JP2005160387A - Method for amplifying nucleic acid and primer set therefor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a nucleic acid amplifying method capable of specifically amplifying a target nucleic acid in a sample and of quickly detecting the presence/absence of the amplified product. <P>SOLUTION: A primer set for the method contains two or more primers capable of amplifying a target nucleic acid sequence. In this primer set, a 1st primer contains on its 3'-terminal a sequence(Ac') hybridizable with a sequence(A) on the 3'-terminal of the target nucleic acid sequence and also contains on the 5' side of the sequence(Ac') a sequence hybridizable with the complementary sequence(Bc) of a sequence(B) present on the 5' side off the sequence(A) in the target nucleic acid sequence. At least one primer in this primer set contains a solid phase carrier or a site bindable thereto. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

Background of the Invention

The present invention relates to a method for amplifying and detecting a target nucleic acid. More specifically, the present invention specifically amplifies a target nucleic acid by observing the aggregation of a solid phase carrier bound to a primer after the target nucleic acid is specifically amplified. The present invention relates to a method for detecting a product.

BACKGROUND ART In gene diagnosis, a technique for amplifying a target nucleic acid and detecting it is particularly important. For example, in genetic diagnosis of an infectious disease, the presence or absence of the pathogen in a sample can be determined by amplification and detection of a target nucleic acid specific to the pathogen causing the infectious disease. In addition, genetic diagnosis for obtaining information on mutation or single nucleotide polymorphism (SNP) of an endogenous gene can be performed by amplification and detection of a target nucleic acid containing such mutation or single nucleotide polymorphism. Therefore, there is a need for a simple method that can rapidly and accurately amplify and detect a target nucleic acid in a sample.

  Amplification of the target gene (nucleic acid amplification) is mainly performed by an enzymatic method using a DNA polymerase. Major examples of such enzymatic methods include the polymerase chain reaction method (PCR method; US Pat. No. 4,683,195, US Pat. No. 4,683,202 and US Pat. No. 4,800,159), and There is a reverse transcription PCR method (RT-PCR method; Trends in Biotechnology 10, pp146-152, 1992), which combines a PCR method and a reverse transcriptase reaction. In the PCR method, a pair of primers consisting of a base sequence designed based on both ends of a target nucleic acid sequence to be amplified is used, and a double-stranded nucleic acid serving as a template is dissociated into a single-stranded nucleic acid (denaturation). The target nucleic acid can be amplified from DNA or RNA by repeating the reaction consisting of the three steps of annealing of the primer to the single-stranded nucleic acid and synthesis of the complementary strand from the primer (extension). In these methods, it is necessary to repeat a total of three steps of adjusting the reaction solution to a temperature suitable for each of the above three steps, thereby enabling exponential amplification of the target nucleic acid.

  Since the PCR method requires a special device for accurately changing the temperature of the reaction solution, it is very difficult to perform it outdoors or at the bedside. The PCR method also has a problem in reaction specificity. That is, in the PCR method, a double-stranded nucleic acid synthesized by the primer extension reaction is used as a new template. In this case, the sequence that the next new primer anneals is included in the sample from the beginning. It is a copy of the primer sequence, not the nucleotide sequence. Therefore, once the erroneous region is amplified, the region is amplified one after another, and a non-target amplification product is easily generated. Thus, in the PCR method, non-target nucleic acid may be amplified due to its reaction specificity. In particular, only the target nucleic acid is specifically amplified by recognizing slight differences in nucleotide sequences such as single bases. It is relatively difficult to do.

  In general, detection of amplification products obtained by various nucleic acid amplification methods such as PCR is performed by developing the reaction solution after the amplification reaction by gel electrophoresis, and using the amplified products and template nucleic acids, primers, etc. In a separated state, the band is stained with an intercalator such as ethidium bromide, and the size of the amplified product band is compared with a band such as a molecular weight marker to determine whether the target amplified product is present. It is done by. However, in the detection of target nucleic acid using various nucleic acid amplification methods, the target nucleic acid is contained in the reaction solution because it contains template nucleic acid, a large amount of unreacted primers, and amplification products other than the target nucleic acid. Depending on the molecular size of the product, separation by gel electrophoresis is often difficult. In addition, when the number of samples is large, performing complicated gel electrophoresis involves a great deal of labor and time. In addition, skillful techniques are required to perform accurate gel electrophoresis, and when the size difference between the target amplification product and the non-target amplification product is small, it is difficult to distinguish them. For example, when targeting nucleic acid sequences that may have insertions or deletions of several bases, it is very difficult to identify small band size differences and determine the presence or absence of target amplification products. Have difficulty. In particular, when genetic diagnosis is performed in a clinical field, it is necessary to process many samples simply and efficiently in a short time, and such conventional methods have not been able to cope with them sufficiently.

