CA2558640A1 - Spliceosome mediated rna trans-splicing - Google Patents

Abstract

The molecules and methods of the present invention provide a means for in vivo production of a trans-spliced molecule in a selected subset of cells. The pre-trans-splicing molecules of the invention are substrates for a trans-splicing reaction between the pre-trans-splicing molecules and a pre-mRNA which is uniquely expressed in the specific target cells. The in vivo trans-splicing reaction provides a novel mRNA which is functional as mRNA or encodes a protein to be expressed in the target cells. The expression product of the mRNA is a protein of therapeutic value to the cell or host organism a toxin which causes killing of the specific cells or a novel protein not normally present in such cells. The invention further provides PTMs that have been genetically engineered for the identification of exon/intron boundaries of pre-mRNA molecules using an exon tagging method. The PTMs of the invention can also be designed to result in the production of chimeric RNA encoding for peptide affinity purification tags which can be used to purify and identify proteins expressed in a specific cell type.

Description

INHIBITOR OF APOPTOSIS PROTEINS AND 1\TUCLEIC ACIDS AND
METHODS FOR MAHING AND USING THEM
PRIORTTY INFORMATION
This application claims priority to United States Provisional Application Serial No.
60/260,478, filed January 8, 2001.
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER
FEDERALLY SPONSORED RESEARCH
This invention was made in part with Government support under National Institutes of Health grants ES02701, AG15402, ES 04699, CA30199 (NCI); U.S.
Department of Agriculture grants 97-35302-4406, 9802852; Binational Agriculture Research and Development grant 96-34339-3532; and, National Institute of Environmental Health Science grant ES 05707. The Government may have certain rights in the invention.
TECHNICAL FIELD
~ 5 This invention generally pertains to the fields of cell biology and molecular biology. In particular, this invention provides polypeptides comprising the inhibitor of apoptosis protein (IAP) family member BmIAP, initially derived from silkworm Bornbyx mori BmN cells, and nucleic acids encoding them, and methods for making and using these compositions, including their use for inhibiting caspase proteases and apoptosis.
2o BACKGROUND
Apoptosis or programmed cell death is a cellular suicide process in which damaged or harmful cells are eliminated from multicellular organisms. Cells undergoing apoptosis have distinct morphological changes including cell shrinkage, membrane blebbing, chromatin condensation, apoptotic body formation and fragmentation. This cell suicide 25 program is evolutionarily conserved across animal and plant species.
Apoptosis plays an important role in the development and homeostasis of metazoans and is also critical in insect embryonic development and metamorphosis. Furthermore, apoptosis acts as a host defense mechanism. For example, virally infected cells are eliminated by apoptosis to limit the propagation of viruses. Apoptosis mechanisms are involved in plant reactions to 3o biotic and abiotic insults. Dysrewlation of apoptosis has been associated with a variety of human diseases including cancer, neurodegenerative disorders and autoimmune diseases.
Accordingly, identification of novel mechanisms to manipulate apoptosis provides new means to study and manipulate this process.

WO 02/0,3,81 PCT/DS02100-I1G
METHODS AND COMPOSITIONS FOR USE IN
SPLICEOSOME MEDIATED RNA TRANS-SPLICING
SPECIFICATION
The present application is a continuation-in part of a pending application 09/838,858 filed on April 20, 2001 which is a continuation in part of pending application serial number 091756096 filed January 8, 2001 which is a continuation-in-part of pending application serial number 09/158,863 filed September 23, 1998 which is a continuation-in part of serial number 09/133,717 filed on August 13, 1998 which is a continuation-in-part of serial number 09/087,233 filed on May 28, 1998, which is a continuation-in part of pending application serial number 08/766,354 filed on December 13, 1996, vcrhich claims benefit to provisional application number 60/008,317 filed on December 15, 1995.
The present .invention was made with government support under Grant Nos. SBIR R43DK56526-O1 and SBIR R44DK56526-02. The government has certain rights in the invention.
1. INTRODUCTION
The present invention provides methods and compositions for generating novel nucleic acid molecules through targeted spliceosomal traps-splicing.
The compositions of the invention include pre-h ans-splicing molecules (PTMs) designed to interact with a natural target precursor messenger RNA molecule (target pre-mRNA) and mediate a traps-splicing reaction resulting in the generation of a novel chimeric RNA molecule (chimeric RNA). The PTMs of the invention are genetically engineered so as to result in the production of a novel chimeric RNA
which may itself perform a function, such as inhibiting the translation of the RNA, or that encodes a protein that complements a defective or inactive protein in a cell, or encodes a toxin which kills specific cells. Generally, the target pre-mRNA is chosen as a target because it is expressed within a specific cell type thus providing a means for targeting expression of the novel chimeric RNA to a selected cell type.
The invention further relates to PTMs that have been genetically engineered for the WO 021053681 PCT/US02/00-t16 identification of exonlintron boundaries of pre-mRNA molecules using an exon tagging method. In addition, PTMs can be designed to result in the production of chimeric RNA encoding for peptide affinity purification tags which can be used to purify and identify proteins expressed in a specific cell type. The methods of the invention encompass contacting the PTMs of the invention with a target pre-mRNA
under conditions in which a portion of the PTM is traps-spliced to a portion of the target pre-mRNA to form a novel chimeric RNA molecule. The methods and compositions of the invention can be used in cellular gene regulation, gene repair and suicide gene therapy for treatment of proliferative disorders such as cancer or treatment of genetic, autoimmune or infectious diseases. In addition, the methods and compositions of the invention can be used to generate novel nucleic acid molecules in plants through targeted splicesomal traps-splicing. For example, targeted tratis-splicing may be used to regulate gene expression in plants for treatment of plants diseases, engineering of disease resistant plants or expression of desirable genes in plants. The methods and compositions of the invention can also be used to map intron-exon boundaries and to identify novel proteins expressed in any given cell.

2. BACKGROUND OF THE INVENTION
DNA sequences in the chromosome are transcribed into pre-mRNAs which contain coding regions (exons) and generally also contain intervening non-coding regions (introns). Introns are removed from pre-mRNAs in a precise process called splicing (Chow et al., 1977, Cell 12:1-8; and Berget, S.M. et al., 1977, Proc.
Natl. Acad. Sci. USA 74:3171-3175). Splicing takes place as a coordinated interaction of several small nuclear ribonucleoprotein particles (snRNP's) and many protein factors that assemble to form an enzymatic complex known as the spliceosome (Moore et al., 1993, in The RNA World, R.F. Gestland and J.F.
Atkins eds. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Kramer, 1996, Annu. Rev. Biochem., 65:367-404; Staley and Guthrie, 1998, Cell 92:315-326).

WO 02J053~81 PCTJi1S0210041G
Pre-mRNA splicing proceeds by a two-step mechanism. In the first step, the 5' splice site is cleaved, resulting in a "free" 5' exon and a lariat intermediate (Moore, M.J. and P.A. Sharp, 1993, Nature 365:364-368). In the second step, the ~5' exon is ligated to the 3' exon with release of the intron as the lariat product. These steps are catalyzed in a complex of small nuclear ribonucleoproteins and proteins called the spliceosome. The splicing reaction sites are defined by consensus sequences around the 5' and 3' splice sites. The 5' splice site consensus sequence is AG/GURAGU (where A=adenosine, U = uracil, G = guanine, C = cytosine, R =
purine and / = the splice site). The 3' splice region consists of three separate sequence elements: the branch point or branch site, a polypyrimidine tract and the 3' splice consensus sequence (YAG). These elements loosely define a 3' splice region, which may encompass 100 nucleotides of the intron upstream of the 3' splice site. The branch point consensus sequence in mammals is ~'1~1YLTR~rC (where N
=
uny nucleotide, Y= pyrimidine). The underlined A is the site of branch formation (the BPA = branch point adenosine). The 3' splice consensus sequence is YAG/G.
Between the branch point and the splice site there is usually found a polypyrimidine tract, which is important in mammalian systems for efficient branch point utilization and 3' splice site recognition (Roscigno, R., F. et al., 1993, J. Biol. Chem.
268:11222-11229). The first YAG trinucleotide downstream from the branch point and polypyrimidine tract is the most commonly used 3' splice site (Smith, C.W. et al., 1989, Nature 342:243-247).
1n most cases, the splicing reaction occurs within the same pre-mRNA
molecule, which is termed cis-splicing. Splicing between two independently transcribed pre-mRNAs is termed traps-splicing. Ti-ans-splicing was first discovered in trypanosomes (Sutton & Boothroyd, 1986, Cell 47:527; Murphy et al., 1986, Cell 47:517) and subsequently in nematodes (Krause & Hirsh, 1987, Cell 49:753);
flatworms (Rajkovic et al., 1990, Proc. Nafl. Acad. Sci. USA, 87:8879; Davis et al., 1995, J. BioL Chem. 270:21813) and in plant mitbchondria (Malek et al., 1997, Proc.
Nat'1. Acad. Sci. USA 94:553). In the parasite Trypanosoma br~scei, all mRNAs acquire a splice leader (SL) RNA at their 5' termini by traps-splicing. A 5' leader sequence is also tnar~r-spliced onto some genes in Caenorhabditis elegans.
This WO 02/053s81 PCT/US02/00:~16 mechanism is appropriate for adding a single common sequence to many different transcripts. ' The mechanism of ts-ans-splicing, which is nearly identical to that of conventional cis-splicing, proceeds via two phosphoryl transfer reactions. The first S causes the formation of a 2'-5' phosphodiester bond producing a'Y' shaped branched intermediate, equivalent to the lariat intermediate in cis-splicing. The second reaction, exon ligation, proceeds as in conventional cis-splicing. In addition, sequences at the 3' splice site and some of the snRNPs which catalyze the tramr-splicing reaction, closely resemble their counterparts involved in cis-splicing.
Traps-splicing may also refer to a different process, where an intron of one pre-mRNA interacts with an intron of a second pre-mRNA, enhancing the recombination of splice sites between two conventional pre-mRNAs. This type of tz~ans-splicing was postulated to account for transcripts encoding a human immunoglobulin variable region sequence linked to the endogenous constant region in a transgenic mouse (Shimizu et al., 1989, Proc. Nat'1. Acad. Sci. USA
86:8020). In addition, traps-splicing of c-myb pre-RNA has been demonstrated (Vellard, M.
et al.
Proc. Nat'1. Acad. Sci., 1992 89:2511-2515) and more recently, RNA transcripts from cloned SV40 traps-spliced to each other were detected in cultured cells and nuclear extracts (Eul et al., 1995, EMBO. J. 14:3226). However, naturally occurring trans-splicing of mammalian pre-mRNAs is thought to be an exceedingly rare event.
Ira vitro traps-splicing has been used as a model system to examine the mechanism of splicing by several groups (Konarska & Sharp, 1985, Cell 46:165-Sohlick, 1985; Cell 42:157; Chiara & Reed, 1995, Nature 375:510; Pasman and Garcia-Blanco, 1996, Nucleic Acids Res. 24:1638). Reasonably efficient trans-splicing (30% of cis-spliced analog) was achieved between RNAs capable of base pairing to each other, splicing of RNAs not tethered by base pairing was further diminished by a factor of 10. Other in vitro traps-splicing reactions not requiring obvious RNA-RNA interactions among the substrates were observed by Chiara &
Reed (1995, Nature 375:510), Bruzik J.P. & Maniatis, T. (1992, Nature 360:692) and Bruzik J.P. and Maniatis, T., (1995, Proc. Nafl. Acad. Sci. USA 92:7456-7059).

WO 02/0~3i81 PCT/US02/00:116 These reactions occur at relatively low frequencies and require specialized elements, such as a downstream S' splice site or exonic splicing enhancers.
In addition to splicing mechanisms involving the binding of multiple proteins to the precursor mRNA which then act to correctly cut and join RNA, a third S mechanism involves cutting and joining of the RNA by the intron itself, by what are termed catalytic RNA molecules or ribozymes. The cleavage activity of ribozymes has been targeted to specific RNAs by engineering a discrete "hybridization"
region into the ribozyme. Upon hybridization to the target RNA, the catalytic region of the ribozyme cleaves the target. It has been suggested that such ribozyme activity would be useful for the inactivation or cleavage of target RNA in vivo, such as for the treatment of human diseases characterized by production of foreign of aberrant RNA.
The use of antisense RNA has also been proposed as an alternative mechanism for targeting and destruction of specific RNAs. In such instances small RNA
molecules ' are designed to hybridize to the target RNA and by binding to the target RNA
prevent translation of the target RNA or cause destruction of the RNA through activation of nucleases.
Until recently, the practical application of targeted traps-splicing to modify specific target genes has been limited to group I ribozvme-based mechanisms.
Using the Tetrahymena group I n'bozyme, targeted traps-splicing was demonstrated in E. coli. coli (Sullenger B.A, and Cech. T.R., 1994, Nature 341:619-622) , in mouse fibroblasts (Jones, J.T. et al., 1996, Nature Medicine 2:643-648), human fibroblasts (Phylacton, L.A. et al. Nature Genetics 18:378-381) and human erythroid precursors (Lap et al., 1998, Science 280:1593-1596). While many applications of targeted RNA
tr-ans-splicing driven by modified group I ribozymes have been explored, targeted h-ans-splicing mediated by native mammalian splicing machinery, i.e., spliceosomes, has not been previously reported.
3. SLTNINIARY OF THE INVENTION
The present invention relates to compositions and methods for generating novel nucleic acid molecules through spliceosome-mediated targeted traps-splicing. The compositions of the invention include pre-ts-ans-splicing WO 02/053581 PCT/US02/00~16 molecules (hereinafter referred to as "PTMs") designed to interact with a natural target pre-mRNA molecule (hereinafter referred to as "pre-mRNA") and mediate a spliceosomal traps-splicing reaction resulting in the generation of a novel chimeric ' RNA molecule (hereinafter referred to as "chimeric RNA"). The methods of the S invention encompass contacting the PTMs of the invention with a natural target pre-mRNA under conditions in which a portion of the PTM is spliced to the natural pre-mRNA to form a novel chimeric RNA. The PTMs of the invention are genetically engineered so that the novel chimeric RNA resulting from the trar~s-splicing reaction may itself perform a function such as inhibiting the translation of RNA, or alternatively, the chimeric RNA may encode a protein that complements a defective or inactive protein in the cell, or encodes a toxin which kills the specific cells.
Generally, the target pre-mRNA is chosen because it is expressed within a specific cell type thereby providing a means for targeting expression of the novel chimeric RNA to a selected cell type. The target cells may include, but are not limited to those 1 S infected with viral or other infectious agents, benign or malignant neoplasms, or components of the immune system which are involved in autoimmune disease or tissue rej ection. The PTMs of the invention may also be used to correct genetic mutations found to be associated with genetic diseases. In particular, double-trans-splicing reactions can be used to replace internal exons. The PTMs of the invention can also be genetically engineered to tag exon sequences in a mRNA molecule as a method for identifying intron/exon boundaries in target pre-mRNA. The invention further relates to the use of PTM molecules that are genetically engineered to encode a peptide affinity purification tag for use in the purification and identification of . - proteins expressed in a specific cell type. The methods and compositions of the invention can be used in gene regulation, gene repair and targeted cell death Such methods and compositions can be used for the treatment of various diseases including, but not limited to, genetic, infectious or autoimmune diseases and proliferative disorders such as cancer and to regulate gene expression in plants.

g 4. BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1A. Model of Pre-Traps-splicing RNA.
Figure 1B. Model PTM constructs and targeted traps-splicing strategy.
Schematic representation of the first generation PTMs (PTM+Sp and PTM-Sp). BD, binding domain; NBD, non-binding domain; BP, branch point; PPT, pyrimidine tract; ss, splice site and DT-A, diphtheria toxin subunit A. Unique restriction sites within the PTMS are indicated by single letters: E; EcoRI; X, Xhol; K, Kpnl; P, Pstl; A, Accl; B, BamHI and H;
HindIII.
Figure 1 C. Schematic drawing showing the binding of PTM+Sp via conventional Watson Crick base pairing to the ~HCG6 target pre-mRNA and the proposed cis-and traps-splicing mechanism.
Figure 2A. In vitro traps-splicing efficiency of various PTM constructs into (3HCG6 target. A targeted binding domain and active splice sites correlate with PTM
traps-splicing activity. Full length targeted (pcPTM+Sp), non-targeted (PTM-Sp) and the splice mutants [Py(-)AG(-) and BP(-)Py(-)AG(-)] PTM RNAs were added to splicing reactions containing (3HCG6 target pre-mRNA. The products were RT-PCR
amplified using primers (3HCG-F (specific for target (3HCG6 exon 1) and DT-SR
(complementary to DT-A) and analyzed by electrophoresis in a 1.5% agarose gel.
Figure 2B. In vitro traps-splicing efficiency of various PTM constructs. Full length PTM with a spacer between the binding domain and splice site (PTM+Sp), PTM
without the spacer region (PTM+) and short PTMs that contain a target binding domain (short PTM+) or a non-target binding region (PTM-) were added to splicing reactions containing (3HCG target pre-mRNA. The products were RT-PCR amplified using primers (3HCG-F and DT-3. For reactions containing the short PTMs, the reverse PCR
primer was DT-4, since the binding site for DT-3 was removed from the PTM.
Figure 3. Nucleotide sequence demonstrating the in vitro traps-spliced product between a PTM and target pre-mRNA (SEQ ID NO: 53). The 466 by traps-spliced RT-PCR product from Figure 2 (lane 2) was re-amplified using a 5' iotin labeled forward primer ((3HCG-F) and a nested unlabeled reverse primer (DT-3R). Single stranded DNA was purified and sequenced directly using toxin specific DT-3R primer. The arrow indicates the splice junction between the last nucleotide of target (3HCG6 exon I and the first nucleotide encoding DT-A.
Figure 4A. Schematic diagram of the "safety" PTM and variations, demonstrating the PTM intramolecular base-paired stem, intended to mask the BP and PPT from splicing factors (SEQ ID NOS: 54, 55, 56): Underlined sequences represent the (3HCG6 intron 1 complementary target-binding domain, sequence in italics indicate target mismatches that are homologous to the BP.
Figure 4B. Schematic of a safety PTM in open configuration upon binding to the target.
Figure 4C. In vitro traps-splicing reactions were carried out by incubating either safety PTM or safety PTM variants with the (3HCG6 target. Splicing reactions were amplified by RT-PCR using ~iHCG-F and DT-3R primers; products were analyzed in a 2.0% agarose gel.
Figure 5. Specificity of targeted traps-splicing is enhanced by the inclusion of a safety into the PTM. (3HCG6 pre-mRNA (250 ng) and (3-globin pre-mRNA (250 ng) were annealed together with either PTM+SF (safety) or pcPTM+Sp (linear) RNA (500 ng). In vitro traps-splicing reactions and RT-PCR analysis were performed as described under experimental procedures and the products were separated on a 2.0% agarose gel.
Primers used for RT-PCR are as indicated.
Figure 6. In the presence of increasing PTM concentration, cis-splicing is inhibited and replaced by traps-splicing. In vitro splicing reactions were performed in the presence of a constant amount of (3HCG6 target pre-mRNA (100 ng) with increasing concentrations of PTM (pcPTM+Sp) RNA (52-300 ng). RT-PCR for cis-spliced and un-spliced products utilized primers (3HCG-F (exon 1 specific) and (3HCG-R2 (exon specific - Panel A); primers ~3HCG-F and DT-3R were used to RT-PCR traps-spliced products (Panel B). Reaction products were analyzed on 1.5% and 2.0% agarose gels, respectively. In panel A, lane 9 represents the 60 min time point in the presence of 300 ng of PTM, which is equivalent to lane 10 in panel B.
Figure 7A. PTMs are capable of traps-splicing in cultured human cancer cells. Total RNA was isolated from each of 4 expanded neomycin resistant H1299 lung carcinoma colonies transfected with pcSp+CRM (expressing non-toxic mutant DT-A) RT-PCR was performed using 1 p,g of total RNA and 5' biotinylated (3HCG-F and non-biotinylated DT-3R primers. Single stranded DNA was purified and sequenced.
S Figure 7B. Nucleotide sequence (sense strand) (SEQ ID NO:1) of the trans-spliced product between endogenous (3HCG6 target and CRM197 mutant toxin is shown (SEQ ID NO: 57). Two arrows indicate the position of the splice junction.
Figure 8A. Schematic diagram of a double splicing pre-therapeutic mRNA.
Figure 8B. Selective trans-splicing of a double splicing PTM. By varying the 10 PTM concentration the PTM can be trans-spliced into either the 5' or the 3' splice site of the target.
Figure 9. Schematic diagram of the use of PTM molecules for exon tagging. Two examples of PTMs are shown. The PTM on the left is capable of non-specifically trans-splicing into a target pre-mRNA 3' splice site. The other PTM on the right is designed to non-specifically trans-splice into a target pre-mRNA 5' splice site. A PTM
mediated trans-splicing reaction will result in the production of a chimeric RNA
comprising a specific tag to either the 5' or 3' side of an authentic exon.
Figure 10A. Schematic diagram of constructs for use in the lacZ knock-out model. The target lacZ pre-mRNA contains the 5' fragment of lacZ (SEQ ID NO:
58 and SEQ ID NO: 67) followed by ~iHCG6 intron 1 (SEQ ID NO: 59 and SEQ ID NO: 68) and the 3' fragment of lacZ (SEQ ID NO: 60) (target 1 ). The PTM molecule for use in the model system was created by digesting pPTM +SP with PstI and HindIII and replacing the DT-A toxin with ~3HCG6 exon 2 (pc3.1 PTM2).
Figure l OB. Schematic diagram of restoration of (3-Gal activity by Spliceosome Mediated RNA Trans-splicing. Schematic diagram of constructs for use in the IacZ
knock-in model (pc.3.1 lacZ T2). The IacZ target pre-mRNA is identical to that target pre-mRNA used for the knock-out experiments except that it contains two stop codons (TAA TAA) in frame four codons after the 3' splice site. The PTM molecule for use in the model system was created by digesting pPTM +SP with PstI and HindIII and replacing the DT-A toxin with functional 3' fragment of lacZ.

Figure 11A. Demonstration of cis-and traps-splicing when utilizing the lacZ
knock-out model. The LacZ splice target 1 pre-mRNA and PTM2 were co-transfected into 293T cells. Total RNA was then isolated and analyzed by PCR for cis-spliced and traps-spliced products using the appropriate specific primers. The amplified PCR
products were separated on a 2% agarose gel.
Figure 11 B-C. Assays for (3-galactosidase activity. 293 cells were transfected with lacZ target 2 DNA alone (panel B) or lacZ target 2 DNA and PTM1 (panel C).
Figure 12A. Nucleotide sequence of traps-spliced molecule demonstrating accurate traps-splicing (SEQ ID NO: 61).
Figure 12B. Nucleotide sequences of the cis-spliced product and the traps-spliced product (SEQ ID NOS: 62, 63) _The nucleotide sequences were those sequences expected for each of the different splicing reactions.
Figure 13. Gene repair model for repair of the cystic fibrosis transmembrane regulator (CFTR) gene.
Figure 14. RT-PCR demonstration of traps-splicing between an exogenously supplied CFTR mini-gene target and PTM. Plasmids were co-transfected into 293 embryonic kidney cells. The primers pairs used for RT-PCR reactions are listed above each lane. The lower band (471 bp) in each lane represents a traps-spliced product. The lower band in lane 1 (471bp) was purified from a 2% Seakem agarose gel and the DNA
sequence of the band was determined.
Figure 15. DNA sequence of the traps-spliced product (lane 1, lower band shown in Figure 14) (SEQ ID NO: 64). The DNA sequence indicates the presence of the codon (CTT), exon 9 sequence is contiguous with exon 10 sequence, and the His tag sequence.
Figure 16. Schematic representation of repair of an exogenously supplied CFTR
target molecule carrying an F508 deletion in exon 10.
Figure 17. Repair of endogenous CFTR transcripts by exon 10 replacement using a double splicing PTM. The use of a double splicing PTM permits repair of the mutation with a very short PTM molecule.

Figure 18. Model lacZ target consisting of lacZ 5' exon - CFTR mini-intron 9 CFTR exon 10 (delta 508) - CFTR mini-intron 10 followed by the lacZ 3' exon.
Binding domains for PTMs are bracketed.
Figure 19. Schematic representation of double-traps-splicing PTMs designed to S restore (3-gal function.
Figure 20. Schematic representation of a double-traps-splicing reaction showing the binding of DSPTM7 with DSCFT1.6 target pre-mRNA.
Figure 21. Important structural elements of DSPTM7. The double splicing PTM
has both 3' and 5' functional splice sites as well as binding domains.
Figure 22. Schematic diagram of mutant double splicing PTMs (SEQ ID N0:85).
Figure 23. Accuracy of double-traps-splicing reaction (SEQ ID NOS:86, 87).
Figure 24. Double-traps-splicing between the target pre-mRNA and the DSPTM7 produces full-length protein. Western blot analysis of total cell lysates using polyclonal anti-(3-galactosidase antiserum.
Figure 25. Precise internal exon substitution between the DSCFT1.6 target pre-mRNA and DSPTM7 RNA by double-traps-splicing produces functionally active ~3-gal protein. Total cell extracts were prepared and assayed for ~i-gal activity using an ONPG
assay.
Figure 26. 3' and 5' splice sites are essential for the restoration of (3-gal function by double-traps-splicing reaction.
Figure 27. Double-traps-splicing: titration of target and PTM. Different concentrations of the target and PTM were co-transfected and analyzed for (3-gal activity restoration.
Figure 28. Constructs designed to test the specificity of double-traps-splicing reaction.
Figure 29. Specificity of a double-traps-splicing reaction.
Figure 30. Traps-splicing repair of the cystic fibrosis gene using a PTM that mediates a double-traps-splicing event.
Figure 31. PTM with a long binding domain masking two splice sites and part of exon 10 in a mini-gene target (SEQ ID N0:83).

Figure 32. Sequence of a single PCR product showing target exon 9 correctly spliced to PTM exon 10 (with modified codons) (upper panel) (SEQ ID N0:89), codon 508 in exon 10 of the PTM (middle panel)(SEQ ID N0:90) and PTM exon 10 correctly spliced to target exon 11 (lower panel) (SEQ ID N0:91). The sequence of a repaired target was generated by RT-PCR followed by PCR.
Figure 33. Traps-splicing repair of the cystic fibrosis gene using a PTM that can perform 5' exon replacement.
Figure 34. Schematic diagram of three different PTM molecules with different binding domains.
Figure 35. Schematic diagram of PTM exon 10 with modified codon usage to reduce antisense effects with its own binding domain (SEQ ID N0:92).
Figure 36. Sequence of cis- and traps-spliced products (SEQ ID NOS:93, 94, 95, 96, 97).
Figure 37. Model system for repair of messenger RNAs by traps-splicing.
(A) Schematic illustration of a defective lacZCF9m splice target used in the present study (see Materials and Methods for details). BP, branch point; PPT, polypyrimidine tracts; ss, splice sites and pA, polyadenylation signal (SEQ ID N0:98, 99):
(B) A
prototype PTM showing the key components of the traps-splicing domain (SEQ ID
NO:100), and the diagrams of various PTMs showing the binding domain length and approximate positions at which they bind to the target pre-mRNA. Unique restriction sites within the traps-splicing domain are N, lVhe I; S, Sac II; K, Kpn I and E, EcoR
V. (C) Schematic diagram showing the binding of a PTM through antisense binding and repair of defective lacZ pre-mRNA through targeted RNA traps-splicing.
Expected cis and traps-spliced products and the primer binding sites for Lac-9F, Lac-3R and Lac-SR are indicated.
Figure 38. Efficient repair of IacZ messenger RNA. Target specific primers, Lac-9F (5' exon) and Lac-3R (3' exon) were used to amplify cis-spliced products (lanes 1-6), while; target and PTM specific primers, Lac-9F (S' exon) and Lac-SR
(3' exon) were used to amplify traps-spliced products (lanes 7-15). 25-50 ng of total RNA was used to measure target cis-splicing (lanes 1-6) and 50-200 ng of total RNA
was used to measure PTM induced RNA traps-splicing (lanes 7-12). Lanes 13-15, 25-50 ng of total RNA from cells transfected with lacZCF9 a control for WO 02/Oi3~81 PCT/OS02/00-t16 1~
traps-splicing. (B) Endogenous mRNA repair by traps-splicing. Lanes 1-3, RNA
from cells transfected with PTM-CF14; lanes 4-6, PTM-CF22 and lanes 7-9, PTM-CF24. Lane 10, RNA from mock-transfected cells and lane 11 is a control in which reverse-transcription reaction was omitted.
Figure 39. Messenger RNA repair leads to synthesis of full-length (3-galactosidase. Lane 1, lacZCF9 (positive control, 5 ,ug); lane 2, IacZCF9m target alone (25 ~cg); lane 3, PTM-CF24 alone (25 ,ug) and lane 4, lacZCF9m target +
PTM-CF24 (25 ug).
Figure 40. Messenger RNA repair by SMaRT produces functional (3-galactosidase. (A) In situ detection of functional (3-galactosidase produced by traps-splicing. 293T cells were either transfected (transient assay) with lacZCF9m target alone (panel A) or co-transfected with lacZCF9m target + pTM-CF24 (panel B) expression plasmids as described above. 48-hr post-transfection, cells were rinsed with PBS and stained izz sitz4 for (3-gal activity. (B) Repair of a defective lacZ mRNA
produces functional (3-galactosidase. Target and PTM, extracts from cells transfected with either lacZCF9m target or PTM-CF24 plasmid alone, and the rest were from cells co-transfected with lacZCF9m target and one of the PTMs as indicated.
(C) - Endogenous mRNA repair by traps-splicing produces functional (3-galactosidase.
Stable cells expressing an endogenous IacZCF9m pre-mRNA target was transfected with "linear" PTMs (PTM-CF14, PTM-CF22 or PTM-CF24) as described above.
Following transfection, total cell lysate was prepared and assayed for (3-gal acfivity.
The results presented are the average of two independent transfections.
Figure 41. Messenger RNA repair is specific. (A) Experimental strategy to measure non-specific traps-splicing beriveen lacZHCGlm pre-mRNA
and "linear" PTMs. (B) Extended binding domains enhance the specificity of trans-splicing. Lanes 1-3, PTM-CF14; 4-6, PTM-CF22; 7-9, PTM-CF24; 10-12, PTM-CF26 and 13-15, PTM-CF27. (C) PTMs with very long binding domains are capable of increasing specificity. Total cell extract (5 /,c1) was assayed in solution for ~3-gal acti~rity and the specific activity was calculated. (3-gal activity was normalized to mock and the results presented are the average of two independent transfections: .

