing than linear PTM. It was.

  Non-targeting reactions were amplified using β-globin-F (specific for exon 1 of β-globin) and DT-3R primer. The estimated product produced by non-specific PTM trans-splicing with β-globin pre-mRNA is 189 bp. It was clear that non-specific trans-splicing was between linear PTM and β-globin pre-mRNA (Figure 5 lane 5). In contrast, non-specific trans-splicing was virtually eliminated by using safety PTM (Fig. 5, lane 11). This was not unexpected as linear PTM was designed to be maximally active to prove the concept of trans-splicing mediated by the spliceosome. The open structure of linear PTM combined with its potent 3 'splice site strongly promotes splicing factor binding. Once bound, these splicing factors can potentially initiate trans-splicing at any 5 'splice site in a process similar to trans-splicing in trypanosomes. The safety stem was designed to prevent splicing factors such as U2AF from binding to the PTM prior to target capture. This result shows that base pairing between the free part of the binding domain and the βHCG6 target breaks the safety stem (due to mRNA-mRNA interaction), the 3 'splice site cover is removed, splicing factor recruitment and trans-splicing This is consistent with the model of enabling the start of No trans-splicing was detected between β-globin and βHCG6 pre-mRNA (FIG. 5, lanes 3, 6, 9, and 12).

6.2.5. In vitro trans-splicing of safety PTMs and mutants To better understand the role of cis elements at the 3 'splice site in trans-splicing, substituting with purines weakens PPT and / or bases substitutions A series of safety PTM mutants with modified BP was constructed (see Table I). The in vitro trans-splicing efficiency of safety (PTM + SF) was compared to the three safety mutants, indicating reduced trans-splicing ability. The greatest effect was seen with variant 2 (PTM + SFPy2), which was incapable of trans-splicing (4C lanes 5-6). This inhibition of trans-splicing may be due to weakening of PPT and / or higher _{Tm of the} safety stem. In contrast, a mutation in the BP sequence (PTM + SFBP3) had no significant effect on trans-splicing (FIG. 4C lanes 7-8). This was not surprising since the introduced modifications were within the mammalian branching point common region YNYURAC (where Y = pyrimidine, R = purine, and N = any nucleotide) (Moore et al., 1993). . This finding indicates that branch point sequences can be removed without affecting splicing efficiency. Changing the PPT (PTM + SF-Pyl) decreased the trans-splicing level (lanes 3-4). Similarly, changing both BP and PPT (PTM + SFBP3-Pyl) caused a further decrease in trans-splicing (FIG. 4C lanes 9-10). The order of the trans-splicing efficiency of these safety variants is PTM + SF> PTM + SFBP3> PTM + SFPy1> PTM + SFBP3-Pyl> PTM + SFPy2. These results confirm that both PPT and BP are important for the efficiency of in vitro trans-splicing (Roscigno et al., 1993, J. Biol. Chem. 268: 11222).

6.2.6. Competition between cis and trans splicing
To investigate whether pre-mRNA cis-splicing could be blocked by increasing the concentration of PTM, experiments were conducted to direct the reaction to trans-splicing. The splicing reaction was performed using a fixed amount of βHCG6 pre-mRNA target and various concentrations of trans-splicing PTM. Cis splicing was monitored by RT-PCR using primers for βHCG-F (exon 1) and βHCG-R2 (exon 2). This amplified the expected 125 bp cis-spliced product and 478 bp non-spliced product (FIG. 6A). Trans-splicing products were detected using primers βHCG-F and DT-3R (FIG. 6B). At lower PTM concentrations, cis-splicing (Figure 6A lanes 1-4) was superior to trans-splicing (Figure 6B lanes 1-4). Cis splicing was reduced approximately 50% at 1.5 times higher PTM concentration than the target. Increasing the PTM mRNA concentration up to 3 times the target concentration inhibited cis-splicing by more than 90% (FIG. 6A lanes 7-9), which increased the trans-splicing product (FIG. 6B lanes 6-10). Competitive RT-PCR was performed to simultaneously amplify both cis and trans splicing products by including all three primers (βHCG-F, HCG-R2 and DT-3R) in a single reaction. This experiment shows similar results seen in Figure 6, showing that under in vitro conditions, PTM effectively blocks cis-splicing of the target pre-mRNA and replaces it with the production of engineered trans-splicing chimeric mRNA. ing.

6.2.7. Trans-splicing in tissue culture To prove the trans-splicing mechanism in a cell culture model, human lung cancer line H1299 (βHCG6-positive) is expressed as a vector expressing SP + CRM (non-functional diphtheria toxin) or vector alone (pcDNA3 Transfected in .1) and grown in the presence of neomycin. Four 14 neomycin resistant colonies were individually collected after 14 days and subsequently expanded in the presence of neomycin. Total mRNA was isolated from each clone and analyzed by RT-PCR using primers βHCG-F and DT-3R. This resulted in a 196 bp trans-splicing product estimated in 3 out of 4 selected clones (FIG. 7A lanes 2, 3 and 4). Direct sequencing of the amplified product from clone # 2 revealed that PTM-driven trans-splicing occurred exactly at the putative splice site of the first nucleotide of βHCG6 target exon 1 and DT-A endogenously expressed in human cells (Fig. 7B).

^a: 99μsの3パルスセットを6パルス直交印加
^b: 10msの4パルスセットを8パルス直交印加
^c: 50msの4パルスセットを8パルス直交印加
⁺: RT-PCRトランススプライシング産物陽性
¹: エレクトロポレーションを受けず 6.2.8. Trans-splicing in an in vivo model To demonstrate the in vivo mechanism of trans-splicing, the following experiment was performed in athymic (nude) mice. Tumors were established by injecting 10 ⁷ H1299 cells into the dorsal ventral subcutaneous site. On day 14, the PTM expression plasmid was injected into the tumor. Most tumors were then subjected to electroporation to facilitate plasmid delivery (see Table 2 below). After 48 hours, tumors were removed and poly-A mRNA was isolated and amplified by RT-PCR. Trans-splicing was detected in 8 of 19 PTM treated tumors. After the first RT-PCR, a trans-splicing product (466 bp) deduced from mRNA was generated in 2 samples. Subsequent second PCR amplification using the nested primer set resulted in six additional tumors being positive for trans-splicing, which produced an estimated 196 bp product (Table 2). Sequencing of each positive sample showed that βHCG6 exon 1 was correctly trans-spliced into the coding sequence of DT-A (wild type or CRM mutant) at the putative splice site. Six positive samples were derived from treatment groups that received the co-transfection plasmids pcPTM + CRM and pcHCG6, and increased the target pre-mRNA concentration. This was done to increase the probability that a trans-splicing event could be detected. The other two positive tumors were from the group that received only pcPTM + Sp (wild type DT-A). These tumors were not transfected with βHCG6 expression plasmids, and again here, similar to the tissue culture model described in Section 6.2.7, of endogenous βHCG6 pre-mRNA produced by PTM and tumor cells. It was shown that trans-splicing occurred between them.

^a : Apply 6 pulses orthogonally to 3 pulses set of 99μs
^b : 4-pulse set of 10ms applied 8 pulses orthogonally
^c : 4-pulse set of 50ms applied 8-pulse orthogonal
⁺ : Positive RT-PCR trans-splicing product
¹ : No electroporation

7. Example: To demonstrate and evaluate the universality of the spliceosome-mediated target trans-splicing mechanism between lacZ trans-splicing model specific pre-mRNA target and PTM, the expression of β-galactosidase enzyme A simple model system based on this was developed. The following sections describe the results showing the success of spliceosome-mediated target trans-splicing between specific targets and PTMs.

7.1. Materials and methods
7.1.1. Primer sequences The following primers were used for testing the lacZ model system:
5'Lac-1F
GCATGAATTCGGTACCATGGGGGGGTTCTCATCATCATC
5'Lac-1R
CTGAGGATCCTCTTACCTGTAAACGCCCATACTGAC
3'Lac-1F
GCATGGTAACCCTGCAGGGCGGCTTCGTCTGGGACTGG
3'Lac-1R
CTGAAAGCTTGTTAACTTATTATTTTTGACACCAGACC
3'Lac-Stop
GCATGGTAACCCTGCAGGGCGGCTTCGTCTAATAATGGGACTGGGTG
HCG-In1F
GCATGGATCCTCCGGAGGGCCCCTGGGCACCTTCCAC
HCG-In1R
CTGACTGCAGGGTAACCGGACAAGGACACTGCTTCACC
HCG-Ex2F
GCATGGTAACCCTGCAGGGGCTGCTGCTGTTGCTG
HCG-Ex2R
CTGAAAGCTTGTTAACCAGCTCACCATGGTGGGGCAG
Lac-TR1 (Biotin): 7-GGCTTTCGCTACCTGGAGAGAC
Lac-TR2 GCTGGATGCGGCGTGCGGTCG
HCG-R2: CGGCACCGTGGCCGAAGTGG

7.1.2. Construction of lacZ pre-mRNA target molecule
The lacZ target 1 pre-mRNA (pc3.l lacT1) is constructed by cloning the following three PCR products: (i) the 5 ′ fragment of lacZ, then (ii) βHCG6 intron 1, and (iii) the 3 ′ fragment of lacZ did. The 5 'and 3' fragments of the lacZ gene are replaced with the following primers: 5'Lac-1F and 5'Lac-1R (for 5 'fragment) and 3'Lac-1F and 3'Lac-1R (for 3' fragment) Was used for PCR amplification from the template pcDNA3.1 / His / lacZ (Invitrogen, San Diego, Calif.). The amplified lacZ 5 'fragment is 1788 bp in length, contains the start codon, the amplified 3' fragment is 1385 bp in length, as well as the branch point, polypyrimidine tract and βHCG6 intron 1 as well as the native type Has 5 'and 3' splice sites. βHCG6 intron 1 was PCR amplified using the following primers: HCG-In1F and HCG-In1R.

  lacZ target 2 is the same version as lacZ target 1 except that it contains two stop codons (TAA TAA) after 4 codons of the 3 ′ splice site in frame. This was generated by PCR amplification of the 3 ′ fragment (lacZ) using the following primers: 3 ′ Lac-Stop and 3 ′ Lac 1R, replacing the functional 3 ′ fragment of lacZ target 1.

7.1.3. Construction of pc3.1 PTM1 and pc3.1 PTM2 The pretrans -splicing molecule pc3.1 PTM1 digests pPTM + Sp with PstI and HindIII and converts the DNA fragment encoding the DT-A toxin into a functional lacZ. It was prepared by replacing with a DNA fragment encoding the 3 'end. This fragment was generated by PCR amplification using the following primers: 3'Lac-1F and 3'Lac-1R. For cell culture experiments, pcDNA3 contains EcoRI and HindIII fragments of pc3.1 PTM2 containing the binding domain for HCG intron 1, 30 bp spacer, yeast branch point (TACTAAC), and lacZ cloned after a strong polypyrimidine tract. Cloned into 1.

  The pretrans-splicing molecule pc3.1 PTM2 was generated by digesting pPTM + Sp with PstI and HindIII and replacing the DNA fragment encoding the DT-A toxin with βHCG6 exon 2. βHCG6 exon 2 was generated by PCR amplification using the following primers: HCG-Ex2F and HCG-Ex2R. For cell culture experiments, the EcoRI and HindIII fragment of pc3.1 PTM2 containing the binding domain for HCG intron 1, a 30 bp spacer, yeast branch point (TACTAAC), and βHCG6 exon 2 cloned after a strong polypyrimidine tract. Using.

7.1.4. Co-transfection of lacZ splice target pre-mRNA and PTM into 293T cells Human embryonic kidney cells (293T) were grown in DMEM medium supplemented with 10% FBS at 37 ° C., 5% CO ₂ . Cells were co-transfected with pc3.1 LacT1 and pc3.1 PTM2 or pc3.1 LacT2 and pc3.1 PTM1 using Lipofectamine Plus (Life Technologies, Gaithersburg, MD) according to the manufacturer's instructions . Cells were harvested 24 hours after transfection, total RNA was isolated and RT-PCR was performed using primers specific for the target and PTM molecules. Also, β-galactosidase activity was monitored by staining the cells with a β-gal staining kit (Invitrogen, San Diego. CA).

7.2. Results
7.2.1. The lacZ splice target is efficiently cis-spliced to produce functional β-galactosidase. To investigate the efficient cis-splicing ability of the splice target pre-mRNA, Lipofectamine Plus (Life Technologies, Gaithersburg, MD ) Was used to transfect pc3.1 lacT1 into 293T cells, and then RT-PCR analysis of total RNA was performed. Sequence analysis of the cis-spliced RT-PCR product showed that splicing was correct and occurred exactly at the putative splice site (FIG. 12B). Furthermore, as a result of accurate cis-splicing of the target pre-mRNA molecule, an active β-galactosidase that catalyzes the hydrolysis of β-galactosidase, that is, an mRNA that can encode X-gal, is formed, and a blue color that can be seen under a microscope. Present. Accurate cis-splicing of the target pre-mRNA was further confirmed by the ability to detect the enzymatic activity of β-galactosidase.