  In order to solve the above problems, attempts have been made to develop a simpler and faster method for detecting an amplification product. In JP-A-9-168400 (Patent Document 1), a primer used in a nucleic acid amplification reaction is immobilized on an insoluble carrier or is allowed to be immobilized, and the aggregation of the insoluble carrier is observed. Thus, a method for detecting an amplification product of a target nucleic acid is described. In this method, the PCR method is used as a nucleic acid amplification method, and it is said that both of the two types of primers need to be immobilized on an insoluble carrier or in an immobilizable state. In addition, when PCR is performed using a primer pair immobilized on an insoluble carrier, the amplification product bound to the insoluble carrier repeatedly aggregates and disperses with changes in temperature, and further amplified by the PCR method. Since the length of the amplified product is generally shorter than the diameter of the insolubilized carrier, the insoluble carriers tend to cause steric hindrance during the amplification reaction, which may hinder amplification. Furthermore, since the amount of amplification product obtained by the PCR method is not so large, the insoluble carrier is often not sufficiently aggregated. In such a case, the aggregation of the insoluble carrier is observed visually to check whether the target nucleic acid has been amplified or not. Is difficult to determine.

  Japanese Patent Application Laid-Open No. 2002-345499 (Patent Document 2) discloses a method of aggregating amplification products using at least one type of immobilized primer, thereby detecting a target nucleic acid. In this method, a target nucleic acid is amplified with two types of primer sets, and when the amplified product forms a stem-loop structure (dumbbell structure), at least one type of immobilized primer immobilized on an insoluble carrier is added. Further, the amplification product is aggregated by performing amplification, and the reaction step is complicated. In addition, this method requires two kinds of primer sets and at least one kind of immobilized primer, so that it is difficult to design a primer and further increases the cost.

JP-A-9-168400 JP 2002-345499 A

Summary of the Invention

  By combining the 3 ′ end portion of a primer used for complementary strand synthesis with the 5 ′ end portion of a primer that can fold back and hybridize to the complementary strand itself generated by the extension reaction, It has been found that a specific target nucleic acid can be amplified. Further, such a primer is immobilized on a solid phase carrier or is made immobilizable on a solid phase carrier, and by using this, the target nucleic acid is amplified without losing the reaction efficiency of complementary strand synthesis, and the solid phase is immobilized. It was found that the amplification product can be detected by observing the aggregation of the phase carrier. The present invention is based on these findings.

  Accordingly, the present invention provides a primer set that can specifically amplify a target nucleic acid in a sample and rapidly detect the presence or absence of the amplification product, and a nucleic acid amplification method and a nucleic acid detection method using this primer set. The purpose is to provide.

  The primer set according to the present invention is a primer set comprising two or more kinds of primers capable of amplifying the target nucleic acid sequence, wherein the first primer included in the primer set is the 3 ′ end of the target nucleic acid sequence. Of the sequence (B) comprising a sequence (Ac ′) hybridizing to the sequence (A) of the portion at the 3 ′ end portion and present 5 ′ to the sequence (A) in the target nucleic acid sequence A sequence (B ′) that hybridizes to a complementary sequence (Bc) is included on the 5 ′ side of the sequence (Ac ′), and at least one primer included in the primer set is a solid phase carrier or It is a primer set comprising a site capable of binding to a solid phase carrier.

Furthermore, the nucleic acid amplification method according to the present invention is a method of amplifying a target nucleic acid sequence in a template nucleic acid,
(A) preparing a template nucleic acid containing a target nucleic acid sequence;
(B) preparing a primer set according to the present invention, and (c) performing a nucleic acid amplification reaction with the primer set in the presence of the template nucleic acid.