Control, extract from cells transfected with lacZHCGIm target alone and the rest were co-transfected with lacZHCGlm target and one of the linear PTMs.
Figure 42. Complete sequence of CFTR PTM 30 (5' exon replacement PTM) showing the traps-splicing domain (underlined) (SEQ ID N0:102) and the coding 5 sequence for exons 1-10 of the CFTR gene (SEQ ID NO:101). Modified codons in exon 10 are underlined and bold.
Figure 43A. 153 base-pair PTM 24 Binding Domain (SEQ ID N0:103).
Figure 43B. Complete sequence of CFTR PTM 24 (3' exon replacement PTM) showing the traps-splicing domain (underlined) (SEQ ID N0:104) and the coding 10 sequence for exons 10-24 of the CFTR cDNA (SEQ ID NO:105). At the end of the coding is a histidine tag and the translation stop codon.
Figure 44A. Detailed structure of the mouse factor VIII PTM containing normal mouse sequences for exons 16-26. BGH=bovine growth hormone 3' UTR
(untranslated sequence); Binding Domain=125bp (SEQ ID N0:106); base changes to eliminate cryptic 15 sites are circled:FS, F6, F7, F8=primer sites.
Figure 44B. Schematic diagram showing the extent of the binding domain in the mouse factor VIII gene.
Figure 44C. Changes to the promoter in AAV vectors pDLZ20 and pDLZ20-M2 to eliminate cryptic donor sites in sequence upstream of the PTM binding domain (SEQ
ID NOS:lU8-109).
Figure 44D. Factor VIII repair model. Schematic diagram of a PTM binding to the 3' splice site of intron 15 of the mouse factor VIII gene.
Figure 45. Schematic diagram of a F8 PTM with the traps-splicing domain eliminated (SEQ ID NOS:110-111). This represents a control PTM to test whether repair is a result of traps-splicing.
Figure 46. Data indicating repair of factor VIII in Factor VIII knock out mice.
Blood was assayed for factor VIII activity using a coatest assay.
Figure 47A. Detailed structure of a mouse factor VIII PTM containing normal sequences for exons 16-26 and a C-terminal FLAG tag (SEQ ID N0:112).
BGH=bovine growth hormone 3"UTR; Binding domain=125 bp.
Figure 47B. Detailed structure of a human or canine factor VIII PTM containing normal sequences for exons 23-26 (SEQ ID N0:113).

Figure 48. Transcription Map of HPV-16.
Figure 49. Disruption of Human Papillomavirus Type 16 Expression by PTM.
Schematic diagram of HPV-PTM 2 binding to the 3' splice site of the HPV type 16 target pre-mRNA.
Figure 50. E7 Targeting Strategy in which Multiple PTMs are targeted to HPV
E7.
Figure 51. PTM Design indicating the binding domain, branch point and polypyrimidine tract (SEQ ID NOS:114 & 115).
Figure 52A. HPV-PTM 1 with 80 by binding domain targeted to 3' ss at 409 (SEQ
ID NO: 116).
Figure 52B. HPV-PTM 2 with 149 by binding domain targeted to 3' ss at 409 (SEQ ID NO: 117).
Figure 53. Binding Domains of HPV-PTM 3 and 4 (SEQ ID NOS:118-121).
Figure 54. Binding Domains of HPV-PTM S and 6. Nucleotides in bold are modified to prevent cryptic splicing of PTMs (SEQ ID NOS:122-123).
Figure 55. Positions of HPV-PTM targeting domains.
Figure 56. Trans-splicing Efficiency of HPV-PTMs in 293 T Cells: 293T cells were con-transfected with 2 ~.g of p1059 target and 1.5 ~,g of PTM expression plasmids.
48 hr post-transfection; total RNA was isolated and analyzed by RT-PCR. Target specific primers, oJMDlS and JMD16 were used to amplify cis-spliced products (lanes l-11, upper panel), while; target and PTM specific primers, oJMD15 and Lac-6R were used to amplify transspliced products (lanes 1-12, lower panel). Lanes 13-14 (upper-panel), RNA
isolated from cells that are transfected with lacZCF9 and HPV-PTM1 and 2 respectively;
hence, serve as controls for evaluating the specificity of HPV-PTMs:
Figure 57. Nucleotide sequence showing the traps-splice junctions between the HPV target pre-mRNA and the PTM. The RT-PCR product was purified and sequenced directly using primer LacSR (binds to 3' exon of the PTM) (SEQ ID N0:124). The arrow indicate traps-splice junction between E6 of HPV pre-mRNA target and lacZ 3' exon of the PTM.

Figure 58. Traps-splicing in 293 cells (Co-transfections) Quantification of traps-splicing efficiency was determined using real-time QRT-PCR.
Figure 59. Traps-splicing efficiency of HPV-PTMs into an endogenous pre-mRNA target. SiHa and CaSki cells were transfected wit 1.5 ~.g of either HPV-PTM1, 2 or CFTR targets PTM14 or 27 expression plasmids. 48 hr post-transplicing, total RNA
was isolated and analyzed by RT-PCR. Traps-splicing between the endogenous HPV
target and the PTm was detected using target and PTM specific primers oJMDlS
and Lac-16R. The expected traps-spliced product (418 bp) is clearly visible in cells that are transfected with HPV-PTMs (lanes 2-3 and 5-7) but not in control (lanes 1 and 4). In addition, traps-splicing is also detected in lane 8 due to non-specific traps-splicing.
Figure 60. Accurate Traps-splicing of HPV-PTM1 in SiHa Cells. Target pre-mRNA was endogenous mRNA (SEQ ID N0:125). Sequence analysis of traps-spliced chimeric RNA indicates that traps-splicing is accurate.
Figure 61. Quantification of traps-splicing efficiency in SiHa cells using real-time QRT-PCR.
Figure 62. Traps-splicing efficiency of HPV-PTM 1, HPV-PTM 5, & HPV-PTM

6 in SiHa cells. Analysis of total RNA was performed using RT-PCR.
Figure 63. Deletion of polypyrimidine tract abolishes traps-splicing. Lanes l and 2 represent RNA from cells transfected with mutant HPV-PPT. Lanes 3 and 4 represent RNA from cells transfected with HPV-PTMS plasmid. 269 by product resulting from traps-splicing is detected:
Figure 64. Schematic Diagram of a PTM binding to the 5' splice site of the HPV
mini-gene target and the resulting traps-spliced chimera RNA.
Figure 65. Double Traps-splicing. Schematic diagram of a double traps-splicing PTM binding to the 3' and 5' splice sites of the HPV mini-gene target. The resultant trans-spliced mRNA is shown.
Figure 66A. Traps-splicing by 3' exon replacement. Schematic diagram of a PTM
binding to the 3' splice site of the HPV mini-gene target.
Figure 66B. Traps-splicing by 5' exon replacement. Schematic diagram of a PTM
binding to the 5' splice site of the HPV mini-gene target.

WO 02/0~3i81 PCT/US02/00~16 Figure 67. Schematic of a double splicing HPV-PTM designed for internal exon replacement.
5. DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to compositions comprising pre-trans-S splicing molecules (PTMs) and the use of such molecules for generating novel nucleic acid molecules. The PTMs of the invention comprise one or more target binding domains that are designed to specifically bind to pre-mRNA, a 3' splice region that includes a branch point, pyrimidine tract and a 3' splice acceptor site and/or a 5' splice donor site; and one or more spacer regions that separate the RNA splice site from the target binding domain. In addition, the PTMs of the invention can be engineered to contain any nucleotide sequences such as those encoding a translatable protein product.
The methods of the invention encompass contacting the PTMs of the invention with a natural pre-mRNA under conditions in which a portion of the PTM
is traps-spliced to a portion of the natural pre-mRNA to form a novel chimeric RN A.
The target pre-mRNA is chosen as a target due to its expression within a specific cell type thus providing a mechanism for targeting expression of a novel RNA to a selected cell type. The resulting chimeric RNA may provide a desired function, or may produce a gene product in the specific cell type. The specific cells may include, but are not limited to those infected with viral yr other infectious agents, benign or malignant neoplasms, or components of the immune system which are involved in autoimmune disease or tissue rejection. Specificity is achieved by modification of the binding domain of the PTM to bind to the target endogenous pre-mRNA. The gene products encoded by the chimeric RNA can be any gene; including genes having clinical usefulness, for example, therapeutic or marker genes, and genes encoding toxins.
5.1. STRUCTURE OF THE PRE-TR.ANS SPLICING MOLECULES
The present invention provides compositions for use in generating novel chimeric nucleic acid molecules through targeted tYans-splicing. The PTMs of the invention comprise (i) one or more target binding domains that targets binding of WO 02/OS3s81 PCT/LIS02/00-t16 the PTM to a pre-mRNA (ii) a 3' splice region that includes a branch point, pyrinudine tract and a 3' splice acceptor site and/or 5' splice donor site;
and (iii) one or more spacer regions to separate the RNA splice site from the target-binding domain. Additionally, the PTMs can be engineered to contain any nucleotide sequence encoding a translatable protein product. In yet another embodiment of the invention, the PTMs can be engineered to contain nucleotide sequences that inhibit the translation of the chimeric RNA molecule. For example, the nucleotide sequences may contain translational stop colons or nucleotide sequences that form secondary structures and thereby inhibit translation. Alternatively, the chimeric RNA
may function as an antisense molecule thereby inhibiting translation of the RNA to which it binds.
The target binding domain of the PTM may contain multiple binding domains which are complementary to and in anti-sense orientation to the targeted region of the selected pre-mRNA. As used herein, a target binding domain is defined as any sequence that confers specificity of binding and anchors the pre-mRNA
closely in space so that the spliceosome processing machinery of the nucleus can trans-splice a portion of the PTM to a portion of the pre-mltNA. The target binding domains may comprise up to several thousand nucleotides. In preferred embodiments of the invention the binding domains may comprise at least 10 to 30 and up to several hundred nucleotides. As demonstrated herein, the specificity of the PTM can be increased significantly by increasing the length of the target binding domain.
For example, the target binding domain may comprise several hundred nucleotides or more. In addition, although the target binding domain may be "linear" it is understood that the RNA may fold to form secondary structures that may stabilize the complex thereby increasing the efficiency of splicing. A second target binding region may be placed at the 3' end of the molecule and can be incorporated into the PTM of the invention. Absolute complementarity, although preferred, is not required.
A sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex. The ability to hybridize will depend on both the degree of complementarity and the length of the nucleic acid (See, for example, Sambrook et WO 02/03581 PCT/US02l00416 al., 1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York). Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA it maycontain and still form a stable duplex. One skilled in the art can ascertain a tolerable degree of 5 mismatch or length of duplex by use of standard procedures to determine the stability of the hybridized complex.
Where the PTMs are designed for use in intron-exon tagging or for peptide affinity tagging, a library of PTMs is genetically engineered to contain random nucleotide sequences in the target binding domain. Alternatively, for intron-10 exon tagging the PTMs may be genetically engineered so as to lack target binding domains. The goal of generating such a library of PTM molecules is that the h'brary will contain a population of PTM molecules capable of binding to each RNA
molecule expressed in the cell. A recombinant expression vector can be genetically engineered to contain a coding region for a PTM including a restriction endonuclease 15 site that can be used for insertion of random DNA fragments into the PTM to form random target binding domains. The random nucleotide sequences to be included in the PTM as target binding domains can be generated using a variety of different methods well~known to those of skill in the art, including but not limited to, partial , digestion of DNA with restriction enzymes or mechanical shearing of DNA to 20 generate random fragments of DNA. Random binding domain regions may also be generated by degenerate oligonucleotide synthesis. The degenerate oligonucleotides can be engineered to have restriction endonuclease recognition sites on each end to facilitate cloning into a PTM molecule for production of a library of PTM
molecules having degenerate binding domains.
Binding may also be achieved through other mechanisms, for example, through triple helix formation or protein/nucleic acid interactions such as those in which the PTM is engineered to recognize a specific RNA binding protein, i.e., a protein bound to a specific target pre-mRNA. Alternatively, the PTMs of the invention may be designed to recognize secondary structures, such as for example, fiairpin structures resulting from intramolecular base pairing between nucleotides within an RNA molecule.

WO 02/OS3s81 PCT/US02/00~16 The PTM molecule also contains a 3' splice region that includes a - branch point, pyrimidine tract and a 3' splice acceptor AG site and/or a 5' splice donor site. Consensus sequences for the 5' splice donor site and the 3' splice region used in RNA splicing are well known in the art (See, Moore, et al., 1993, The RNA
World, Cold Spring Harbor Laboratory Press, p. 303-358). In addition, modified consensus sequences that maintain the ability to function as 5' donor splice sites and 3' splice regions may be used in the practice of the invention. Briefly, the 5' splice site consensus sequence is AGIGURAGU (where A=adenosine, U=uracil, G=guanine, C=cytosine, R~urine and /=the splice site). The 3' splice site consists of three separate sequence elements: the branch point or branch site, a polypyrimidine tract and the-3' consensus sequence (YAG). The branch point consensus sequence in mammals is '~'1VYURAC (Y~yrimidine). The underlined A is the site of branch formation. A polypyrimidine tract is located between the branch point and the splice site acceptor and is important for different branch point utilization and 3' splice site recognition.
Further, PTMs comprising a 3' acceptor site (AG) may be genetically engineered. Such PTMs may further comprise a pyrimidine tract and/or branch point sequence.
Recently, pre-messenger RNA introns beginning with the dinucleotide AU and ending with the dinucleotide AC have been identified and referred to as introns. U12 intron sequences as well as any sequences that function as splice acceptor/donor sequences may also be used in PTMs.
A spacer region to separate the RI~TA splice site from the target binding domain is also included in the PTM. The spacer region can have features such as stop codons which would block any translation of an unspliced PTM and/or sequences that enhance trarzs-splicing to the target pre-mRNA.
In a preferred embodiment of the invention, a "safety" is also incorporated into the spacer, binding domain, or elsewhere in the PTM to prevent non-specific t~-atis-splicing. This is a region of the PTM that covers elements of the 3' and/or 5' splice site of the PTM by relatively weak complementarity, preventing non-specific traits-splicing. The PTM is designed in such a way that upon hybridization of the binding /targeting portions) of the PTM, the 3' and/or 5'splice site is uncovered and becomes fully active.
The "safety" consists of one or more complementary stretches of cis-sequence (or could be a second, separate, strand of nucleic acid) which weakly binds to one or both sides of the PTM branch point, pyrimidine tract, 3' splice site and/or 5' splice site (splicing elements), or could bind to parts of the splicing elements themselves. This "safety"
binding prevents the splicing elements from being active (i.e. block U2 snRNP
or other splicing factors from attaching to the PTM splice site recognition elements).
The binding of the "safety" may be disrupted by the binding of the target binding region of the PTM to the target pre-mRNA, thus exposing and activating the PTM splicing elements (snaking them available to traps-splice into the target pre-mRNA).
A nucleotide sequence encoding a translatable protein capable of producing an effect, such as cell death, or alternatively, one that restores a missing function or acts as a marker, is included in the PTM of the invention. For example, the nucleotide sequence can include those sequences encoding gene products missing or altered in known genetic diseases. Alternatively, the nucleotide sequences can encode marker proteins or peptides which may be used to identify or image cells. In yet another embodiment of the invention nucleotide sequences encoding affinity tags such as, HIS tags (6 consecutive histidine residues) (Janknecht, et al., 1991; Proc. Natl. Acad. Sci. USA 88:8972-8976);
the C-terminus of glutathione-S-transferase (GST) (Smith and Johnson, 1986, Proc.
Natl. Acad.
Sci. USA 83:8703--8707) (Pharmacia) or FLAG (Asp-Tyr-Lys-Asp-Asp-Asp-Lys) (SEQ
ID NO: 66) (Eastman Kodak/IBI, Rochester, N~ can be included in PTM molecules for use in affinity purification. The use of PTMs containing such nucleotide sequences results in the production of a chimeric RNA encoding a fusion protein containing peptide sequences normally expressed in a cell linked to the peptide affinity tag. The affinity tag provides a method for the rapid purification and identification of peptide sequences expressed in the cell. In a preferred embodiment the nucleotide sequences may encode toxins or other proteins which provide some function which enhances the susceptibility of the cells to subsequent treatments, such as radiation or chemotherapy.

WO 02/053581 PCT/US02/OO.tl6 In a highly preferred embodiment of the invention a PTM molecule is designed to contain nucleotide sequences encoding the Diphtheria toxin subunit A
(Greenfield, L., et al., 1983, Proc. Nafl. Acad. Sci. USA 80: 6853-685'X).
Diphtheria toxin subunit A contains enzymatic toxin activity and will function if expressed or delivered into human cells resulting in cell death. Furthermore, various other known peptide toxins may be used in the present invention, including but not limited to, ricin, Pseudomonus toxin, Shiga toxin and exotoxin A.
Additional features can be added to the PTM molecule either after, or before, the nucleotide sequence encoding a translatable protein, such as polyadenylation signals or 5' splice sequences to enhance splicing, additional binding regions, "safety"-self complementary regions, additional splice sites, or protective groups to modulate the stability of the molecule and prevent degradation.
Additional features that may be incorporated into the PTMs of the invention include stop codons or other elements in the region between the binding domain and the splice site to prevent unspliced pre-mRNA expression. In another embodiment of the invention, PTMs can be generated with a second anti-sense binding domain downstream from the nucleotide sequences encoding a translatable protein to promote binding to the 3' target intron or exon and to block the fixed authentic cis-5' splice site (LJS and/or Ul binding sites).
PTMs may also be generated that require a double-traps-splicing reaction for generation of a chimeric traps-spliced product. Such PTMs could be used to replace an internal exon which could be used for RNA repair. PTMs designed to promote two tans-splicing reactions are engineered as described above, however, they contain both 5' donor sites and 3' splice acceptor sites. In addition, the PTMs may comprise two or more binding domains and splicer regions. The splicer regions may be place between the multiple binding domains and splice sites or alternatively between the multiple binding domains.
Further elements such as a 3' hairpin structure, circularized RNA, nucleotide base modification, or a synthetic analog can be incorporated into PTMs to promote or facilitate nuclear localization and spliceosomal incorporation, and intra-cellular stability. _ WO 02!053581 PCTlUS02/00~16 2~l Additionally, when engineering PTMs for use in plant cells it may not be necessary to include conserved branch point sequences or polypyrimidine tracts as these sequences may not be essential for intron processing in plants. However, a 3' splice acceptor site and/or 5' splice donor site, such as those required for splicing in S vertebrates and yeast, will be included. Further, the efficiency of splicing in plants may be increased by also including UA-rich intronic sequences. The skilled artisan will recognize that any sequences that are capable of mediating a traps-splicing reaction in plants may be used.
The PTMs of the invention can be used in methods designed to produce a novel chimeric RNA in a target cell. The methods of the present invention comprise delivering to the target cell a PTM which may be in any form used by one skilled in the art, for example, an RNA molecule, or a DNA vector which is transcribed into a RNA molecule, wherein said PTM binds to a pre~.mRNA and mediates a traps-splicing reaction resulting in formation of a chimeric RNA
comprising a portion of the PTM molecule spliced to a portion of the pre-mRNA.
5.2. SYNTHESIS OF THE TRANS SPLICING MOLECULES
The nucleic acid molecules of the invention can be RNA or DNA or derivatives or modified versions thereof, single-stranded or double-stranded.
By nucleic acid is meant a PTM molecule or a nucleic acid molecule encoding a PTM
molecule, whether composed of deoxyribonucleotides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).
The RNA and DNA molecules of the invention can be prepared by ariy method known in the art for the synthesis of DNA and RNA molecules. For example, the nucleic acids may be chemically synthesized using commercially available reagents and synthesizers by methods that are well known in the art (see, e.e., Gait, 1985, Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford, England).
Alternatively, RlvTA molecules can be generated by iti vitro and in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be WO 02/053s81 PCT/OS02/00~16 2s incorporated into a wide variety of vectors which incorporate suitable RNA
polymerase promoters such as the T7 or SP6 polymerase promoters. RNAs may be produced in high yield via in vitro transcription using plasmids such as SPS65 (Promega Corporation, Madison, WI). In addition, RNA amplification methods such as Q-(3 amplification can be utilized to produce RNAs.
The nucleic acid molecules can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, transport into the cell, etc. For example, modification of a PTM to reduce the overall charge can enhance the cellular uptake of the molecule. In addition 1 b modifications can be made to reduce susceptibility to nuclease degradation. The nucleic acid molecules may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A.
86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT
Publication No.
W088/09810, published December 15, 1988) or the blood-brain barrier (see, e.g., PCT
Publication No. W089/10134, published April 25, 1988), hybridization-triggered cleavage agents. (See, e.g., Krol et al., 198S, BioTechniques 6:958-976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the nucleic acid molecules may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc. Various other well-known modifications to the nucleic acid molecules can be introduced as a means of increasing intracellular stability and half life. Possible modifications include, but are not limited to, the addition of flanking sequences of ribo- or deoxy- nucleotides to the 5' and/or 3' ends of the molecule. In some circumstances where increased stability is desired, nucleic acids having modified internucleoside linkages such as 2'-0-methylation may be preferred.
Nucleic acids containing modified internucleoside linkages may be synthesized using reagents and methods that are well known in the art (see, Uhlmann et al., 1990, Chem.
Rev.
90:543-584; Schneider et al., 1990, Tetrahedron Lett. 31:335 and references sited therein).

WO 02/053581 PCT/US02/OO~116 The nucleic acids may be purified by any suitable means, as are well known in the art. For example, the nucleic acids can be purified by reverse phase chromatography or geI electrophoresis. Of course,~the skilled artisan will recognize that the method of purification will depend in part on the size of the nucleic acid to be purified.
In instances where a nucleic acid molecule encoding a PTM is utilized, cloning techniques known in the art may be used for cloning of the nucleic acid molecule into an expression vector. Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al.
(eds.), 1993, Current Protocols in Molecular Biology, John Wiley & Sons, NY;
and Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY.
The DNA encoding the PTM of interest may be recombinantly engineered into a variety of host vector systems that also provide for replication of tt_,~
1 S DNA in large scale and contain the necessary elements for directing the transcription of the PTM. The use of such a construct to transfect target cells in the patient will result in the transcription of sufficient amounts of PTMs that wil: form complementary base pairs with the endogenously expressed pre-mRNA targets and thereby facilitate a traps-splicing reaction between the complexed nucleic acid molecules. For example, a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of the PTM molecule. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired RNA. Such vectors can be constructed by recombinant DNA
teclmology methods standard in the art.
Vectors encoding the PTM of interest can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells.
Expression of the sequence encoding the PTM can be regulated by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include but are not limited to: the SV40 early promoter region (Benoist, C. and Chambon, P. 1981, Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., WO 02/0,3,81 PCT/US02/00~16 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:14411445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296:39-42), the viral-CMV
promoter, the human chorionic gonadotropin-(3 promoter (Hollenberg et al., 1994, Mol. Cell. Endocrinology 106:111-119), etc. Any type of plasmid, cosmid, YAC
or viral vector can be used to prepare the recombinant DNA construct which can be introduced directly into the tissue site. Alternatively, viral vectors can be used which selectively infect the desired target cell.
Far use of PTMs encoding peptide affinity purification tags, it is desirable to insert nucleotide sequences containing random target binding sites into the PTMs and clone them into a selectable mammalian expression vector system.
A
number of selection systems can be used, including but not limited to selection for expression of the herpes simplex virus thymidine kinase, hypoxantlrine-guanine phosphoribosyltransterase and adenine phosphoribosyl transferase protein in tk-, hgprt- or aprt- deficient cells, respectively. Also, anti-metabolic resistance can be used as the basis of selection for dihydrofolate tranferase (dl~), which confers .
resistance to methotrexate; xanthine-guanine phosphoribosyl transferase (gpt), which confers resistance to mycophenolic acid; neomycin (rzeo), which confers resistance to aminoglycoside G-418; and hygromycin B phosphotransferase (hygro) which confers resistance to hygromycin. In a preferred embodiment of the invention, the cell culture is transformed at a Iow ratio of vector to cell such that there will be only a single vector, or a limited number of vectors, present in any one cell. Vectors for use in the practice of the invention include any eukaryotic expression vectors, including but not limited to viral expression vectors such as those derived from the class of retroviruses or adeno-associated viruses.
5.3. USES AND ADMINISTRATION OF TRANS SPLICING MOLECULES
5.3.1. USE OF PTM MOLECULES FOR GENE REGULATION, GEN>i REPAIR AND TARGETED CELL DEATH
The compositions and methods of the present invention will have a variety of different applications including gene regulation, gene repair and targeted WO 02IOS3i81 PCT/US02/00~16 cell death. For example, traps-splicing can be used to introduce a protein with toxic properties into a cell. In addition, PTMs can be engineered to bind to viral mRNA
and destroy the function of the viral mRNA, or alternatively, to destroy any cell expressing the viral mRNA. In yet another embodiment of the invention, PTMs can be engineered to place a stop codon in a deleterious mRNA transcript thereby decreasing the expression of that transcript.
In an embodiment of the invention PTM molecules were designed to bind to papilloma virus RNA and inhibit the function of the viral RNA.
Specifically anti-I3PV PTMs were designed to specifically target HPV pre-mRNAs and result in the expression of a disruptive or toxic protein only in the HPV-infected cancer cells.
Thus, the invention provides PTM molecules designed to inhibit the function of papilloma virus RNA. Such papilloma viruses, include but are not limited to mammalian papillomavin~ses including human papillomaviruses.
The papilloma viruses are a group of small DNA viruses which induce papillomas (warts) in a variety of vertebrates, including human. In addition, human papilloma virus is one of the most common causes of sexually transmitted diseases in the country and the vast majority of cervical cancers are associated with oncogenic human papillomaviruses and express viral mRNAs encoding the E6 and E7 oncoproteins. Thus; the PTM molecules of the invention may be used to inhibit the proliferation of papillomaviruses within an infected host.
Targeted traps-splicing, including double-traps-splicing reactions, 3' exon replacement and/or S' exon replacement can be used to repair or correct transcripts that are either truncated or contain point mutations. The PTMs of the invention are designed to cleave a targeted transcript upstream or downstream of a specific mutation or upstream of a premature 3' and correct the mutant transcript via a traps-splicing reaction which replaces the portion of the transcript containing the mutation with a functional sequence.
1n addition, double traps-splicing reactions may be used for the selective expression of a toxin in tumor cells. For example, PTMs can be designed to replace the second exon of the human ~i-chronic gonadotropin-6 ((3hCG6) gene transcripts and to deliver an exon encoding the subunit A of diptheria toxin (DT-A).