  Repair of defective lacZ target 2 pre-mRNA by trans-splicing of a functional 3 ′ lacZ fragment (PTM1) was measured by staining the enzymatic activity of β-galactosidase. For this purpose, 293T cells were co-transfected with lacZ target 2 pre-mRNA (containing a defective 3 ′ fragment) and PTM1 (containing a normal 3 ′ lacZ sequence). Cells were assayed for β-galactosidase enzyme activity 48 hours after transfection. Efficient trans-splicing of PTM1 to the lacZ target 2 pre-mRNA will result in functional β-galactosidase activity. As shown in FIGS. 11B-E, trans-splicing of PTM1 to lacZ target 2 results in recovery of β-galactosidase enzyme activity from 5% to 10% of the control.

7.2.2. Target trans-splicing between lacZ target pre-mRNA and PTM2 To assay trans-splicing, lacZ target pre-mRNA and PTM2 were transfected into 293T cells. Following transfection, total RNA was analyzed using RT-PCR. The following primers were used in the PCR reaction: lacZ-TR1 (lacZ 5 ′ exon specific) and HCGR2 (βHCGR exon 2 specific). This RT PCR reaction produced a putative 195 bp trans-splicing product (Figure 11 lanes 2 and 3), indicating efficient trans-splicing between the lacZ target pre-mRNA and PTM2. Lane 1 shows a control without PTM2.

  The efficiency of trans-splicing was measured by staining β-galactosidase enzyme activity. To assay for trans-splicing, 293T cells were co-transfected with lacZ target pre-mRNA and PTM2. Cells were assayed for β-galactosidase activity 24 hours after transfection. Efficient trans-splicing between the target pre-mRNA and PTM results in a chimeric mRNA consisting of the 5 'fragment of the lacZ target pre-mRNA, resulting in the formation of βHCG6 exon 2 that cannot encode active β-galactosidase Is done. The results of these co-transfection experiments showed that trans-splicing of PTM2 to lacZ target 1 resulted in decreased β-galactosidase activity compared to the control.

  To further confirm that the trans-splicing between lacZ target pre-mRNA and PTM2 is correct, RT-PCR was performed using 5 'biotinylated lacZ-TR1 and non-biotinylated HCGR2 primers. Single stranded DNA was isolated and sequenced directly using HCGR2 primer (HCG exon 2 specific primer). As is evident by the splicing site sequence, trans-splicing occurs exactly between the putative splice sites (Figures 12A and 12B), allowing the PTM manipulated by normal pre-mRNA to enter during splicing, It was further confirmed that this reaction was accurate.

8. Examples: Collection of Cystic Fibrosis Transmembrane Regulatory Protein Genes Cystic fibrosis (CF) is one of the most common genetic diseases in the world. Genes related to CF have been isolated and their protein products presumed (Kerem, BS et al., 1989, Science 245: 1073-1080; Riordan et al., 1989, Science 245: 1066-1073; Rommans et al., 1989, Science 245: 1059-1065). The protein product of the CF-related gene is called cystic fibrosis transmembrane conductance regulatory protein (CFTR). The most common pathogenic mutation, accounting for approximately 70% of all mutant alleles, is a deletion of 3 nucleotides of exon 10 encoding 508 phenylalanine (ΔF508). The following sections describe the successful repair of the cystic fibrosis gene using spliceosome-mediated trans-splicing and demonstrate the feasibility of CFTR repair in a model system.

8.1. Materials and Methods
8.1.1. Pre-trans-splicing molecules
The CFTR pretrans-splicing molecule (PTM) is a 23 nucleotide binding domain complementary to CFTR intron 9 (3 'end, -13 to -31), a 30 nucleotide spacer region (efficient spliceosomal component) 3 'splice site AG dinucleotide immediately upstream of the sequence encoding the branch point (BP) sequence, polypyrimidine tract (PPT) and CFTR exon 10 (wild type sequence including F508). Consists of. Since this initial PTM was designed to be maximally active to demonstrate trans-splicing, the PTM therefore contained the UACUAAC yeast common BP sequence and an extended PPT. An 18 nucleotide HIS tag (6 histamine codons) was included after the wild type exon 10 coding sequence to allow specific amplification and isolation of the trans-spliced product but not the endogenous CFTR. The oligonucleotides used to generate these two fragments contained unique restriction sites that facilitate directional cloning of the amplified DNA into the mammalian expression vector pcDNA3.1 (Apal and PstI, and PstI, respectively). NotI).

8.1.2. Target CFTR pre-mRNA minigene
The CFTR minigene target is shown in FIG. 13 and includes CFTR exon 9, functional 5 ′ and 3 ′ regions of intron 9 (260 and 265 nucleotides from each end, respectively), exon 10 [ΔF508], and 5 ′ region of intron 10 (96 nucleotides). In addition, as shown in Figure 16, we test the use of spliceosome-mediated trans-splicing for a collection of cystic fibrosis mutations using mini-target genes containing CFTR exons 1-9 and 10-24 it can. FIG. 17 shows a dual splicing PTM that can also be used against a collection of cystic fibrosis mutations. As shown, the double spliced PTM is CFTR BD intron 9, spacer, branch point, polypyrimidine tract, 3 'splice site, CFTR exon 10, spacer, branch point, polypyrimidine tract, 5' splice site and CFTR. Includes BD exon 10.

8.1.3. Oligonucleotides CFTR PTMs were made using the following oligonucleotides:

The following nucleotides were used to create the CFTR target pre-mRNA minigene (exon 9 + mini intron 9 + exon 10 + 5 ′ terminal intron 10):

The following oligonucleotides were used to detect trans-splicing products:

8.2. Results
PTM and target pre-mRNA were co-transfected into 293 embryonic kidney cells using Lipofectamine (Life Technologies, Gaithersburg, MD). Cells were harvested 24 hours after transfection and RNA was isolated. Using the PTM and target-specific primers in the RT-PCR reaction, a trans-splicing product was detected in which the mutant exon 10 of the target pre-mRNA was replaced with the wild-type exon 10 of PTM (FIG. 14). Sequence analysis of the trans-splicing product confirmed that the three nucleotide deletions were restored, that the splicing was correct and occurred at the putative splice site (Figure 15), the first time for the cystic fibrosis gene CFTR RNA repair was shown (Mansfield et al., 2000, Gene Therapy 7: 1885-1895).

9. Example: Double trans-splicing The following example is functionally active, with internal transons accurately displaced by double trans-splicing between target pre-mRNA and PTM RNA containing both 3 'and 5' splice sites. This indicates that the production of a full-length protein is guided.

  As described herein, any pre-mRNA can be reprogrammed by providing a trans-reactive RNA molecule that includes one or both of a 3′-splice site, a 5′-splice site. The following example describes the successful targeting and substitution of a single internal exon using a pretrans-splicing molecule (PTM) containing both 5 'and 3' splice sites. Such PTMs can promote two trans-splicing reactions with the intended target gene mediated by the spliceosome. To test this mechanism, a spliced lacZ model target gene consisting of lacZ 5 ′ “exon” -CFTR miniintron 9-CFTR exon 10 (ΔF508) -CFTR miniintron 10, followed by lacZ 3 ′ “exon” was generated. In this target transcript, the 124 bp middle part of β-galactosidase ORF was replaced with exon 10 (ΔF508) of CFTR, thus producing a non-functional protein. A PTM consisting of a 5 'and 3' trans-splicing domain containing a deletion of the 124 bp lacZ “mini-exon” and a binding domain (BD) complementary to the target intron and exon was generated. When HEK 293T cells were transfected with either target alone or PTM alone, no detectable levels of β-gal activity were seen. In contrast, 293T cells transfected with target + PTM produced substantial levels of β-gal activity, indicating restoration of protein function. The accuracy of trans-splicing between target and PTM was confirmed by sequencing the appropriate RT-PCR product that revealed a putative internal exon substitution. The feasibility of this approach in a disease model was examined by replacing CFTR ΔF508 exon 10 with normal exon 10 including F508 in cystic fibrosis. These results indicate that trans-splicing techniques are easily adapted to correct many of the genetic defects, whether they relate to the 5 'or 3' exons of a gene, or to any internal exons. Show that you can.

  FIG. 18 is a schematic diagram of a model lacZ target consisting of lacZ 5 ′ exon-CFTR miniintron 9-CFTR exon 10 (Δ508) -CFTR miniintron 10, followed by lacZ 3 ′ exon. In this target, the 124 bp central part of the lacZ gene has been replaced with CFTR exon 10, which has a mutation at position 508 (Δ508). This pre-mRNA target is subject to normal cis-splicing to produce mRNA that is lacZ 5 ′ exon-CFTR exon 10 (Δ508) followed by lacZ 3 ′ exon. Since the β-galactosidase ORF is destroyed, it produces a truncated protein with no function.

  In order to restore β-gal function by double trans-splicing, as shown in FIG. Three PTMs consisting of splicing domains were prepared. These PTMs are 120 bp 3 'binding domain (complementary to intron 9) from PTM24 (see below) used for 3' exon substitution, spacer sequence, yeast branch point, polypyrimidine tract, 3 'acceptor AG dinucleotide, It has a lacZ “mini-exon”, a 5 ′ splice site, a spacer sequence, followed by a 5 ′ binding domain. These PTMs differ only in the 5 'binding domain sequence. DSPTM5 is complementary to intron 10 and has a 27 bp BD that blocks only the 5 'splice site of the target. DSPTM6 has a 120 bp 5'BD and spans both the 5 'and 3' splice sites of the target, while DSPTM7 masks both the splice sites (5 'and 3') and 260 bp of BD throughout the target exon. Have.

  A schematic diagram of the double trans-splicing reaction showing the binding of DSPTM7 and DSCFT1.6 target pre-mRNA is shown in FIG. 3′BD is a 120 bp binding domain complementary to miniintron 9; 5′BD (260 bp) is a second binding domain complementary to miniintron 10 and exon 10; ss is a splice site; BP is a branch point; PPT is a polypyrimidine tract.

The important structural elements of DSPTM7 (Figure 21) are:

  To determine if the restoration of β-gal function is RNA trans-splicing mediated, the mutant is shown in FIG. DSPTM8 is a 3 ′ splice mutant in which a 3 ′ splice element such as BP, polypyrimidine tract and 3 ′ acceptor AG dinucleotide has been deleted and replaced with a random sequence. This PTM still has 3 'and 5' binding domains and a functional 5 'splice site. PTM29 lacks the second binding domain and 5'ss but still has a 3 'binding domain 3' splice site, while PTM30 lacks the first binding domain and 3 'splice site, but is functional 5' It has a splice site and a second binding domain.

  To investigate the recovery of β-gal function mediated by double trans-splicing, 293T cells were transfected with 2 μg target or PTM alone or 2 μg target and 1.5 μg Co-transfected with PTM. 48 hours after transfection, total RNA was isolated and analyzed by RT-PCR using K1-1F and Lac-6R primers. These primers amplified both cis and trans splicing products in a single reaction and were identified based on size. The size of the cis-splicing product is 295 bp, while the size of the trans-splicing product is 230 bp. To ensure correct trans-splicing between DSPTM7 and DSCFT1.6 pre-mRNA, the RT-PCR amplification product is excised and re-amplified using K1-2F and Lac-6R primers, and K1-2F or Lac Sequencing was done directly using the -6R primer. As shown in FIG. 23, trans-splicing occurred exactly at the putative splice site, confirming correct internal exon replacement by two trans-splicing events.

  Repair of defective lacZ pre-mRNA by double trans-splicing events and subsequent production of full-length β-gal protein was examined in a co-transfection assay. 293T cells were co-transfected with DSCFT1.6 target and DSPTM7 expression plasmid and simultaneously with DSCFT1.6 target or DSPTM7 alone as controls. Western blot analysis of whole cell lysates using polyclonal anti-β-galactosidase antiserum specifically recognized a protein of about 120 kDa only in cells co-transfected with DSCFT1.6 target + DSPTM7 plasmid (Figure 24 lane 3). And 4), did not recognize in cells transfected with DSCFT1.6 target (lane 1) or DSPTM7 plasmid alone (lane 2). Similarly, co-transfected with DSCFT1.6 target + 3 'splice mutant (lanes 5 and 6), or PTM29 or 30 (lane 7) lacking the 3' trans-splicing domain or 5 'trans-splicing domain No full-length protein was detected in the cells. Furthermore, the 120 kDa protein band migrated simultaneously with the functional full-length β-gal produced using the lacZ-T1 plasmid (positive control, data not shown). These results not only confirmed the production of full-length proteins by double trans-splicing between the target and PTM, but also indicated that both the 3 'and 5' splice sites are essential for this process.