Furthermore, the nucleic acid detection method according to the present invention is a method for determining the presence or absence of a target nucleic acid in a nucleic acid sample,
(A) a step of preparing a nucleic acid sample;
(B) preparing a primer set according to the present invention;
(C) performing a nucleic acid amplification reaction with the primer set in the presence of the nucleic acid sample;
(D) When none of the primers included in the primer set includes a solid phase carrier, the solid phase carrier is bound to a site capable of binding to the solid phase carrier included in at least one of these primers. And (e) a step of observing the presence or absence of aggregation of the solid phase carrier. In this method, it is determined that the target nucleic acid is present when aggregation of the solid phase carrier is observed, and it is determined that the target nucleic acid is not present when aggregation of the solid phase carrier is not observed.

  According to the present invention, it is possible to specifically amplify a target nucleic acid with at least two kinds of primers, and furthermore, it is possible to detect the amplification product by observing the aggregation of the solid phase carrier. Therefore, according to the present invention, it is possible to accurately and quickly detect the presence or absence of the target nucleic acid, for example, it is also possible to rapidly detect a mutation in the nucleic acid sequence.

DETAILED DESCRIPTION OF THE INVENTION

  The action mechanism of the nucleic acid amplification reaction according to the present invention is schematically shown in FIG. First, a target nucleic acid sequence in a nucleic acid to be a template is determined, and a sequence (A) at the 3 ′ end portion of the target nucleic acid sequence and a sequence (B) existing on the 5 ′ side of the sequence (A) are determined. . The primer according to the present invention comprises the sequence (Ac ′) and further comprises the sequence (B ′) on the 5 ′ side thereof. The sequence (Ac ′) hybridizes to the sequence (A). The sequence (B ′) hybridizes to the complementary sequence (Bc) of the sequence (B). Here, the primer according to the present invention may include an intervening sequence that does not affect the reaction between the sequence (Ac ′) and the sequence (B ′). When such a primer is annealed to the template nucleic acid, the sequence (Ac ′) in the primer is hybridized to the sequence (A) of the target nucleic acid sequence (FIG. 1 (a)). When a primer extension reaction occurs in this state, a nucleic acid containing a complementary sequence of the target nucleic acid sequence is synthesized. Then, the sequence (B ′) present on the 5 ′ end side of the synthesized nucleic acid hybridizes to the sequence (Bc) present in the nucleic acid, and thereby the stem in the 5 ′ end portion of the synthesized nucleic acid. -A loop structure is formed. As a result, the sequence (A) on the template nucleic acid becomes a single strand, and this primer hybridizes with another primer having the same sequence as the previous primer (FIG. 1 (b)). Thereafter, an extension reaction from the newly hybridized primer occurs by the strand displacement reaction, and at the same time, the previously synthesized nucleic acid is separated from the template nucleic acid (FIG. 1 (c)).

  In the above action mechanism, the phenomenon that the sequence (B ′) hybridizes to the sequence (Bc) occurs due to the presence of complementary regions on the same strand. In general, when a double-stranded nucleic acid is dissociated into a single strand, partial dissociation starts from its terminal or other relatively unstable part. In the double-stranded nucleic acid generated by the extension reaction using the above-described primer, the base pair at the terminal portion is in an equilibrium state of dissociation and binding at a relatively high temperature, and the double-stranded nucleic acid is maintained as a whole. In such a state, when a sequence complementary to the dissociated portion of the terminal is present on the same strand, a stem-loop structure can be formed as a metastable state. Although this stem-loop structure does not exist stably, the same primer binds to the complementary strand portion (sequence (A) on the template nucleic acid) exposed by the formation of the structure, and the polymerase immediately performs an extension reaction. As a result, the previously synthesized strand is replaced and released, and at the same time, a new double-stranded nucleic acid is generated.

  By repeating the above reaction, a large amount of nucleic acid complementary to the target nucleic acid sequence in the template nucleic acid can be synthesized. Further, by using in combination with the second primer designed for the complementary strand of the target nucleic acid sequence, a nucleic acid synthesis reaction using the complementary strand of the template nucleic acid as a template can be performed simultaneously. In particular, by using a primer that is designed in the same manner as the first primer as the second primer, it is possible to simultaneously perform the same nucleic acid synthesis reaction using the complementary strand of the template nucleic acid as a template. . The target nucleic acid newly synthesized by these nucleic acid synthesis reactions is used as a template for the synthesis of each complementary strand in the next nucleic acid synthesis reaction. Therefore, the target nucleic acid sequence in the template nucleic acid can be amplified by these nucleic acid synthesis reactions.