WO 02/OS3s81 PCT/US02/00~16 Expression of DT-A in the absence of subunit B should lead to toxicity only in the cells expressing the gene. (3hCG6 is a prototypical target for genetic modification by traps-splicing. The sequence and the stntcture of the (3hCG6 gene are completely known and the pattern of splicing has been determined. The (3hCG6 gene is highly expressed in many types of solid tumors, including many non-germ line tumors, but the ~ihCG6 gene is silent in the majority cells in a normal adult. Therefore, the (3hCG6 pre-mRNA represents a desirable target for a traps-splicing reaction designed to produce tumor-specific toxicity.
The first exon of (3hCG6 pre-mRNA is ideal in that it encodes only five amino acids, including the initiator AUG, which should result in minimal interference v~rith the proper folding of the DT-A toxin while providing the required signals for effective translation of the traps-spliced mRNA. The DT-A exon, which is designed to include a stop codon to prevent chimeric protein formation, will be engineered to traps-splice into the last exon of the (3hCG6 gene. The last exon of the (3hCG6 gene provides the construct with the appropriate signals to polyadenylate the mRNA and ensure translation.
Cystic fibrosis (CF) is one of the most common fatal genetic disease in humans. Based on both genetic and molecular analyses, the gene associated with cystic fibrosis has been isolated and its protein product deduced (Kerem, B.S.
et al., 1989, Science 245:1073-1080; Riordan et al., 1989, Science 245:1066-1073;Rommans, et al., 1989, Science 245:1059-1065). The protein product of the CF
associated gene is called the cystic fibrosis transmembrane conductance regulator (CFTR). In a specific embodiment of the invention, a traps-splicing reaction will be used to coxTect a genetic defect in the DNA sequence encoding the cystic fibrosis transmembrane regulator (CFTR) whereby the DNA sequence encoding the cystic fibrosis traps-membrane regulator protein is expressed and a functional chloride ion channel is produced in the airway epithelial cells of a patient.
Population studies have indicated that the most common cystic fibrosis mutation is a deletion of the three nucleotides in exon 10 that encode phenylalanine at position 508 of the CFTR amino acid sequence. As indicated in Figure 15, a trans-splicing reaction was capable of correcting the deletion at position 508 in the CFTR

l-amino acid sequence. The PTM used for correction of the genetic defect contained a CFTR BD intron 9 sequence, a spacer sequence, a branch point, a polypyrimidine ' tract, a 3' splice site and a wild type CFTR BD exon 10 sequence (Figure 13).
The successful correction of the mutated DNA encoding CFTR utilizing a trams-splicing 5 reaction supports the general application of PTMs for correction of genetic defects.
HemophiliaA is an X-linked bleeding disorder characterized by a deficiency in the activity of factor VIII, a n important component of the coagulation cascade. The incidence of hemophilia A is approximately 1 in S,OOO to 10,000 males.
Affected individuals suffer joint and muscle hemorrhage, easy bruising, and 10 prolonged bleeding from wounds. Hemophilia A arises from a variety of mutations within the factor VIII gene. The gene comprises 26 exons and spans I86 kb.
About 95 percent of those patients with hemophilia A in whom mutations have been characterized, have point mutations in the gene. In a specific embodiment of the invention, a tracts-splicing reaction will be used to correct a genetic defect in the 15 DNA sequence encoding factor VIII whereby the DNA sequence encoding the factor VIII protein is expressed and a functional clotting factor is produced in the plasma of a patient. The PTMs of the invention can be genetically engineered to repair any exon of interest, or combination of exons for the purpose.of correcting a defect in the coding region of the factor VIfI gene.
20 Genetic studies have indicated that the most common factor VIII
mutations) are be generated. As indicated in Figure 46, a traps-splicing reaction was capable of correcting the mutation in the factor VIII amino acid sequence. The mutation was created by an insertion of the neomycin gene into exon 16 and intron 16 of the mouse gene, interrupting the open reading frame of exon 16 and eliminating 25 intron 16's 3' splice donor site. The PTM used for correction of the genetic defect contained factor VIII exons 16-24 coding sequences, a spacer sequence, a branch point, a polypyrimidine tract, and a 3' acceptor splice (Figure 44A). The successful correction of the mutated DNA encoding factor VIII utilizing a traps-splicing reaction further supports the general application of PTMs for correction of genetic defects.
30 The methods and compositions of the invention may also be used to regulate gene expression in plants. For example, trafis-splicing may be used to place the expression of any engineered gene under the natural regulation of a chosen target plant gene, thereby regulating the expression of the engineered gene. Traps-splicing may also be used to prevent the expression of engineered genes in non-host plants or to convert an endogenous gene product into a more desirable product.
In a specific embodiment of the invention trap-splicing may be used to regulate the expression of the insecticidal gene that produces Bt toxin (Bacillus thzcr~ingierasis). For example, the PTM may be designed to traps-splice into an injury response gene (pre-mRNA) that is expressed only after an insect bites the plant.
Thus, all cells of the plant would carry the gene for Bt in the PTM, but the cells would only produce Bt when and where an insect injures the plant. The rest of the plant will make little or no Bt. A PTM could traps-splice the Bt gene into any chosen gene with a desired pattern of expression. Further, it should be possible to target a PTM so that no Bt is produced in the edible portion of the plant.
One advantage associated with the use of PTMs is that the PTM
acquires the native gene control elements of the target gene, thus, reducing the time and effort that might otherwise be spent attempting to identify and reconstitute appropriate regulatory sequences upstream of an engineered gene. Thus, expression of the PTM regulated gene should occur only in those plant cells containing the target pre-mRNA. By targeting a gene not expressed in the edible portion of the plant or in the pollen, traps-splicing can alleviate opposition to genetically modified plants, as consumers would not be eating the proteins made from modified genes. The edible portion of such crops should test negative for genetically modified proteins.
In addition, PTM can be targeted to a unique sequence of the host gene that is not present in other plants. Therefore, even if the gene (DNA) which encodes the PTM jumps to another species of plant, the PTM gene will not have an appropriate target for tr-ans-splicing. Thus, tram-splicing offers a "fail-safe" mode fox prevention of gene "jumping" to other plant species: the PTM gene will be expressed only in the engineered host plant, which contains the appropriate target pre-mRNA.
Expression in non-engineered plants would not be possible.
Traps-splicing also provides a more efficient way to convert one gene product into another. For example, tr-ar~.r-splicing ribozymes and chimeric oligos can WO 02/OS3s81 PCTIUS02/OO.116 be incorporated into corn genomes to modify the ratio of saturated to unsaturated oils.
Ti-afiS-splicing can also be used to convert one gene product into another.
Various delivery systems are known and can be used to transfer the compositions of the invention into cells, e.g. encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the composition, receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J.
Biol.
Chem. 262:4429-4432), construction of a nucleic acid as part of a retroviral or other vector, injection of DNA, electroporation, calcium phosphate mediated transfection, etc.
The compositions and methods can be used to treat cancer and other serious viral infections, autoimmune disorders, and other pathological conditions in which the alteration or elimination of a specific cell type would be beneficial.
Additionally, the compositions and methods may also be used to provide a gene encoding a functional biologically active molecule to cells of an individual with an I S inherited genetic disorder where expression of the missing or mutant gene product produces a normal phenotype. -In a preferred embodiment, nucleic acids comprising a sequence encoding a PTM are administered to promote PTM function, by way of gene delivery and expression into a host cell. In this embodiment of the invention, the nucleic acid mediates an effect by promoting PTM production. Any of the methods for gene delivery into a host cell available in the art can be used according to the present invention. For general reviews of the methods of gene delivery see Strauss, M.
and Barranger, J.A.; 1997, Concepts in Gene Therapy, by Walter de Gruyter & Co., Berlin; Goldspiel et al., 1993, Clinical Pharmacy 12:488-SOS; Wu and Wu, 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 33:573-596;
Mulligan, 1993, Science 260:926-932; and Morgan and Anderson,1993, Ann. Rev.
Biochem. 62:191-217; 1993, TIBTECH 11 (5):155-215. Exemplary methods are described below.
Delivery of the nucleic acid into a host cell may be either direct, in which case the host is directly exposed to the nucleic acid or nucleic acid-carrying vector, or indirect, in which case, host cells are first transformed with the nucleic acid WO 02/0,3,81 PCTlUS02/00~1( 132 v111'0, then transplanted into the host. These two approaches are known, respectively, as in vivo or ex vivo gene delivery.
In a specific embodiment, the nucleic acid is directly administered in vivo, where it is expressed to produce the PTM. This can be accomplished by any of S numerous methods known in the art, e.g., by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g. by infection using a defective or attenuated retroviral or other viral vector (see U.S. Patent No. 4,980,286), or by direct injection of naked DNA, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, encapsulation in liposomes, mieroparticles, or microcapsules, or by administering it in linkage to a peptide which is known to enter the nucleus, by administerilig it in linkage to a ligand subject to receptor-mediated endocytosis (see e.g., Wu and Wu, 1987, J. Biol. Chem.
262:4429-4432).
In a specific embodiment, a viral vector that contains the PTM can be used. For example, a retroviral vector can be utilized that has been modified to delete retroviral sequences that are not necessary for packaging of the viral genome and integration into host cell DNA (see Miller et al., 1993, Meth. Enzymol.
217:581-599).
Alternatively, adenoviral or adeno-associated viral vectors can be used for gene delivery to cells or tissues. (See, Kozarsky and Wilson, 1993, Current Opinion in Genetics and Development 3:499-503 for a review of adenovirus-based gene delivery).
Another approach to gene delivery into a cell involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection- Usually, the method of transfer includes the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. The resulting recombinant cells can be delivered to a host by various methods known in the art. In a preferred embodiment, the cell used for gene delivery is autologous to the host cell.

WO 02/OS3s81 PCT/DS02/00~16 3.1 The present invention also provides for pharmaceutical compositions comprising an effective amount of a PTM or a nucleic acid encoding a PTM, and a pharmaceutically acceptable carrier. In a specific embodiment, the term-"pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier"
refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Examples of suitable pharmaceutical earners are described in "Remington's Pharmaceutical sciences" by E.W. Martin.
In specific embodiments, pharmaceutical compositions are administered: (1) in diseases or disorders involving an absence or decreased (relative to normal or desired) level of an endogenous protein or function, for example, in hosts where the protein is lacking, genetically defective, biologically inactive or underactive, or under expressed; or (2) in diseases or disorders wherein, in vitro or in vivo, assays indicate the utility of PTMs that inhibit the function of a particular protein . The activity of the protein encoded for by the chimeric mRNA
resulting from the PTM mediated traps-splicing reaction can be readily detected, e.g., by obtaining a host tissue sample (e.g., from biopsy tissue) and assaying it in vitro for mRNA or protein levels, structure and/or activity of the expressed chimeric mRNA.
Many methods standard in the art can be thus employed, including but not Iinuted to immunoassays to detect and/or visualize the protein encoded for by the chimeric mRNA (e.g., Western blot, inmmnoprecipitation followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis, immunocytochemistry, ere.) and/or hybridization assays to detect formation of chimeric mRNA expression by detecting and/or visualizing the presence of chimeric mRNA (e.g., Northern assays, dot blots, in situ hybridization, and Reverse-Transcription PCR, ere.), ere.
The present invention also provides for pharmaceutical compositions comprising an effective amount of a PTM or a nucleic acid encoding a PTM, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized WO 02/053,81 PCTlUS02/00~16 3s pharmacopeia for use in animals, and more particularly in humans. The term "carrier"
refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Examples of suitable pharmaceutical corners are described in "Remington's Pharmaceutical sciences" by E.V~~. Martin. In a specific embodiment, it S may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment. This may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers: Other control release drug delivery systems, such as nanoparticles, matrices such as controlled-release polymers, hydrogels.
The PTM will be administered in amounts which are effective to produce the desired effect in the targeted cell. Effective dosages of the PTMs can be 1 S determined through procedures well known to those in the art which address such parameters as biological half life, bioavailability and toxicity. The amount of the composition of the invention which will be effective will depend on the nature of the disease or disorder being treated, and can be determined by standard clinical techniques. In addition, is~ vitro assays may optionally be employed to help identify optimal dosage ranges.
The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention optionally associated with such containers) can lie a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
5.3.2. USE OF PTM MOLECULES FOR EXON TAGGING
In view of current efforts to sequence and characterize the genomes of humans and other organisms, there is a need for methods that facilitate such characterization. A majority of the information currently obtained by genomic mapping and sequencing is derived from complementary DNA (cDNA) libraries, which are made by reverse transcription of mRNA into cDNA. Unfortunately, this process causes the loss of information concerning intron sequences and the location of exon/intron boundaries.
The present invention encompasses a method for mapping exon-intron boundaries in pre-mRNA molecules comprising (r) contacting a pre-traps-splicing molecule with a pre-mRNA molecule under conditions in which a portion of the pre-trans-splicing molecule is traps-spliced to a portion of the target pre-mRNA
to form a chimeric mIRNA; (ii) amplifying the chimeric mRNA molecule; (iii) selectively purifying the amplified molecule; and (iv) determining the nucleotide sequence of the amplified molecule thereby identifying the intron-exon boundaries.
In an embodiment of the present invention, PTMs can be used in trans-splicing reactions to locate exon-intron boundaries in pre-mRNAs molecules.
PTMs for use in mapping of intron-exon boundaries have structures similar to those described above in Section 5.1. Specifically, the PTMs contain (r) a target binding domain that is designed to bind to many pre-mRNAs: (ii) a 3' splice region that includes a branch point, pyrimidine tract and a 3' splice acceptor site, or a 5' splice donor site; (iii) a spacer region that separates the mRNA splice site from the target . binding domain; and (iv) a tag region that will be traps-spliced onto a pre-mRNA.
Alternatively, the PTMs to be used to locate exon-intron boundaries may be engineered to contain no target binding domain.
For purposes of intron-exon mapping, the PTMs are genetically engineered to contain target binding domains comprising random nucleotide sequences. The random nucleotide sequences contain at least 15-30 and up to several hundred nucleotide sequences capable ofbinding and anchoring a pre-mRNA so that the spliceosome processing machinery of the nucleus can traps-splice a portion (tag or marker region) of the PTM to a portion of the pre-mRNA. PTMs containing short target binding domains, or containing inosines bind under less stringent conditions to the pre-mRNA molecules. In addition, strong branch point sequences and pyrimidine tracts serve to increase the non-specificity of PTM traps-splicing.

WO 02/OS3s81 PCT/US02/00~16 The random nucleotide sequences used as target binding domains in the PTM molecules can be generated using a variety of different methods, including, but not limited to, partial digestion of DNA with restriction endonucleases or mechanical shearing of the DNA. The use of such random nucleotide sequences is designed to generate a vast array of PT11~I molecules with different binding activities for each target pre-mRNA expressed in a cell. Randomized libraries of oligonucleotides can be synthesized with appropriate restriction endonucleases recognition sites on each end for cloning into PTM molecules genetically engineered into plasmid vectors. When the randomized oligonucleotides are litigated and IO expressed, a randomized binding library of PTMs is generated.
Tn a specific embodiment of the invention, an expression library encoding PTM molecules containing target binding domains comprising random nucleotide sequences can be generated using a variety of methods which are well known to those of skill in the art. Ideally, the library is complex enough to contain PTM molecules capable of interacting with each target pre-mRNA expressed in a cell.
By way of example, Figure 9 is a schematic representation of two forms of PTMs which can be utilized to map intron-exon boundaries. The PTM on the left is capable of non-specifically traps-splicing into a pre-mRNA 3' splice site, while the PTM on the right is capable of traps-splicing into a pre-mRNA 5' splice site.
Traps-splicing between the PTM and the target pre-mRNA results in the production of a chimeric mRNA molecule having a specific nucleotide sequence "tag" on either the 3' or 5' end of an authentic exon.
Following selective purification, a DNA sequencing reaction is then performed using a primer which begins in the tag nucleotide sequence of the PTM and proceeds into the sequence of the tagged exon. The sequence immediately following the last nucleotide of the tag nucleotide sequence represents an exon boundary. For identification of intron-exon tags, the traps-splicing reactions of the invention can be performed either ifs vitro or in vivo using methods well known to those of skill in the art.

WO 02/OS3s81 PCT/US02/00:116 5.3.3. USE OF PTM MOLECULES FOR IDENTIFICATION
OF PROTEINS EXPRESSED IN A CELL
In yet another embodiment of the invention, PTM mediated trans-splicing reactions can be used to identify previously undetected and unknown proteins S expressed in a cell. This method is especially useful for identification of proteins that cannot be detected by a two-dimensional electrophoresis, or by other methods, due to ifzter alia the small size of the protein, low concentration of the protein, or failure to detect the protein due to similar migration patterns with other proteins in two-dimensional electrophoresis.
The present invention relates to a method for identifying proteins expressed in a cell comprising (i) contacting a pre-traps-splicing molecule containing a random target binding domain and a nucleotide sequence encoding a peptide tag with a pre-mRNA molecule under conditions in which a portion of the pre-trans-splicing molecule is traps-spliced to a portion of the target pre-mRNA to form a chimeric mRNA encoding a fusion polypeptide or separating it by gel electrophoresis (ii) affinity purifying the fusion polypeptide; and (iii) determining the amino acid sequence of the fusion protein.
To identify proteins expressed in a cell, the PTMs of the invention are genetically engineered to contain: (i) a target binding domain comprising randomized nucleotide sequences; (ii) a 3' splice region that includes a branch point, pyrimidine tract and a 3' splice acceptor site and/or a 5' splice donor site; (iii) a spacer region that separates the PTM splice site from the target binding domain; and (iv) nucleotide sequences encoding a marker or peptide affinity purification tag. Such peptide tags include, but are not limited to, HIS tags (6 histidine consecutive residues) (Janlrnecht, et al., 1991 Proc. Natl. Acad. Sci. USA 88:8972-8976), glutathione-S-transferase (GST) (Smith, D.B. and Johnson K.S., 1988, Gene 67:31) (Pharmacia) or FLAG
(Kodak/IB~ tags (Nisson, J. et al. J. Mol. Recognit., 1996, 5:585-594).
Traps-splicing reactions using such PTMs results in the generation of chimeric mRNA molecules encoding fusion proteins comprising protein sequences normally expressed in a cell linked to a marker or peptide affinity purification tag.
The desired goal of such a method is that every protein synthesized in a cell receives a WO 02/053681 PCT/US02/00~16 marker or peptide affinity tag thereby providing a method for identifying each protein expressed in a cell.
In a specific embodiment of the invention, PTM expression libraries encoding PTMs having different target binding domains comprising random nucleotide sequences are generated The desired goal is to create a PTM
expression library that is complex enough to produce a PTM capable of binding to each pre-mRNA expressed in a cell. In a preferred embodiment, the library is cloned into a mammalian expression vector that results in one, or at most, a few vectors being present in any one cell.
To identify the expression of chimeric proteins, host cells are transformed with the PTM library and plated so that individual colonies containing one PTM vector can be grown and purified. Single colonies are selected, isolated, and propagated in the appropriate media and the labeled chimeric protein exon(s) fragments are separated away from other cellular proteins using, for example, an affinitypurification tag. For example, affinity chromatography can involve the use of antibodies that specifically bind to a peptide tag such as the FLAG tag.
Alternatively, when utilizing HIS tags, the fusion proteins are purified using a Niz+
nitriloacetic acid agarose columns, which allows selective elution of bound peptide eluted with imidazole containing buffers. When using GST tags, the fusion proteins are purified using glutathione-S-transferase agarose beads. The fusion proteins can then be eluted in the presence of free glutathione.
Following purification of the chimeric protein, an analysis is earned out to determine the amino acid sequence of the fusion protein. The amino acid sequence of the fusion protein is determined using techniques well known to those of skill in the art, such as Edman Degradation followed by amino acid analysis using HPLC, mass spectrometry or an amino acid analyzation. Once identified, the peptide sequence is compared to those sequences available in protein databases, such as GenBank. If the partial peptide sequence is already known, no further analysis is done. If the partial protein sequence is unknown, then a more complete sequence of that protein can be carried out to determine the full protein sequence. Since the fusion protein will contain only a portion of the full length protein, a nucleic acid encoding the full length protein can be isolated using conventional methods.
For example, based on the partial protein sequence oligonucleotide primers can be generated for use as probes or PCR primers to screen a cDNA library.
6. EXAMPLE: PRODUCTION OF TRANS-SPLICING MOLECULES
5 The following section describes the production of PTMs and the demonstration that such molecules are capable of mediating trans-splicing reactions resulting in the production of chimeric mRNA molecules.
6.1. MATERIALS AND METHODS
6.1.1. CONSTRUCTION OF PRE-mRNA MOLECULES
10 Plasmids containing the wild type diphtheria toxin subunit A (DT-A, wild-type accession #K01722) and a DT-A mutant (CRM 197, no enzymatic activity) were obtained from Dr. Virginia Johnson, Food and Drug Administration, Bethesda, Maryland (Uchida et al., 1973 J. Biol. Chem 248:3838). For in vitro experiments, DT--A was amplified using primers: DT-1F (5'-GGCGCTGCAGGGCGCTGATGATGTTGTTG) (SEQ ID
15 N0:2); and DT-2R (5'-GGCGAAG CTTGGATCCGACACGATTTCCTGCACAGG) (SEQ ID N0:3), cut with PstI and HindIII, and cloned into PstI and HindIII
digested pBS(-) vector (Stratagene, La Jolla, CA). The resulting clone, pDTA was used to construct the individual PTMs. (1) pPTM+: Targeted construct. Created by inserting 20 (5'AATTCTCTAGATGCTTCACCCGGGCCTGACTCGAGTACTAACTGGTACCTCT
TCTTTTTTTTCCTGCA) (SEQ ID N0:4) and IN2-4 (5'-GG GAAGAGGTACCAGTTAGTACTCGAGTCAGG
CCCGGGTGAAGCATCTAGAG) (SEQ ID NO:S) primers into EcoRI and Pstl digested pDTA. (2) pPTM+Sp: As pPTM+ but with a 30 by spacer sequence 25 between the BD and BP. Created by digesting pPTM+ with XhoI and ligating in the oligonucleotides, spacer S (5'-TCGAGCAACGTTATAATAATGTTC) (SEQ ID
N0:6) and spacer AS (5'-TCGAGAACATTATT ATAACGTTGC) (SEQ ID N0:7).
For in vivo studies, an EcoRI and HindIII fragment of pcPTM+Sp was cloned into mammalian expression vector pcDNA3.1 (Invitrogen), under the control of a 30 CMV promoter. Also, the methionine at codon 14 was changed into isoleucine to prevent initiation of translation. The resulting plasmid was designated as pcPTM+Sp. (3) pPTM+CRM: As pPTM+Sp but the wild type DT-A was substituted with CRM mutant DT-A (T. Uchida, et al., 1973, J. Biol.
Chem.
248:3838). This was created by PCR amplification of a DT-A mutant (mutation at G52E) using primers DT-1F and DT-2R. For in vivo studies, an EcoRI HindIII fragment of PTM+CRM was cloned into pc3.lDNA that resulted in pcPTM+ARM. (4) PTM-:
Non-targeted construct. Created by digestion of PTM+ with EcoRI and Pst I, gel purified to remove the binding domain followed by ligation of the oligonucleotides, IN-(5'-ATCTCTAGATCAGGCCCGGGTGAAGCC CGAG) (SEQ ID N0:8) and IN-6 (S'-TGCTTCACCC GGGCCTGATCTAGAG) (SEQ ID N0:9). (5) PTM-Sp, is an identical version of the PTM-, except it has a 30 by spacer sequence at the PstI site.
Similarly, the splice mutants [Py(-)AG(-) and BP(-)Py(-)AG(-)] and safety variants [PTM+SF-Py 1, PTM+SF-Py2, PTM+SFBP3 and PTM+SFBP3-Py 1 ] were constructed either by insertion or deletion of specific sequences (see Table 1).
Table 1. Binding/non-binding domain, BP, PPT and 3' as sequences of different PTMs.

PTM constructBD/NBD BP PPT 3'ss PTM+Sp (targeted):TGCTTCACCCGGGCCTGATACTAAC CTCTTCTTTTTTTTCCCAG

(SEQ ID NO:10) (SEQ ID NO:
1 I) PTM-Sp (non-targeted):CAACGTTATAATAATGTTTACTAAC CTCTTCTTTTTTTTCCCAG

(SEQ ID N0:12) (SEQ ID NO:11 ) pTM+py (-)AG(-)BP(-):TGCTTCACCCGGGCCTGAGGCTGAT CTGTGATTAATAGCGGACG

(SEQ ID NO:10) (SEQ ID NO:
13) PTM+py(-)AG(-):TGCTTCACCCGGGCCTGATACTAAC CCTGGACGCGGAAGTTACG

(SEQ ID NO: 10) (SEQ ID NO:
14) PTM+SF :CTGGGACAAGGACACTGCTTCA

CCCGGTTAGTAGACCACAGCCCT

GAAGCC (SEQ ID NO: TACTAAC CTTCTGTTTTTTTCTCCAG
15) ( SEQ ID NO: 16) PTM+SF-Pyl :As in PTM+SF TACTAAC CTTCTGTATTATTCTCCAG

( SEQ ID NO: 17) PTM+SF-Py2 :As in PTM+SF TACTAAC GTTCTGTCCTTGTCTCCAG

( SEQ ID NO:I8) PTM+SF-BP3 :As in PTM+SF TGCTGAC CTTCTG'ITITITTCTCCAG

( SEQ ID N0:16) PTM+SFBP3-Pyl:As in PTM+SF TGCTGAC CTTCTGTATTATTCTCCAG

(SEQ ID NO:
17) Nucleotides in bold indicate the mutations compared to normal BP, PPT and 3' splice site.
Branch site A is underlined. The nucleotides in italics indicates the mismatch introduced into safety BD to mask the BP sequence in the PTM.

WO 02/053581 PCT/US02/00~16 a2 A double-traps-splicing PTM construct (DS-PTM) was also made adding a 5' splice site and a second target binding domain complementary to the second intron of (3HCG pre-mRNA to the 3' end of the toxin coding sequence of PTM+SF (Figare A).
6.1.2. (iHCG6 TARGET PRE-mRNA
To produce the in vitro target pre-mRNA, a Sacl fragment of ~HCG
gene 6 (accession #X00266) was cloned into pBS(-). This produced an 805 by insert from nucleotide 460 to 1265, which includes the 5' untranslated region, initiation codon, exon 1; intron 1, exon 2, and most of intron 2. For in vivo studies, an EcoRI
and BamHI fragment was cloned into mammalian expression-vector (pc3.lDNA), producing (3HCG6.
6.1.3. mRNA PREPARATION
For in vitro splicing experiments, (3HCG6, ~i-globin pre-nzRNA and different PTM mRNAs were synthesized by in vitro transcription of BamHI and HindIII digested plasmid Dl~TAs respectively, using T7 mRNA polymerase (Pasman & Garcia-Blanco, 1996, Nucleic Acids Res. 24:1638). Synthesized mRNAs were purified by electrophoresis on a denaturing polyacrylarilide gel, and the products were excised and eluted.
6.1.4 IN VITRO SPLICING
PTMs and target pre-mRNA were annealed by heating at 98 °C
followed by slow cooling to 30-34°C. Each reaction contained 4 p,1 of annealed mRNA complex (100 ng of target and 200 ng of PTM),~ 1X splice buffer (2 mM
MgCIZ, 1 mM ATP, 5 mM creatinine phosphate, and 40 mM KCl) and 4 p1 of HeLa splice nuclear extract (Promega) in a 12.5 ~,1 final volume. Reactions were incubated 2S at 30°C for the indicated times and stopped by the addition of an equal volume of high salt buffer (7 M urea, 5% SDS,100 mM LiCI,10 mM EDTA and 10 mM TrisHCI, pH 7.5). Nucleic acids were purified by extraction with phenol:chloroform:isoamyl alcohol (50:49:1) followed by ethanol precipitation.