  DSCFT1.6 targeting + double splicing PTM5, 6 or 7 expression to determine whether the full-length protein produced by double trans-splicing between target pre-mRNA and DSPTM7 RNA is functionally active Co-transfected with one of the plasmids or transfected with DSCFT1.6 target or DSPTM7 alone. Whole cell extracts were prepared and assayed for β-gal activity using the ONPG assay (Invitrogen). Β-gal activity in extracts prepared from cells transfected with either DSCFT1.6 target or DSPTM7 alone was approximately the same as the background level detected by mock transfection (FIG. 25). In contrast, 293T cells co-transfected with DSCFT1.6 target and DSPTM7 produced β-gal activity that was approximately 21 times higher than background (FIG. 25). These results confirmed the correct double trans-splicing between the target pre-mRNA and PTM RNA and the production of a functional full-length protein.

  To confirm that the restoration of β-gal activity by the double trans-splicing reaction is absolutely dependent on the presence of both the 3 'and 5' splice sites of PTM, we (A) DSPTMB is the same as DSPTM7 except that the functional 3 'splice elements (branch point, polypyrimidine tract and 3' acceptor AG dinucleotide) have been deleted and replaced with a random sequence. (See FIG. 22 for details); (b) PTM29 lacks a 5 ′ splice site and a 5 ′ binding domain, but has a 3 ′ binding domain and a 3 ′ splice site; and (c) PTM30 has a 3 ′ binding. It lacks a domain and a 3 ′ splice site, but has a 5 ′ splice site and a 5 ′ binding domain. Β-gal activity in extracts prepared from cells transfected with either DSCFT1.6 target or DSPTM7 alone was almost the same as the background level detected by mock transfection (FIG. 26). Similarly, a significant increase in β-gal activity was detected in cells transfected with DSPTM8 alone (3 'splice site mutant) or co-transfection with DSCFT1.6 target + one of the mutant PTMs above. There wasn't. On the other hand, DSCFT1.6 target with functional 3 ′ and 5 ′ splice sites and DSPTM7 co-transfected cells produced substantial levels of β-gal activity above background (FIG. 26). These results confirm that double splicing PTM requires both splice sites and eliminate the possibility that recovery of β-gal activity was due to complementarity between truncated proteins. (FIG. 26).

  Various concentrations of target and PTM were co-transfected and assayed for recovery of β-gal activity. As expected, 293T cells co-transfected with DSCFT1.6 target + DSPTM7 showed substantial levels of β-gal activity (approximately 30-fold) over control. Increasing the PTM concentration 2 and 3 times increased the β-gal activity level but was not significant (FIG. 27). These results further confirmed the recovery of β-gal enzyme function mediated by double trans-splicing.

  The specificity of the double trans-splicing reaction is similar to the specific target (DSCFT1.6), but instead of CFTR miniintron 9-CFTR exon 10 (Δ508) and CFTR miniintron 10, βHCG intron 1-βHCG exon 2 and It was investigated by constructing a non-specific target (DSHCGT1.1) with βHCG intron 2 (FIG. 28). RT-PCR analysis of total RNA isolated from cells transfected with DSHCGT1.1 (non-specific target) alone or in combination with DSPTM7 (targeted to DSCFT1.6 target) showed the expected 314 bp duplex No trans-splicing product was produced. On the other hand, RT-PCR analysis of total RNA prepared from cells co-transfected with specific target + PTM yielded the expected 314 bp product. This was further confirmed by β-gal activity assay of whole cell extract. The level of β-gal activity detected in cells transfected with non-specific target alone or in combination with DSPTM7 targeted to DSCFT1.6 target was almost the same as the background level. In contrast, substantial levels of β-gal activity were detected in cells co-transfected with specific target (DSCFT1.6) + DSPTM7 (FIG. 27). These results confirmed that double trans-splicing is highly specific.

  The repair model of FIG. 30 shows a portion of the target CFTR pre-mRNA consisting of exons 1-9, miniintron 9, exon 10, containing a Δ508 mutation, miniintron 10 and exons 11-24 (FIG. 30). The PTM shown in the figure has an exon 10 coding sequence (including codon 508) and binding domains complementary to each of its unique splicing elements (accepting and donating sites, branch points and pyrimidine tracts) and intron 9 splice sites It consists of two trans-splicing domains, part of exon 10 (5 ′ and 3 ′ end) and intron 10 5 ′ splice site (FIG. 31 (DS-CF1)). PTM exon 10 is also a modified codon that leads to reduced antisense action between PTM exon 10 and the binding domain that is also for PTMs that have a binding domain that is unique and complementary to the exon sequence. Also has use (Figure 31). A double trans-splicing event between the PTM and the target should result in a repaired full-length mRNA.

  Figure 32 shows precisely spliced to target exon 9 (with modified codon) correctly spliced to PTM20 exon 10 (top panel), codon 508 of PTM exon 10 (middle panel), and target exon 11 Shown is the sequence of a single PCR product showing PTM exon 10 (bottom panel). The repaired target sequence was generated by performing PCR after RT-PCR.

10. Example: An important advantage of using 5 'exon substitution for trans-splicing repair gene repair of cystic fibrosis gene using PTM capable of performing 5' exon substitution is
(a) the replacement of the 5 ′ part of the gene is possible,
(b) the construct requires less sequence and space than the full-length gene construct;
(c) the ability to produce PTMs lacking a polyA signal that are thought to interfere with PTM translation; and
(d) The 5 ′ end can be modified to enhance translation.

10.1. Materials and Methods
10.1.1. Plasmid construction
The CFTM coding sequence of PTM30 (exons 1-10) was generated by PCR using a partial cDNA plasmid template (61160; American Type Culture Collection, Manassas, VA). Trans-splicing domain (TSD) [includes binding domain, spacer sequence, polypyrimidine tract (PPT), branch point (BP) and 3 'splice site] anneals oligonucleotides from PCR products (using existing plasmid templates) Was generated. The various fragments (TSD and coding sequence) were then cloned into pcDNA3.1 (-) using appropriate restriction sites. Oligodeoxynucleotide primers were obtained from Sigma Genosys (The Woodlands, TX). All PCR products were generated using either REDTaq (Sigma, St. Louis, Mo.) or cloning Pfu (Stratagene, La Jolla, Calif.) DNA polymerase. PCR primers for amplification included restriction sites for directional cloning. The PCR product was digested with appropriate restriction enzymes and cloned into the mammalian expression plasmid pc3.1DNA (-) (Invitrogen, Carlsbad, CA).

10.2. Cell culture and transfection Using Lipofectamine Plus (Life Technologies, Gaithersburg, MD), constructs were transferred to human embryonic kidney (HEK) 293T or 293 cells (1.25 x 10 ⁶ cells / 60 mm poly-d-lysine coating) The cells were harvested 48 hours after the start of transfection. Total RNA was isolated as described in the manufacturer's instructions (Epicenter Technologies, Inc.). HEK 293T cells were grown in Dulbecco's modified Eagle medium (Life Technologies) supplemented with 10% v / v fetal bovine serum (Hyclone, Inc., Logan, UT). All cells were maintained in a humidified incubator at 37 ° C. and 5% CO ₂ .

10.1.3. Reverse transcription polymerase chain reaction (TR-PCR)
RT-PCR was performed using an EZ-RT-PCR kit (Perkin-Elmer, Foster, CA). Each reaction contained 0.03-1.0 μg total RNA and 80 ng 5 ′ and 3 ′ specific primers in a reaction volume of 40 μl. The RT-PCR product was subjected to electrophoresis on a 2% Seaken agarose gel. The PTM-specific and target-specific oligonucleotides used to generate the trans-splicing product are 5'-CGCTGGAAAAACGAGCTTGTTG-3 '(primer CF93) and 5'-ACTCAGTGTGATTCCACCTTCTC-3' (primer CF111), respectively. The PTM-specific and target-specific oligonucleotides used to generate the cis-splicing products were CF1 and CF93. The sequence of oligonucleotide CF1 is 5′-GACCTCTGCAGACTTCACTTCTAATGATGATTATGG-3 ′.

  The repair model of FIG. 33 shows a target CFTR pre-mRNA portion consisting of exons 1-9, miniintron 9, exon 10, containing a Δ508 mutation, miniintron 10 and exons 11-24 (FIG. 33). The PTM shown in the figure consists of an exon 1-10 coding sequence (including codon 508) and a trans-splicing domain with its unique splicing elements (donor site, branch point and pyrimidine tract) and binding domain. Several PTMs with different binding domains were constructed. Three examples are shown in FIG. In FIG. 34A, the binding domain is complementary to the splice site of intron 9 and part of exon 10 (3 ′ end; CF-PTM11). In FIG. 34B, the PTM has an extended binding domain that spans the 5 ′ end of exon 10 and the 3 ′ splice site of intron 9 (CF-PTM20). In the last example (FIG. 34C), the binding domain is the same as shown in panel B (CF-PTM30) except that the binding domain spans the entire length of exon 10. In the last case, PTM exon 10 has a modified codon usage to mitigate the antisense effect due to its unique binding domain (FIG. 34). A further example of a binding domain is shown in FIG.

  FIG. 36 shows the sequences of cis and trans splicing products. The top panel of FIG. 36A shows the target exon 10 with its three nucleotides (CTT) deleted, while the bottom panel shows the precisely spliced target exons 10 and 11. Figure 36B is a partial sequence of one PCR product, correctly spliced to the modified codon in exon 10 of PTM (top panel), codon 508 of PTM exon 10 (middle panel), and target exon 11 PTM exon 10 (bottom panel) is shown, indicating that trans-splicing is correct. The repaired target sequence was generated by RT-PCR followed by PCR.

11. Example: PTMs with long binding domains (which may be discontinuous) increase trans-splicing efficiency and specificity
11.1. Materials and Methods
11.1.1. Cell culture Human embryonic kidney cells (293 or 293T) were derived from the University of North Carolina tissue culture facility at Chapel Hill (Chapel Hill, NC). Cells were maintained in Dulbecco's modified Eagle medium (Life Technologies, Bethesda, MD) supplemented with 10% v / v fetal calf serum (Hyclone, Logan, UT) in a humidified incubator at 37 ° C. and 5% CO ₂ . Cells were passaged every 2-3 days with 0.5% trypsin and re-plated at the desired density. Stable cells expressing the endogenous mutant lacZ pre-mRNA (lacZCF9) were maintained in the presence of 0.5 mg / ml G418 (Calbiochem, San Diego, CA).

11.1.2. Recombinant plasmid targets: pc3.1lacZCF9, pc3.1lacZCF9m, and pc3.1lacZHCG1m. pc3.1lacZCF9 encodes a normal lacZ pre-mRNA, and 5 ′ exons include lacZ coding sequence nucleotides 1 to 1788, CFTR miniintron 9, followed by lacZ coding sequence nucleotides 1789 to 3174 as 3 ′ exons. Built using. This is similar to pc3.1lacZ-T2 except that it does not contain a stop codon in the lacZ 3 ′ exon and has CFTR miniintron 9 instead of βHCG6 intron 1 (FIG. 37A). CFTR miniintron 9 is PCR amplified using plasmid T5 as a template and primers CFIN-9F (5'-CTA GGATCC CGTTCTTTTGTTCTTCACT ATTAA) and CFIN-9R (5'-CTAG GGTTACC GAAGTAAAACCATACTTATTAG, underlined restriction sites), BamHI and Digested with BstEII and cloned in place of BHCG6 intron 1 of pc3.1lacZ-T2 plasmid. pc3.1lacZCF9m expresses defective lacZ pre-mRNA, but is identical to pc3.1lacZCF9 except that it contains two nonsense codons in-frame within the 3 ′ exon (FIG. 37A). pc3.1lacZHCG1m is a chimeric target, including lacZ 5 ′ exon, followed by intron 1 and exon 2 of βHCG6. This is similar to pc3.1lacZCF9m except that it contains exon 2 of βHCG6 instead of the mutant lacZ 3 ′ exon. BetaHCG6 exon 2, BetaHCG6 plasmid as template DNA (accession number X00266) and primer HCGEx-2F (5'-GCAT GGTTACC CTGCAGGGGCTGCTGCTGTTGCTG) and HCGEx-2R (5'-CTGA AAGCTT GTTAACCAGCTCACCATGGTGGGGCAG, underlined restriction sites) using PCR amplified, digested with BstEII and HindIII, and cloned to replace the lacZ 3 ′ exon of pc3.1lacZCF9m. Plasmids pcDNA3.1 / HisB / lacZ (Invitrogen, Carlsbad, Calif.) Were used as DNA templates to generate 5 ′ and 3 ′ lacZ exons. The lacZ 5 ′ exon is 1788 bp long and has an ATG start codon, and the lacZ 3 ′ exon (not including the stop codon) is 1385 bp long and has a transcription termination signal at the end of the 3 ′ exon. CFTR miniintron 9 and βHCG6 intron 1 are 548 bp and 352 bp in size, respectively, and both have 5 ′ and 3 ′ splice signals. Exon 2 of βHCG6 is 162 bp long and has a transcription termination signal at the end of the exon.