  Furthermore, since at least one primer contained in the primer set according to the present invention contains a solid phase carrier or a site capable of binding to the solid phase carrier, by observing the aggregation of the solid phase carrier after the amplification reaction, Rapid detection of the amplified product is possible.

  The primer set according to the present invention comprises two or more primers that enable amplification of a target nucleic acid sequence by the nucleic acid amplification reaction as described above. The first primer included in the primer set comprises a sequence (Ac ′) that hybridizes to the sequence (A) of the 3 ′ end portion of the target nucleic acid sequence at the 3 ′ end portion, and the target nucleic acid sequence A sequence (B ′) that hybridizes to the complementary sequence (Bc) of the sequence (B) existing 5 ′ from the sequence (A) on the 5 ′ side of the sequence (Ac ′) Is done.

  In the present invention, the “target nucleic acid” or “target nucleic acid sequence” means not only the nucleic acid to be amplified or the sequence itself, but also a complementary sequence or a nucleic acid having the sequence.

  In the present invention, “hybridize” means that a part of the primer according to the present invention hybridizes to a target nucleic acid under stringent conditions and does not hybridize to a nucleic acid molecule other than the target nucleic acid. The stringent conditions can be determined depending on the melting temperature Tm (° C.) of the duplex of the primer according to the present invention and its complementary strand, the salt concentration of the hybridization solution, etc., for example, J. Sambrook, Reference can be made to EF Frisch, T. Maniatis; Molecular Cloning 2nd edition, Cold Spring Harbor Laboratory (1989). For example, when hybridization is performed at a temperature slightly lower than the melting temperature of the primer to be used, the primer can be specifically hybridized to the target nucleic acid. Such a primer can be designed using commercially available primer construction software, such as Primer 3 (manufactured by Whitehead Institute for Biomedical Research). According to a preferred embodiment of the present invention, a primer that hybridizes to a target nucleic acid comprises a sequence of all or part of a nucleic acid molecule complementary to the target nucleic acid.

  The design criteria for the first primer in a preferred embodiment of the present invention are as follows. First, in order for a new primer to efficiently anneal to the template nucleic acid after the complementary strand of the template nucleic acid is synthesized by extension of the primer, the template is formed by forming a stem-loop structure at the 5 ′ end of the synthesized complementary strand. The part of the sequence (A) on the nucleic acid needs to be a single strand. For this purpose, the difference (X−Y) between the base number X of the sequence (Ac ′) and the base number Y of the region sandwiched between the sequence (A) and the sequence (B) in the target nucleic acid sequence is expressed as X The ratio (X−Y) / X to is important. However, it is not necessary to make a single strand up to the portion which is present 5 ′ from the sequence (A) on the template nucleic acid and which is not related to primer hybridization. In addition, in order for a new primer to efficiently anneal to a template nucleic acid, it is also necessary to efficiently perform the above-described stem-loop structure formation. For efficient stem-loop structure formation, that is, efficient hybridization between the sequence (B ′) and the sequence (Bc), the distance between the sequence (B ′) and the sequence (Bc) (X + Y) is important. In general, the optimum temperature for the primer extension reaction is at most around 72 ° C., and at such a low temperature, it is difficult for the extended strand to dissociate over a long region. Therefore, in order for the sequence (B ′) to efficiently hybridize to the sequence (Bc), it is considered preferable that the number of bases between both sequences is small. On the other hand, in order for the sequence (B ′) to hybridize to the sequence (Bc) and to make the portion of the sequence (A) on the template nucleic acid a single strand, the sequence (B ′) and the sequence (Bc) It is considered that a larger number of bases between is preferred.

  From the above viewpoints, the first primer according to a preferred embodiment of the present invention is the (X−) in the case where no intervening sequence exists between the sequence (Ac ′) and the sequence (B ′) constituting the primer. Y) / X is −1.00 or more, preferably 0.00 or more, more preferably 0.05 or more, more preferably 0.10 or more, and 1.00 or less, preferably 0.75 or less, It is designed to be preferably 0.50 or less, more preferably 0.25 or less. Further, (X + Y) is preferably 15 or more, more preferably 20 or more, more preferably 30 or more, and preferably 50 or less, more preferably 48 or less, and further preferably 42 or less.