6.1.5. REVERSE TRANSCRIPTION-PCR REACTIONS
RT-PCR analysis was performed using EZ-RT PCR kit (Perkin-Elmer, Foster City, CA). Each reaction contained 10 ng of cis- or traps-spliced mRNA, or 1-2 ~.g of total mRNA, 0.1 ~.l of each 3' and S' specific primer, 0.3 mM of each dNTP, 1 X EZ
buffer (50 mM bicine, 11 S mM potassium acetate, 4% glycerol, pH 8.2), 2.5 mM magnesium acetate and 5 U of rTth DNA polymerase in a 50 ~,1 reaction volume. Reverse transcription was performed at 60°C for 45 min followed by PCR amplification of the resulting cDNA as follows: one cycle of initial denaturation at 94°C for 30 sec, and 25 cycles of denaturation at 94° C for 18 sec and annealing and extension at 60°C for 40 sec, followed by a 7 min final extension at 70°C. Reaction products were separated by electrophoresis in agarose gels.
Primers used in the study were as follows:
DT-1F: GGCGCTGCAGGGCGCTGATGATGTTGTTG (SEQ ID NO: 19) DT-2R: GGCGAAGCTTGGATCCGACACGATTTCCTGCACAGG (SEQ ID NO: 20) DT-3R: CATCGTCATAATTTCCTTGTG (SEQ ID NO: 21) DT-4R: ATGGAATCTACATAACCAGG (SEQ ID NO: 22) DT-SR: GAAGGCTGAGCACTACACGC (SEQ ID NO: 23) HCG-R2: CGGCACCGTGGCCGAAGTGG (SEQ ID NO: 24) Bio-HCG-F: ACCGGAATTCATGAAGCCAGGTACACCAGG (SEQ ID NO: 25) b- globulin-F: GGGCAAGGTGAACGTGGATG (SEQ ID NO: 26) b- globulin-R: ATCAGGAGTGGACAGATCC (SEQ ID NO: 27) 6.1.6. CELL GROWTH. TRANSFECTION AND mRNA ISOLATION
Human lung cancer cell line H1299 (ATCC accession # CRL-5803) was grown in RPMI medium supplemented with 10% fetal bovine serum at 37°C in a 5%

environment. Cells were transfected with pcSp+CRM (CRM is a non-functional toxin), a vector expressing a PTM, or vector alone (pcDNA3.1 ) using lipofectamine reagent (Life Technologies, Gaithersburg, MD). The assay was scored for neomycin resistance (neon) colony formation two weeks after transfection. Four neon colonies were selected and expanded under continued neo selection. Total WO 02/053681 PCT/US02/00~16 cellular mRNA was isolated using RNA exol (BioChain Institute, Inc., San Leandro, CA) and used for RT-PCR.
6.1.7. TRANS SPLICING IN TUMORS IN NUDE MICE
Eleven nude mice were bilaterally injected (except B10, B11 and B12 had 1 tumor) into the dorsal flank subcutaneous space with 1 x 10' H1299 human lung tumor cells (day 1). On day 14, the mice were given an appropriate dose of anesthesia and injected with, or without electroporation (T820, BTX Inc., San Diego, CA) in several orientations with a total volume of 100 u1 of saline containing 100 ,ug pcSp+CRM with or without pc~iHCG6 or pcPTM+Sp. Solutions injected into the right side tumors also contained India ink to mark needle tracks. The animals were sacrificed 48 hours later and the tumor excised and immediately frozen at -80°C. For analysis, l0 mg of each tumor was homogenized and mRNA was isolated using a Dynabeads mRNA direct kit (Dynal) following the manufacturers directions.
Purified mRNA (2 ,u1 of 10 ,u1 total volume) was subj ected to RT-PCR using (3HCG-F and DT-SR primers as described earlier. All samples were re-amplified using DT-3R, a nested DT-A primer and biotinylated [3HCG F and the products were analyzed by electrophoresis on a 2% agarose gel. Samples that produced a band were processed into single stranded DNA using M280 Streptavidin Dynabeads and sequenced using a toxin specific primer (DT-3R).
20. 6.2. RESULTS
6.2.1. SYI~T'I~SIS OF PTM
A prototypical traps-splicing mRNA molecule, pcPTM+Sp (Figure 1A) was constructed that included: an 18 pt target binding domain (complementary to ~iHCG6 intron 1), a 30 nucleotide spacer region, branch point (BP) sequence, a polypyrinudine tract (PPT) and an AG dinucleotide at the 3' splice site immediately upstream of an exon encoding .diphtheria toxin subunit A (DT-A) (LTchida et al., 1973, J. Biol. Chem. 248:3838). Later DT-A exons were modified to eliminate translation initiation sites at codon 14. The PTM constructs were designed for maximal activity WO 02/OS3~81 PCT/US02/00~16 in order to demonstrate tz-ans-splicing; therefore, they included potent 3' splice elements (yeast BP and a mammalian PPT) (Moore et al., 1993, In The mRNA
World, R.F. Gesteland and J.F. Atkins, eds. (Cold Spring Harbor, New York:
Cold Spring Harbor Laboratory Press). (3HCG6 pre-mRNA (Talmadge et al., 1984, Nucleic Acids Res. 12:8415) was chosen as a model target as this gene is expressed in most tumor cells. It is not expressed in normal adult cells, with the exception of some in the pituitary gland and gonads. (Acevedo et al., 1992, Cancer 76:1467; Hoon et al., 1996, Int J. Cancer 69:369; Bellet et al:, 1997, Cancer Res. 57:516). As shown in Figure 1 C, pcPTM+Sp forms conventional Watson-Grick base pairs by its binding domain with the 3' end of (3HCG6 intron 1, masking the intronic 3' splice signals of the target. This feature is designed to facilitate trmzs-splicing between the target and the PTM_ HeLa nuclear extracts were used in conjunction with established splicing procedures (Pasman & Garcia-Blanco, 1996, Nucleic Acids Res. 24:1638) to test if a PTM consri-uct could invade the (3HCG6 pre-mRNA target. The products of izz vitro traps-splicing were detected by RT-PCR, using primers specific for chimeric mRNA molecules. The predicted product of a successfizl traps-splicing reaction is a chimeric mRNA comprising the first exon of [3HCG6, followed immediately by the exon contributed from pcPTM+Sp encoding DT-A (Figure 1 C). Such chimeric mRNAs were readily detected by RT-PCR using primers (3HCG-F (specific to (3HCG6 exon 1) and DT-3R (specific to DT-A, Figure 2A, lanes 1-2). At time zero or in the absence of ATP, no 466 by product was observed, indicating that this reaction was both ATP and time dependent.
The target binding domain of pcPTM+Sp contained 18 nucleotides 2S complementary to ~3HCG6 intron 1 pre-mRNA and demonstrated efficient trans-splicing (Figure 2A, lanes 1-2). Traps-splicing efficiency decreased at least 8 fold (Figure 2, lanes 3-4) using non-targeted PTM-Sp, which contains a non-complementary 18 nucleotide "non-binding domain". Traps-splicing efficiencies of PTM mRNAs with or without a spacer between the binding domain and BP were also compared. This experiment demonstrated a significant increase in the efficiency of traps-splicing by the addition of a spacer (Figure 2B, lanes 2 + 5). To facilitate the a6 recruitment of splicing factors required for efficient traps-splicing, some space may be needed between the 3' splice site and the double-stranded secondary structure produced by the binding domain/target interaction.
To investigate the effect of PTM length on traps-splicing specificity, shorter PTMs were synthesized from AccI cut PTM plasmid (see Figure 1). This eliminated 479 pt from the 3' end of the DT-A coding sequence. Figure 2B shows the traps-splicing ability of a targeted short PTM(+) (lanes 10-12), compared to a non-targeted short PTM(-) (lanes 14-17). Short PTM+ produced substantially more trans-spliced product (Figure 2B, lane 12) than its counterpart, non-targeted short PTM
(Figure 2B, lane 17). These experiments indicate that longer PTMs may have increased potential to mediate traps-splicing non-specifically.
6.2.2. ACCUR.A.CY OF PTM SPLICEOSOME
MEDIATED TRAMS SPLICING
To confirm that traps-splicing between the pcPTM+Sp and (3HGG6 target is precise, RT-PCR amplified product was produced using 5' biotinylated (3HCG-F and nonbiotinylated DT-3R primers. This product was converted into single stranded DNA and sequenced directly with primer DT-3R (DT-A specific reverse primer) using the method of Mitchell and Mernl (1989, Anal. Biochem. 178:239).
Traps-splicing occurred exactly between the predicted splice sites (Figure 3), confirming that a conventional pre-mRNA can be invaded by an engineered PTM
construct during splicing; moreover, this reaction is precise.
In addition selective traps-splicing of a double splicing PTM (DS-PTM) was observed (Figure 8B). The DS-PTM can produce tra~zs-splicing by contributing either a 3' or 5' splice site. Further, DS-PTMs can be constructed which will be capable of simultaneously double-traps-splicing, at both a 3' and 5' site, thereby permitting exon replacement. Figure 8B demonstrates that in this construct the 5' splice site is most active at a 1:1 concentration of target (3HCG pre-xnRNA:DS-PTM. At a 1:6 ratio the 3' splice site is more active.

WO 02/OS3s81 PCT/US02/00.116 ~7 6.2.3. 3' SPLICE SITES ARE ESSENTIAL FOR PTM TRANS SPLICING
In general, the 3' splice site contains three elements: 1) a BP sequence located 5' of the acceptor site, 2) a PPT consisting of a short run of pyrimidine residues, and 3) a YAG trinucleotide splice site acceptor at the intron-exon border (Senapathy et al., 1990, Cell 91:875; Moore et al:, 1993). Deletion or alteration of one of these sequence elements are lmown to either decrease or abolish splicing (Aebi et al., 1986; Reed & Maniatis 1988, Genes Dev. 2:1268; Reed, 1989, Genes Dev.
3:21 I3; Roscigno et al., 1993, J. Biol. Chem. 268:11222; Coolidge et al., 1997, Nucleic Acids Res. 25:888). The role of these conserved elements in targeted trans-splicing was addressed experimentally. In one case [(BP(-)Py(-)AG(-)], all three cis -elements (BP, PPT and AG dinucleotide) were replaced by random sequences. A
second splicing mutant [(Py(-)AG(-)] was constructed in which the PPT and the 3' splice site acceptor were mutated and substituted by random sequences. Neither construct was able to support trafZS-splicing in vitro (Figure 2A, lanes 5-8), suggesting that, as in the case of conventional cis-splicing, the PTM traps-splicing process also requires a functional BP, PPT and AG acceptor at the 3' splice site.
6.2.4. DEVELOPMENT OF A "SAFETI"' SPLICE SITE
TO INCREASE SPECIFICITY
To improve the levels of target specificity achieved by the inclusion of a binding domain or by shortening the PTM, the target-binding domain of several PTM constructs was modified to create an infra-molecular stem to mask the 3' splice site (termed a "safety PTM"). The safety stem is formed by portions of the binding domain that partially base pair with regions of the PTM 3' splice site or sequences adj acent to them, thereby blocking the access of spliceosornal components to the PTM
3' splice site prior to target acquisition (Figure 4A, PTM+SF). Base pairing between free portions of the PTM binding domain and (3HCG6 target region unwinds the safety stem, allowing splicing factors such as U2AF to bind to the PTM 3' splice site and initiate traps-splicing (Figure 4B).
This concept was tested in splicing reactions containing either PTM+SF (safety) or pcPTM+Sp (linear), and both target (/3HCG6) and non-target ((3-WO 02/053681 PCT/US02/00~16 :18 globin) pre-mRNA. The spliced products were subsequently analyzed by RT-PCR
and gel electrophoresis. Using (3HCG-F and DT-3R primers, the specific 196 by trams-spliced band was demonstrated in reactions containing (3HCG target and either linear PTM (pcPTM+Sp, Figure 5, lane 2) or safety PTM (PTM+SF, Figure S, lane 8).
Comparison of the targeted trarzs-splicing between linear PTM (Figure 5, lane 2) and safety PTM (Figure 5, lane 8) demonstrated that the safety PTM traps-spliced less.
efficiently than the linear PTM.
Non-targeted reactions were amplified using (3-globin-F (specific to exon 1 of (3-globin) and DT-3R primers. The predicted product generated by non-specific PTM tr-ans-splicing with ~i-globin pre-mRNA is 189 bp. Non-specific trarvs-splicing was evident between linear PTM and (3-globin pre-mRNA (Figure 5, lane 5).
In contrast, non-specific trams-splicing was virtually eliminated by the use of safety PTM (Figure 5, lane 11). This was not unexpected, since the linear PTM was designed for maximal activity to prove the concept of spliceosome-mediated trar~.r-splicing. The open structure of the linear PTM combined with its potent 3' splice sites strongly promotes the binding of splicing factors. Once bound, these splicing factors can potentially initiate trarcs-splicing with any S' splice site, in a process similar to tram-splicing in trypanosomes. The safety stem was designed to prevent splicing factors, such as U2AF from binding to the PTM prior to target acquisition.
This result is consistent with a model that base-pairing between the free portion of the binding domain and the (3HCG6 target unwinds the safety stem (by mRNA-mRNA
interaction), uncovering the 3' splice site, permitting the recruitment of splicing factors and initiation of tr ans-splicing. No traps-splicing was detected between (3-globin and ~iHCG6 pre-mRNAs (Figure 5, lanes 3, 6, 9 and 12).
6.2.5. IN VITRO TRANS SPLICING OF SAFETY PTM AND VARTANTS
To better understand the role of cis-elements at the 3' splice site in traps-splicing a series of safety PTM variants were constructed in which either the PPT was weakened by substitution with purines and/or the BP was modified by base substitution (see Table I). In vitr o traps-splicing efficiency of the safety (PTM+SF) was compared to three safety variants, which demonstrated a decreased ability to WO 02/0;3;81 PCT/US02/00-t16 -t9 tr ans-splice. The greatest effect was observed with variant 2 (PTM+SFPy2), which was tr-ans-splicing incompetent (Figure 4C, lanes 5-6). This inlubition of trans-splicing may be attributed to a weakened PPT and/or the higher Tm of the safety stem.
In contrast, variations in the BP sequence (PTM+SFBP3) did not markedly effect S traps-splicing (Figure 4C, lanes 7-8). This was not surprising since the modifications introduced were within the mammalian branch point consensus range ~i'NYUR.AC
(where Y = pyrimidine, R = purine and N = any nucleotide) (Moore et al., 1993).
This finding indicates that the branch point sequence can be removed without affecting splicing efficiency. Alterations in the PPT (PTM+SF-Pyl) decreased the level of traps-splicing (lanes 3-4). Similarly, when both BP and PPT were altered PTM+SFBP3-Pyl, they caused a furPher reduction in tf~arzs-splicing (Figure 4C, lanes 9-10). The order of traps-splicing efficiency of these-safety variants is PTM+SF>PTM+SFBP3> PTM+SFPyl>PTM+SFBP3-Pyl>PTM+SFPy2. These results confirm that both the PPT and BP are important for efficient in vitro trans-splicing (Roscigno et al., 1993, J. Biol. Chem. 268:11222).
6.2.6. COMPETITION BETWEEN CIS AND TRANS- SPLICING
To determine if it was possible to block pre-mRNA cis-splicing by increasing concentrations of PTM, experiments were performed to drive the reaction towards traps-splicing: Splicing reactions were conducted with a constant amount of (3HCG6 pre-mRNA target and various concentrations of traps-splicing PTM. Cis-splicing was monitored by RT-PCR using primers to (3HCG-F (exon 1 ) and (3HCG-(exon 2). This amplified the expected 125 by cis-spliced and 478 by unspliced products (Figure 6A). The primers (3HCG-F and DT-3R mere used to detect trans-spliced products (Figure 6B). At lower concentrations ofPTM, cis-splicing (Fig. 6A, lanes 1-4) predominated over trarzs-splicing (Figure 6B, lanes 1-4). Cis-splicing was reduced approximately by 50% at a PTM concentration 1.5 fold greater than target.
Increasing the PTM mRNA concentration to 3 fold that of target inhibited cis-splicing by more than 90% (Figure 6A, lanes 7-9), with a concomitant increase in the tratzs-spliced product (Figure 6B, lanes 6-10). A competitive RT-PCR was performed to simultaneously amplify both cis and tr a~a-spliced products by including all three WO 02/OS3s81 PCT/US02/00~16 ;0 primers (~iHCG-F, HCG-R2 and DT-3R) in a single reaction. This experiment had similar results to those seen in Figure 6, demonstrating that under in vitro conditions, a PTM can effectively block target pre-mRNA cis-splicing and replace it with the production of an engineered t~~ans-spliced chimeric mRNA.
6.2.7. TRANS SPLICING IN TISSUE CULTURE
To demonstrate the mechanism of traps-splicing in a cell culture model, the human lung cancer line H1299 ((3HCG6 positive) was transfected with a vector expressing SP+CRM (a non-functional diphtheria toxin) or vector alone (pcDNA3.1) and grown in the presence of neomycin. Four neomycin resistant colonies were individually collected after 14 days and expanded in the continued presence of neomycin. Total mRNA was isolated from each clone and analyzed by RT-PCR using primers (3HCG-F and DT-3R. This yielded the predicted 196 by trans-spliced product in three out of the four selected clones (Figure 7A, lanes 2, 3 and 4).
The amplified product from clone #2 was directly sequenced, confirming that PTM
1 S driven traps-splicing occurred in human cells exactly at the predicted splice sites of endogenously expressed (3HCG6 target exon 1 and the first nucleotide of DT-A
(Figure 7B).
' 6.2.8. TRANS-SPLICING IN AN IN VIVO MODEL
To demonstrate the mechanism of trams-splicing in vivo, the following experiment was conducted in athymic (nude) mice. Tumors were established by injecting 10' H1299 cells into the dorsal flank subcutaneous space. On day 14, PTM
expression plasmids were injected into tumors. Mvst tumors were then subjected to electroporation to facilitate plasmid delivery (see Table 2, below). After 48 hrs, tumors were removed, poly-A mRNA was isolated and amplified by RT-PCR Ti-ans-splicing was detected in 8 out of 19 PTM treated tumors. Two samples produced the predicted traps-spliced product (466 bp) from mRNA after one round of RT-PCR.
Six additional tumors were subsequently positive for fians-splicing by a second PCR
amplification using a nested set of primers that produced the predicted 196 by product (Table 2). Each positive sample was sequenced, demonstrating that [3HCG6 exon WO 02/053681 PCT/US02100~16 6l was precisely traps-spliced to the coding sequence of DT-A (wild type or CRM
- ' mutant) at the predicted splice sites. Six of the positive samples were from treatment groups that received cotransfected plasmids, pcPTM+CRM and pcHCG6, which increased the concentration of target pre-mRNA. This was done to enhance the probability of detecting traps-spliced events. The other two positive tumors were from a group that received only pcPTM+Sp (wild type DT-A). These tumors were not transfected with (3HCG6 expression plasmid, demonstrating once again, as in the tissue culture model described in Section 6.2.7, that traps-splicing occurred between the PTM and endogenous (3HCG6 pre-mRNA produced by tumor cells.

Table 2.
Traps-splicing in tumors in nude mice:

MousePlasmid Left RightElectroporationRT-PCR Nested Nucleotide Sequence Left PCR
Ri ht rt B2 MV-S BI-3 B1-4'IOOOV/cm- - - - - -rt B3 cS RM B3-I B3-21000V/cm - - - -B3-3 B3-4'IOOOV/cm- - -B4 pcSp+CRMB4-I B4-2b50V/cm - - - - -B4-3 B4-4'ZSV/cm - - - - -BS pcSp+CRM/BS-I BS-21000V/cm + - + + ATGTTCCAG9GGCGTG

N0:65 BS-3 BS-4'IOOOV/cm+ _ + + ATGTTCCAG9GGCGTG
ATGAT SE ID
N0:65 B6 pcSp+CRM/B6-I B6-2SOV/cm - - - - -B6-3 B6-4'25V/cm - - + ~. ATGTTCCAG9GGCGTG
ATGAT SE ID
N0:65 B7 pTM+S B7-1 '1000V/cm B8 pc PTM+SpB8-I SOV/cm - % ATGTTCCAG9GGCGTG
ATGAT SE ID
N0:65 'B9 pc PTM+SpB9-I - - % ATGTTCCAG9GGCGTG
ATGAT SE ID
N0:65 a: 6 pulses of 99Fs sets of 3 pulses administered orthogonally b: 8 pulses of l Oms sets of 4 pulses administered orthogonally °: 8 pulses of SOms sets of 4 pulses administered orthogonally +: positive for RT-PCR traps-spliced produce I: did not receive electroporation 7. EXAMPLE: lacZ TRANS-SPLICING MODEL
In order to demonstrate and evaluate the generality of the mechanism of spliceosome mediated targeted traps-splicing between a specific pre-mRNA target and a PTM, a simple model system based on expression of enzyme (3-galactosidase was developed. The following section describes results demonstrating successful splicesome mediated targeted trans-splicing between a specific target and a PTM.

7.1. MATERIALS AND METHODS
7.1.1. PRIMER SEQUENCES
The following primers were used for testing the IacZ model system:
5' Lac-1F
GCATGAATTCGGTACCATGGGGGGGTTCTCATCATCATC (SEQ ID NO: 28) 5' Lac-1 R
CTGAGGATCCTCTTACCTGTAAACGCCCATACTGAC (SEQ ID NO: 29) 3' Lac-1F
GCATGGTAACCCTGCAGGGCGGCTTCGTCTGGGACTGG (SEQ ID NO: 30) 3' Lac-1R
CTGAAAGCTTGTTAACTTATTATTTTTGACACCAGACC (SEQ ID NO: 31 ) 3' Lac-Stop GCATGGTAACCCTGCAGGGCGGCTTCGTCTAATAATGGGACTGGGTG
(SEQ ID NO: 32) HCG-In 1 F
GCATGGATCCTCCGGAGGGCCCCTGGGCACCTTCCAC (SEQ ID NO: 33) HCG-InIR
CTGACTGCAGGGTAACCGGACAAGGACACTGCTTCACC (SEQ ID NO: 34) HCG-Ex2F
GCATGGTAACCCTGCAGGGGCTGCTGCTGTTGCTG (SEQ ID NO: 35) HCG-Ex2R
CTGAAAGCTTGTTAACCAGCTCACCATGGTGGGGCAG (SEQ ID NO: 36) Lac-TRl (Biotin): 7-GGCTTTCGCTACCTGGAGAGAC (SEQ ID NO: 37) Lac-TR2 GCTGGATGCGGCGTGCGGTCG (SEQ ID NO: 38) HCG-R2: CGGCACCGTGGCCGAAGTGG (SEQ ID NO: 39) 7. 1.2. CONSTRUCTION OF THE lacZ PRE-mRNA TARGET MOLECULE
The IacZ target 1 pre-mRNA (pc3.l IacTl) was constructed by cloning of the following three PCR products: (i) the S' fragment of lacZ; followed by (ii) bHCG6 intron l; (iii) and the 3' fragment of lacZ. The 5' and 3' fragment of the IacZ

WO 02/0,3,81 PCT/US02/00~16 ;:1 gene were PCR amplified from template pcDNA3.1/HisllacZ (Invitrogen,San Diego, CA) using the following primers: S' Lac-1F and 5'Lac-1R (for 5' fragment), and 3'Lac-1F and 3' Lao-lR (for 3' fragment). The amplified lacZ 5' fragment is 1788 by long which includes the initiation codon, and the amplified 3' fi-agment is 1385 by long and has the natural 5' and 3' splice sites in addition to a branch point, polypyrinlidine tract and /3HCG6 intron 1. The (3HCG6 intron 1 was PCR
amplified using the following primers: HCG-lnlF and HCG-InlR.
The lacZ target 2 is an identical version of lacZ target 1 except it contains two stop codons (TAA TAA) in frame four codons after the 3'splice site.
This was created by PCR amplification of the 3' fragment (lacZ) using the following primers: 3' Lac-Stop and 3' Lac 1R and replacing the functional 3' fragment in lacZ
target 1.
7.1.3. CONSTRUCTION OFpc3.1 PTMl and pc3.1 PTMZ
The pre-traps-splicing molecule, pc3.1 PTMl was created by digesting -15 pPTM +Sp with PstI and HindlIf and replacing the DNA fragment encoding the DT-A toxin with the a DNA fragment encoding the functional 3' end of lacZ. This fragment was generated by PCR amplification using the following primers: 3' Lac-1F
and 3' Lac-1R For cell culture experiments, an EcoRI and HindIII fragment of pc3.1 PTM2 which contains the binding domain to HCG intron 1, a 30 by spacer, a yeast branch point (TACTAAC), and strong polypyrimidine tract followed by the lacZ
cloned was cloned into pcDNA3.1.
The pre-traps-splicing molecule, pc3.1 PTM2 was created by digesting pPTM +Sp with PstI and HindIII and replacing the DNA fragment encoding the DT-A toxin with the (3HCG6 exon 2. ~3HCG6 exon 2 was generated by PCR
amplification using the following primers: HCG-Ex2F and HCG-Ex2R. For cell culture experiments, an EcoRI and HindlII fragment of pc3.1 PTM2 which contains the binding domain to HCG intron l, a 30 by spacer, a yeast branch point (TACTAAC), and strong polypyrimidine tract followed by the (3HCG6 exon 2 cloned was used.

WO 02/OS3s81 PCT/US02/00~16 ;s 7.I.4. CO-TRANSFECTION OF THE lacZ SPLICE TARGET
PRE-mRNA AND PTMS INTO 293T CELLS
Human embryonic kidney cells (293T) were grown in I1MEM medium supplemented with 10% FBS at 37°C in a 5% C02. Cells were co-transfected with S pc3. l LacTl and pc3.l PTM2, or pc3.1 LacT2 and pc3.1 PTM1, using Lipofectamine Plus (Life Technologies,Gaithersburg, MD) according to the manufacturer's instructions. 24 hours post-transfection, the cells were harvested; total RNA
was isolated and RT-PCR was performed using specific primers for the target and PTM
molecules. (3-galactosidase activity was also monitored by staining the cells using a (i-gal staining kit (Invitrogen, San Diego. CA).
7.2. RESULTS
7.2.1. THE lacZ SPLICE TARGET CIS SPLICES EFFICIENTLY
TO PRODUCE FUNCTIONAL (3-GALACTOSIDASE
To test the ability of the splice target pre-mRNA to cis-splice efficiently, pc3.1 IacT l was transfected into 293 T cells using Lipfectamine Plus reagent (Life Technologies,Gaithersburg, MD) followed by RT-PCR analysis of total RNA. Sequence analysis of the cis-spliced RT-PCR product indicated that splicing was accurate and occurred exactly at the predicted splice sites (Fig. 12B). In addition, accurate cis-splicing of the target pre-mRNA molecule results in formation of a mRNA capable of encoding active (3-galactosidase which catalyzes the hydrolysis of [3-galactosidase, i.e., ~-gal, producing a blue color that can be ~risualized under a microscope. Accurate cis-splicing of the target pre-mRNA was further confirmed by successfully detecting ~i-galactosidase enzyme activity.
Repair of defective lacZ target 2 pre-mRNA by traps-splicing of the functional 3' lacZ fragment (PTMl) was measured by staining for (3-galactosidase enzyme activity. For this purpose, 293T cells were co-transfected with lacZ
target 2 pre-mRNA (containing a defective 3' fragment) and PTMl (contain normal 3' lacZ
sequence). 48 hours post-transfection cells were assayed for (3-galactosidase enzyme activity. Efficient traps-splicing of PTMl into the lacZ target 2 pre-mRNA
will WO 02/OS3s81 PCT/US02/00~16 s6 result in the production of functional ~i-galactosidase activity. As demonstrated in Figure 11B-E, traps-splicing of PTM 1 into lacZ target 2 results in restoration of (3-galactosidase enzyme activity up to 5% to 10% compared to control.
7.2.2. TARGETED TRANS SPLICING BETWEEN
THE lacZ TARGET PRE-mRNA and PTM2 To assay for traps-splicing, lacZ target pre-mRNA and PTM2 were transfected into 293 T cells. Following transfection, total RNA was analyzed using RT-PCR. The following primers were used in the PCR reactions: lacZ-TRl (lacZ
5' exon specific) and HCGR2 ((3HCGR exon 2 specific). The RT PCR reaction , produced the expected 195 by t~-ans-spliced product ( Fig. 1 l, lanes 2 and 3) demonstrating efficient traps-splicing between the lacZ target pre-mRNA and PTM 2.
Lane 1 represents the control, which does not contain PTM 2.
The efficiency of the traps-splicing was also measured by staining for (3-galactosidase enzyme activity. To assay for traps-splicing, 293T cells were co-transfected with lacZ target pre-mRNA and PTM 2. 24 hours post-transfection, cells were assayed for (3-galactosidase activity. If there is efficient traris-splicing between the target pre-mRNA and the PTM, a chimeric mRNA is produced consisting of the 5' fragment of the lacZ target pre-mRNA and (3HCG6 exon 2 is formed which is incapable of coding for an active ~i-galactosidase. Results from the co-transfection experiments demonstrated that traps-splicing of PTM2 into lacZ target 1 resulted in the reduction of (3-galactosidase activity by compared to the control.
To further confirm that trams-splicing between the lacZ target pre-mRNA and PTM2 is accurate, RT-PCR was performed using 5' biotinylated lacZ-TRl and non-biotinylated HCGR2 primers. Single stranded DNA was isolated and sequenced directly using HCGR2 primer (HCG exon 2 specific primer). As evidenced by the sequence of the splice junction, traps-splicing occurred exactly as predicted between the splice sites (Fig. 12A and 12B), confirming that a conventional pre-mRNA can be invaded by an engineered PTM during splicing, and moreover, that this reaction is precise.