  Pre-trans-splicing molecule (PTM): PTM-CF14 is of the same form as pcPTM1 with minor modifications of the trans-splicing domain (FIG. 37B). PTM-CF14 is a linear form, 23 bp antisense binding domain (BD) complementary to CFTR miniintron 9 (5'-ACCCATCATTATTAGGTCATTAT), 18 bp spacer, standard branch point sequence (UACUAAC; BP) and Contains an extended polypyrimidine tract (PPT) followed by a normal lacZ 3 'exon. PTM-CF22, PTM-CF24, PTM-CF26 and PTM-CF27 are the same as PTM-CF14 except that the lengths of the BDs are different (FIG. 37B). sPTM-CF18 has a 32 bp BD, and sPTM-CF22 and sPTM-CF24 contain the same BD as PTM-CF22 and PTM-CF24, respectively. In these PTMs, the binding domain was modified to create an intramolecular stem-loop structure (“safety”) to mask the 3 ′ splice site of the PTM. The various binding domains were generated by PCR amplification using specific primers (including unique NheI and SacII sites) and a plasmid containing CFTR miniintron 9 as a template. The PCR product was digested with Nhe I and Sac II and cloned into a PTM plasmid consisting of a spacer sequence, 3 'splice elements (BP, PPT and acceptor AG dinucleotide) followed by a normal lacZ 3' exon. .

11.1.3. Transfection of plasmid DNA into 293T cells The day before transfection, 1 x 10 ⁶ 293T cells were coated with poly-D-lysine-coated 60 mm plates (Sigma, St. Louis to enhance cell adhesion). , MO) and grown at 37 ° C. for 24 hours. Cells were transfected with the expression plasmid using Lipofectamine Plus reagent (Life Technologies, Bethesda, MD) according to standard protocols. In a typical cotransfection, 2 μg of pc3.1lacZCF9m target and 1.5 μg of PTM expression plasmid are transfected into the cells, and pcDNA3.1 vector is used as a control (target and PTM alone transfection) and total DNA The concentration was standardized to 3.5 μg.

  Forty-eight hours after transfection, plates were rinsed with PBS, cells were harvested, and total RNA or total DNA was isolated using a Master Pure RNA / DNA purification kit (Epicenter Technologies, Madison, Wis.). Contaminated DNA in the RNA preparation was removed by treatment with DNase I, while contaminating RNA in the DNA preparation was removed by digestion with RNase A at 37 ° C. for 30-45 minutes.

11.1.4. Reverse transcription polymerase chain reaction (RT-PCR)
RT-PCR was performed using the EZrTth RNA PCR kit (Perkins-Elmer, Foster City, CA) as indicated by the manufacturer. A typical reaction (50 μl) includes 25-500 ng total RNA, 100 ng 5 ′ target specific primer (common to cis and trans splicing products) (Las-9F, 5′-GATCAAATCTGTCGATCCTTCC) and 100 ng 3 ′ primer ( Las-3R, 5'-CTGATCCACCCAGTCCCATTA, target-specific primer for cis-splicing; and Lac-5R, 5'-GACTGATCCACCCAGTCCCAGA, PTM-specific primer for trans-splicing), 1x reverse transcription buffer (100 mM Tris-HCl , pH8.3, 900mM KCL) containing 1 mM MnC1 _2, including the rTth DNA polymerase of 200 [mu] M dNTPs and 10 units. For RT reactions, 45 minutes at 60 ° C followed by 30 seconds pre-heating at 94 ° C, then PCR amplification 25-35 cycles with annealing and extension at 94 ° C for 18 seconds and 60 ° C for 1 minute, A final extension at 70 ° C. for 7 minutes was performed. The reaction product was analyzed by agarose gel electrophoresis.

11.1.5. Protein preparation and total cell protein isolated from cells transfected with βgal assay expression plasmid by freeze-thawing and β-galactosidase activity using β-gal assay kit (Invitrogen, Carlsbad, CA) Were assayed. Protein concentration was determined by a dye binding assay using Bio-Rad protein assay reagent (BIO-RAD, Hercules, CA).

11.1.6. Western blot Approximately 5-25 μg of total protein was electrophoresed on a 7.5% SDS-PAGE gel and further electroblotted onto a PVDF-P membrane (Millipore). After blocking for 1 hour at room temperature (blocking buffer: 5% dry milk and 0.1% Tween-20 in 1 × PBS), the blot was polyclonal rabbit anti-β-galactosidase antibody (Research Diagnostics Inc. , NJ) with a 1: 2500 dilution, washed three times with blocking buffer, and then incubated with a 1: 5000 dilution of anti-rabbit HRP-conjugated secondary antibody. After incubation at room temperature for 1 hour, the cells were washed three times in blocking buffer and developed with ECL PLus Western blotting reagent (Amersham Pharmacia Biotech, Piscataway, NJ).

11.1.7. In situ β-gal staining Cells were monitored for functional β-galactosidase expression using a β-gal staining kit (Invitrogen, Carlsbad, Calif.). The percentage of β-gal positive cells was determined by calculating stained versus unstained cells in 5-10 randomly selected fields.

11.1.8. Selection of neomycin resistant clones expressing endogenous defective lacZ pre-mRNA target
On day 1, 1 × 10 ⁶ 293 cells were plated on 60 mm plates and grown at 37 ° C. for 24 hours. On the second day, cells were transfected with 2 μg of pc3.1lacZCF9m using Lipofectamine plus transfection reagent as described above. Forty-eight hours after transfection, cells were diluted (1:20 ratio) in medium containing 0.5 mg / ml G418 and grown. At the end of 2 weeks, neomycin resistant colonies were selected, pooled and expanded and always maintained in the presence of G418.

11.2. Results We developed a model system that allows easy and versatile analysis of spliceosome-mediated RNA trans-splicing in cells. The bacterial lacZ gene was cleaved with a truncated intron 9 derived from the cystic fibrosis transmembrane conductance regulatory protein (CFTR) gene (FIG. 37A). This split lacZ gene, when introduced into human 293T cells, induced the synthesis of lacZ pre-mRNA capable of proper splicing. The open reading frame of this lacZ gene was mutated by inserting two nonsense codons in-frame near the 5 ′ end of the second exon (FIG. 37A). This lacZ gene is called lacZCF9m. In 293T cells, lacZCF9m induced the synthesis of lacZCF9m pre-mRNA encoding a truncated β-galactosidase (β-gal) protein without enzymatic activity. Cells carrying the lacZCF9m gene serve as a model system for genetic diseases caused by loss-of-function mutations.

  A pretrans-splicing molecule (PTM) was designed to trans-splice with the lacZCF9m pre-mRNA to repair mutations caused by two nonsense codons. PTMs with binding domains spanning 23, 91 and 153 nucleotides (nt) were constructed and designated PTM-CF14, PTM-CF22 and PTM-CF24 (FIG. 37B). The PTM-CF24 binding domain does not bind to the 153 contiguous nucleotides of the target CFTR gene intron 9, but rather creates a 47 nucleotide loop in the target that lies between the complementary region of 27 and 126 nucleotides ( FIG. 37B). These PTMs were presumed to repair defects created by lacZCF9m (FIG. 37C).

  Semi-quantitative RT-PCR analysis was used to examine the efficiency of PTM-mediated trans-splicing with a long target binding domain. Repair of lacZCF9m transcripts by trans-splicing was investigated in two different ways: co-transfection of PTM with the target (lacZCF9m) plasmid or transfection of cells modified to express the target as endogenous pre-mRNA. . Co-transfecting a plasmid encoding PTM with the lacZCF9m plasmid was an easy way to screen the former for its efficiency. PTM-CF22 and PTM-CF24 are approximately 3 and 10 times more efficient than PTM-CF14 in the semi-quantitative RT-PCR assay, indicating a significant improvement in mRNA repair (Figure 38). Sequencing of the RT-PCR product showed that trans-splicing was correct, resulting in proper ligation of the target and exons from the PTM. Furthermore, mutations in key cis-acting elements in the 3 'splice site of PTM prevented trans-splicing. In these assays and all other assays described herein, control experiments were performed to rule out DNA level recombination. Thus, repair of the lacZCF9m transcript was the result of target RNA trans-splicing.

  Transfection of PTM-CF14, PTM-CF22 or PTM-CF24 into 293 cells with the endogenous lacZCF9m gene confirmed that the longer the target binding domain, the more efficient PTM is (FIG. 38B). Equivalent levels of RT-PCR trans-splicing specific products were obtained after 30 and 35 cycles of PCR for PTM-CF24 and PTM-CF14, respectively. Thus, this data indicates that PTMs with long binding domains repaired the lacZCF9m transcript at a level at least an order of magnitude higher than previously reported PTMs.

  More than 1 out of 10 lacZCF9m can be repaired by trans-splicing. Quantitative real-time PCR was used to determine the percentage of lacZCF9m transcript repaired by PTM with a long binding domain. The co-transfection assay described above was used in these experiments. PTM-CF14, containing a 23 nucleotide binding domain, was shown to repair lacZCF9 mRNA in 1.2-1.6% in 293T cells and 2.1% in H1299 human lung cancer cells. PTM-CF24, which has a long binding domain of 153 nucleotides, was significantly more efficient, correcting 12.1 to 15.2% in 293T cells and 19.7% in lacZCF9 mRNA in H1299 cells. As a result this resulted in a measurable decrease in the level of lacZCF9m mRNA. These data also confirmed the remarkable ability of this RT-PCR assay to distinguish between the cis-spliced product lacZCF9m mRNA and the trans-spliced product repaired lacZCF9m mRNA. This is the first true quantification of mRNA repair efficiency mediated by trans-splicing at the RNA level. These data confirm the suggestion of the semi-quantitative RT-PCR analysis shown above. Similar experiments were performed with 293 cells expressing the endogenous lacZCF9m pre-mRNA target. Consistent with the data shown above, PTM-CF24 is 10 times more efficient than PTM-CF14, which corrects 1.3-4.1% of the endogenous lacZCF9m transcript. These data confirm that increasing the length of the PTM results in a significant increase in trans-splicing efficiency.

  MRNA repair mediated by trans-splicing results in the synthesis of active β-galactosidase. The final criterion for successful repair of mRNA at the cellular level is the production of active protein. A Western assay was used to confirm that full-length β-gal was produced as a result of trans-splicing. Full length β-gal was not observed after 293T cells were transfected with plasmids encoding lacZCF9m or PTM-CF24. However, co-transfection of both plasmids resulted in the active production of full-length β-gal protein, which was easily detected using anti-β-gal antiserum (FIG. 39). This result complements the enzyme activity data, suggesting that the enzyme activity data was not due to supplementation of the truncated β-gal protein. Western blot analysis revealed that full-length β-gal protein was generated by trans-splicing in 293T cells, and further confirmed that PTMs with long binding domains were efficiently spliced.

  Proper repair of β-gal mRNA and synthesis of full-length β-gal protein should result in the production of active enzyme. Indeed, 293T cells co-transfected with lacZCF9m and PTM-CF24 were shown to have β-gal activity when measured either in situ (FIG. 40A) or extract (FIG. 40B). This activity was shown to be due to trans-splicing between the target pre-mRNA and PTM. In addition, the quantitative liquid phase assay further confirmed the data presented above, ie, PTM-CF22 and PTM-CF24 were 2.9-fold and 9.3-fold more efficient than PTM-CF14, respectively. However, the most remarkable result was obtained when 293T cells having lacZCF9m as a stable endogenous gene were used. When these cells were transfected with PTM-CF14, the level of β-gal activity obtained was barely above background. However, transfection with PTM-CF24 resulted in significant levels of β-gal activity (FIG. 40C). This was done in parallel with the appearance of full-length β-gal protein. These data show a significant increase in trans-splicing efficiency to repair the mutated pre-mRNA. Indeed, all previous reports on the repair of endogenous RNA in mammalian cells, either by group I ribozymes or trans-splicing, have only described signs of low level repair using RT-PCR.

  PTMs with very long binding domains are highly specific. It was shown that the secondary structure within the binding domain can enhance the specificity of PTM in HeLa nuclear extract. In order to confirm the specificity of the trans-splicing reaction in vivo, a second target gene that can function as a reporter for non-specific reaction was prepared. This gene is called lacZHCG1m and shares the first exon with lacZCF9m. The intron of lacZHCG1m is intron 1 of the β-subunit of human chorionic gonadotropin gene 6 (βhCG6), and the second exon is exon 2 of the same gene. lacZHCG1m drives the synthesis of a pre-mRNA that is correctly spliced to yield a chimeric mRNA that does not encode full-length β-gal (see below). PTM-CF14, PTM-CF22 and PTM-CF24 are not targeted to the lacZHCG1m pre-mRNA because there is no complementarity between the binding domains in these PTMs and target genes. Therefore, all of the splicing between these PTM and lacZHCG1m pre-mRNA is nonspecific (FIG. 41A).