  Further, when there is an intervening sequence (base number Y ′) between the sequence (Ac ′) and the sequence (B ′) constituting the primer, the first primer according to a preferred embodiment of the present invention is {X- (YY ')} / X is -1.00 or more, preferably 0.00 or more, more preferably 0.05 or more, more preferably 0.10 or more, and 1.00 or less, It is designed to be preferably 0.75 or less, more preferably 0.50 or less, and still more preferably 0.25 or less. Further, (X + Y + Y ′) is preferably 15 or more, more preferably 20 or more, more preferably 30 or more, and is preferably 100 or less, more preferably 75 or less, and even more preferably 50 or less.

  The first primer is composed of deoxynucleotides and / or ribonucleotides, and has a chain length that allows base pairing with a target nucleic acid while maintaining the required specificity under given conditions. It is what has. The primer has a chain length of preferably 15 to 100 nucleotides, more preferably 30 to 60 nucleotides. The lengths of the sequence (Ac ′) and the sequence (B ′) constituting the first primer are preferably 5 to 50 nucleotides, more preferably 10 to 30 nucleotides, respectively. If necessary, an intervening sequence that does not affect the reaction may be inserted between the sequence (Ac ′) and the sequence (B ′).

  In the present invention, “ribonucleotide” (sometimes simply referred to as “N”) refers to ribonucleotide triphosphate such as ATP, UTP, CTP, GTP and the like. Furthermore, ribonucleotides include these derivatives, for example, ribonucleotides (α-thio-ribonucleotides) in which the oxygen atom of the phosphate group at the α-position is replaced with a sulfur atom.

  The first primer includes an oligonucleotide primer composed of unmodified deoxynucleotides and / or modified deoxynucleotides, an oligonucleotide primer composed of unmodified ribonucleotides and / or modified ribonucleotides, and unmodified deoxynucleotides. Also included are chimeric oligonucleotide primers containing nucleotides and / or modified deoxynucleotides and unmodified ribonucleotides and / or modified ribonucleotides.

  The second primer included in the primer set according to the present invention is only required to be a starting point for synthesis of a complementary strand of a template in a nucleic acid amplification reaction. For example, it is designed in the same manner as a primer used in a known method such as a PCR method. can do. In addition, the second primer can be designed in the same manner as the first primer, thereby improving the amplification efficiency in the nucleic acid amplification reaction. Therefore, according to a preferred embodiment of the present invention, the second primer has a sequence (Cc ′) that hybridizes to the sequence (C) of the 3 ′ end portion of the complementary sequence of the target nucleic acid sequence at the 3 ′ end portion. And a sequence (D ′) that hybridizes to a complementary sequence (Dc) of a sequence (D) that is 5 ′ to the sequence (C) in the complementary sequence of the target nucleic acid sequence. Cc ′) is included on the 5 ′ side. The preferred design criteria for such a second primer are as described above for the first primer.

  In addition to the first and second primers described above, the primer set according to the present invention may contain an additional primer capable of amplifying a region containing all or part of the same target nucleic acid sequence. Such an additional primer may be any primer that can serve as a starting point for synthesis of a complementary strand of a template in a nucleic acid amplification reaction, and can be designed in the same manner as a primer used in a known method such as a PCR method. The additional primer can typically comprise a nucleotide sequence that hybridizes to the 3 'terminal portion of either strand of the targeted region. The number of additional primers included in the primer set according to the present invention is not particularly limited. By using such an additional primer, it is possible to further improve the amplification efficiency in the nucleic acid amplification reaction. However, since sufficient amplification efficiency can be obtained even in the nucleic acid amplification reaction using only the first and second primers, an additional primer is not always necessary.

  According to one preferred embodiment of the present invention, the primer set according to the present invention comprises only the first and second primers described above. Since such a primer set includes a minimum number of primers, it is advantageous to easily design the primer and to make the mechanism of nucleic acid amplification reaction as simple as possible.

  The primers included in the primer set according to the present invention can be synthesized by any method that can be used for the synthesis of oligonucleotides, such as the phosphate triester method, the H-phosphonate method, the thiophosphonate method, and the like. The first and second primers can be easily obtained by, for example, synthesizing by the phosphoramidite method using a DNA synthesizer type 394 manufactured by ABI (Applied Biosystem Inc.).

  At least one primer contained in the primer set according to the present invention comprises a solid phase carrier or a site capable of binding to the solid phase carrier. The solid phase carrier or the site capable of binding to the solid phase carrier may be introduced into any part such as the 3 ′ end portion, 5 ′ end portion, central region of the primer, but preferably the 5 ′ end portion. It is assumed that it was introduced. Moreover, according to one preferable embodiment of the present invention, the solid phase carrier or the site capable of binding to the solid phase carrier is introduced into one or both of the first primer and the second primer.