WO 02/053s81 PCT/US02/00.116 8. EXAMPLE: CORRECTION OF THE CYSTIC FIBROSIS
TRANSMEMBRANE REGULATOR GENE
Cystic fibrosis (CF) is one of the most common genetic diseases in the world. The gene associated with CF has been isolated and its protein product deduced (Kerem, B.S. et al., 1989, Science 245:1073-1080; Riordan et al., 1989, Science 245:1066-1073;Rommans, et al., 1989, Science 245:1059-1065): The protein product of the CF associated gene is referred to as the cystic fibrosis trans-membrane conductance regulator (CFTR). The most common disease-causing mutation which accounts for ~70% of all mutant alleles is a deletion of three nucleotides in exon 10 that encode for a phenylalanine at position 508 (~1F508). The following section describes the successful repair of the cystic fibrosis gene using spliceosome mediated trails-splicing and demonstrates the feasibility of repairing CFTR in a model system.
8.1 MATERIALS AND METHODS
8.1.1. PRE-TRAMS-SPLICING MOLECULE
The CFTR pre-traps-splicing molecule (PTM) consists of a 23 nucleotide binding domain complimentary to CFTR intron 9 (3' end, -13 to -31), a 30 nucleotide spacer region (to allow efficient binding of spliceosomal components), branch point (BP) sequence, polypyrimidine tract (PPT) and an AG dinucleotide at the 3' splice site immediately upstream of the sequence encoding CFTR exon 10 (wild type sequence containing F508). This initial PTM was designed for maximal activity in order to demonstrate traps-splicing; therefore the PTM included a UACUAAC
yeast consensus BP sequence and an extensive PPT. An 18 nucleotide HIS tag (6 histamine codons) was included after wild type exon 10 coding sequence to allow specific amplification and isolation of the traps-spliced products and not the endogenous CFTR. The oligonucleotides used to generate the two fragments included unique restriction sites. (Apal and PstI, and PstI and NotI, respectively) to facilitate directed cloning of amplified DNA into the mammalian expression vector pcDNA3.1.

8.1.2. THE TARGET CFTR PRE-mRNA MINI-GENE
The CFTR mini-gene target is shown in Figure 13 and consists of CFTR exon 9 ;
the functional 5' and 3' regions of intron 9 (260 and 265 nucleotides from each end, respectively);
exon 10 [~F508]; and the 5' region of intron 10 (96 nucleotides). In addition, as depicted in Figure 16, a mini-target gene comprising CFTR exons 1-9 and 10-24 can be used to test the use of spliceosome mediated traps-splicing for correction of the cystic fibrosis mutation.
Figure 17, shows a double splicing PTM that may also be used for correction of the cystic fibrosis mutation. As shown, the double splicing PTM contains CFTR BD intron 9, a spacer, a branch point, a polypyrimidine tract, a 3' splice site, CFTR exon 10, a spacer, a branch point, a polypyrimidine tract, a 5' splice site and CFTR BD exon 10.
8.1.3. OLIGONUCLEOTIDES
The following oligonucleotides were used to create CFTR PTM:
Forward CF3 ACCT GGGCCC ACC CAT TAT TAG GTC ATT AT CCGCGG AAC ATT ATA
ApaI site. Intron 9 CFTR, -12 to -34. (SEQ ID NO: 40) Reverse CF4 ACCT CTGCAGGTGACC CTG CAG GAA AAA AAA GAA G (SEQ ID NO: 41) PstI BstEI PPT
Forward CFS
ACCT CTGCAG ACT TCA CTT CTA ATG ATG AT (SEQ ID NO: 42) Pstl. Exon 10 CFTR, +1 to +24 Reverse CF6 ACCT GCGGCCGC CTA ATG ATG ATG ATG ATG ATG CTC TTC TAG TTG GCA TGC
Not I. Stop Polyhistamine tag Exon 10 CFTR, +15 to +132 (SEQ ID NO: 43) The following nucleotides were used to create the CFTR TARGET
pre-mRNA mini gene (Exon 9 + mini-Intron 9 + Exon 10 + 5' end Intron 10):

Forward CF 18 GACCT CTCGAG GGA TTT GGG GAA TTA TTT GAG (SEQ ID NO: 44) XhoI Exon 9 CFTR, 1 to 21.
Reverse CF 19 S CTGACCT GCGGCCGC TAC AGT GTT GAA TGT GGT GC (SEQ ID NO: 4S) NotI. Intron 9 S' end.
Forward CF20 CTGACCT GCGGCCGC CCA ACT ATC TGA ATC ATG TG (SEQ ID NO: 46) NotI. Intron 9 3' end.
Reverse CF21 GACCT CTTAAG TAG ACT AAC CGA TTG AAT ATG (SEQ ID NO: 47) AflII Intron 10 S' end.
The following oligonucleotides were used for detection of trans-spliced products:
1S Reverse Bio-His CTA ATG ATG ATG ATG ATG ATG (SEQ ID NO: 48) Stop. Polyhistidine tag (S' biotin label):
Reverse Bio-His(2) CGC CTA ATG ATG ATG ATG ATG (SEQ ID NO: 49) 3' UT Stop. Polyhistidine tag (S' biotin label).
Forward CF8 CTT CTT GGT ACT CCT GTC CTG (SEQ ID NO: SO) 2S Exon 9 CFTR.
Forward CF 18 GACCT CTCGAG GGA TTT GGG GAA TTA TTT GAG (SEQ ID NO: S 1 ) Xhol. Exon 9 CFTR.
Reverse CF28 AAC TAG AAG GCA CAG TCG AGG (SEQ ID NO: S2) Pc3.l vector sequence (present in PTM 3' UT but not target).

WO 02/0S3581 PCT/US02/00~16 8.2. RESULTS
The PTM and target pre-mRNA were co-transfected in 293 embryonic kidney cells using lipofectamine (Life Technologies,Gaithersburg, MD). Cells were harvested 24 h post transfection and RNA was isolated. Using PTM and target-5 specific primers in RT-PCR reactions, a traps-spliced product was detected in which mutant exon 10 of the target pre-mRNA was replaced by the wild type exon 10 of the PTM (Figure 14). Sequence analysis of the traps-spliced product confirmed the restoration of the three nucleotide deletion and that splicing was accurate, occurring at the predicted splice sites (Figure 15), demonstrating for the first time RNA
repair of 10 the cystic fibrosis gene, CFTR (Mansfield et al., 2000, Gene Therapy 7:1885-1895):
9. EXAMPLE: DOUBLE-TRA~IrS SPLICING
The following example demonstrates accurate replacement of an internal exon by a double-traps-splicing between a target pre-mRNA and a PTM
RNA containing both 3' and 5' splice sites leading to production of full length 15 functionally active protein.
As descn'bed herein, any pre-mRNA can be reprogrammed by providing a traps-reactive RNA molecule containing either a 3'-splice site, a 5'-splice site or both. The following example describes successful targeting and replacement of a single internal exon utilizing pre-traps-splicing molecules (PTMs) containing 20 both the 5' and 3' splice sites. Such PTMs can promote two traps-splicing reactions with the intended target gene mediated by the splicesome(s). To test this mechanism, a splicing lacZ model target gene consisting of lacZ 5' "exon" - CFTRmini-intron 9 -CFTR exon 10 (0F508) - CFTR mini-intron 10 followed by lacZ 3"'exon" was created. In this target transcript, a 124 by central portion of the ~-galactosidase ORF
25 was substituted by exon 10 (~F508) of CFTR, thus it produces non-functional protein.
A PTM consisting of the missing 124 by IacZ "mini-exon" and a 5' and 3' trans-splicing domain containing binding domains (BDs) complementary to the target introns and exons was created. Transfection of HEK 293T cells with either target alone or PTM alone showed no detectable levels of (3-gal activity. In contrast, 293T
30 cells transfected with target plus PTM produced substantial levels of (3-gal activity WO 02/053;81 PCT/US02/00=t1G

indicating the restoration of protein function. The accuracy of traps-splicing between the target and PTM was confirmed by sequencing the appropriate RT-PCR product, which revealed the predicted internal exon substitution. The feasibility of this approach in a disease model was tested by replacing the CFTR DF508 exon I O
with normal exon 10 containing FSO8 in cystic fibrosis. These results.demonstrate that a traps-splicing technology can be easily adapted to correct many of the genetic defects whether they are associated with the S' exon or 3' exon or any internal exon of the gene.
Figure 18 is a schematic of a model lacZ target consisting of lacZ 5' exon - CFTR mini-intron 9 - CFTR exon 10 (delta 508) - CFTR min-intron 10 followed by the lacZ 3' exon. In this target, a 124 by central portion of the IacZ gene is substituted with CFTR exon 10 which has a mutation at position 508 (delta 508).
The pre-mRNA target undergoes normal cis-splicing to produce an mRNA
consisting of lacZ S' exon - CFTR exon 10 (delta 508) followed by the lacZ 3' exon.
Because of the disruption in (3-galactosidase ORF it produces truncated proteins which are non-functional.
To restore (3-gal function by double-traps-splicing, three PTMs were created consisting of the missing 124 by lacZ "mini-exon" and a 5' and 3' trans-splicing domain containing binding domains complementary to the target introns and exons as shown in F awre 19. These PTMs ha~~e an I20 by 3' binding domain (complementary to intron 9) from PTM24 (see below) used in 3' exon replacement, spacer sequence, yeast branch point, polypyrimidine tract, 3' acceptor AG
dinucleotide, lacZ "mini-exon", S' splice site, spacer sequence followed by the S' binding domain. These PTMs differ only in their 5' binding domain sequences.
DSPTMS has a 27 by BD which is complementary to intron 10 and blocks just the 5' splice site of the target. DSPTM6 has 120 by S' BD and covers both S' and 3' splice sites of the target, while, DSPTM7 has 260 by BD which masks both the splice sites (5' and 3') and also covers the entire exon of the target.
A schematic representation of a double-traps-splicing reaction showing the binding of DSPTM7 with DSCFTl .6 target pre-mRNA is shown in Figure 20. 3' BD: 120 by binding domain complementary to mini-intron 9; 5' BD

(260 bp); second binding domain complementary to mini-intron 10 and exon 10.
ss: splice sites; BP: branch point, and PPT: polypyrimidine tract.
The important structural elements of DSPTM7 (Figure 21) are as follows:
(1) 3' BD (120 BPl (SEO ID N0:69):
GATTCACTTGCTCCAATTATCATCCTAAGCAGAAGTGTATATTCTTA
TTTGTAAAGATTCTATTAACTCATTTGATTCAAAATATTTAAAATACTTCC
TGTTTCATACTCTGCTATGCAC
(2) Spacer sequences (24 bp~SEO ID N0:701: AACATTATTATAACGTTGCTCGAA
(3) Branch point pyrimidine tract and acceptor splice site (SEQ ID N0:711:
3' ss BP Kpn 1 PPT EcoRV ~~~lacz mini-exon TACTAAC T GGTACC TCTTCTTTI°TTTTTT GATATC CTGCAG ( GGC GGC I
(4) 5' donor site and 2nd spacer sequence (SEO ID N0:721:
5' ss 1$ lacZ mini-exon I TGA ACG I GTAAGT GTTATCACCGATATGTGTCTAACCTGATTCGGGCCTTC
GATACGCTAAGATCCACCGG
~5) 5' BD (260 BP1~SE0 ID N0:73):
TCAAAAAGTTTTCACATAATTTCTTACCTCTTCTTGAATTCATC'rCTT
TGATGACGCTTCTGTATCTATATTCATCATTGGAAACACCAATGATTTTZ'C
TTTAATGGTGCCTGGCATAATCCTGGAAAACTGATAACACAATGAAATTC
TTCCACTGTGCTTAAAAAAACCCTCTTGAATTCTCCATTTCTCCCATAATC
ATCATTACAACTGAACTCTGGAAATAAAACCCATCATTATTAACTCATTAT
CAAATCACGC
To determine whether the restoration of (3-gal function is RNA tra»s-splicing mediated, the mutants are depicted in Figure 22. DSPTM8 is a 3' splice mutant in which the 3' splice elements such as BP, polypyrimidine tract and the 3' acceptor AG
dinucleotides were deleted and replaced with random sequences (SEO ID N0:851. This PTM still has 3' and 5' binding domains and the functional S' splice site. PTM29 lacks the 2"d binding domain + 5' ss but still has the 3' binding domain 3' splice site, while PTM30 lacks the 1St binding domain + 3' splice site but has the functional S' splice site and 2"a binding domain.
To examine the double-traps-splicing mediated restoration of (3-gal function, cells were either transfected with 2 ~.g of target or PTM alone or co-transfected with 2 ~.g of target + 1.5 ~.g of PTM using Lipofectamine Plus reagent. 48 hrs. after transfection, total RNA
was isolated and analyzed by RT-PCR using Kl-1F and Lac-6R primers. These primers amplify both cis- and traps-spliced products in a single reaction which were identified based on the size. The cis-spliced product is 295 by in size while the traps-spliced product is 230 by in size. To confirm that traps-splicing between DSPTM7 and DSCFT1.6 pre-mRNA
is precise, RT-PCR amplified products were excised, re-amplified using K1-2F and Lac-6R
primers and sequenced directly using K1-2F or Lac-6R primers. As shown in Figure 23 trans-splicing occurred exactly at the predicted splice sites, confirming the precise internal exon substitution by two traps-splicing events (SEQ ID N0:86, 87).
The repair of defective lacZ pre-mRNA by double traps-splicing events and subsequent production of full-length (3-gal protein was investigated in co-transfection assays. 293T cells were co-transfected with DSCFT1.6 target and DSPTM7 expression plasmids, as well as with DSCFT1.6 target or DSPTM7 alone as controls. Western blot analysis of total cell lysates using polyclonal anti-(3-galactosidase antiserum specifically recognized a 120 kDa protein only in cells co-transfected with DSCFT1.6 target + DSPTM7 plasmids (Fig. 24, lanes 3 and 4) but not in cells transfected with either DSCFT1.6 target (Lane 1) or DSPTM7 plasmid alone (Lane 2). Similarly, no full-length protein was detected in cells co-transfected with DSCFT1.6 target + 3' splice mutant (Lane 5 and 6) or PTM29 or 30 in which either 3' traps-splicing domain or S' traps-splicing domains has been deleted (Lane 7). In addition, the 120 kDa protein band co-migrated with the full-length functional (3-gal produced using lacZ-T1 plasmid (positive control, data not shown). These results not only confirmed the production of full-length protein by double-traps-splicing between the target and PTM but also demonstrated that both the 3' splice site and S' splice sites are essential for this process.

i i WO 02/0a3581 PCT/US02/00~16 6~
To determine whether the full-length protein produced by double-rrans-splicing between the target pre-mRNA and DSPTM7 RNA is functionally active, 293T cells were co-transfected with DSCFTl .6 targeted + one of the double splicing PTMs 5, 6 or 7 expression plasmids, or transfected with DSCFT1.6 target or S DSPTM7 alone. Total cell extracts were prepared and assayed for ø-gal activity using ONPG assay (Invitrogen). ø-gal activity in extracts prepared from cells transfected with either DSCFT1.6 target or DSPTM7 alone was almost identical to the .
background levels detected in mock transfection (Fig. 25). In contrast, 293T
cells co-transfected with DSCFTl .6 target and DSPTM7 produced - 21 fold higher levels of ø-gaI activity over the background (Fig. 25). These results confirmed the accurate double-trays-splicing between the target pre-mRNA and PTM RNA and production of the full-Length functional protein.
To confirm that restoration of ø-gal activity by double-traps-splicing reaction is absolutely depended on the presence of both 3' and S' splice sites of the PTM, we constructed several mutants: (a) DSPTMB, is identical to DSPTM7 except the functional 3' spice elements (branch point, polypyrimidine tract and the 3' acceptor AG dinucleotides) were deleted and substituted with random sequences (see Fig.

for details); (b) PTM29 lacks S' splice site as well as the 5' binding domain but has the 3' binding domain and 3' splice site, and (c) PTM30 lacks 3' binding domain and 3' splice site but has he 5' splice site and 5' binding domain. ø-gal activity in extracts prepared from cells transfected vtiith either DSCFT1.6 target or DSPTM7 alone vvas almost identical to the background levels detected in mock transfection (Fig.
26).
Similarly, no significant increase in /3-gal activify was detected in cells transfected with either DSFTM8 alone (3' splice site mutant) or co-transfection of DSCFT1.6 target + one of the above mutant PTMs. On the other hand, cells co-transfected with DSCFT1.6 target and DSPTM7 with functional 3' and 5' splice sites produced substantial levels of ø-gal activity over the background (Fig. 26). These results confirmed the requirement of both splice sites in the double-splicing PTM and also eliminated the possibility that restoration of ø-gal activity was due to complementation between the truncated proteins (Fig. 26).

Different concentrations of the target and PTM were co-transfected and analyzed for (3-gal activity restoration. As expected, 293T cells co-transfected with DSCFT1.6 target + DSPTM7 showed substantial levels of ~3-gal activity (~ 30 fold) over the controls. Increasing the concentrations of the PTM by 2 and 3 fold did increase the level of (3-gal activity, but not significantly (Fig. 27). These results further confirmed the double-traps-splicing mediated restoration of (3-gal enzyme function.
The specificity of double-traps-splicing reaction was examined by constructing a non-specific target (DSHCGT1.1) which is similar to that of specific target (DSCFT1.6) but has (3HCG intron 1 - (3HCG exon 2 and (3HCG intron 2 instead of 10 CFTR mini-intron 9 - CFTR exon 10 (delta 508) and CFTR mini-intron 10 (Fig.
28).
RT-PCR analysis of the total RNA isolated from cells transfected with either DSHCGT1.1 (non-specific target) alone or in combination DSPTM7 (targeted to DSCFT1.6 target) failed to produce the expected 314 by double-traps-spliced product.
On the other hand, RT-PCR analysis of the total RNA prepared from cells co-transfected 15 with specific target + PTM produced the expected 314 pb product. This was further confirmed by (3-gal activity assay of the total cellular extract. The level (3-gal activity detected in cells transfected with non-specific target alone or in combination with DSPTM7 targeted to DSCFT1.6 target was almost identical to the background level. In contrast substantial levels of (3-gal activity was detected in cells co-transfected with 20 specific target (DSCFT1.6) + DSPTM7 (Fig. 27). These results confirmed that the double-traps-splicing is highly specific.
The repair model in Fig. 30 shows a portion of a target CFTR pre-mRNA
consisting of exons 1-9, mini-intron 9, exon 10 containing the delta 508 mutation, mini-intron 10 and exons 11-24 (Fig. 30). The PTM shown in the figure consists of exon 10 25 coding sequences (containing codon 508) and two traps-splicing domains each with its own splicing elements (acceptor and donor sites, branchpoint and pyrimidine tract) and a binding domain complementary to intron 9 splice site, part of exon 10 (5' and 3' ends) and intron 10 5' splice site (SEQ ID N0:88) (Fig. 31 (DS-CF1)). Exon 10 of the PTM
also has modified codon usage throughout to reduce antisense effects between exon 10 30 of the PTM and it's own binding domains and for PTMs that have binding domains which are complementary to exon sequences (Fig. 31). A double-trans-splicing event between the PTM and target should produce a repaired full-length mRNA.
Fig. 32 shows the sequence of a single PCR product showing target exon 9 correctly spliced to PTM 20 exon 10 (with modified codons) (upper panel) (SEQ
ID
N0:89), codon 508 in exon 10 of the PTM (middle panel) (SEQ ID N0:90) and PTM
exon 10 correctly spliced to target exon 11 (lower panel) (SEQ ID N0:91). The sequence of a repaired target was generated by RT-PCR followed by PCR.
10. EXAMPLE: TRANS SPLICING REPAIR OF THE
CYSTIC FIBROSIS GENE USING A PTM
TO THAT CAN PERFORM S' EXON REPLACEMENT
The key advantage of using S' exon replacement for gene repair are (a) it permits replacement of the 5' portion of a gene (b) the construct requires less sequence and space than a full-length gene construct, (c) PTMs can be produced that lack a polyA signal which should prevent PTM translation, and (d) the 5' end can be modified to increase translation.
10.1 MATERIALS AND METHODS
10.1.1 PLASMID CONSTRUCTION
The CFTR coding sequences (exons 1-10) for PTM30 were generated by PCR
using a partial cDNA plasmid template (61160; American Type Culture Collection, Manassas, VA). The traps-splicing domain (TSDj [including the binding domain, spacer sequence, polypyrimidine tract (PPT), branchpoint (BP) and 3' splice site] was generated from a PCR product (using an existing plasmid template) and by annealing oligonucleotides. The different fragments (the TSD and coding sequences) were then cloned into pcDNA3.1 (-) using appropriate restriction sites.
Oligodeoxynucleotide primers were procured from Sigma Genosys (The Woodlands, TX). All PCR
products were generated with either REDTaq (Sigma, St. Louis, MO), or cloned Pfu (Stratagene, La Jolla, CA) DNA Polymerase. PCR primers for amplification contained restriction sites for directed cloning. PCR products were digested with the appropriate restriction enzymes and cloned into the mammalian expression plasmid pc3.lDNA(-) (Invitrogen, Carlsbad, CA).
10.1.2 CELL CULTURE AND TRANSFECTIONS
S Constructs were cotransfected in human embryonic kidney (HEK) 293T or 293 cells ( 1.25 x 1 O6 cells per 60 mm poly-d-lysine coated dish) using LipofectaminePlus (Life Technologies, Gaithersburg, MD) and the cells were harvested 48 h after the start of transfection. Total RNA was isolated as described in the manufacturers instructions (Epicenter Technologies, Inc.). HEK 293T cells were grown in Dulbecco's Modified Eagle's Medium (Life Technologies) supplemented with 10%
v/v fetal bovine serum (Hyclone, Inc., Logan, UT). All cells were kept in a humidified incubator at 37EC and 5% COZ.
10.1.3 REVERSE TRANSCRIPTION-POLYMERASE
CHAIN REACTION (TR-PCR) 1 S RT-PCR was performed using an EZ-RT-PCR kit (Perkin-Elmer, Foster, CA).
Each reaction contained 0.03 to 1.0 ~.g of total RNA and 80 ng of a 5' and 3' specific primer in a 40 ~l reaction volume. RT-PCR products were electrophoresed on 2%
Seaken agarose gels. The PTM- and target-specific oligonucleotides used to generate trans-spliced products are 5'-CGCTGGAAAAACGAGCTTGTTG-3' (primer CF93) (SEQ ID N0:74) and 5'-ACTCAGTGTGATTCCACCTTCTC-3' (primer CF111) (SEQ
ID N0:75), respectively. The PTM- and target-specific oligonucleotides used to generate cis-spliced products were CFI and CF93. The sequence of oligonucleotide CFI
is 5'-GACCTCTGCAGACTTCACTTCTAATGATGATTATGG-3' (SEQ ID N0:76).
The repair model in Fig. 33 shows a portion of a target CFTR pre-mRNA
consisting of exons 1-9, mini-intron 9; exon 10 containing the delta 508 mutation; mini-intron 10 and exons 11-24 (Fig. 33). The PTM shown in the figure consists of exon 1-10 coding sequences (containing codon 508) and a traps-splicing domain with its own splicing elements (donor site, branchpoint and pyrimidine tract) and a binding domain. Several PTMs have been constructed with different binding domains. Three examples are shown in Figure 34. In Fig. 34A the binding domain is complementary to the splice site of intron 9 and part of exon 10 (3' end; CF-PTM 11). In Fig.
34B the PTM has an extended binding domain which also covers the 5' end of exon 10 and the 3' splice site of intron 9 (CF-PTM 20). In the last example (Fig. 34C) the binding domain is the same as that shown in panel B except the binding domain extends the full-length of exon (CF-PTM 30). In the latter case the PTM exon 10 has modified codon usage to reduce antisense effects with it's own binding domain (Fig. 34). Further examples of binding domains are shown in Figure 35.
Figure 36 shows the sequence of cis- and traps-spliced products. The top panel of Fig.
10 36A shows target exon 10 with it's three missing nucleotides (CTT) (SEQ ID
N0:93), whilst the lower panel shows exon 10 and 11 of the target correctly spliced together (SEQ ID N0:94).
Figure 36B is a partial sequence of a single PCR product showing the modified codons in exon 10 of the PTM (upper panel) (SEQ ID N0:95), codon 508 in exon 10 of the PTM
(middle panel) (SEQ ID N0:96), and PTM exon 10 correctly spliced to target exon 11 (lower panel) (SEQ ID N0:97), indicating that traps-splicing is accurate. The sequence of the repaired target was generated by RT-PCR followed by PCR.

11. EXAMPLE: PTMs WITH A LONG BINDING DOMAIN, WHICH MAY BE DISCONTINUOUS, HAVE
INCREASED TRANS-SPLICING EFFICIENCY
AND SPECIFICITY
11.1. MATERIALS AND METHODS
11.1.1. CELL CULTURE
Human embryonic kidney cells (293 or 293T) were from the University of North Carolina tissue culture facility at Chapel Hill (Chapel Hill, NC). Cells were maintained at 37EC in a humidified incubator with S% C02 in Dulbecco's modified Eagle's medium (Life Technologies, Bethesda, MD) supplemented with 10% v/v fetal bovine serum (Hyclone, Logan, UT). Cells were passaged every 2-3 days using 0.5% trypsin and re-plated at the desired density. Stable cells, expressing an endogenous mutant lacZ pre-mRNA
(lacZCF9) were maintained in the presence of 0.5 mg/ml 6418 (Calbiochem, San Diego, CA)_ 11.1.2. RECOMBINANT PLASMIDS
Targets: pc3.11acZCF9, pc3.11acZCF9m, and pc3.11acZHCGIm. pc3.11acZCF9 encodes for a normal lacZ pre-mRNA was constructed using lacZ coding sequences nucleotides 1-1788 as 5' exon, CFTR mini-intron 9 followed by lacZ coding sequences nucleotides 17.89-3174 as 3' exon. This is similar to pc3.11acZ-T2 construct but without stop codons in the lacZ 3' exon and has CFTR mini-intron 9 instead of (3HCG6 intron 1 (Fig. 37A). CFTR mini-intron 9 was PCR amplified using plasmid TS as template and primers CFIN-9F (5'-CTAGGATCCCGTTCTTTTGTTCTTCACT ATTAA) (SEQ ID
N0:77) and CFIN-9R (5'-CTAGGGTTACCGAAGTAAAACCATACTTATTAG, restriction sites underlined) (SEQ ID N0:78), digested with BamH I and BstE II
and cloned in place of BHCG6 intron 1 of pc3.11acZ-T2 plasmid. pc3.11acZCF9m expresses a defective lacZ pre-mRNA and is identical to pc3. llacZCF9 but contains two in-frame non-sense codons in the 3' exon (Fig. 3 7A). pc3. l lacZHCG 1 m is a chimeric target, which includes the lacZ 5' exon followed by intron 1 and exon 2 of ~3HCG6.
This is similar to pc3.11acZCF9m except that it contains exon 2 of (3HCG6 in place of mutant lacZ 3' exon. (3HCG6 exon 2 was PCR amplified using (3HCG6 plasmid (accession #
X00266) as template DNA and primers HCGEx-2F (5'-GCATGGTTACCCTGCAGGGGCTGCTGCTGTTGCTG) (SEQ ID N0:79) and HCGEx-2R (5'-CTGAAAGCTTGTTAACCAGCTCACCATGGTGGGGCAG, restriction sites underlined) ~SEQ ID N0:8~ digested with BstE II and Hind III
and cloned in place of the lacZ 3' exon of pc3.11acZCF9m. Plasmid pcDNA3.1/HisB/lacZ
(Invitrogen; Carlsbad, CA) was used as DNA template to produce 5' and 3' lacZ
exons.
The lacZ 5' exon is 1788 by long, has an ATG initiation codon, lacZ 3' exon (without stop codons) is 1385 by long and has a transcription termination signal at the end of the 3' exon. CFTR mini-intron 9 and (3HCG6 intron 1 are 548 by and 352 by in size, respectively, and both have 5' and 3' splice signals. Exon 2 of (3HCG6 is 162 by long and has a transcription termination signal at the end of the exon.
Pre-traps-splicing Molecules (PTMs): PTM-CF 14 is an identical version of pcPTMl with minor modifications in the traps-splicing domain (Fig. 37B). PTM-is a linear version and contains a 23 by antisense binding domain (BD) (S'-ACCCATCATTATTAGGTCATTAT) ( SEQ ID N0:81) complementary to CFTR mini-intron 9, 18 by spacer, a canonical branch point sequence (UACUAAC;
BP) and an extended polypyrimidine tract (PPT) followed by normal lacZ 3' exon.
PTM-CF22, PTM-CF24, PTM-CF26 and PTM-CF27 are identical to PTM-CF14 except they differ in length of the BD (Fig. 37B). sPTM-CF18 has a 32 by BD, sPTM-CF22 and sPTM-CF24 contain the same BD as PTM-CF22 and PTM-CF24, respectively. In these PTMs, the binding domains were modified to create intra-molecular stem-loop structure ("safety") to mask the 3' splice-site of the PTM.
Different binding domains were produced by PCR amplification using specific 10 primers (with unique Nhe I and Sac II sites) and a plasmid containing CFTR
mini-intron 9'as template. PCR products were digested with Nhe I and Sac II and cloned into a PTM plasmid consisting of spacer sequences, 3' splice elements (BP, PPT
and acceptor AG dinucleotide) followed by a normal lacZ 3' exon.
11.1.3. TRANSFECTION OF PLASMID DNAs INTO 293T

The day before transfection, 1 x 106 293T cells were plated on 60 mm plates coated with Poly-D-lysine (Sigma, St. Louis, MO) to enhance the adherence of cells and grown for 24 hr at 37°C. Cells were transfected with expression plasmids using LipofectaminePlus reagent according to standard protocols (Life Technologies, 20 Bethesda, MD). In a typical co-transfection; 2 p.g of pc3.11aeZCF9m target and 1.5 p,g of PTM expression plasmids were transfected into cells and for controls (target and PTM alone transfections) total DNA concentration was normalized to 3.5 ~.g with peDNA3.1 vector.
Forty-eight hours after transfection the plates were rinsed with PBS, cells 25 harvested and total RNA or DNA was isolated using MasterPure RNA/DNA
purification kit (Epicenter Technologies, Madison, WI). Contaminating DNA in the RNA preparation was removed by treating with DNase I, while, contaminating RNA
in the DNA preparation was removed by digesting with RNase A at 37°C
for 30-45 min.