  293T cells were transfected with PTM-CF14, PTM-CF22 or PTM-CF24 and the level of non-specific trans-splicing was measured by RT-PCR and liquid phase β-gal assay. Semi-quantitative RT-PCR suggested that PTM-CF24 is much less prone to trans-splicing with lacZHCG1m pre-mRNA than PTM-CF14. As confirmed by measurement of β-gal activity, cells co-transfected with lacZHCG1m and PTM-CF24 were 3.7 times less β than those co-transfected with lacZHCG1m and PTM-CF14. Only -gal occurred (Figure 41C). Based on these data, PTM-CF24 was estimated to be 50 times more likely to cause trans-splicing to that target than to a non-specific target. SPTM-CF24, a “safety” form of PTM-CF24, did not provide further specificity (FIG. 41C). However, again, for PTMs with shorter binding domains, a “safety” stem containing the binding domain was found to increase specificity in vivo (FIG. 41C). From these data, it was concluded that long binding domains result in PTMs that are not only highly efficient but also highly specific.

  The observation that long binding domains increased the specificity of PTM suggested that very long binding domains (> 200 nt) could further enhance discrimination. Plasmids encoding PTM-CF26 and -CF27 with binding domains spanning 200 and 411 nucleotides, respectively, were constructed and co-transfected with the lacZHCG1m plasmid. Nonspecific trans-splicing of these two PTMs was barely detectable by RT-PCR (Figure 41B). PTM-CF26 and PTM-CF27 had minimal non-specific trans-splicing activity as measured by β-gal assay (FIG. 41C). In a specific trans-splicing reaction with lacZCF9m as measured by liquid phase β-gal assay, PTM-CF26 was as active as PTM-CF14 (FIG. 41B). PTM-CF26 was estimated to be 80 times more likely to trans-splice against a specific target (lacZCF9m) than to a non-specific target (lacZHCG1m). Thus, including very long binding domains confers very high specificity to these PTMs.

12. Example: Repair of factor VIII gene with 3 'exon replacement Hemophilia is a bleeding disorder caused by a deficiency of one of the blood clotting factors. Hemophilia A accounts for about 80% of all cases and is deficient in coagulation factor VIII. The following sections describe the successful repair of the coagulation factor VIII gene using spliceosome-mediated trans-splicing and demonstrate the feasibility of repair of factor VIII using gene therapy.

  The coding region of murine factor VIII PTM (exons 16-24) was PCR amplified from a cDNA plasmid template with primers containing a unique restriction site for directional cloning. All PCR products were generated using cloned Pfu DNA polymerase (Stratagene, La Jolla, CA). The coding sequence was cloned into pc3.1DNA (-) using EcoRV and PmeI restriction sites. The binding domain (BD) was prepared by PCR using genomic DNA as a template. The primer contained a unique restriction site for directional cloning. This PCR product was cloned into an existing PTM plasmid (PTM-CF24, pc3.1DNA) using NheI and SacII restriction sites. This plasmid already contained the rest of the TSD element including the spacer sequence, polypyrimidine tract (PPT), branch point (BP) and 3 ′ acceptor site. The entire TSD was then subcloned into a vector containing the factor VIII PTM coding sequence (above). Finally, bovine growth hormone 3 'untranslated sequences from separate plasmid clones were subcloned into the PTM using PmeI and BamHI restriction sites.

  After sequencing the entire construct, possible ambiguous splicing was assayed by RT-PCR and then subcloned into AAV plasmid pDLZ20-M2 using XhoI and BamHI restriction sites (Chao et al., 2000, Gene Therapy 95 : 1594-1599; Flotte and Carter, 1998, Methods Enzymol., 292: 717-32). In some viral (and non-viral) delivery systems, the size of the therapeutic agent is important. Viral vectors, such as adeno-associated viruses, are (i) non-pathogenic viruses with a broad host range, (ii) have a lower inflammatory response compared to adenoviral vectors, and (iii) dividing cells And non-dividing cells can be infected. However, the packaging capacity of rAAV is limited to approximately 110% of the wild-type genome size, ie about 4.9 kB, so there is little room for large regulatory elements such as promoters and enhancers. Since B-domain deleted human factor VIII is close to the packaging size of AAV, trans-splicing offers the possibility of delivering smaller transgenes and allows for the addition of regulatory elements.

  An approximately 170 bp sequence was removed from the original AAV construct containing part of exon 1 and the entire intron 1 sequence to remove the ambiguous donor site of the pre-mRNA upstream of the XhoI PTM cloning site (see FIG. 44C).

  The repair model in FIG. 44D shows a simplified model of the mouse factor VIII pre-mRNA target (endogenous gene) consisting of exons 1-14, intron 14, exon 15, intron 16, and exons 16-24 containing the neomycin gene insert. The PTM shown in the figure consists of an exon 16-24 coding sequence and a trans-splicing domain with its own splicing elements (donor site, branch point and pyrimidine tract) and binding domain. Details of the binding domain are shown in FIGS. 44A and 44B. This binding domain is complementary to the splice site of intron 15 and part of exon 16 (5 ′ end).

  An important advantage of using 3 ′ exon replacement for gene repair is that (i) the construct requires less sequence and space than the full-length gene construct, thereby leaving more space for regulatory elements (ii) ) Since repair of SMaRT occurs only in cells that express the target gene, the potential problems associated with ectopic expression of the repaired RNA are eliminated.

  Factor VIII deficient mice were maintained in an animal facility at the University of North Carolina at Chapel Hil. For plasmid injection, each mouse was administered a sedative and placed under a dissecting microscope and a 1 cm vertical midline abdominal incision was made. Phosphate buffered saline containing approximately 100 micrograms of PTM plasmid DNA was injected into the liver portal vein. Blood was drawn from the retro-orbital plexus at intervals of 1, 2, 3 and 20 days after injection and factor VIII activity was assayed using the Coatest assay.

  The activity of factor VIII in blood samples taken from mice was assayed using a standard test called the core test assay. The assay was performed according to the manufacturer's instructions (Chromgenix AB, Milan, Italy). Data showing factor VIII repair in factor VIII knockout mice is shown in FIG.

  Hemophilia A defects in humans fall roughly into several categories, including whole DNA rearrangements, single DNA base substitutions, deletions and insertions. DNA rearrangement with inversion of exons 1-22 (including introns) and translocation away from exons 23-26 is confirmed to cause about 40% of all cases of severe hemophilia A Has been. The canine hemophilia A model is also very similar in overall rearrangement. This mutation is used as the basis for our human and canine factor VIII PTM design.

The method of construction of human factor VIII PTM is that different coding regions (exons 23-26) are amplified from human cDNA, binding domains are amplified from human genomic sequence templates (total genomic DNA or genomic clones), and repaired factor VIII PTMs used to detect proteins are very similar to those described above for mouse PTMs, except that the C-terminal FLAG tag is genetically engineered. The remaining elements of the trans-splicing domain, including the spacer sequence, polypyrimidine tract (PPT), branch point (BP) and 3 ′ acceptor site, are obtained from existing plasmids. If necessary, changes are made to the binding domain sequence to eliminate ambiguous splicing within the PTM. The final PTM was subcloned into the same mouse AAV plasmid vector pDLZ20-M2 and virus was prepared from this plasmid. Canine factor VIII PTM was prepared in the same manner except that canine cDNA and genomic plasmid were used.
13. Examples: Target trans-splicing of papillomavirus RNA The majority of cervical cancers are associated with oncogenic human papillomavirus (HPV) and express viral mRNAs encoding E6 and E7 oncoproteins. As described below, PTM is targeted to the E6 region of HPV-16 and uses a 5 'splice site located at nucleotide 226 to splice the TM exon to the 5' end of the E6 ORF.

13.1 Materials and methods
Target DNA (p1059) was used to examine PTM efficiency, which includes the SV40 early promoter and the entire HPV-16 early region (nt 79-4468) cloned behind the origin of replication. Specificity was assessed using the heterologous expression vector lacZCF9m as a target (Puttaraju et al., 2001. Mol Ther 4: 105-14). The plasmid was prepared using Quiagen maxi prep kit.

A 6 cm plate almost confluent of 293 cells was transfected with 2 μg of target DNA and 2 μg of PTM DNA using Lipofectamine 2000 (Life Technologies). Two days after transfection, the cells on the plate were washed with PBS and lysed on the plate using 300 μl lysis buffer. Total cellular RNA was prepared using the Ambion RNAqueous kit. Transfected DNA was removed from RNA by LiCl precipitation followed by DNase I treatment and removal reagent using Amboin DNA-free ^™ DNAse treatment.

  RT from the High Capacity cDNA Archive Kit (PE Applied Biosystems) was used according to the manufacturer's instructions (with the following modifications: the amount of random primer was halved and 5 μl of 50 μM oligo (dTl6) per 100 μl reaction. The stock solution and 5 μl of 20 units / μl RNase inhibitor stock solution were added), and the RNA was converted to cDNA. The RT reaction was diluted to 50 ng / μl and 5 ng / μl (relative to the original RNA content) for real-time quantitative PCR (QPCR) analysis. The amount of specific cis and trans splice mRNA was quantified using real-time quantitative PCR. These assays are called real-time QRT-PCR. These reactions were essentially performed as described previously (Puttaraju et al., 2001 Mol Ther 4: 105-14) using the SYBR Green Kit from PE Applied Biosystems, using a Bio-Rad iCycler iQ Real Time PCR instrument. I went.

  Total HPV-16 RNA levels (cis and trans-spliced) were assessed using a common amplicon in E6 exon 1 (HPV-16 nt152-204; 53 bp). This assay uses HPV-16 primers oJMD-15 (ACAGAGCTGCAAACAACTAT) and oJMD-16 (TTGCAGTACACATTCTAA). The amount of RT reaction used for each PCR reaction was 5 ng. Trans-splicing from the nt226 5 ′ splice site of HPV-16 to the PTM lacZ exon was evaluated using a 53 bp chimeric amplicon. This assay uses HPV-16 sense primer oCCB-348 (GCAAGCAACAGTTACTGCGA; HPV-16 nt 201-220) and lacZ antisense primer oCCB-322 (ATCCACCCAGTCCCAGA). The amount of RT reaction used for each PCR reaction was 50 ng. Both assays used the same plasmid (p3671) to generate a standard curve for quantification. Trans-splicing from the nt880 5 ′ splice site of HPV-16 to the PTM lacZ exon was evaluated using a 50 bp chimeric amplicon. This assay uses HPV-16 sense primer oCCB-366 (ATCTACCATGGCTGATCCTG; HPV-16 nt858-877) and lacZ antisense primer oCCB-322. The amount of RT reaction used for each PCR reaction was 50 ng. Plasmid p3672 was used to generate a standard curve for this assay.

  The plasmid used as the standard for real-time QPCR was cloned as follows. The RT reaction from co-transfection of p1059 and HPV-PTM1 in 293T cells was used as a template for the PCR reaction. Primers oCCB-257 (HPV-16 nt127-147; ACCCAGAAAGTTACCACAGTT) and oCCB-322 showed a 127 bp band which was TOPO cloned into pCRII-TOPO (Invitrogen) to give p3671. Sequencing showed that this DNA corresponds to trans-splicing from HPV-16 nt226 to the 3 'splice site of PTM. Primers oJMD-17 (HPV-16 nt 689-708; GACAAGCAGAACCGGACAGA) and oCCB-322 showed a 219 bp band, which was TOPO cloned into pCRII-TOPO to obtain p3672. Sequencing showed that this DNA corresponds to trans-splicing from HPV-16 nt880 to the 3 'splice site of PTM. The stock plasmid solution (1 ng / μl) was quantified using PicoGreen (Molecular Probes) before being used for the standard curve.

  Cis and trans-splicing quantification for co-transfection with PTM and target lacZCF9m was performed exactly as described previously (Puttaraju et al., 2001. Mol. Ther. 4: 105-14). The amount of RT reaction used for each PCR reaction was 5 ng.

13.2 Results
HPV and CF PTM were co-transfected into 293 cells with HPV-16 expression vector p1059 to assess trans-splicing efficiency or with lacZCF9m (including CF intron) to assess trans-splicing specificity. Real-time QRT-PCR assays were performed as described above to assess the level of trans-splicing for each target cis-splicing. The results are shown in Table 1. Total RNA levels are expressed as DNA standard fg. Standards p3671 and p3672 are close to the same size, so these values can be used and expressed in relative RNA levels for each assay. HPV-PTM1, 2, 5 and 6 were efficiently trans-spliced into the nt226 5 ′ splice site of HPV-16. HPV-PTM1 showed up to 70% trans-splicing. As expected, HPV-PTM5 trans-splicing was abolished by mutations in the PTM branch and polypyrimidine tracts. These PTMs showed less than 1% trans-splicing to the nt 880 5 ′ splice site. This data is consistent with these PTM designs having binding domains complementary to nucleotides 409 and 526 3 ′ splice sites. 880 HPV-PTM-8 and HPV-PTM-9 trans-binding domains downstream of the 5 'splice site show efficient trans-splicing to the 5' splice site (37% for HPV-PTM8 and 22% for HPV-PTM9) The trans-splicing efficiency for the nt226 5 ′ splice site is somewhat lower. HPV-PTM9 interferes with the binding of the splicing factor to the nt880 5 ′ splice site by steric hindrance. In addition, the specificity of HPV-PTM1, 2, 5 and 6 was also evaluated by the trans-splicing ability for target pre-mRNA having CF intron. Specificity ranged from 274 to 606 times.