  The solid phase carrier used in the present invention is a carrier that is insoluble in the reaction solution used for the nucleic acid amplification reaction, or a property from the liquid phase to the solid phase (gel phase) or from the solid phase (gel phase) to the liquid phase before and after amplification. Any phase transition carrier that changes can be used. Preferred solid phase carriers include water-insoluble organic polymer carriers, water-insoluble inorganic polymer carriers, synthetic polymer carriers, phase transition carriers, metal colloids, magnetic particles, and the like, and further solvent-insoluble organic polymer carriers. , Solvent-insoluble inorganic polymer carriers, solvent-soluble polymer carriers, gel polymer carriers and the like. Furthermore, examples of the water-insoluble organic polymer include silicon-containing materials such as porous silica, porous glass, diatomaceous earth, and celite, and cross-linked polysaccharides such as nitrocellulose, hydroxyapatite, agarose, dextran, cellulose, and carboxymethylcellulose. , Cross-linked protein such as methylated albumin, gelatin, collagen, casein, gel particles, dye sol and the like. Examples of the water-insoluble inorganic polymer include aluminum oxide, titanium oxide, and ceramic particles. Examples of the synthetic polymer include polystyrene, poly (meth) acrylate, polyvinyl alcohol, polyacrylonitrile or a copolymer thereof, a styrene-styrene sulfonic acid copolymer, a vinyl acetate-acrylic acid ester copolymer, and the like. . Examples of the metal colloid include gold colloid. Magnetic particles include magnetic iron oxide beads, monodispersed magnetic iron oxide finely pulverized particles on the surface, superparamagnetic particles (Japanese Patent Publication No. 4-501959), and superparamagnetic oxidation covered with a polymerizable silane coating. Examples thereof include magnetically responsive particles having iron (Japanese Patent Publication No. 7-6986), and finely magnetizable particles encapsulated in an organic polymer. The magnetized solid phase carrier can be easily separated from solid and liquid using magnetic force. Examples of the shape of the solid phase carrier include particles, membranes, and filters. Particles are particularly preferred as the shape of the solid support, and the surface thereof may be either porous or non-porous. Particularly preferred solid phase carriers include latex in which a synthetic polymer carrier is uniformly dispersed in water, metal colloid particles such as gold colloid, magnetic particles such as magnet beads, and the like.

  Immobilization of the primer to the solid phase carrier can be performed by a method known to those skilled in the art, and may be a method by either physical bonding or chemical bonding. Immobilization of a primer on a solid phase carrier is generally performed by combining, for example, a substance that can label an oligonucleotide such as a primer or a probe with a solid phase carrier that is bound to a substance that can be bound thereto. it can. As a combination of substances used for such purpose, those well known in the art can be used, for example, a combination of biotin and avidin or streptavidin, a combination of an antigen and an antibody capable of binding thereto, a ligand, And a combination of two nucleic acids which hybridize with each other. Specifically, for example, a primer labeled with biotin is bound to a solid phase carrier whose surface is coated with avidin or streptavidin, whereby the primer can be immobilized on the solid phase carrier. Examples of the antigen include haptens such as FITC, DIG, and DNP. Examples of antibodies that can bind to these include antibodies such as anti-FITC antibody, anti-DIG antibody, and anti-DNP antibody. In addition, these antibodies may be either monoclonal antibodies or polyclonal antibodies. In particular, the combination of biotin and streptavidin has high specificity and good binding efficiency, so that these combinations are particularly preferable. Labeling substances such as biotin, hapten, and ligand may be used alone or in a plurality of combinations if necessary, by known means (Japanese Patent Laid-Open Nos. 59-93099, 59-148798, and No. 59-204200) can be introduced at the 5 ′ end of the primer.

  The site (or group) capable of binding to the solid phase carrier used in the present invention can be selected according to the above-mentioned method used for immobilizing the primer to the solid phase carrier, Either a physical bond or a chemical bond may be used. Examples of the site capable of binding to such a solid phase carrier include biotin, avidin, streptavidin, antigen, antibody, ligand, receptor, nucleic acid, protein and the like, and preferably biotin or streptavidin. More preferably, it is biotin. By using a primer containing such a site, the solid phase carrier can be bound to the amplification product after the nucleic acid amplification reaction. The solid phase carrier used in this case can include a binding partner of the site included in the primer, if necessary. Such a binding partner is present in a form capable of binding to the site contained in the primer, and is preferably present on the surface of the solid phase carrier, more preferably the surface of the solid phase carrier. It is said that it was applied on top.