11.1.4. REVERSE TRANSCRIPTION-POLYMERASE
CHAIN REACTION (RT-PCR) RT-PCR was performed as suggested by manufacturer using an EZ rTth RNA
PCR kit (Perkins-Elmer, Foster City, CA). A typical reaction (SO ~.1) contained 25-500 ng of total RNA, 100 ng of 5' target specific primer (common to cis-and traps-spliced products) (Lac-9F, S'-GATCAAATCTGTCGATCCTTCC) (SEQ ID
N0:82) and 100 ng of 3' primer (Lac-3R, 5'-CTGATCCACCCAGTCCCATTA, target specific primer for cis-splicing (SEQ ID N0:83), and Lac-SR, S'-GACTGATCCACCCAGTCCCAGA (SEQ ID N0:84), PTM specific primer for traps-splicing), 1X reverse transcription buffer (100 mM Tris-HCI, pH 8.3, 900 mM
KCL with 1 mM MnCl2), 200 ~.M dNTPs and 10 units of rTth DNA polymerise.
RT reactions were performed at 60°C for 45 min. followed by 30 sec pre-heating at 94°C and 25-35 cycles of PCR amplification at 94°C for 18 sec, annealing and extension at 60°C for 1 min followed by a final extension at 70°C for 7 min. The reaction products were analyzed by agarose gel electrophoresis.
11.1.5. PROTEIN PREPARATION AND (3-GAL ASSAY
Total cellular protein from cells transfected with expression plasmids was isolated by freeze thaw method and assayed for ~3-galactosidase activity using a ~i-gal assay kit (Invitrogen, Carlsbad; CA). Protein concentration was measured by the dye-binding assay using Bio-Rad protein assay reagents (BIO-RAD, Hercules, CA).
11.1.6. WESTERN BLOT
About 5-25 p.g of total protein was electrophoresed on a 7.5% SDS-PAGE gel and electroblotted onto PVDF-P membrane (Millipore). After blocking for 1 hr at room temperature (blocking buffer: 5% dry milk and 0.1% Tween-20 in 1X PBS), the blot was incubated with a 1:2500 dilution of polyclonal rabbit anti-(3-galactosidase antibody for 1 hr at room temperature (Research Diagnostics Inc. NJ), washed 3x with blocking buffer and then incubated with a 1:5000 diluted anti-rabbit HRP
conjugated secondary antibody. After incubating at room temperature for 1 hr, it was washed 3x in blocking buffer and developed using ECLPlus Western blotting reagents (Amershanl Pharmacia Biotech, Piscataway, N~.
11.1.7. INSITTIJ3-GAL STARTING
Cells were monitored for the expression of functional (3-galactosidase using a ~i-gal staining kit (Invitrogen, Carlsbad, CA). The percentage of (3-gal positive cells were determined by counting stained vs. unstained cells in 5-10 randomly selected fields.
11.1.8. SELECTION OF NEOMYCIN RESISTANT CLONES
EXPRESSING AN El~'DOGENOUS DEFECTIVE IacZ
PRE-mRNA TARGET
On day 1, 1 x I06 293 cells were plated on 60 mm plates and grown for 24 hr at 37 °C. On day 2, the cells were transfected with 2 /.cg of pc3.11acZCF9m using LipofectaminePlus transfection reagent as described above. 48 hr post-transfection, cells were split (1:20 ratio) and grown in media containing 0.5 mg/ml 6418. At the end of 2 weeks, neomycin resistant colonies were selected, pooled, expanded and maintained constantly in the presence of 6418:
11.2. RESULTS
A model system was developed that permits facile and versatile analysis of spliceosome mediated RNA tram-splicing in cells. The bacterial lacZ
gene was split with a truncated intron 9 from the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene (Figure 37A). This split IacZ gene, when introduced into human 293T cells, directed the synthesis of a lacZ pre-mRNA
that could splice properly. The open reading frame of the lacZ gene was mutated by insertion of two in-frame nonsense codons near the 5' end of the second exon (Figure 37A). This IacZ gene is referred to as lacZCF9m. In 293T cells, lacZCF9m directs the synthesis of lacZCF9m pre-mRNA, which encodes a truncated (3-galactosidase (~3-gal) protein that does not have enzymatic activity. Cells bearing the lacZCF9m gene are a model system for genetic disorders caused by loss of function mutations.

WO 02/OS3~$1 PCT/US02/00:116 Pre-traps-splicing molecules (PTMs) were designed to trafas-splice with lacZCF9m pre-mRNA and repair the mutation caused by the two nonsense codons. PTMs were constructed with binding domains spanning 23, 91 and 153 nucleotides (pt), which we named PTM-CFI4, PTM-CF22 and PTM-CF24 (Figure S 37B). The PTM-CF24 binding domain does not bind 153 contiguous pt in the targeted CFTR gene intron 9, but rather creates a loop of 47 pt in the target in between two regions of complementary of 27 and I26 pt (Figure 37B). These PTMs were' predicted to repair the deficiency created by laeZCF9m (Figure 37C).
Semi-quantitative RT-PCR analysis was used to tests the efficiency of Z O traps-splicing mediated by PTMs with long target binding domains. Repair of IacZCF9m transcripts by trasas-splicing was tested in two different ways: co-transfection of PTM and target (IacZCF9m) plasmids or transfection of cells that had been modified to express the target as an endogenous pre-mRNA. Co-transfecting plasmids encoding PTMs with the IacZCF9m plasmid provided a facile method for 15 screening the former for efficiency. PTM-CF22 and PTM-CF24 were approximately 3-fold and 10-fold more efficient than PTM-CFI4 in a semi-quantitative RT-PCR
assay suggesting a significant improvement in nlRNA repair (Figure 38).
Sequencing of the RT-PCR products showed that tracts-splicing was accurate, resulting in proper ligation of the exons from the target and the PTM. Moreover, mutation of key cis-20 acting elements in the 3' splice site of the PTMs resulted in an abrogation of trans-splicing. In these and all other assays described herein controls were carried out to rule out recombination at the DNA level. Thus, repair of the lacZCF9m transcripts was a result of targeted RNA tr am-splicing.
Transfection of PTM-CFI4, -CF22 or -CF24 into 293 cells bearing an 25 endogenous lacZCF9m gene confirmed that the longer target binding domains provided the PTMs with higher efficiency (Figure 38B). It should be noted that similar levels of RT-PCR tram-splicing specific product were obtained after 30 PCR
cycles and 35 cycles fox PTM-CF24 and PTM-CFI4, respectively. The data therefore suggests that PTMs with long binding domains repaired lacZCF9m transcripts at least 30 an order of magnitude better than previously described PTMs.

WO 02/OS3a81 PCT/US02/00~16 7.1 More than one in ten transcripts of lacZCF9m can be repaired by tf afzs-splicing. Quantitative, real-time PCR was used to measure the fraction of lacZCF9m transcripts repaired by PTMs with long binding domains. The co-transfECtion assay described above was used in these experiments. PTM-CF14, which contains a binding domain of 23 pt, was shown to repair between 1.2 and 1.6% of lacZCF9m RNAs in 293T cells and 2.1% of lacZCF9m RNAs in the H1299 human lung cancer cells. PTM-CF24, which has a 153 not long binding domain, was significantly more efficient, correcting between 12.1 and 15.2% of lacZCF9m RNAs in 293T cells and _.. 19.7% in H1299 cells. This in effect resulted in a measurable reduction in the levels of lacZCF9m mRNA. These data also confirmed the remarkable capability of this RT-PCR assay to distinguish between the products of cis-splicing, the IacZCF9m and mRNA, and the products of traps-splicing, repaired lacZCF9m mRNA. This is the first true quantification of the efficacy of trams-splicing mediated mRNA
repair at the RNA level. These data confirm the suggestions of the semi-quantitative RT-PCR
analysis shown above. Similar experiments were carried out using 293 cells that express an endogenous lacZCF9m pre-mRNA target. Consistent with the data shown above, PTM-CF24 was ten times more efficient than PTM-CF14, with the former correcting between,1.3 and 4.1% of endogenous lacZCF9m transcripts. These data confirmed that increasing the length of the PTMs provided a remarkable enhancement in traps-splicing efficiency.
Traps-splicing mediated mRNA repair results in the synthesis of active (3-galactosidase. At the cellular level, the ultimate criterion for the success of mRNA
repair is the production of an active protein. Using a western assay it was determined that full-length (3-gal was produced as a result of traus-splicing . Full-length (3-gal was not observed following transfection of 293T cells with plasmids encoding lacZCF9m or PTM-CF24. .Co-transfection of both plasmids, however, resulted in robust production of full-length (3-gal protein, which was readily detectable using anti-~3-gal antiserum (Figure 39). This result complements enzymatic activity data suggests that the latter was not due to a complementation by truncated (3-gal proteins.
The Western blot analysis revealed that full-length ~i-gal protein was made in WO 02/0,3,81 PCT/US02/00~16 7~
cells by tr-ans-splicing and furthernlore confirmed that the PTMs with long binding domains were efficiently spliced.
Appropriate repair of [3-gal mRNA and synthesis of full=length (3-gal protein should lead to the production of active enzyme. Indeed, 293T cells co-y transfected with lacZCF9m and PTM-CF24 were shown to have (3-gal activity measured either irr situ (Figure 40A) or in extracts (Figure 40B). This activity was shown to depend on the tr-arrs-splicing between the target pre-mRNA and the PTM.
The quantitative in solution assay further confirmed the data presented above:
PTM-CF22 and PTM-CF24 were 2.9 and 9.3 fold more efficient respectively than PTM-CF14. Most impressive, however, were results using 293 cells that harbor lacZCF9m as a stable endogenous gene. When these cells were transfected with PTM-CF14 the levels of ~i-gal activity obtained were barely above background. Transfection with PTM-CF24, however, resulted in a considerable level of (3-gal activity (F awre 40C).
This was paralleled by the appearance of full-length (3-gal protein. These data demonstrate a sizeable increase in the efficiency of traps-splicing to repair a mutated pre-mRNA. In fact all prior reports of repair of endogenous RNA in mammalian cells by either group I ribozymes or traps-splicing have been only documented using RT-PCR, an indication of the low level of repair.
PTMs with very long binding domains are highly specific. It was shown that a secondary structure within the binding domain could enhance specificity of PTMs in HeLa nuclear extracts. In order to ascertain the specificity of the trans-splicing reactions in vivo a second target gene was prepared, which could serve as reporter of non-specific reactions. This gene, which is referred to as lacZHCGlm, shares the first exon with lacZCF9m. The intron in IacZHCGlm is intron 1 of the (3-subunit of the human chorionic gonadotropin gene 6 ((3hCG6) and the second exon is exon 2 of the same gene. lacZHCGlm drives the synthesis of a pre-mRNA that is spliced correctly to yield a chimeric mRNA that does not encode a full-length (3-gal (see below). PTM-CFI4, -CF22 and -CF24 are not targeted to lacZHCGIm pre-mRNA since there is no complementarity between the binding domains in these PTMs and the target gene. Any traps-splicing between these PT'Ms and lacZHCGlm pre-mRNA is therefore non specific (Figure 41A).

WO 02/03581 PCT/US02/00~16 293T cells were transfected with PTM-CF14, -CF22 or -CF24 and the level of non-specific traus-splicing was determined by RT-PCR and by in solution (3-gal assays. Semi-quantitative RT-PCR suggested that PTM-CF24 was significantly less likely than PTM-CF14 to tr-ans-splice with lacZHCGIm pre-mRNA.
Measurement of (3-gal activity confirmed this; cells co-transfected with lacZHCGIm and PTM-CF24 produced 3.7 fold less (3-gal than those co-transfected with lacZHCGIm and PTM-CF14 (Figure 41C). Based on these data it was estimated that PTM-CF24 is 50 times more likely to traps-splice to its target than to a non-specific target. A "safety" version of PTM-CF24, sPTM-CF24, did not confer further specificity (Figure 41C). Nonetheless, for PTMs with shorter binding domains a "safety" stem involving the binding domain was seen to improve specificity in vivo (Figure 41C). It was concluded from these data, that the longer binding domains resulted in PTMs that were not only more efficient but also more specific.
The observation that long binding domains increased the specificity of PTMs suggested that very long binding domains (>200 pt) could further enhance discrimination. Plasmids encoding PTM-CF26 and -CF27, which have binding domains that span 200 pt and 411 pt respectively, were constructed and co-transfected with lacZHCGlm plasmid. Non-specific traps-splicing of these two PTMs was barely detectable with RT-PCR (Figure 41B). As measured by the (3-gal assay PTM-CF26 and -CF27 had minimal non-specific traps-splicing activity (Figure 41C).
In a specific h anr-splicing reaction with lacZCF9m as measured by the solution (3-gal assay PTM-CF26 was as active as PTM-CF14 (Figure 41B). It was estimated that PTM-CF26 is 80 times more likely to tra~zr-splice to the specific target (lacZCF9m) than to a non-specific target (lacZHCGlm). Therefore, inclusion of very long binding domains confers to these PTMs very High specificity.

12. EXAMPLE: CORRECTION OF THE FACTOR VIII GENE
USING 3' EXON REPLACEMENT
Hemophilia is a bleeding disorder caused by a deficiency in one of the blood clotting factors. Hemophilia A, which accounts for about 80 percent of all cases is a deficiency in clotting factor VIII. The following section describes the WO 02/0,3,81 PCT/L1S02/OO~IG

successful repair of the clotting factor VIII gene using spliceosome mediated tr-ans-splicing and demonstrates the feasibility of repairing the factor VIII using gene therapy. -The coding region for mouse factor VIII PTM (exons 16-24) was PCR
amplfied from a cDNA plasmid template using primers that included unique restriction sites for directed cloning. All PCR products were generated with cloned Pfu DNA Polymerase (Stratagene, La Jolla, CA). The coding sequence was cloned into pc3.lDNA(-) using EcoRV and PmeI restriction sites. The binding domain (BD) was created by PCR using genomic DNA as a template. Primers included unique restriction sites for directed cloning. The PCR product v~ras cloned into an existing PTM plasmid (PTM-CF24, pc3.lDNA) using NheI and Sacll restriction sites. This plasmid already contained the remaining elements of the TSD including a spacer sequence, polypyrimidine tract (PPT), branchpoint (BP) and 3' acceptor site.
The vcThole of the TSD was then subcloned into the vector (described above) containing the factor VIII PTM coding sequences. Finally, bovine growth hormone 3' untranslated sequences from a separate plasmid clone were subcloned into the above PTM
using PmeI and BamHI restriction sites.
The whole construct was sequenced and then analyzed by RT-PCR for possible cryptic splicing, and then subcloned into the AAV plasmid pDLZ20-M2 using XhoI and BamHI restriction sites (Chao et al., 2000, Gene Therapy 95:1594-1599; Flotte and Carter, 1998, Methods Erarymol., 292:717-32). For some viral (and non-viral) delivery systems, the size of the therapeutic is essential. Viral vectors such as adeno-associated virus are preferred because they are a (i) non-pathogenic virus with a broad host range (ii) it induces a low inflammatory response when compared to adenovirus vectors and (iii) it has the ability to infect both dividing and non-dividing cells. However, the packaging capacity of the rAAV is limited to approximately 110% of the size of the wild type genome, or ~4.9 kB, thus, leaving little room for large regulatory elements such as promoters and enhancers. The B-domain deleted human factor VIII is close to the packaging size of AAV , thus, traps-splicing offers the possibility of delivering a smaller transgene while permitting the addition of regulatory elements.

WO 02/Oi3S81 PCT/US02/00416 To eliminate cryptic donor sites in the pre-mRNA upstream of the Xlzol PTM cloning site approximately 170 by of sequence was eliminated from the original AAV construct that includes part of exon 1 and alI of the intron 1 sequence (see Fig. 44C).
The repair model in Fig. 44D shows a simplified model of the mouse factor VIII pre-nlRNA target (endogenous gene) consisting of exons 1-14, intron I4, exon 15, intron 16, and exon 16-24 containing a neomycin gene insertion. The PTM
shown in the figure consists of exon 16-24 coding sequences and a trans-splicing domain with its own splicing elements (donor site, branchpoint and pyrimidine tract) and a binding domain. Details of the binding domain are shown in Fig. 44A and 44B.
The binding domain is complementary to the splice site of intron 15 and part of exon 16 (5' end).
The key advantages of using 3' exon replacement for gene repair are (l) the construct requires less sequence and space than a full length gene construct, thereby leaving more space for regulatory elements, (ii) SMaRT repair should only occur in those cells that express the target gene, therefore eliminating any potential problems associated with ectopic expression of repaired RNA.
Factor VIII deficient mice were maintained at the animal facilities at the University of North Carolina at Chapel Hill. For plasmid injections each mouse was sedated and placed under a dissecting microscope and a 1 cm vertical midline abdomen incision was made. Approximately 100 micrograms ofPTM plasmid DNA
in phosphate buffered saline was injected to liver portal vein. Blood was collected from the retro-orbital plexus at intervals of 1, 2, 3 and 20 days after injection and assayed for factor VIII activity using the Coatest assay.
Factor VIII activity in blood samples collected from mice were assayed using a standard test called the Coatest assay. The assay was performed according to manufacturer's instructions (Chromgenix AB, Milan, Italy). Data indicating repair of factor VIII in factor VIII knock out mice is demonstrated in Figure 46.
Hemophilia A defects in humans are broadly split into several categories that include gross DNA rearrangements, single DNA base substitutions, deletions and insertions. It has been determined that a rearrangement of DNA

WO 0210s3i81 PCT/US02/00.116 involving an inversion and translocation of exons 1-22 (together with iiitrons) away from exons 23-26 is responsible for ~40% of all cases of severe hemophilia A.
The canine hemophilia A model also has a very similar gross rearrangement. This mutation will be used as the basis for our human and canine factor VIII PTM
designs.
Methods for building the human factor VIII PTM will be very similar to that described above for the mouse PTM except that different coding regions (exons 23-26) will be amplified from a human cDNA, the binding domain will be amplified from human genomic sequence templates (whole genomic DNA or a genomic clone),. and a C-terminal FLAG tag will be engineered in the PTM to be used to detect repaired factor VIII protein. The remaining elements of the traps-splicing domain including a spacer sequence, polypyrimidine tract (PPT), branchpoint (BP) and 3' acceptor site will be obtained from an existing plasmid. Where necessary changes will be made to the binding domain sequence to eliminate any cryptic splicing within the PTM. The final PTM will be subcloned into the same mouse AAV
1 S plasmid vector, pDLZ20-M2 and virus preparation made from this plasmid.
The canine factor VIII PTM will be made in an identical fashion but using canine cDNA
and genomic plasmid.

13. EXAMPLE: TARGETED TRANS SPLICING OF
PAPILLOMAV>R.AL RNA
The vast majority of cervical cancers are associated with oncogenic human papilloma viruses (IVs) and express viral mRNAs encoding the E6 and E7 oncoproteins. As described below, PTMs targeted against the E6 region of HPV-and splice the TM exon to the 5' end of the E6 ORF using the 5' splice site at the nucleotide 226.
13.1 MATERIALS AND METHODS
The target DNA (p1059) was used to test PTM efficiency and contains the entire HPV-16 early region (pt 79-4468) cloned behind the SV40 early promoter and origin of replication. Specificity was assessed using the heterologous expression vector lacZCF9m as target (Puttaraju et al. 2001. Mol Ther 4:105-14). PlaSmids were a piepared using Quiagen maxi prep kits.

Nearly confluent 6 cm plates of 293 cells were transfected with 2 ltg target DNA and 2 pg PTM DNA using LipofectAmine 2000 (Life Technologies). At two days post-transfection, cells were washed on the plate with PBS and lysed on the plate using 300 p1 Iysis buffer. Total cell RNA was prepared using Ambion S RNAqueous kit. Transfected DNA was removed from the RNA by LiCI
precipitation followed by DNAse I treatment using the Amboin DNA-freeTM DNAse treatment and removal reagents.
RNA was converted to cDNA using RT from the High Capacity cDNA
Archive Kit (P'E Applied Biosystems) as directed by the manufacturer with the 10 following modifications: the amount of random primer was cut in half and S
w1 of a SO liM stock of oligo(dT 16) and 5 p,1 of a 20 unites/~,1 stock of RNAse inhibitor were added per 100 p.1 reaction. RT reactions were diluted to 50 ng/p.l and 5 ng/p.l (based on original RNA content) for real time Quantitative PCR (QPCR) analysis.
Amounts of specific cis and traps spliced mRNAs were quantitated using Real Time 15 Quantitative PCR. These assays are referred to as R~ a1 Time QRT-PCR. These reactions were carried out on the Bio-Rad iCycler iQ Real Time PCR instrument using the SYBR Green kit from PE Applied Biosystems essentially as described previously (Puttaraju et al. 2001 Mol Then 4:105-14.).
Total HI'V-I6 RNA levels (cis and traps-spliced) were assessed using 20 a common amplicon in E6 exon 1 (HPV-I6 pt I 52-204; 53 bp). This assay uses the HPV-16 primers oJMD-15 (ACAGAGCTGCAAACAACTAT) and oJMD-I6 ('TTGCAGTACACATTCTAA). The amount of RT reaction used for each PCR
reaction was S pg. Traps-splicing from the HPV-16 pt 226 5' splice site to the PTM
lacZ exon was assessed using a 53 by chimeric amplicon. This assay uses the HPV-25 I6 senser primer oCCB-348 (GCAAGCAACAGTTACTGCGA; HPV-16 pt 201-220) and the lacZ antisense primer oCCB-322 (ATCCACCCAGTCCCAGA). The amount of RT reaction used for each PCR reaction was 50 pg. Both assays used the same plasmid (p367I) to generate standard curves for quantitation. Traps-splicing from the HPV-16 pt 880 5' splice site to the PTM lacZ exon was assessed using a 50 by 30 chimeric amplicon. This assay uses the HPV-l6.sense primer oCCB-366 (ATCTACCATGGCTGATCCTG; HPV-16 pt 858-877) and the lacZ antisenser WO 02/0~3~81 PCT/U502/00-116 primer oCCB-322. The amount of RT reaction used for each PCR reaction was SO
pg. The plasmid p3672 was used to generate the standard curve for this assay.
Plasmids used as standards for real time QPCR were cloned as follows.
An RT reaction from cotransfections of p1059 and HPV-PTMl in 293T cells was used as template for PCR reactions. Primers oCCB-257 (HPV-16 pt 127-147;
ACCCAGAAAGTTACCACAGTT) and oCCB-322 gave a 127 by band which was TOPO-cloned into pCRII-TOPO (Invitrogen) to give p3671. Sequencing showed that this DNA corresponds to traps-splicing from HPV-16 pt 226 into the 3' splice site of the PTM. Primers oJMD-17 (HPV-16 pt 689-708;
GACAAGCAGAACCGGACAGA) and oCCB-322 gave a 219 by band which was TOPO-cloned into pCRII-TOPO to give p3672. Sequencing showed that this DNA
corresponds to traps-splicing from HPV-16 pt 880 into the 3' splice site of the PTM.
Plasmids stocks (1 ng/~,1) were quantitated using PicoGreen (Molecular Probes) prior to use for standard curves.
Quantitation of cis- and trains-splicing for the cotransfections with PTMs and the target lacZCF9m were done exactly as described previously (Puttaraju et al. 2001. Mol. Ther. 4:105-14). The amount of RT reaction used for each PCR
reaction was 5 pg.
13.2 RESULTS
HPV and CF PTMs were contransfected into 293 cells with either the HPV-16 expression vector p1059 to assess traus-splicing efficiency or with lacZCF9m (containing a CF intron) to assess h~ans-splicing specificity. Real Time QRT-PCR assays were done as described above to assess levels of traps-spl icing relative to cis-splicing of each target. The results are shown in Table 1. All RNA
levels are expressed as fg of the DNA standard. The standards p3671 and p3672 are close to the same size so these values can be used to represent relative RNA
levels for each assays. I-iPV-PTM1, 2, 5, and 6 efficiently traps-spliced to the HPV-16 pt 226 5' splice site. Up to 70% traps-splicing was seen for the HPV-PTM1. As expected, HI'V-PTMS traits-splicing was abolished by mutations in the branch point and polypSTimidine tracts of the PTM. These PTMs showed less than 1% traps-splicing to WO 02/053581 PCT/US02/00~16 the pt 880 5' splice site. This data is consistent with the design of these PTMs which have binding domains complementary to the nucleotide 409 and 526 3' .splice sites.
HPV PTM-8 and HPV-PTM-9 traps binding domains downstream of the pt 880 S' splice site and show efficient trams-splicing to this 5' splice site (37% for and 22% for HPV-PTM9) and somewhat less efficient traps-splicing to the pt 226 S' splice site. HI'V-PTM9 may interfere sterically with binding of splicing factors to the pt 880 5' splice site. The specificity of HPV-PTMI, 2, 5 and 6 was also assessed by their ability to traps-splice to a target pre-mRNA with a CF intron.
Specificity ranged from 274 to 606 fold.

WO 02/0i3581 PCT/US02/00~16 o m ww°~m cNo co 3 ~~3~ ''' 'NO
y , _ co ~r ~ ~ m n 0 o d.o in o a _ ~ o~ N ~'.
N N N N 'J J ' J J ~1 J J .1 7 i~ W N ~ 0~ V O CJt ? W N -~ O c0 00 V O fJ~ 1~ W N -~ N m f~ ,p, .bly, 'O 'n ~t it ~ ~ 3~ ~ ~ ~ ~ ~k ~ ~t -') ~ ~ 17 ~ ~D
~ W W -~ -~ V ~.I Gt CI~ ~ ~ W W N N -r -~ 1 ~ ~j O r ,nr o ~ ~ ~ -' m D w D a~ D ~ D w D o7 D ao D W D 0o D ~ ~. ~ ~ ~' o ,», o V ~ D n h n C~ n n I = ~ 2 Z 2 Z Z Z S Z Z N
~ ~ N N N N T 'T1 ~ 'D 'D ~ 'fl ~ ~ ~ Tl '0 ~ ~ ~ ~ tll n 0'D
0 0 ~ ~ v ~ ~ ~ p ~ G < < < C < < < C C < < ~ ~ ~_ ~ N
~ ~ ~ Z Z .-. ... Z7 'O 'U ~ 'O '~ ~ '0 ~ ~0 17 'v o ci a ~ o ~a ~n D D O O -i -I -i -1 -I -i -~ -1 -~ -! -i -i ~ 7 ~ ~ ~ '' ""WC"tTvX ~~~.3.~.~~~~~,'S~ a'' N.-.
n.
<O to W OD O 07 Cn O N N -~ J ~ a O 01 N C
n 2 n W ~ ~ z W ~ u~
cp cn ~
'm _ 3 c W
! ~ W
J J .~ .a ~a. s ..a r. N N -~ N -~ ~ -i fJ N J J W
'G W CTS W ~ Ch (n 47 W ~ GJ OD U1 s1 V V Cf O Oo Ca7 N ~ N ~ N
V N V j O N N Ch l0 O O V N V Uf N cD la 00 O~. p, G
O O O O O O O O O O O O O O N O O O O O O~~._~. W ~ tD
0 ocoooooo°oo°oooooooo°oc~'w i 'a O O O 3~ W N W ~ N N N W tii N O -~ -~ W 1~, W .--~ O C Cn OD ~ (fl Clt IV V IV .P O O ~ m OD -~ -~ 07 as ~ N j 'O V V ? W W O O O O ~ ~D m O CTS CD N CTt V O O .1~ 41 N <D
py O O O O A ~ s -~ O O O O O O O O O O O O ~
7 O O W W O 00 Q1 O -~ ~ N tJ J ._i J J (V ._i W J
Q. \ ~ ~ ~ ~O ~ ~ ~ ~ ~ .~ ~ 0 O 0 0 O 0 0 O
0 0 0 0 0 0 0 0 o a o o ~ ~ ~ ~. ~ ~ ~ o fA
(D
Z
D

v N
D-N
O
Z
D
N
(D
N .