14. Example: Target Papillomavirus PTM Design The first therapeutic drug precursor RNA molecule ("PTM") is developed based on the abundance and splicing pattern of HPV mRNA. A transcription map of HPV-16 in benign infection is shown in FIG. Cis and trans-splicing assays are performed on this initial PTM and the data obtained from those assays are used to create a specific PTM with optimal efficiency in the RNA trans-splicing reaction mediated by the spliceosome.

  The most efficient PTMs are those that transsplice the HPV target transcript with a PTM that encodes a toxic product that kills infected cells. In the most commonly used HPV target splice site targeting, two active 5 'splice site targets and two active 3' splice site targets can be used. When designing PTMs to block sites that are used more frequently, splice sites that are used less frequently may be sufficient targets. In many cervical cancers, HPV-16 incorporation only results in expression of the E6 and E7 regions in these cancers, so the choice of target splice site is further limited by whether its strength is intended for cancer therapy .

  The following target splice sites are used in the development of the first PTM that results in the expression of toxic products.

i) 5 'splice site target:
nt226: This splice site is used for the synthesis of all E6 ^* species. In most tumors and cell lines, the majority of P97 promoter transcripts are spliced using this 5 'splice site.

nt880: This splice site is used for the synthesis of all E6US (non-splicing) and E6 ^* species except E6 ^* III, both splice sites being suitable targets for both proliferative infection and cancer.

ii) 3 'splice site target:
nt409: This 3 ′ splice site is generally used for splicing of E6 ^* I species that are more abundant than E6 ^* II species. This splice site is used for cancer and proliferative HPV infection.

  nt3358: This target is used for splicing most mRNAs only when the viral DNA is extrachromosomal. This splice site is not a good target for the treatment of most cancers.

  In addition, dual trans-splicing PTMs are developed to replace internal exons nt409-880 or nt526-880 in proliferatively infected tissues or cancer.

Alternatively, the initial PTM is designed such that trans-splicing results in an mRNA that encodes a fusion protein that is a partial virus and a partial foreign peptide encoded by the PTM. This fusion protein alters the function of the viral protein to inhibit essential viral functions. The splice site is targeted to produce the following three viral fusion proteins:
(i) N-terminus of E6 using 226 5 'splice site as target
(ii) C6 terminus of E6 using nt409 (best) or nt526 3 'splice site as target
(iii) C2 terminus of E2 using nt3358 3 ′ splice site as target.

  This fusion protein is produced in productive infections and cancers involving extrachromosomal viral DNA. The C-terminal domain of E2 is a DNA binding and dimerization domain that can be used to target the fusion protein to the P97 promoter and block transcription. At high concentrations, the E2 viral protein binds immediately upstream of the P97 promoter and inhibits transcription by competing with transcription factors SP1 and TFIID for binding. However, these E2 binding sites are weaker than those upstream of the long regulatory region (LCR) and saturate only at high concentrations of viral E2 protein. At low concentrations of E2, this protein binds to the E2 binding site of the upstream LCR and activates transcription. Thus, adding a “repressor” domain to a fusion protein can block transcription by binding to any E2 binding site. This fusion protein is also useful for blocking viral DNA replication because the E1 / E2 complex binds to the origin of replication. However, it has been shown that the complex of E2 DNA binding domain and E1 does not bind to this origin. Since E2 is a dimer, heterodimerization of the E2 fusion protein with the full-length E2 protein will likely lose the function of E2 in DNA replication.

  Diphtheria toxin sub that constructs a PTM based on targeting and trans-splicing ability to the HPV target splice site shown above in FIG. 48 and kills infected cells or expresses a marker gene that can be easily detected by splicing Screen for expression of unit A (DT-A) product. Other peptide or protein toxins may also be encoded. A typical prototype PTM (3 ′ trans-splicing) is an antisense target binding domain (25 or more) complementary to the HPV sequence, a spacer sequence, a standard branch point sequence (UACUAAC), an extended polypyrimidine tract (12-15U) 3 'splice site AG dinucleotide followed by the gene to be delivered. PTMs are also constructed so that PTM-mediated trans-splicing occurs using the HPV 3 ′ splice site (FIG. 66B). The PTM trans-splicing domain (TSD) is constructed in a modular fashion. Incorporate a unique restriction site between each PTM element to facilitate individual element replacement. Schematic diagrams of 3 ′ exon substitution and 5 ′ exon substitution models are shown, respectively (FIGS. 66A-B). To date, both trans-splicing efficiency and specificity can be substantially regulated by several sequence changes in TSD, including binding domain length, spacer sequence, and PPT strength. Proven.

  “Linear” PTMs are initially designed to identify PTM sequences that maximize trans-splicing efficiency, thereby giving very high trans-splicing efficiency. Linear PTM refers to the binding domain of PTM as a single-stranded form. To achieve a high degree of targeting specificity, another form of TSD called a “safety stem” can be constructed. In these PTMs, the splice site of the PTM is protected from reaction with other pre-mRNA targets by binding to itself in a folded structure. Contact with a specific target facilitates release of the safety stem, exposure and activation of the PTM 3 'splice site for spliceosome formation.

  A PTM is also constructed that requires two trans-splicing events to obtain the expected therapeutic effect to further increase the specificity of trans-splicing (FIG. 65). This PTM has an upstream 3 'splice site that trans-splices into the HPV 5' splice site, thereby producing a single trans-spliced product. This product will be inactive because it does not contain the necessary polyadenylation signal and is incapable of nucleocytoplasmic transport and mRNA translation. The second splicing event using the HPV 3 'splice site needs to provide a PTM with the signal required for polyadenylation (Figure 65). Polyadenylation is required for PTMs with linear binding domains in which both the 3 'and 5' binding domains are linear, or PTMs with 3 'safety + 5' linear binding domains, which inhibit viral expression Also designed for. In addition, PTMs are also designed as “dual safety” PTMs with both 3 ′ and 5 ′ safety splice sites, or 3 ′ linear or 5 ′ safety sites.

  These PTM tests are performed using in vitro splicing assays and cell culture based assays. In order to examine the trans-splicing ability of PTM, a cell line containing HPV-16 is used. W12 cells (80263 cells) contain extrachromosomal HPV-16 DNA and express the entire HPV-16 early region and can be used to test PTM targeting. SiHa and CaSki cell lines contain integrated HPV-16 and express only the E6 / E7 / 5′E1 region of the virus. These cell lines are useful because they express viral pre-mRNA characteristic of that expressed in cervical cancer. However, they are not useful cell lines for testing PTMs that target the 3358 3 'splice site. CaSki cells express significantly higher levels of HPV-16 mRNA than any other cell line tested, making them the best cells to assay for other PTMs.

  Co-transfection experiments with cell culture-based PTM expression vector and HPV-16 early region expression vector assay for PTM expression. Several plasmids that drive the expression of HPV-16 were constructed. For example, two plasmids that can be used in co-transfection experiments include those that express HPV-16 under the direction of either the SV40 early promoter (p1059) or the K14 promoter (p2571; pK14-1203).

  Assay for alternative splicing using isoform-specific (ie, splice-specific) primers in combination with quantitative real-time reverse transcription polymerase chain reaction (QRT / PCR). This assay is highly isoform specific, relatively insensitive to RNA degradation, sensitive to single molecule cDNA, has a wide dynamic range (at least on the order of 70), and The absolute amount of each isoform is obtained. Primer pairs specific to each PTM / target pre-mRNA combination are used. The sequence specificity of this assay allows the specificity of the trans-splicing reaction to be monitored. The sensitivity and quantification of the assay and the rapidity in developing and performing the assay are useful for optimizing the PTM targeted to the papillomavirus pre-mRNA.

  The specificity of trans-splicing induced by PTM (i.e., to determine the specificity of target trans-splicing to HPV target pre-mRNA) is also 5 'and / or 3 at the end of the cDNA according to standard techniques. 'Evaluate by rapid amplification (RACE). This method is relatively quick compared to the construction of a conventional cDNA library and gives the complete sequence of the 5 ′ and / or 3 ′ cDNA ends, thus determining the number of specific and non-specific splicing events. it can. First, two cDNA libraries are constructed consisting of RNA isolated from cells co-transfected with (i) a linear PTM + HPV minigene target and (ii) a safety PTM + HPV minigene target. For example, to identify the 5 'end (3' exon substitution) of trans-spliced RNA, a 5 'RACE assay is performed using PTM antisense primers. Similarly, a 3 ′ RACE assay is performed using PTM sense primers to identify the 3 ′ end (5 ′ exon substitution) of the trans-spliced RNA. This cDNA is amplified by PCR, digested with restriction enzymes, and cloned into a plasmid vector. These cDNA clones are first screened by colony hybridization using a PTM specific probe. Positive clones are selected from each cDNA library, sequenced, and the specificity of linear PTM and safety PTM is compared using the sequence information. This allows identification of non-specific targets that transsplice at high frequency. Analyzing these targets provides useful information about the sequences that cause non-specific trans-splicing and helps in the construction of specific PTMs.

  Using the data of trans-splicing efficiency and specificity obtained from the analysis of the first candidate PTM in the trans-splicing assay, we will devise and develop a PTM with the optimal trans-splicing ability. These optimal PTMs are analyzed using the trans-splicing assay described above.

  Organ mouse model of papillomavirus infection using the typical “raft / xenograft” technique. Papillomaviruses are generally species and cell type specific. A productive infection was established in nude mice using bovine keratinocytes and bovine papillomavirus. In this system, keratinocytes are first plated on collagen “raft” containing fibroblasts and grown to confluence in tissue culture. Next, keratinocytes are infected with papillomavirus or keratinocytes are transfected with viral genomic DNA and grown in culture for several days. These rafts are then transplanted into the back of nude mice where they develop into productively infected bovine tissue. Human papillomavirus infection can also be established using the same technique using a combination of human papillomavirus and keratinocytes. This system is useful for examining the in vivo efficiency of anti-papillomavirus PTM. In addition, transplantation of cervical cancer tissue or cervical cancer cell lines into nude mice is also used. Tests can also be conducted using several animal models including bovine papilloma virus (BPV-1), canine oral papilloma virus (COPV), and cottontail rabbit papilloma virus (CRPV). COPV is particularly useful as a good model for vaccine development.

  The present invention is not limited in scope to the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims. Various references are cited herein, the entire disclosures of which are incorporated herein by reference.

Pre-trans-splicing RNA model. Model PTM constructs and targeted trans-splicing strategies. Schematic diagram of the first generation PTM (PTM + Sp and PTM-Sp). BD, binding domain; NBD, non-binding domain; BP, branch point; PPT, pyrimidine tract; ss, splice site; and DT-A, diphtheria toxin subunit A. Unique restriction sites within PTMS are indicated by a single letter: E, EcoRI; X, Xhol; K, Kpnl; P, Pstl; A, Accl; B, BamHI and H, HindIII. The schematic diagram which showed the coupling | bonding of PTM + Sp and (beta) HCG6 target pre mRNA by the conventional Watson Crick base pairing, and the proposed cis and trans splicing mechanism. In vitro trans-splicing efficiency of various PTM constructs against βHCG6 target. Targeted binding domains and active splice sites correlate with PTM trans-splicing activity. Full length target (pcPTM + Sp), non-target (PTM-Sp) and splice variants [Py (-) AG (-) and BP (-) Py (-) AG (-)] PTM RNA, βHCG6 target pre-mRNA Was added to the splicing reaction. These products were RT-PCR amplified using primers βHCG-F (specific for target βHCG6 exon 1) and DT-5R (complementary to DT-A) and analyzed by electrophoresis on a 1.5% agarose gel. In vitro trans-splicing efficiency of various PTM constructs. Full length PTM with spacer between binding domain and splice site (PTM + Sp), PTM without spacer region (PTM +) and short PTM with target binding domain (short PTM +) or non-target binding region (PTM-) , Added to the splicing reaction containing the βHCG target pre-mRNA. These products were RT-PCR amplified using primers βHCG-F and DT-3. For the reaction containing short PTM, since the binding site of DT-3 was removed from PTA, the reverse PCR primer was designated as DT-4. Nucleotide sequence showing the product of in vitro trans-splicing between PTM and target pre-mRNA. From FIG. 2 (lane 2), the 466 bp trans-spliced RT-PCR product was reamplified using a 5 'biotin labeled forward primer (βHCG-F) and a nested unlabeled reverse primer (DT-3R). Single stranded DNA was purified and sequenced directly using toxin-specific DT-3R primers. The arrow indicates the splice site between the last nucleotide of target βHCG6 exon 1 and the first nucleotide encoding DT-A. Schematic representation of “safety” PTMs and mutants showing PTM intramolecular base pairing stems intended to mask BP and PPT from splicing factors. The underlined sequence represents the βHCG6 intron 1 complementary target binding domain, and the italicized sequence indicates target mismatches that are homologous to BP. Schematic diagram of safety PTM in open configuration when bound to target. In vitro trans-splicing reactions were performed by incubating safety PTMs or safety PTM variants with a βHCG6 target. The splicing reaction was amplified by RT-PCR using βHCG-F and DT-3R primers and the products were analyzed on a 2.0% agarose gel. The specificity of targeted trans-splicing is enhanced by including a safety sequence in the PTM. βHCG6 pre-mRNA (250 ng) and β-globin pre-mRNA (250 ng) were annealed with either PTM + SF (safety) or pcPTM + Sp (linear) RNA (500 ng). In vitro trans-splicing reactions and RT-PCR analysis were performed as described in the experimental procedure, and the products were separated on a 2.0% agarose gel. Primers used for RT-PCR are as shown. In the presence of increasing PTM concentrations, cis-splicing is inhibited and replaced by trans-splicing. In vitro splicing reaction was performed while increasing the concentration of PTM (pcPTM + Sp) RNA (52-300 ng) in the presence of a certain amount of βHCG6 target pre-mRNA (100 ng). Primers βHCG-F (exon 1 specific) and βHCG-R2 (exon 2 specific-panel A) are used for RT-PCR of cis-spliced and non-spliced products, and primers for RT-PCR trans-spliced products βHCG-F and DT-3R were used (Panel B). The reaction products were analyzed on 1.5% and 2.0% agarose gels, respectively. In panel A, lane 9 represents the 60 minute time point in the presence of 300 ng PTM, which corresponds to lane 10 in panel B. PTM can be trans-spliced in cultured human cancer cells. Total RNA was isolated from each of four neomycin resistant H1299 lung carcinoma colonies (expressing non-toxic DT-A) transfected with pcSp + CRM, total RNA 1 μg and 5 ′ biotinylated βHCG-F and non-biotinylated DT- RT-PCR was performed using 3R primers. Single stranded DNA was purified and sequenced. The nucleotide sequence (sense strand) of the product trans-spliced between the endogenous βHCG6 target and CRM197 mutant toxin is shown. Two arrows indicate the position of the splice site. Schematic diagram of double splicing pre-treatment mRNA. Selective trans-splicing of double splicing PTM. By varying the PTM concentration, the PTM can be trans-spliced to either the target 5 'splice site or 3' splice site. Diagram showing the use of PTM molecules for exon tagging. Two examples of PTM are shown. The left PTM is capable of non-specific trans-splicing to the 3 'splice site of the target pre-mRNA. On the other hand, the right PTM is designed to non-specifically trans-splice to the 5 'splice site of the target pre-mRNA. The result of the PTM-mediated trans-splicing reaction results in a chimeric RNA comprising a specific tag on either the 5 'or 3' side of the exon. Schematic diagram of the construct used in the lacZ knockout model. The target lacZ pre-mRNA contains a 5 'fragment of lacZ, followed by βHCG6 intron 1 and a 3' fragment of lacZ (target 1). The PTM molecule used in this model system was generated by digesting pPTM + SP with PstI and HindIII and replacing the DT-A toxin with βHCG6 exon 2 (pc3.1PTM2). Schematic showing the recovery of β-Gal activity by RNA trans-splicing mediated by spliceosome. Schematic diagram of the construct used in the lacZ knock-in model (pc.3.1 lacZ T2). This lacZ target pre-mRNA is the same as the target pre-mRNA used in the knockout experiment except that it contains two stop codons (TAA TAA) in-frame 4 codons after the 3 'splice site. The PTM molecule used in this model system was generated by digesting pPTM + SP with PstI and HindIII and replacing the DT-A toxin with a functional 3 'fragment of lacZ. Shown with cis and trans splicing using lacZ knockout model. LacZ splice target 1 pre-mRNA and PTM2 were co-transfected into 293T cells. Total RNA was then isolated and analyzed by PCR for cis and trans spliced products using appropriate specific primers. Amplified PCR products were separated on a 2% agarose gel. Analysis of β-galactosidase activity. 293 cells were transfected with lacZ target 2 DNA alone. Analysis of β-galactosidase activity. 293 cells were transfected with lacZ target 2 DNA and PTM1. Nucleotide sequence of a trans-spliced molecule showing correct trans-splicing. Nucleotide sequence of cis-splicing product and trans-splicing product. These nucleotide sequences were the expected sequences for each of the different splicing reactions. A gene repair model for the repair of the cystic fibrosis transmembrane regulatory protein (CFTR) gene. RT-PCR showing trans-splicing between exogenously added CFTR minigene target and PTM. The plasmid was cotransfected into 293 embryonic kidney cells. The primer pair used for the RT-PCR reaction is indicated above each lane. The lower band (471 bp) in each lane indicates the trans-splicing product. The lower band (471 bp) in lane 1 was purified from a 2% Seakem agarose gel and the DNA sequence of the band was determined. DNA sequence of the trans-splicing product (lower band in lane 1 shown in FIG. 14). This DNA sequence indicates the presence of the F508 codon (CTT) and the exon 9 sequence is contiguous with the exon 10 sequence and the His tag sequence. Continuation of the DNA sequence of the trans-splicing product shown in FIG. 15A. Schematic diagram for the repair of exogenously added CFTR target molecule with F508 deletion in exon 10. Repair of endogenous CFTR transcript by exon 10 substitution using double splicing PTM. By using double splicing PTM, the Δ508 mutation can be repaired by extremely short PTM molecules. lacZ 5 'exon-CFTR miniintron 9-CFTR exon 10 (Δ508)-a model lacZ target consisting of a CFTR miniintron 10 followed by a lacZ 3' exon. The PTM binding domain is enclosed in parentheses. Schematic diagram of double trans-splicing PTM designed to restore β-gal function. Schematic diagram of double trans-splicing reaction showing binding of DSPTM7 and DSCFT1.6 target pre-mRNA. An important structural element of DSPTM7. Double spliced PTMs have both 3 'and 5' functional splice sites and binding domains. Schematic of mutant double splicing PTM. The accuracy of the double trans-splicing reaction. Double trans-splicing between the target pre-mRNA and DSPTM7 results in a full-length protein. Western blot analysis of whole cell lysates using polyclonal anti-β-galactosidase antiserum. Accurate internal exon substitution between DSCFT1.6 target pre-mRNA and DSPTM7 RNA by double trans-splicing results in a functionally active β-gal protein. Whole cell extracts were prepared and examined for β-gal activity by ONPG assay. The 3 'and 5' splice sites are essential for the restoration of β-gal function by a double trans-splicing reaction. Double trans-splicing: Target and PTM titration. Various concentrations of target and PTM were co-transfected and analyzed for recovery of β-gal activity. A construct designed to investigate the specificity of the double trans-splicing reaction. Specificity of the double trans-splicing reaction. Trans-splicing repair of the cystic fibrosis gene using PTM to mediate double trans-splicing events. PTM with a long binding domain that masks two splice sites of the minigene target and a portion of exon 10. Precisely spliced to PTM exon 10 (with codon modification), target exon 9 (top panel), codon 508 in PTM exon 10 (middle panel), and target exon 11 Single PCR product sequence showing PTM exon 10 (bottom panel). The repaired target sequence was generated by RT-PCR followed by PCR. Trans-splicing repair of cystic fibrosis using PTM capable of 5 'exon replacement. Schematic of three different PTM molecules with different binding domains. Schematic diagram of PTM exon 10 with codon usage modified to reduce the antisense effect due to its own binding domain. Cis and trans-spliced product sequences. A model system for messenger RNA repair by trans-splicing. Schematic representation of the defective lacZCF9m splice target used in this study (see Materials and Methods for details). BP, branch point; PPT, polypyrimidine tract; ss, splice site and pA, polyadenylation signal. Diagram of a prototype PTM showing the key components of the trans-splicing domain, and various PTMs showing the length of the binding domains and the approximate location where they bind to the target pre-mRNA. Unique restriction sites within the trans-splicing domain are N, Nhe I; S, Sac II; K, Kpn I and E, EcoR V. Schematic diagram showing PTM binding by antisense binding and repair of defective lacZ pre-mRNA by target RNA trans-splicing. The predicted cis and trans spliced products and the primer binding sites for Lac-9F, Lac-3R and Lac-5R are shown. Efficient repair of lacZ messenger RNA. Target specific primers Lac-9F (5 ′ exon) and Lac-3R (3 ′ exon) are used to amplify the cis-splicing product, while target and PTM specific primers Lac-9F (5 ′ exon) and Lac− The trans-splicing product was amplified using 5R (3 ′ exon) (lanes 7-15). Target cis-splicing was measured using 25-50 ng of total RNA (lanes 1-6), and RNA trans-splicing induced by PTM was measured using 50-200 ng of total RNA (lanes 7-12). Lanes 13-15 are 25-50 ng of total RNA from cells transfected with control lacZCF9 for trans-splicing. Repair of endogenous mRNA by trans-splicing. Lanes 1 to 3 are RNAs derived from cells transfected with PTM-CF14, lanes 4 to 6 are PTM-CF22, and lanes 7 to 9 are PTM-CF24. Lane 10 is RNA derived from mock-transfected cells, and lane 11 is a control without reverse transcription reaction. Messenger RNA repair results in the synthesis of full-length β-galactosidase. Lane 1 is lacZCF9 (positive control, 5 μg), lane 2 is lacZCF9m target alone (25 μg), lane 3 is PTM-CF24 alone (25 μg), and lane 4 is lacZCF9m target + PTM-CF24 (25 μg). Repair of messenger RNA by SMaRT results in a functional β-galactosidase. In situ detection of functional β-galactosidase generated by trans-splicing. As described above, 293T cells were transfected with lacZCF9m target alone (Panel A) (transient assay) or co-transfected with lacZCF9m target + PTM-CF24 (Panel B) expression plasmid. Cells were rinsed with PBS 48 hours after transfection and stained in situ for β-gal activity. Repair of defective lacZ mRNA results in a functional β-galactosidase. Extracts from cells transfected with either target and PTM, lacZCF9m target or PTM-CF24 plasmid alone, the rest were from cells co-transfected with lacZCF9m target and one of the indicated PTMs. Repair of endogenous mRNA by trans-splicing results in a functional β-galactosidase. Stable cells expressing the endogenous lacZCF9m pre-mRNA target were transfected with the “linear” PTM (PTM-CF14, PTM-CF22 or PTM-CF24) described above. Following transfection, whole cell lysates were prepared and assayed for β-gal activity. Results shown are the average of two independent transfections. Messenger RNA repair is specific. Experimental strategy to evaluate non-specific trans-splicing between lacZHCG1m pre-mRNA and "linear" PTM. Extension of the binding domain enhances the specificity of trans-splicing. Lanes 1-3 are PTM-CF14, 4-6 are PTM-CF22, 7-9 are PTM-CF24, 10-12 are PTM-CF26, and 13-15 are PTM-CF27. PTMs with very long binding domains can enhance specificity. Whole cell extracts (5 μl) were assayed for β-gal activity in the liquid phase and the specific activity was calculated. β-gal activity was normalized to mock. The results shown are the average values of two independent transfections. Controls, extracts from cells transfected with the lacZHCG1m target alone, others were co-transfected with one of the lacZHCG1m target and linear PTM. Full sequence of CFTR PTM30 (5 'exon replacement PTM) showing the trans-splicing domain (underlined) and the coding sequence of exons 1-10 of the CFTR gene. Codons modified with exon 10 are underlined and shown in bold. A 153 base pair PTM24 binding domain. Full sequence of CFTR PTM24 (3 ′ exon substituted PTM) showing the trans-splicing domain (underlined) and coding sequence of exons 10-24 of CFTR cDNA. There is a histidine tag and a translation stop codon at the end of the coding sequence. Detailed structure of mouse factor VIII PTM containing normal mouse sequences of exons 16-26. BGH = bovine growth hormone 3′UTR (untranslated sequence); binding domain = 125 bp; base changes to remove cryptic sites are circled: F5, F6, F7, F8 = primer sites. The schematic diagram which shows the range of the binding domain in a mouse factor VIII gene. Altering the promoters of AAV vectors pDLZ20 and pDLZ20-M2 to remove cryptic donor sites at sequences upstream of the PTM binding domain. Factor VIII repair model. Schematic diagram of PTM binding to the 3 'splice site of intron 15 of mouse factor VIII gene. Schematic diagram of F8 PTM with trans-splicing domain removed. This corresponds to a control PTM to determine if the repair is the result of trans-splicing. Data showing factor VIII repair in factor VIII knockout mice. Blood was examined for factor VIII activity using a core test assay. Detailed structure of mouse factor VIII PTM containing normal sequences of exons 16-26 and a C-terminal FLAG tag. BGH = bovine growth hormone 3 "UTR; binding domain = 125 bp. Detailed structure of human or canine factor VIII PTM containing normal sequences of exons 23-26. A transcription map of HPV-16. Disruption of type 16 human papillomavirus expression by PTM. Schematic of HPV-PTM2 binding to the 3 'splice site of type 16 HPV target pre-mRNA. E7 targeting strategy where multiple PTMs are targeted to HPV E7. PTM design showing binding domains, branch points and polypyrimidine tracts. (A) HPV-PTM1 with an 80 bp binding domain targeted to 3'ss at position 409. (B) HPV-PTM2 with a 149 bp binding domain targeted to the 3'ss at position 409. HPV-PTM3 and 4 binding domains. HPV-PTM5 and 6 binding domains. Bold nucleotides have been modified to avoid cryptic splicing of PTM. Location of the HPV-PTM targeting domain. Transsplicing efficiency of HPV-PTM in 293T cells. 293T cells were co-transfected with 2 μg p1059 target and 1.5 μg PTM expression plasmid. Total RNA was isolated 48 hours after transfection and analyzed by RT-PCR. The cis-spliced product was amplified using target-specific primers oJMD15 and JMD16 (lanes 1-11 in the upper panel), while the trans-splicing product was amplified using target and PTM-specific primers oJMD15 and Lac-6R ( Lower panel lanes 1-12). Thus, in lanes 13-14 (upper panel), RNA isolated from cells transfected with lacZCF9 and HPV-PTM1 and 2 respectively can be used as a control to assess the specificity of HPV-PTM. Nucleotide sequence showing the transsplice site between HPV target pre-mRNA and PTM. The RT-PCR product was purified and sequenced directly using primer Lac5R (which binds to the 3 ′ exon of PTM). The arrow indicates the trans-splice site between the HPV pre-mRNA target E6 and the PTM lacZ 3 'exon. Trans-splicing (co-transfection) in 293 cells. Trans-splicing efficiency was quantified using real-time QRT-PCR. Trans-splicing efficiency of HPV-PTM to endogenous pre-mRNA target. SiHa and CaSki cells were transfected with 1.5 μg HPV-PTM1,2 or CFTR target PTM14 or 27 expression plasmids. 48 hours after trans-splicing, total RNA was isolated and analyzed by RT-PCR. Trans-splicing between the endogenous HPV target and PTM was detected using target and PTM specific primers oJMD15 and Lac-16R. In the cells transfected with HPV-PTM, the expected trans-splicing product (418 bp) is clearly seen (lanes 2-3 and 5-7), but not in the control (lanes 1 and 4). Furthermore, trans-splicing is also detected in lane 8 due to non-specific trans-splicing. Accurate trans-splicing of HPV-PTM1 in SiHa cells. The target pre-mRNA was an endogenous mRNA. Sequence analysis of the trans-spliced chimeric RNA shows that trans-splicing is correct. Quantification of trans-splicing efficiency in SiHa cells using real-time QRT-PCR. Trans-splicing efficiency of HPV-PTM1, HPV-PTM5, and HPV-PTM6 in SiHa cells. Total RNA analysis was performed by RT-PCR. Deletion of polypyrimidine tract abolish trans-splicing. Lanes 1 and 2 show RNA from cells transfected with mutant HPV-PPT. Lanes 3 and 4 show RNA from cells transfected with the HPV-PTM5 plasmid. A 269 bp product obtained from trans-splicing is detected. Schematic representation of the PTM binding to the 5 'splice site of the HPV minigene target and the resulting trans-spliced chimeric RNA. Double trans-splicing. Schematic of dual trans-splicing PTM binding to 3 'and 5' splice sites of HPV minigene target. The resulting trans-spliced mRNA is shown. (A) Trans-splicing by 3 'exon substitution. Schematic of PTM binding to the 3 'splice site of the HPV minigene target. (B) Trans-splicing by 5 'exon substitution. Schematic representation of PTM binding to the 5 'splice site of the HPV minigene target. Schematic diagram of double splicing HPV-PTM designed for internal exon replacement.