N .
N
O
$a_ WO 02/053681 PCT/US02/00~16 8~

14. EXAMPLE: DESIGN OF TARGETED PAPILLOMA VIRUS
PTMs Initial pre-therapeutic RNA molecules ("PTMs") are developed based on the abundance and splicing patterns of HPV mRNA. The transcription map of HPV-16 in benign infections is shown in Figure 48. Cis and traps splicing assays are performed on the initial PTMs and the data obtained from the assays is used to create specific PTMs with optimized efficacy in spliceosome-mediated RNA traps-splicing reactions.
The most effective PTM is one that wars-splices an HPV target transcript with a PTM encoding a toxic product which will kill the infected cell. In targeting the most frequently used HPV splice sites, two viable 5' splice site targets and two viable 3' splice site targets can be used. Less frequently used splice sites can also make good targets if the PTM is desired to block the more frequently used site.
Choice of target splice sites is further restricted if the intention is to treat cancers, since integration of HPV-16 in many cervical cancers leads to expression of only the E6 and E7 regions in these cancers.
The following target splice sites are used in the development of the initial PTMs which leads to the expression of a toxic product:
i) S' splice site targets:
- pt 226: This splice site is used in the synthesis of all E6* species.
In most tumors and cell lines, the vast majority of P97 promoter transcripts will be spliced using this 5' splice site.
- pt 880: This splice site is used in the synthesis of all E6US
(unspliced) and E6* species except E6*III, both splice sites are good targets in both productive infections and cancers; and ii) 3' splice site targets:
- pt 409: This 3' splice site is used in the splicing of E6*I species which are generally more abundant than E6*II species. This splice site is used in cancers and productive HPV infection.

WO 02/053581 PCT/US02/00-t16 $5 -nt 3358: This target is used for splicing of most mRNAs, but only if the viral DNA is extrachromosomal. This splice site is not a good target for the treatment of most cancers.
In addition, a double tnar7s-splicing PTM is developed to replace the S internal exons nt 409-880 or nt 526-880 in productively infected tissue and in cancers.
Alternatively, initial PTMs are designed in which tra~zs-splicing produces an mRNA encoding a fusion protein that is part viral and part exogenous peptide encoded by the PTM. The fusion protein will change the function of the viral protein so that it inhibits an essential viral function. The splice sites listed above are IO targeted to produce three viral fusion proteins:
(i) The E6 N terminus, using the nt 226 5' splice site as the target;
(ii) The E6 C terminus, using the nt 409 (best) or nt 526 3' splice sites as the targets; and (iii) The E2 C terminus, using the nt 3358 3' splice site as target.

15 This fusion protein is produced in productive infections and cancers containing extrachromosomal viral DNA. The C terminal domain of E2 is the DNA
binding and dimerization domain, and can be used to target a fusion protein to the P97 promoter and block transcription. At high concentrations, the E2 viral protein binds just upstream of the P97 promoter and inhibits transcription by competing with the 20 transcription factors, SP 1 and TFI)D, for binding. However, these E2 binding sites are weaker than those upstream in the Long Control Region (LCR) and are only saturated at high concentrations of the viral E2 protein. At low concentrations of E2, the protein binds to the E2 binding sites in the upstream LCR and activates transcription. Thus, a "repressor" domain can be added to the fusion protein resulting 25 in a block of transcription through binding to any E2 binding site. This fusion protein is also useful to block viral DNA replication, since an E1B2 complex binds the origin of replication. It has been demonstrated, however, that a complex of the E2 DNA
binding domain and E1 does not bind to the origin. Since E2 is a dimer, heterodimerization of the E2 fusion protein with full length E2 protein would 30 probably eliminate E2 function in DNA replication.

WO 02/053181 PCT/US02/00~16 PTM(s) based on their ability to target and tram-splice to the HPV
target splice sites depicted in Figure 48 listed above are constructed and screened such that splicing results in the expression of diphtheria toxin sub unit A (DT-A) product, which will kill the infected cells or express a marker gene which can be easily detected. Other peptide or protein toxins may also be encoded. A typical prototype PTM (3' tr arzs-splicing) consists of an antisense target binding domain (25 or more) complementary to I3PV sequences, spacer sequence, canonical branchpoint sequence (LTACUAAC), an extensive polypyrimidine tract (12-15 U's), AG dinucleotide of the 3' splice site followed by the delivered gene. PTMs are also constructed to carry out PTM-mediated traps-splicing with HPV 3' splice sites (Fig. 66B). The traps-splicing domain (TSD) of the PTMs are constructed in modular fashion. Unique restriction sites are incorporated between each of the PTM elements, facilitating the replacement of individual elements. Schematic diagrams of 3' exon replacement and S' exon replacement models are shown (Figure 66A-B), respectively. It has previously been demonstrated that both e~ciency and specificity of tracts-splicing can be modulated substantially by altering several s~uences in the TSD, including, the length of the binding domain, spacer sequences, strength of the PPT etc.
"Linear" PTMs are designed initially to maximize the traps-splicing efficiency, thereby identifying the PTM sequences that provide highest trar~s-splicing efficiency. Linear PTMs refer to the binding domain in the PTM as single stranded in configuration To achieve a higher degree of targeting specificity, another form of TSD referred to as a "safety stem" can be constructed. In these PTMs, the splice site of the PTM is protected from reacting with other pre-mRNA targets by binding to itself in a folded structure. Contact with the specific target promotes unwinding of the safety stem exposing and activating the PTM's 3' splice site for spliceosome formation.
To further enhance the trar~s-splicing specificity, a PTM that requires two tr arcs-splicing events to produce the expected therapeutic effect is also .
constructed (Fig. 65). This PTM will have an upstream 3' splice site that will trans-splice into an HPV 5' splice site, producing a singularly trarzs-spliced product. This product does not contain the required polyadenylation signals and would be inactive WO 02/OS3s81 PCT/US02/OO~IG

due to failure in nucleocytoplasmic transport and translation of the mRNA. A
second traps-splicing event with a HPV 3' splice site is necessary to provide the PTM
with the signals required for polyadenylation (Fig. 65). Polyadenylation is necessary for PTMs with linear binding domains in which both 3' and 5' binding domains are linear, or with 3' safety+ 5' linear binding domains, are also designed for inhibition of viral expression. In addition, PTMs are designed as "double safety" PTMs with both 3' and 5' safety splice sites or 3' linear or 5' safety sites.
Testing of the PTMs is performed using in vitro splicing assays and cell culture-based assays. HPV-16-containing cell lines are used for testing the ability IO of PTMs to traps-splice. W12 cells (80263 cells) contain extrachromosomal DNA and express the full HPV-16 early region and can be used to test PTMs targeting. SiHa and CaSki cell lines contain integrated HPV-16 and express only the viral E6/E7/5'El regions. These cell lines are useful because they express viral pre-mRNAs characteristic of those expressed in cervical cancers. However, they may not be useful cell lines for testing a PTM targeting the pt 3358 3' splice site.
CaSki cells express considerably higher levels of HPV-I6 mRNAs than any of the other cell lines tested and therefore may be the best cells for assaying other PTMs.
Cell culture based cotransfection experiments with a PTM expression vector and an HPV-16 early region expression vector are assayed for expression of the PTM. Several plasmids driving the expression of HPV-16 have been constructed.
For example, two plasmids that can be used in co-transfection experiments include ones that express HPV-16 under the direction of either the SV40 early promoter (p 1059) or the K14 promoter (p2571; pKl4-1203).
Combined isoform-specific (i.e. splice-specific) primers with quantitative real time reverse transcription polymerase chain reaction (QRTIPCR) are used to assay for alternative splicing. This assay is very isoform specific, relatively insensitive to RNA degradation, sensitive to one molecule of cDNA, has a wide dynamic range (at least seven orders of magnitude), and gives absolute quantitation of each isoform. Primer pairs specific for each PTM/target pre-mRNA combination are used. The sequence specificity of the assay permits the monitoring of the specificity of the traps-splicing reactions. The sensitivity and quantitative nature of the assay as WO 02/0,3,81 PCT/US02/00~16 well as the rapidity with which assays can be developed and performed is useful for the optimization of PTMs targeted against papillomaviral pre-rnRNAs.
The specificity of PTM induced tr-ans-splicing (i.e. to determine the specificity of targeted traps-splicing to HPV target pre-mRNA) is als~~
evaluated by 5' andlor 3' rapid amplification of cDNA ends (RACE) according to stai.:iard procedures. This method is relatively fast compared to the conventional cDNA
library construction, and gives complete sequences of 5' and/or 3' cDNA ends, so that the number of specific and non-specific splicing events can be determined.
Initially, two cDNA libraries are constructed comprised of RNA isolated from cells co-transfected with a (i) linear PTM + HPV mini-gene target and (ii) safety PTM + I-D'V mini-gene target. For example, in order to identify the 5' ends of the tr-ans-spliced RNAs (3' exon replacement), a 5' RACE assay is performed with a PTM antisense primer.
Similarly, to identify the 3' ends of the traps-spliced RNAs (5' exon replacement), a 3' RACE assay is performed using a PTM sense primer. The cDNA is amplified by PCR, digested with restriction enzymes and cloned into a plasmid vector. The cDNA
clones are initially screened by colony hybridization using a PTM specific probe.
From each cDNA '~brary, positive clones are selected and sequenced, and the sequence information is used to compare the specificity of linear vs. safety PTM.
This permits identification of non-specific targets that traps-splice at high frequencies. Analysis of these targets provides useful information about the sequences that are responsible for non-specific tf-ar~s-splicing and helps in the construction of specific PTMs.
The trap s-splicing efficiency and specificity data obtained from the analysis of the initial candidate PTMs in traps-splicing assays is used to formulate and develop PTMs with optimal traps-splicing capabilities. The optimal PTMs are analyzed using the traps-splicing assays described above.
A mouse model for papillomavirus infections using an organotypic "raftlxenograft" technique. Papillomaviruses are generally species and cell type specific. Productive infections have been established in nude mice using bovine keratinocytes and bovine papillomaviruses. In this system, keratinocytes are initially plated onto a collagen "raft" containing fibroblasts and allowed to grow to confluence WO 02/OS3s81 PCT/US02/00~16 in tissue culture. The keratinocytes are then infected or transfected with papillomavirus or viral genomic DNA; respectively, and allowed to grow in culture for a few days. These rafts are then grafted onto the backs of nude mice where they develop into productively infected bovine tissue. Human papillomavirus infections can be established using the same techniques combined with human papillomaviruses and keratinocytes. This system is useful for testing the in vivo efficacy of anti-papillomavirus PTMs. In addition, grafting of cervical carcinoma tissue or cervical cancer cell lines onto nude mice is used. In addition, testing can be done using several animal models including bovine papillomavirus (BPV-1), Canine oral papillomavirus (COPY), and Cottontail rabbit papillomavirus (CRPV). COPV, in particular, has served as a good model for vaccine development.
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art ZS from the foregoing description and accompanying Figures. Such modifications are intended to fall within the scope of the appended claims. Various references are cited herein, the disclosure of which are incorporated by reference in their entireties.

SEQUENCE LISTING
<110> Intronn, Inc.
Government of the United States of America, Secretary, Department of Health and Human Services <120> SPLICEOSOME MEDIATED RNA TRANS-SPLICING
<130> 4936-48 <140>
<141> 2002-O1-08 <150> US 09/756,095 <151> 2001-O1-08 <150> US 09/756,096 <151> 2001-O1-08 <150> US 09/756,097 <151> 2001-O1-08 <150> US 09/838,858 <151> 2001-04-20 <150> US 09/941,492 <151> 2001-08-29 <160> 125 <170> FastSEQ for Windows Version 4.0 <210> 1 <211> 132 <212> DNA
<213> Homo sapien <400> 1 caggggacgc accaaggatg gagatgttcc agggcgctga tgatgttgtt gattcttctt 60 aaatcttttg tgatggaaaa cttttcttcg taccacggga ctaaacctgg ttatgtagat 120 tccattcaaa as 132 <210> 2 <211> 29 <212> DNA
<213> Corynebacterium diptheriae <400> 2 ggcgctgcag ggcgctgatg atgttgttg 29 <210> 3 <211> 36 <212> DNA
<213> Corynebacterium diptheriae <400> 3 ggcgaagctt ggatccgaca cgatttcctg cacagg 36 <210> 4 <211> 68 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide <400> 4 aattctctag atgcttcacc cgggcctgac tcgagtacta actggtacct cttctttttt 60 ttcctgca 6g <210> 5 <211> 60 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide <400> 5 ggaaaaaaaa gaagaggtac cagttagtac tcgagtcagg cccgggtgaa gcatctagag 60 <210> 6 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 6 tcgagcaacg ttataataat gttc 24 <210> 7 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 7 tcgagaacat tattataacg ttgc 24 <210> 8 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 8 aattctctag atcaggcccg ggtgaagcac tcgag 35 <210> 9 <211> 25 <212> DNA
<213> Artificial Sequence <220>

<223> Oligonucleotide primer <400> 9 tgcttcaccc gggcctgatc tagag 25 <210> 10 <211> 18 <212> DNA
<213> Homo sapien <400> 10 tgcttcaccc gggcctga 18 <210> 11 <211> 16 <212> DNA
<213> Homo sapien <400> 11 ctcttctttt ttttcc 16 <210>

<211>

<212>
DNA

<213> sapien Homo <400>

caacgttataataatgtt 18 <210>

<211>

<212>
DNA

<213> sapien Homo <400>

ctgtgattaatagcgg 16 <210>

<211>

<212>
DNA

<213> sapien Homo <400>

cctggacgcggaagtt 16 <210>

<211>

<212>
DNA

<213> sapien Homo <400>

ctgggacaaggacactgctt cacccggtta gtagaccaca gccctgaagc51 c <210>

<211>

<212>
DNA

<213> sapien Homo <400>

cttctgttttttttctc 17 <210> 17 <211> 16 <212> DNA

<213> Homo sapien <400> 17 cttctgtatt attctc 16 <210> 18 <211> 16 <212> DNA

<213> Homo sapien <400> 18 gttctgtcct tgtctc 16 <210> 19 <211> 29 <212> DNA

<213> Corynebacteriumdiptheriae <400> 19 ggcgctgcag ggcgctgatgatgttgttg 29 <210> 20 <211> 36 <212> DNA

<213> Corynebacteriumdiptheriae <400> 20 ggcgaagctt ggatccgacacgatttcctg cacagg 36 <210> 21 <211> 21 <212> DNA

<213> Corynebacteriumdiptheriae <400> 21 catcgtcata atttccttgtg 21 <210> 22 <211> 20 <212> DNA

<213> Corynebacteriumdiptheriae <400> 22 atggaatcta cataaccagg 20 <210> 23 <211> 20 <212> DNA

<213> Corynebacteriumdiptheriae <400> 23 gaaggctgag cactacacgc 20 <210> 24 <211> 20 <212> DNA

<213> Corynebacteriumdiptheriae <400> 24 cggcaccgtg gccgaagtgg 20 <210> 25 <211> 30 <212> DNA
<213> Homo sapien <400> 25 accggaattc atgaagccag gtacaccagg 30 <210> 26 <211> 20 <212> DNA
<213> Homo sapien <400> 26 gggcaaggtg aacgtggatg 20 <210> 27 <211> 19 <212> DNA
<213> Homo sapien <400> 27 atcaggagtg gacagatcc 19 <210> 28 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer complimentary to the Escherichia coli lacZ gene <400> 28 gcatgaattc ggtaccatgg gggggttctc atcatcatc 39 <210> 29 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer complimentary to the Escherichia coli lacZ gene <400> 29 ctgaggatcc tcttacctgt aaacgcccat actgac 36 <210> 30 <211> 38 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer complimentary to the Escherichia coli lacZ gene <400> 30 gcatggtaac cctgcagggc ggcttcgtct gggactgg 38 <210>31 <211>38 <212>DNA

<213>Artificial Sequence <220>

<223>Oligonucleotide primer complimentaryto the Escherichia coli lacZ gene <400>31 ctgaaagctt 38 gttaacttat tatttttgac accagacc <210>32 <211>47 <212>DNA

<213>Artificial Sequence <220>

<223>Oligonucleotide primer complimentaryto the Escherichia coli lacZ gene <400>32 gcatggtaac ctgggtg 47 cctgcagggc ggcttcgtct aataatggga <210>33 <211>37 <212>DNA

<213>Artificial Sequence <220>

<223>Oligonucleotide primer complimentaryto the beta HCG6 gene (accession #X00266) <400>33 gcatggatcc 37 tccggagggc ccctgggcac cttccac <210>34 <211>38 <212>DNA

<213>Artificial Sequence <220>

<223>Oligonucleotide primer complimentaryto the beta HCG6 gene (accession #X00266) <400>34 ctgactgcag 38 ggtaaccgga caaggacact gcttcacc <210>35 <211>35 <212>DNA

<213>Artificial Sequence <220>

<223>Oligonucleotide primer complimentaryto the beta HCG6 gene (accession #X00266) <400>35 gcatggtaac 35 cctgcagggg ctgctgctgt tgctg <210> 36 <211> 37 <212> DNA

<213> Artificial Sequence <220>

<223> Oligonucleotide primer complimentaryto the beta HCG6 gene (accession #X00266) <400> 36 ctgaaagctt gttaaccagc tcaccatggt 37 ggggcag <210> 37 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> Oligonucleotide primer complimentaryto the Escherichia coli lacZ gene <400> 37 ggctttcgct acctggagag ac 22 <210> 38 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> Oligonucleotide primer complimentaryto the Escherichia coli lacZ gene <400> 38 gctggatgcg gcgtgcggtc g 21 <210> 39 <211> 20 <212> DNA

<213> Artificial Sequence <220>

<223> Oligonucleotide primer complimentaryto the Escherichia coli lacZ gene <400> 39 cggcaccgtg gccgaagtgg 20 <210> 40 <211> 45 <212> DNA

<213> Homo sapien <400> 40 acctgggccc acccattatt aggtcattat ttata 45 ccgcggaaca <210> 41 <211> 35 <212> DNA

<213> Homo sapien <400>

acctctgcaggtgaccctgcaggaaaaaaaagaag 35 <210>

<211>

<212>
DNA

<213> sapien Homo <400>

acctctgcagacttcacttctaatgatgat 30 <210>

<211>

<212>
DNA

<213> sapien Homo <400>

acctgcggccgcctaatgatgatgatgatgatgctcttct agttggcatg 51 c <210>

<211>

<212>
DNA

<213> sapien Homo <400>

gacctctcgagggatttggggaattatttgag 32 <210>

<211>

<212>
DNA

<213> sapien Homo <400>

ctgacctgcggccgctacagtgttgaatgtggtgc 35 <210>

<211>

<212>
DNA

<213> sapien Homo <400>

ctgacctgcggccgcccaactatctgaatcatgtg 35 <210>

<211>

<212>
DNA

<213> sapien Homo <400>

gacctcttaagtagactaaccgattgaatatg 32 <210>

<211>

<212>
DNA

<213> sapien Homo <400>

ctaatgatgatgatgatgatg 21 <210> 49 <211> 21 <212> DNA

<213> Homo sapien <400> 49 cgcctaatga tgatgatgat g 21 <210> 50 <211> 21 <212> DNA

<213> Homo sapien <400> 50 cttcttggta ctcctgtcct g 21 <210> 51 <211> 32 <212> DNA

<213> Homo sapien <400> 51 gacctctcga gggatttggg gaattatttg ag 32 <210> 52 <211> 21 <212> DNA

<213> Homo sapien <400> 52 aactagaagg cacagtcgag g 21 <210> 53 <211> 24 <212> DNA

<213> Artificial Sequence <220>

<223> Trans-spliced product containing human chorionic gonadotropin gene 6 sequences and Corynebacterium diptheriae toxin A sequence <400> 53 gagatgttcc agggcgtgat gatg 24 <210> 54 <211> 127 <212> RNA

<213> Artificial Sequence <220>

<223> PTM intramolecular base paired stem <221> misc_feature <222> (57)...(70) <223> Loop comprising a combination of 14 nucleotides according to the specification <400> 54 gcuagccugg gacaaggaca cugcuucacc cgguuaguag accacagccc60 ugagccnnnn nnnnnnnnnn aucguuaacu aauaaacuac uaacugggug aacuucuguu120 uuuuucucga gcugcag 127 <210>55 <211>127 <212>RNA

<213>Artificial Sequence <220>

<223>PTM intramolecular base paired stem <221>misc_feature <222>(57)...(70) <223>Loop comprising a combination of 14 nucleotides according to the specification <400>55 gcuagccugg ugagccnnnn gacaaggaca 60 cugcuucacc cgguuaguag accacagccc nnnnnnnnnn uuauucucga aucguuaacu 120 aauaaacuac uaacugggug aacuucugua gcugcag 127 <210>56 <211>127 <212>RNA

<213>Artificial Sequence <220>

<223>PTM intramolecular base paired stem <221>misc_feature <222>(57)...(70) <223>Loop comprising a combination of 14 nucleotides according to the specification <400>56 gcuagccugg ugagccnnnn gacaaggaca 60 cugcuucacc cgguuaguag accacagccc nnnnnnnnnn cuugucucga aucguuaacu 120 aauaaacuac uaacugggug aaguucuguc gcugcag 127 <210>57 <211>132 <212>DNA

<213>Artificial Sequence <220>

<223>Trans-spliced product containing human chorionic gonadotropin gene 6 sequences and Corynebacterium diptheriae toxin A sequences <400>57 caggggacgc gattcttctt accaaggatg 60 gagatgttcc agggcgctga tgatgttgtt aaatcttttg ttatgtagat tgatggaaaa 120 cttttcttcg taccacggga ctaaacctgg tccattcaaa 132 as <210>58 <211>18 <212>DNA

<213>Artificial Sequence <220>

<223>Artificial sequence derived from Escherichia coli lacZ gene 1~~
<400> 58 gaattcggta ccatgggg 18 <210> 59 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Artificial sequence derived from Escherichia coli lacZ gene <400> 59 cgtttacagg taagaggatc ctccggaggg ccc 33 <210> 60 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Artificial sequence derived from Escherichia coli lacZ gene <400> 60 tggtgtcaaa aataataagt taacaagctt 30 <210> 61 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Trans-spliced product containing Esherichia coli lacZ and human chorionic gonadotropin gene 6 sequences <400> 61 cagcagcccc tgtaaacggg gatac 25 <210> 62 <211> 286 <212> DNA
<213> Artificial Sequence <220>
<223> Trans-spliced product containing Escherichia coli lacZ gene sequences <400> 62 ggctttcgct acctggagag acgcgcccgc tgatcctttg cgaatacgcc cacgcgatgg 60 gtaacagtct tggcggtttc gctaaatact ggcaggcgtt tcgtcagtat ccccgtttac 120 agggcggctt cgtctaataa tgggactggg tggatcagtc gctgattaaa tatgatgaaa 180 acgggcaacc cgtggtcggc ttacggcggt gattttggcg atacgccgaa cgatcgccag 240 ttctgtatga acggtctggt ctttgccgac cgcacgccgc atccag 286 <210> 63 <211> 196 <212> DNA
<213> Artificial Sequence l~l <220>
<223> Trans-spliced product containing Esherichia coli lacZ gene sequences <400> 63 ggctttcgct acctggagag acgcgcccgc tgatcctttg cgaatacgcc cacgcgatgg 60 gtaacagtct tggcggtttc gctaaatact ggcaggcgtt tcgtcagtat ccccgtttac 120 aggggctgct gctgttgctg ctgctgagca tgggcgggac atgggcatcc aaggagccac 180 ttcggccacg gtgccg 196 <210> 64 <211> 420 <212> DNA
<213> Artificial Sequence <220>
<223> Trans-spliced product comprising cystic fibrosis transmembrane regulator-derived sequences and His tag sequences <400> 64 gctagcgttt aaacgggccg acccatcatt attaggtcat tatccgcgga acattattat 60 aacgttgctc gagtactaac tggaacctct tctttttttt cctgcagact tcacttctaa 120 tgatgattat gggagaactg gagccttcag agggtaaaat taagcacagt ggaagaattt 180 cattctgttc tcagttttcc tggattatgc ctggcaccat taaagaaaat atcatctttg 240 gcggccgcca ctgtgctgga tatctgcaga attccaccac actggactag tggatccgag 300 ctcggtacca aggttaagtt taaaccgctg atcagcctcg actgtgcctt ctagttgcca 360 gccatctgtt gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg ccactcccac 420 <210> 65 <211> 20 <212> DNA
<213> Artificial Sequence <220>
<223> Splice junction sequence <400> 65 atgttccagg gcgtgatgat <210> 66 <211> 6 <212> PRT
<213> Artificial Sequence <220>
<223> FLAG peptide <400> 66 Asp Tyr Lys Asp Asp Lys <210> 67 <211> 15 <212> DNA
<213> Artificial Sequence <220>
<223> Artificial sequence comprising sequence derived from Escherichia coli lacZ gene <400> 67 ggagttgatc ccgtc 15 <210> 68 <211> 37 <212> DNA

<213> Artificial Sequence <220>

<223> Artificial sequence comprising sequences derived from Escherichia coli lacZ gene <400> 68 gcagtgtcct tgtgcggtta ccctgcagggcggcttc 37 <210> 69 <211> 120 <212> DNA

<213> Artificial Sequence <220>

<223> PTM binding domain of PTM

<400> 69 gattcacttg ctccaattat catcctaagcagaagtgtat attcttattt gtaaagattc60 tattaactca tttgattcaa aatatttaaaatacttcctg tttcatactc tgctatgcac120 <210> 70 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Spacer sequence of PTM
<400> 70 aacattatta taacgttgct cgaa 24 <210> 71 <211> 47 <212> DNA
<213> Artificial Sequence <220>
<223> Branch point, pyrimidine tract and acceptor splice site of PTM
<400> 71 tactaactgg tacctcttct tttttttttg atatcctgca gggcggc 47 <210> 72 <211> 70 <212> DNA
<213> Artificial Sequence <220>
<223> Donor site and spacer sequence of PTM

<400> 72 tgaacggtaa gtgttatcac cgatatgtgt ctaacctgat tcgggccttc gatacgctaa 60 gatccaccgg 70 <210> 73 <211> 260 <212> DNA
<213> Artificial Sequence <220>
<223> Binding domain of spacer sequence <400> 73 tcaaaaagtt ttcacataat ttcttacctc ttcttgaatt catgctttga tgacgcttct 60 gtatctatat tcatcattgg aaacaccaat gatttttctt taatggtgcc tggcataatc 120 ctggaaaact gataacacaa tgaaattctt ccactgtgct taaaaaaacc ctcttgaatt 180 ctccatttct cccataatca tcattacaac tgaactctgg aaataaaacc catcattatt 240 aactcattat caaatcacgc 260 <210> 74 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 74 cgctggaaaa acgagcttgt tg 22 <210> 75 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide <400> 75 actcagtgtg attccacctt ctc 23 <210> 76 <211> 36 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide <400> 76 gacctctgca gacttcactt ctaatgatga ttatgg 36 <210> 77 <211> 33 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 77 ctaggatccc gttcttttgt tcttcactat taa 33 <210> 78 <211> 33 <212> DNA

<213> Artificial Sequence <220>

<223> Oligonucleotide primer <400> 78 ctagggttac cgaagtaaaa ccatacttat tag 33 <210> 79 <211> 35 <212> DNA

<213> Artificial Sequence <220>

<223> Oligonucleotide primer <400> 79 gcatggttac cctgcagggg ctgctgctgt tgctg 35 <210> 80 <211> 37 <212> DNA

<213> Artificial Sequence <220>

<223> Oligonucleotide primer <400> 80 ctgaaagctt gttaaccagc tcaccatggt ggggcag 37 <210> 81 <211> 23 <212> DNA