Claims (38)

A cell comprising a nucleic acid molecule, the nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to non-human factor VIII pre-mRNA expressed in a cell;
b) a 3 ′ splice region comprising a branch point and a 3 ′ splice acceptor site;
c) a spacer region that separates the 3 ′ splice region from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
And the nucleic acid molecule is recognized by a nuclear splicing component in the cell. A cell comprising a nucleic acid molecule, the nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to non-human factor VIII pre-mRNA expressed in a cell;
b) 3 'splice acceptor site;
c) a spacer region that separates the 3 ′ splice region from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
And the nucleic acid molecule is recognized by a nuclear splicing component in the cell. A cell comprising a nucleic acid molecule, the nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to non-human factor VIII pre-mRNA expressed in a cell;
b) 5 'splice site;
c) a spacer region separating the 5 ′ splice site from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
And the nucleic acid molecule is recognized by a nuclear splicing component in the cell.   2. The cell of claim 1, wherein the nucleic acid molecule further comprises a 5 'donor site.   2. The cell of claim 1, wherein the 3 'splice region further comprises a pyrimidine tract.   2. The cell of claim 1, wherein the nucleic acid molecule further comprises a safety sequence comprising one or more complementary sequences that bind to one or both sides of the 5 'splice site.   2. The cell of claim 1, wherein the nucleic acid molecule further comprises a safety nucleotide sequence comprising one or more complementary sequences that bind to one or both sides of the 3 'splice region.   2. The cell of claim 1, wherein binding of the nucleic acid molecule to a target pre-mRNA is mediated by complementarity, triple helix formation or protein-nucleic acid interaction.   2. The cell of claim 1, wherein the nucleotide sequence trans-spliced to the target pre-mRNA encodes canon non-human factor VIII protein exons 23-26 or mouse non-human factor VIII protein exons 16-26. A cell comprising a recombinant vector that expresses a nucleic acid molecule, the nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to non-human factor VIII pre-mRNA expressed in a cell;
b) a 3 ′ splice region comprising a branch point and a 3 ′ splice acceptor site;
c) a spacer region that separates the 3 ′ splice region from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
And the nucleic acid molecule is recognized by a nuclear splicing component in the cell. A cell comprising a recombinant vector that expresses a nucleic acid molecule, the nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to non-human factor VIII pre-mRNA expressed in a cell;
b) 3 'splice acceptor site;
c) a spacer region that separates the 3 ′ splice region from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
And the nucleic acid molecule is recognized by a nuclear splicing component in the cell. A cell comprising a recombinant vector that expresses a nucleic acid molecule, the nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to non-human factor VIII pre-mRNA expressed in a cell;
b) 5 'splice site;
c) a spacer region separating the 5 ′ splice site from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
And the nucleic acid molecule is recognized by a nuclear splicing component in the cell.   11. The cell of claim 10, wherein the nucleic acid molecule further comprises a 5 'donor site.   11. The cell of claim 10, wherein the 3 'splice region further comprises a pyrimidine tract.   11. The cell of claim 10, wherein the nucleic acid molecule further comprises a safety nucleotide sequence comprising one or more complementary sequences that bind to one or both sides of the 3 'splice region. A method for producing a chimeric RNA molecule in a cell comprising:
The target non-human factor VIII pre-mRNA expressed in the cell and the nucleic acid molecule recognized by the nuclear splicing component are partially spliced into a part of the target pre-mRNA, and the chimeric RNA in the cell Contacting under conditions that form a nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to non-human factor VIII pre-mRNA expressed in a cell;
b) a 3 ′ splice region comprising a branch point and a 3 ′ splice acceptor site;
c) a spacer region that separates the 3 ′ splice region from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
Comprising the above method. A method for producing a chimeric RNA molecule in a cell comprising:
The target non-human factor VIII pre-mRNA expressed in the cell and the nucleic acid molecule recognized by the nuclear splicing component are partially spliced into a part of the target pre-mRNA, and the chimeric RNA in the cell Contacting under conditions that form a nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to non-human factor VIII pre-mRNA expressed in a cell;
b) 3 'splice acceptor site;
c) a spacer region that separates the 3 ′ splice region from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
Comprising the above method. A method for producing a chimeric RNA molecule in a cell comprising:
Contacting a target non-human factor VIII pre-mRNA expressed in a cell with a nucleic acid molecule recognized by a nuclear splicing component, the nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to non-human factor VIII pre-mRNA expressed in a cell;
b) 5 'splice site;
c) a spacer region separating the 5 ′ splice site from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
And the nucleic acid molecule is recognized by a nuclear splicing component in a cell.   17. The method of claim 16, wherein the nucleic acid molecule further comprises a 5 'donor site.   17. The method of claim 16, wherein the 3 'splice region further comprises a pyrimidine tract.   17. The method of claim 16, wherein the nucleic acid molecule further comprises a safety nucleotide sequence comprising one or more complementary sequences that bind to one or both sides of the 3 'splice region. a) one or more target binding domains that target the binding of nucleic acid molecules to non-human factor VIII pre-mRNA expressed in cells;
b) a 3 ′ splice region comprising a branch point and a 3 ′ splice acceptor site;
c) a spacer region that separates the 3 ′ splice region from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
A nucleic acid molecule that is recognized by a nuclear splicing component in a cell. a) one or more target binding domains that target the binding of nucleic acid molecules to non-human factor VIII pre-mRNA expressed in cells;
b) 3 'splice acceptor site;
c) a spacer region that separates the 3 ′ splice region from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
A nucleic acid molecule that is recognized by a nuclear splicing component in a cell. a) one or more target binding domains that target the binding of nucleic acid molecules to non-human factor VIII pre-mRNA expressed in cells;
b) 5 'splice site;
c) a spacer region separating the 5 ′ splice site from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
A nucleic acid molecule that is recognized by a nuclear splicing component in a cell.   23. The nucleic acid molecule of claim 22, wherein the nucleic acid molecule further comprises a 5 'donor site.   23. The nucleic acid molecule of claim 22, wherein the 3 'splice region further comprises a pyrimidine tract.   23. The nucleic acid molecule of claim 22, further comprising a safety nucleotide sequence comprising one or more complementary sequences that bind to one or both sides of the 3 'splice region.   23. The nucleic acid molecule of claim 22, wherein binding of the nucleic acid molecule to a target pre-mRNA is mediated by complementarity, triple helix formation, or protein-nucleic acid interaction. A eukaryotic expression vector for expressing a nucleic acid molecule, the nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to non-human factor VIII pre-mRNA expressed in a cell;
b) a 3 ′ splice region comprising a branch point and a 3 ′ splice acceptor site;
c) a spacer region that separates the 3 ′ splice region from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
And the nucleic acid molecule is recognized by a nuclear splicing component in a cell. A eukaryotic expression vector for expressing a nucleic acid molecule, the nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to non-human factor VIII pre-mRNA expressed in a cell;
b) 3 'splice acceptor site;
c) a spacer region that separates the 3 ′ splice region from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
And the nucleic acid molecule is recognized by a nuclear splicing component in a cell. A eukaryotic expression vector for expressing a nucleic acid molecule, the nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to non-human factor VIII pre-mRNA expressed in a cell;
b) 5 'splice site;
c) a spacer region separating the 5 ′ splice site from the target binding domain; and
d) a nucleotide sequence trans-spliced into the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
And the nucleic acid molecule is recognized by a nuclear splicing component in a cell.   30. The vector of claim 29, wherein the nucleic acid molecule further comprises a 5 'donor site.   30. The vector of claim 29, wherein the nucleic acid molecule further comprises a pyrimidine tract.   30. The vector of claim 29, wherein the nucleic acid molecule further comprises a safety nucleotide sequence comprising one or more complementary sequences that bind to one or both sides of the 3 'splice region.   30. The vector of claim 29, wherein the vector is a viral vector.   36. The vector of claim 35, wherein the viral vector is an adeno-associated viral vector.   37. A composition comprising a physiologically acceptable carrier and the vector according to any one of claims 29 to 36. A method for repairing a non-human factor VIII genetic defect in a subject comprising administering to the subject a nucleic acid molecule, the nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to a non-human factor VIII pre-mRNA expressed in a cell, wherein the pre-mRNA is encoded by a gene containing a non-human factor VIII genetic defect Be; and
b) a nucleotide sequence trans-spliced to the target pre-mRNA, said nucleotide sequence encoding a non-human factor VIII polypeptide;
And the nucleic acid molecule is recognized by a nuclear splicing component in a cell.

Images