<213> Artificial Sequence <220>

<223> Binding domain of PTM molecule <400> 81 acccatcatt attaggtcat tat 23 <210> 82 <211> 22 <212> DNA

<213> Artificial Sequence <220>

<223> Oligonucleotide primer <400> 82 gatcaaatct gtcgatcctt cc 22 <210> 83 <211> 21 <212> DNA

<213> Artificial Sequence 1~5 <220>
<223> Oligonucleotide primer <400> 83 ctgatccacc cagtcccatt a 21 <210> 84 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 84 gactgatcca cccagtccca ga 22 <210> 85 <211> 52 <212> DNA
<213> Artificial Sequence <220>
<223> Random sequence inserted to replace 3' splice site <221> misc_feature <222> (7)...(30) <223> spacer sequence, see SEQ ID NO: 70 <400> 85 ccgcggnnnn nnnnnnnnnn nnnnnnnnnn gggttccggt accggcggct tc 52 <210> 86 <211> 71 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide primer <400> 86 ttttatcccc gtttacaggg cggcttcgtc tgggactggg tggatcagtc gctgattaaa 60 tatgatgaaa a 71 <210> 87 <211> 66 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide <400> 87 tttggcgata cgccgaacga tcgccagttc tgtatgaacg gtctggtctt tgccgaccgc 60 acgccg 66 <210> 88 <211> 192 <212> DNA
<213> Artificial Sequence <220>
<223> PTM sequence <400> 88 acgagcttgc tcatgatgat catgggcgag ttagaaccaa gtgaaggcaa gatcaaacat 60 tccggccgca tcagcttttg cagccaattc agttggatca tgcccggtac catcaaggag 120 aacataatct tcggcgtcag ttacgacgag taccgctatc gctcggtgat taaggcctgt 180 cagttggagg ag 192 <210> 89 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide <400> 89 gagcaggcaa gacgagcttg ctcat 25 <210> 90 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide <400> 90 gagaacataa tcttcggcgt cagttacg 28 <210> 91 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Oligonucleotide <400> 91 gtcagttgga ggaggacatc tccaagtttg 30 <210> 92 <211> 192 <212> DNA
<213> Artificial Sequence <220>
<223> PTM exon 10 <400> 92 acgagcttgc tcatgatgat catgggcgag ttagaaccaa gtgaaggcaa gatcaaacat 60 tccggccgca tcagcttttg cagccaattc agttggatca tgcccggtac catcaaggag 120 aacataatct tcggcgtcag ttacgacgag taccgctatc gctcggtgat taaggcctgt 180 cagttggagg ag 192 <210> 93 <211> 27 <212> DNA
<213> Artificial Sequence 1~7 <220>

<223> PTM sequence <400> 93 aaatatcatt ggtgtttctt atgatga 27 <210> 94 <211> 30 <212> DNA

<213> Artificial Sequence <220>

<223> Oligonucleotide <400> 94 ccaactagaa gaggacatct ccaagtttgc 30 <210> 95 <211> 30 <212> DNA

<213> Artificial Sequence <220>

<223> Oligonucleotide <400> 95 atgatcatgg gcgagttaga accaagtgag 30 <210> 96 <211> 27 <212> DNA

<213> Artificial Sequence <220>

<223> oligonucleotide <400> 96 aaaatatcat ctttggtgtt tcctatg 27 <210> 97 <211> 27 <212> DNA

<213> Artificial Sequence <220>

<223> Oligonucleotide <400> 97 ccaactagaa gaggacatct ccaagtt 27 <210> 98 <211> 21 <212> DNA

<213> Artificial Sequence <220>

<223> 5' Splice site <400> 98 cgtttacagg taagtggatc c 21 <210> 99 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> 3' Splice site <400> 99 ctgcagggcg gcttcgtcta ataatgg 27 <210> 100 <211> 47 <212> DNA
<213> Artificial Sequence <220>
<223> Sequence from trans-splicing domain <400> 100 tactaactgg tacctcttct tttttttttg atatcctgca gggcggc 47 <210> 101 <211> 1584 <212> DNA
<213> Artificial Sequence <220>
<223> CFTR PTM
<400> 101 atgcagaggt cgcctctgga aaaggccagc gttgtctcca aacttttttt cagctggacc 60 agaccaattt tgaggaaagg atacagacag cgcctggaat tgtcagacat ataccaaatc 120 ccttctgttg attctgctga caatctatct gaaaaattgg aaagagaatg ggatagagag 180 ctggcttcaa agaaaaatcc taaactcatt aatgcccttc ggcgatgttt tttctggaga 240 tttatgttct atggaatctt tttatattta ggggaagtca ccaaagcagt acagcctctc 300 ttactgggaa gaatcatagc ttcctatgac ccggataaca aggaggaacg ctctatcgcg 360 atttatctag gcataggctt atgccttctc tttattgtga ggacactgct cctacaccca 420 gccatttttg gccttcatca cattggaatg cagatgagaa tagctatgtt tagtttgatt 480 tataagaaga ctttaaagct gtcaagccgt gttctagata aaataagtat tggacaactt 540 gttagtctcc tttccaacaa cctgaacaaa tttgatgaag gacttgcatt ggcacatttc 600 gtgtggatcg ctcctttgca agtggcactc ctcatggggc taatctggga gttgttacag 660 gcgtctgcct tctgtggact tggtttcctg atagtccttg ccctttttca ggctgggcta 720 gggagaatga tgatgaagta cagagatcag agagctggga agatcagtga aagacttgtg 780 attacctcag aaatgatcga gaacatccaa tctgttaagg catactgctg ggaagaagca 840 atggaaaaaa tgattgaaaa cttaagacaa acagaactga aactgactcg gaaggcagcc 900 tatgtgagat acttcaatag ctcagccttc ttcttctcag ggttctttgt ggtgttttta 960 tctgtgcttc cctatgcact aatcaaagga atcatcctcc ggaaaatatt caccaccatc 1020 tcattctgca ttgttctgcg catggcggtc actcggcaat ttccctgggc tgtacaaaca 1080 tggtatgact ctcttggagc aataaacaaa atacaggatt tcttacaaaa gcaagaatat 1140 aagacattgg aatataactt aacgactaca gaagtagtga tggagaatgt aacagccttc 1200 tgggaggagg gatttgggga attatttgag aaagcaaaac aaaacaataa caatagaaaa 1260 acttctaatg gtgatgacag cctcttcttc agtaatttct cacttcttgg tactcctgtc 1320 ctgaaagata ttaatttcaa gatagaaaga ggacagttgt tggcggttgc tggatccact 1380 ggagcaggca agacgagctt gctcatgatg atcatgggcg agttagaacc aagtgaaggc 1440 aagatcaaac attccggccg catcagcttt tgcagccaat tcagttggat catgcccggt 1500 accatcaagg agaacataat cttcggcgtc agttacgacg agtaccgcta tcgctcggtg 1560 attaaggcct gtcagttgga ggag 1584 <210> 102 <211> 323 <212> DNA
<213> Artificial Sequence <220>
<223> Trans-splicing domain of CFTR PTM
<400> 102 gtaagatatc accgatatgt gtctaacctg attcgggcct tcgatacgct aagatccacc 60 ggtcaaaaag ttttcacata atttcttacc tcttcttgaa ttcatgcttt gatgacgctt 120 ctgtatctat attcatcatt ggaaacacca atgatatttt ctttaatggt gcctggcata 180 atcctggaaa actgataaca caatgaaatt cttccactgt gcttaatttt accctctgaa 240 ttctccattt ctcccataat catcattaca actgaactct ggaaataaaa cccatcatta 300 ttaactcatt atcaaatcac get 323 <210> 103 <211> 165 <212> DNA
<213> Artificial Sequence <220>
<223> PTM Binding domain <400> 103 gctagcaata atgacgaagc cgcccctcac gctcaggatt cacttgcctc caattatcat 60 cctaagcaga agtgtatatt cttatttgta aagattctat taactcattt gattcaaaat 120 atttaaaata cttcctgttt cacctactct gctatgcacc cgcgg 165 <210> 104 <211> 225 <212> DNA
<213> Artificial Sequence <220>
<223> Trans-splicing domain of CFTR PTM
<400> 104 aataatgacg aagccgcccc tcacgctcag gattcacttg ccctccaatt atcatcctaa 60 gcagaagtgt atattcttat ttgtaaagat tctattaact catttgattc aaaatattta 120 aaatacttcc tgtttcacct actctgctat gcacccgcgg aacattatta taacgttgct 180 cgaatactaa ctggtacctc ttcttttttt tttgatatcc tgcag 225 <210> 105 <211> 3069 <212> DNA
<213> Artificial Sequence <220>
<223> CFTR PTM sequence <400> 105 acttcacttc taatgatgat tatgggagaa ctggagcctt cagagggtaa aattaagcac 60 agtggaagaa tttcattctg ttctcagttt tcctggatta tgcctggcac cattaaagaa 120 aatatcatct ttggtgtttc ctatgatgaa tatagataca gaagcgtcat caaagcatgc 180 caactagaag aggacatctc caagtttgca gagaaagaca atatagttct tggagaaggt 240 ggaatcacac tgagtggagg tcaacgagca agaatttctt tagcaagagc agtatacaaa 300 gatgctgatt tgtatttatt agactctcct tttggatacc tagatgtttt aacagaaaaa 360 gaaatatttg aaagctgtgt ctgtaaactg atggctaaca aaactaggat tttggtcact 420 tctaaaatgg aacatttaaa gaaagctgac aaaatattaa ttttgcatga aggtagcagc 480 tatttttatg ggacattttc agaactccaa aatctacagc cagactttag ctcaaaactc 540 atgggatgtg attctttcga ccaatttagt gcagaaagaa gaaattcaat cctaactgag 600 accttacacc gtttctcatt agaaggagat gctcctgtct cctggacaga aacaaaaaaa 660 caatctttta aacagactgg agagtttggg gaaaaaagga agaattctat tctcaatcca 720 atcaactcta tacgaaaatt ttccattgtg caaaagactc ccttacaaat gaatggcatc 780 gaagaggatt ctgatgagcc tttagagaga aggctgtcct tagtaccaga ttctgagcag 840 ggagaggcga tactgcctcg catcagcgtg atcagcactg gccccacgct tcaggcacga 900 aggaggcagt ctgtcctgaa cctgatgaca cactcagtta accaaggtca gaacattcac 960 cgaaagacaa cagcatccac acgaaaagtg tcactggccc ctcaggcaaa cttgactgaa 1020 ctggatatat attcaagaag gttatctcaa gaaactggct tggaaataag tgaagaaatt 1080 aacgaagaag acttaaagga gtgctttttt gatgatatgg agagcatacc agcagtgact 1140 acatggaaca cataccttcg atatattact gtccacaaga gcttaatttt tgtgctaatt 1200 tggtgcttag taatttttct ggcagaggtg gctgcttctt tggttgtgct gtggctcctt 1260 ggaaacactc ctcttcaaga caaagggaat agtactcata gtagaaataa cagctatgca 1320 gtgattatca ccagcaccag ttcgtattat gtgttttaca tttacgtggg agtagccgac 1380 actttgcttg ctatgggatt cttcagaggt ctaccactgg tgcatactct aatcacagtg 1440 tcgaaaattt tacaccacaa aatgttacat tctgttcttc aagcacctat gtcaaccctc 1500 aacacgttga aagcaggtgg gattcttaat agattctcca aagatatagc aattttggat 1560 gaccttctgc ctcttaccat atttgacttc atccagttgt tattaattgt gattggagct 1620 atagcagttg tcgcagtttt acaaccctac atctttgttg caacagtgcc agtgatagtg 1680 gcttttatta tgttgagagc atatttcctc caaacctcac agcaactcaa acaactggaa 1740 tctgaaggca ggagtccaat tttcactcat cttgttacaa gcttaaaagg actatggaca 1800 cttcgtgcct tcggacggca gccttacttt gaaactctgt tccacaaagc tctgaattta 1860 catactgcca actggttctt gtacctgtca acactgcgct ggttccaaat gagaatagaa 1920 atgatttttg tcatcttctt cattgctgtt accttcattt ccattttaac aacaggagaa 1980 ggagaaggaa gagttggtat tatcctgact ttagccatga atatcatgag tacattgcag 2040 tgggctgtaa actccagcat agatgtggat agcttgatgc gatctgtgag ccgagtcttt 2100 aagttcattg acatgccaac agaaggtaaa cctaccaagt caaccaaacc atacaagaat 2160 ggccaactct cgaaagttat gattattgag aattcacacg tgaagaaaga tgacatctgg 2220 ccctcagggg gccaaatgac tgtcaaagat ctcacagcaa aatacacaga aggtggaaat 2280 gccatattag agaacatttc cttctcaata agtcctggcc agagggtggg cctcttggga 2340 agaactggat cagggaagag tactttgtta tcagcttttt tgagactact gaacactgaa 2400 ggagaaatcc agatcgatgg tgtgtcttgg gattcaataa ctttgcaaca gtggaggaaa 2460 gcctttggag tgataccaca gaaagtattt attttttctg gaacatttag aaaaaacttg 2520 gatccctatg aacagtggag tgatcaagaa atatggaaag ttgcagatga ggttgggctc 2580 agatctgtga tagaacagtt tcctgggaag cttgactttg tccttgtgga tgggggctgt 2640 gtcctaagcc atggccacaa gcagttgatg tgcttggcta gatctgttct cagtaaggcg 2700 aagatcttgc tgcttgatga acccagtgct catttggatc cagtaacata ccaaataatt 2760 agaagaactc taaaacaagc atttgctgat tgcacagtaa ttctctgtga acacaggata 2820 gaagcaatgc tggaatgcca acaatttttg gtcatagaag agaacaaagt gcggcagtac 2880 gattccatcc agaaactgct gaacgagagg agcctcttcc ggcaagccat cagcccctcc 2940 gacagggtga agctctttcc ccaccggaac tcaagcaagt gcaagtctaa gccccagatt 3000 gctgctctga aagaggagac agaagaagag gtgcaagata caaggcttca tcatcatcat 3060 catcattag 3069 <210> 106 <211> 131 <212> DNA
<213> Artificial Sequence <220>
<223> Binding domain of mouse factor VIII PTM
<400> 106 ctcgagctta cctgaactaa ttttttagaa tattaaaatc ctaagctttt atatctctat 60 ccctctatct tttgctctct atccaatttt tattaactta gactttaaaa agaaacttat 120 gagaaaaatt t 131 <210> 107 <211> 71 <212> DNA
<213> Artificial Sequence <220>
<223> Spacer sequence of PTM
<400> 107 ccgcggaaca ttattataac gttgctcgaa tactaactgg tacctcttct tttttttttg 60 atatcctgca g 71 <210> 108 <211> 527 <212> DNA
<213> Artificial Sequence <220>
<223> Chicken beta actin promoter sequences <400> 108 ccatggtcga cgttagcccc acgttctgct tcactctccc catctccccc ccctccccac 60 ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 120 ggggggggcg cgcgccaggc ggggcggggc ggggcgaggg gcggggcggg gcgaggcgga 180 gaggtgcggc ggcagccaat cagagcggcg cgctccgaaa gttcctttta tcgcgaggcg 240 gcggcggcgg cggccctata aaaagcgaag cgcgcggcgg ccgggagtcg ctgcgacgct 300 gccttcgccc cgtgccaacc tccgcctcga gcttacctga actaattttt tagaatatta 360 aaatcctaag cttttatact cctatccctc tatcttttgc tctctatcca atttttatta 420 acttagactt taaaaagaaa cttatgagaa aaatttccgc ggaacattat tataacgttg 480 ctcgaatact aactggtacc tcttcttttt tttttgatat cctgcag 527 <210> 109 <211> 169 <212> DNA
<213> Artificial Sequence <220>
<223> Sequence not included in construct <400> 109 cgccgcctcg cgccgcccgc cccggctctg actgaccgcg ttactcccac aggtgagcgg 60 gcgggacggc ccttctcctc cgggctgtaa ttagcgcttg gtttaatcac ggcttgtttc 120 ttttctgtgg ctgcgtgaaa gccttgaggg gctccgggag gaattcgta 169 <210> 110 <211> 42 <212> DNA
<213> Artificial Sequence <220>
<223> F8 PTM sequences <400> 110 ggagtcgctg cgacgctgcc ttcgccccgt gccaacctcc gc 42 <210> 111 <211> 22 <212> DNA
<213> Artificial Sequence <220>
<223> F8 PTM sequences <400> 111 ctcgagcacc gatatcgtaa ct . 22 <210> 112 <211> 53 <212> DNA
<213> Artificial Sequence <220>
<223> Exon 26, Flag tag, stop sequences of mouse factor VIII PTM
<400> 112 gaggcccagc agcaatacga ctacaaggac gacgatgaca agtgagttta aac 53 <210> 113 <211> 71 <212> DNA
<213> Artificial Sequence <220>
<223> Spacer sequences of human or canine factor VIII
PTM
<400> 113 ccgcggaaca ttattataac gttgctcgaa tactaactgg tacctcttct tttttttttg 60 atatcctgca g 71 <210> 114 <211> 47 <212> DNA
<213> Artificial Sequence <220>
<223> Branch point and polypyrimidine tract sequences of human papilloma virus PTM
<400> 114 tactaactgg tacctcttct tttttttttg atatcctgca gggcggc 47 <210> 115 <211> 47 <212> DNA
<213> Artificial Sequence <220>
<223> Branch point and polypyrimidine tract of human papilloma virus PTM
<400> 115 tactaactgg tacctcttct tttttttttg atatcctgca gggcggc 47 <210> 116 <211> 80 <212> DNA
<213> Artificial Sequence <220>
<223> Binding domain of human papilloma virus PTM
<400> 116 cagttaatac acctaattaa caaatcacac aacgctttgt tgtattgctg ttctaatgtt 60 gttccataca cactataaca 80 <210> 117 <211> 149 <212> DNA

<213> Artificial Sequence <220>

<223> Binding domain of human papilloma virus PTM

<400> 117 cagttaatac acctaattaa caaatcacac aacgctttgt ttctaatgtt tgtattgctg 60 gttccataca cactataaca ataatgtcta tactcactaa aaactttaaa ttttagaata 120 catttatcac atacagcata tcgattccc 149 <210> 118 <211> 35 <212> DNA

<213> Artificial Sequence <220>

<223> Binding domain of human papilloma virus PTM

<400> 118 gatgatctgc aacaagacat acatcgaccg gtcca 35 <210> 119 <211> 104 <212> DNA

<213> Artificial Sequence <220>

<223> Binding domain of human papilloma virus PTM

<400> 119 cttcaggaca cagtggcttt tgacagttaa tacacctaat cacaacggtt taacaaatca 60 tgttgtattg cagttctatg ttgttccata cacactataa 104 caat <210> 120 <211> 18 <212> DNA

<213> Artificial Sequence <220>

<223> Binding domain of human papilloma virus PTM

<400> 120 gatgatctgc aacaagac 1g <210> 121 <211> 99 <212> DNA

<213> Artificial Sequence <220>

<223> Binding domain of human papilloma virus PTM

<400> 121 gacacagtgg cttttgacag ttaatacacc taattaacaa ggtttgttgt atcacacaac 60 attgcagttc taatgttgtt ccatacacac tataacaat 99 <210> 122 <211> 138 <212> DNA
<213> Artificial Sequence <220>
<223> Binding domain of human papilloma virus PTM
<400> 122 gatgatctgc aacaagacat acatcgaccg gtccacttca ggacacagtg gcttttgaca 60 gttaatagac ctaattaaca aatcacacaa cggtttgttg tattgcagtt ctaatgttgt 120 tccatacaca ctataaca 138 <210> 123 <211> 89 <212> DNA
<213> Artificial Sequence <220>
<223> Binding domain of human papilloma virus PTM
<400> 123 gatgatctgc aacaagacga cacagtggct tttgacagtt aatacaccta attaacaaat 60 cacacaacgg tttgttgtat tgcagttct 89 <210> 124 <211> 66 <212> DNA
<213> Artificial Sequence <220>
<223> Trans-spliced product <400> 124 agaatgtgtg tactgcaagc aacagttact gcgacgtgag ggcggcttcg tctgggactg 60 ggtgga 66 <210> 125 <211> 71 <212> DNA
<213> Artificial Sequence <220>
<223> Trans-spliced product <400> 125 gtgtactgca agcaacagtt actgcgacgt gagggcggct tcgtctggga ctgggtggat 60 cagtcgctga t 71

Claims (38)

1. A cell comprising a nucleic acid molecule wherein said nucleic acid molecule comprises:
a) one or more target binding domains that target binding of the nucleic acid molecule to papilloma virus pre-mRNA expressed within the cell;
b) a 3' splice region comprising a branch point, a pyrimidine tract and a 3' splice acceptor site;
c) a spacer region that separates the 3' splice region from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA; wherein said nucleotide sequence encodes a papilloma virus polypeptide; and wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

2. A cell comprising a nucleic acid molecule wherein said nucleic acid molecule comprises:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 3' splice acceptor site;
c) a spacer region that separates the 3' splice region from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA; wherein said nucleotide sequence encodes a papilloma virus polypeptide; and wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

3. A cell comprising a nucleic acid molecule wherein said nucleic acid molecule comprises:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 5' splice site;
c) a spacer region that separates the 5' splice site from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleotide sequence encodes a papilloma virus polypeptide; and wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

4. The cell of claim 1 wherein the nucleic acid molecule further comprises a

5' donor site.

5. The cell of claim 1 wherein the nucleic acid molecule further comprises a safety nucleotide sequence comprising one or more complementary sequences that bind to one or more sides of the 3' splice region.

6. The cell of claim 1 wherein the binding of the nucleic acid molecule to the target pre-mRNA is mediated by complementary, triple helix formation, or protein-nucleic acid interaction.

7. The cell of claim 1 wherein the papilloma virus is an oncogenic papilloma virus.

8. A cell comprising a recombinant vector wherein said vector expresses a nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 3' splice region comprising a branch point, a pyrimidine tract and a 3' splice acceptor site;
c) a spacer region that separates the 3' splice region from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleotide sequence encodes a papilloma virus polypeptide; and wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

9. A cell comprising a recombinant vector wherein said vector expresses a nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 3' splice acceptor site;
c) a spacer region that separates the 3' splice region from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleotide sequence encodes a papilloma virus polypeptide; and wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

10. A cell comprising a recombinant vector wherein said vector expresses a nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 5' splice site;
c) a spacer region that separates the 5' splice site from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleotide sequence encodes a papilloma virus polypeptide; and wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

11. The cell of claim 8 wherein the nucleic acid molecule further comprises a 5' donor site.

12. A method of producing a chimeric RNA molecule in a cell comprising:
contacting a target pre-mRNA expressed in the cell with a nucleic acid molecule recognized by nuclear splicing components wherein said nucleic acid molecule comprises:

a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 3' splice region comprising a branch point, a pyrimidine tract and a 3' splice acceptor site;
c) a spacer region that separates the 3' splice region from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
under conditions in which a portion of the nucleic acid molecule is trans-spliced to a portion of the target pre-mRNA to form a chimeric RNA within the cell, wherein said nucleotide sequence encodes a papilloma virus polypeptide.

13. A method of producing a chimeric RNA molecule in a cell comprising:
contacting a target pre-mRNA expressed in the cell with a nucleic acid molecule recognized by nuclear splicing components wherein said nucleic acid molecule comprises:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 3' splice acceptor site;
c) a spacer region that separates the 3' splice region from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA;

under conditions in which a portion of the nucleic acid molecule is trans-spliced to a portion of the target pre-mRNA to form a chimeric RNA within the cell, wherein said nucleotide sequence encodes a papilloma virus polypeptide.

14. A method of producing a chimeric RNA molecule in a cell comprising:
contacting a target pre-mRNA expressed within the cell with a nucleic acid molecule recognized by nuclear splicing components wherein said nucleic acid molecule comprises:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 5' splice site;
c) a spacer region that separates the 5' splice site from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
under conditions in which a portion of the nucleic acid molecule is trans-spliced to a portion of the target pre-mRNA to form a chimeric RNA within the cell, wherein said nucleotide sequence encodes a papilloma virus polypeptide.

15. A method of claim 12 wherein the nucleic acid molecule further comprises a 5' donor site.

16. The method of claim 12, wherein the chimeric RNA molecule comprises sequences encoding a translatable protein.

17. A nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;

b) a 3' splice region comprising a branch point, a pyrimidine tract and a 3' splice acceptor site;
c) a spacer region that separates the 3' splice region from the target binding domain;
d) a safety sequence comprising one or more complementary sequences that bind to one or both sides of the 3' splice site;
and e) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleotide sequence encodes a papilloma virus polypeptide; and wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

18. A nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 3' splice acceptor site;
c) a spacer region that separates the 3' splice region from the target binding domain;
d) a safety sequence comprising one or more complementary sequences that bind to one or both sides of the 3' splice site;
and e) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleotide sequence encodes a papilloma virus polypeptide; and wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

19. A nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 5' splice site;
c) a spacer region that separates the 5' splice site from the target binding domain;
d) a safety sequence comprising one or more complementary sequences that bind to one or both sides of the 5' splice site;
and e) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleotide sequence encodes a papilloma virus polypeptide; and wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

20. The nucleic acid molecule of claim 17 wherein the nucleic acid molecule further comprises a 5' donor site.

21. The nucleic acid molecule of claim 17 wherein the binding of the nucleic acid molecule to the target pre-mRNA is mediated by complementary, triple helix formation, or protein-nucleic acid interaction.

22. The nucleic acid molecule of claim 17 wherein the papilloma virus is an oncogenic papilloma virus.

23. The nucleic acid molecule of claim 22 wherein the papilloma virus is papilloma virus 16.

24. The nucleic acid molecule of claim 19 wherein the papilloma virus is an oncogenic papilloma virus.

25. The nucleic acid molecule of claim 19 wherein the human papilloma virus is an oncogenic virus.

26. The nucleic acid molecule of claim 19 wherein the binding of the nucleic acid molecule to the target pre-mRNA is mediated by complementary, triple helix formation, or a protein-nucleic acid interaction.

27. A eukaryotic expression vector wherein said vector expresses a nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus protein pre-mRNA
expressed within the cell;
b) a 3' splice region comprising a branch point, a pyrimidine tract and a 3' splice acceptor site;
c) a spacer region that separates the 3' splice region from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA; wherein said nucleotide sequence encodes a papilloma virus polypeptide; and wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

28. A eukaryotic expression vector wherein said vector expresses a nucleic acid molecule comprising:

a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus protein pre-mRNA
expressed within the cell;
b) a 3' splice acceptor site;
c) a spacer region that separates the 3' splice region from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleotide sequence encodes a papilloma virus polypeptide; and wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

29. A eukaryotic expression vector wherein said vector expresses a nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus protein pre-mRNA
expressed within the cell;
b) a 5' splice site;
c) a spacer region that separates the 5' splice site from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleotide sequence encodes a papilloma virus polypeptide; and wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

30. The vector of claim 27 wherein the nucleic acid molecule further comprises a 5' donor site.

31. The vector of claim 27 wherein said vector is a viral vector.

32. The vector of claim 31 wherein in said viral vector is an adeno-associated viral vector.

33. A composition comprising a physiologically acceptable carrier and a vector according to any of claims 27-32.

34. A cell comprising a nucleic acid molecule wherein said nucleic acid molecule comprises:
a) one or more target binding domains that target binding of the nucleic acid molecule to a viral pre-mRNA expressed within the cell;
b) a 3' splice region comprising a branch point, a pyrimidine tract and a 3' splice acceptor site;
c) a spacer region that separates the 3' splice region from the target binding domain; and d) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

35. A method for inhibiting the expression of papilloma virus pre-mRNA in a subject having cervical carcinoma comprising administering to said subject a nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA

expressed within the cell; and b) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

36. A cell comprising a recombinant vector wherein said vector expresses a nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 3' splice acceptor site; and c) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

37. A cell comprising a recombinant vector wherein said vector expresses a nucleic acid molecule comprising:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 5' splice site; and c) a nucleotide sequence to be trans-spliced to the target pre-mRNA;
wherein said nucleic acid molecule is recognized by nuclear splicing components within the cell.

38. A method of producing a chimeric RNA molecule in a cell comprising:
contacting a target pre-mRNA expressed in the cell with a nucleic acid molecule recognized by nuclear splicing components wherein said nucleic acid molecule comprises:
a) one or more target binding domains that target binding of the nucleic acid molecule to a papilloma virus pre-mRNA
expressed within the cell;
b) a 3' splice acceptor site; and c) a nucleotide sequence to be trans-spliced to the target pre-mRNA; under conditions in which a portion of the nucleic acid molecule is trans-spliced to a portion of the target pre-mRNA
to form a chimeric RNA within the cell.