  The nucleic acid amplification reaction using the primer set according to the present invention makes it possible to amplify the target nucleic acid sequence in the template nucleic acid and determine the presence or absence of the target nucleic acid in the nucleic acid sample.

  The template nucleic acid or nucleic acid sample containing the target nucleic acid sequence used in the nucleic acid amplification reaction may be either DNA or RNA. These nucleic acids can be isolated, for example, from blood, tissues, cells, biological samples such as animals and plants, or microorganism-derived samples separated from food, soil, waste water, and the like.

  Isolation of the template nucleic acid or nucleic acid sample can be performed by any method, and examples thereof include a method using a lysis treatment with a surfactant, sonication, shaking and stirring using glass beads, a French press, and the like. In addition, when an endogenous nuclease is present, it is preferable to purify the isolated nucleic acid. The purification of the nucleic acid can be performed by, for example, phenol extraction, chromatography, ion exchange, gel electrophoresis, density-dependent centrifugation, and the like.

  More specifically, the template nucleic acid or the nucleic acid sample is a double-stranded nucleic acid such as genomic DNA or PCR fragment isolated by the above method, or a cDNA prepared by reverse transcription from total RNA or mRNA. Any single stranded nucleic acid can be used. In the case of the above double-stranded nucleic acid, it can be used more optimally by carrying out a denaturing step to make it a single strand.

  The enzyme used in the reverse transcription reaction is not particularly limited as long as it has cDNA synthesis activity using RNA as a template. For example, avian myeloblastosis virus-derived reverse transcriptase (AMV RTase), rous-related virus 2 reverse transcriptase (RAV-2 RTase), Moloney murine leukemia virus-derived reverse transcriptase (MMLV RTase), and other reverse transcriptases. In addition, a DNA polymerase having reverse transcription activity can also be used. For the purpose of the present invention, an enzyme having reverse transcription activity at a high temperature is optimal. For example, a DNA polymerase derived from Thermus bacterium (Tth DNA polymerase, etc.), a DNA polymerase derived from Bacillus bacterium, or the like can be used. As a particularly preferable enzyme, for example, as a DNA polymerase derived from a thermophilic Bacillus bacterium, B. st-derived DNA polymerase (Bst DNA polymerase); Ca-derived DNA polymerase (Bca DNA polymerase), for example, BcaBEST DNA polymerase, Bca (exo-) DNA polymerase, and the like can be mentioned. For example, Bca DNA polymerase does not require manganese ions for reaction, and can synthesize cDNA while suppressing secondary structure formation of template RNA under high temperature conditions.

  In the nucleic acid amplification reaction, even when the template nucleic acid is a double-stranded nucleic acid, it can be used as it is in the reaction. However, if necessary, the primer nucleic acid can be denatured into a single strand to obtain a primer for the template nucleic acid. Annealing can also be performed efficiently. Increasing the temperature to about 95 ° C is a preferred nucleic acid denaturation method. As another method, it is possible to denature by raising the pH, but in this case, it is necessary to lower the pH in order to hybridize the primer to the target nucleic acid.

  The DNA polymerase used in the nucleic acid amplification reaction only needs to have a strand displacement activity (strand displacement ability), and any of room temperature, intermediate temperature, and heat resistance can be suitably used. Further, this DNA polymerase may be either a natural body or a mutant with artificial mutation. Furthermore, it is preferable that the DNA polymerase has substantially no 5 '→ 3' exonuclease activity. Examples of such a DNA polymerase include thermophilic Bacillus bacteria such as Bacillus stearothermophilus (hereinafter referred to as “B.st”) and Bacillus caldotenax (hereinafter referred to as “B.ca”). Examples include mutants lacking the 5 ′ → 3 ′ exonuclease activity of the derived DNA polymerase, Klenow fragment of E. coli derived DNA polymerase I, and the like. Examples of the DNA polymerase used in the nucleic acid amplification reaction include Vent DNA polymerase, Vent (Exo-) DNA polymerase, DeepVent DNA polymerase, DeepVent (Exo-) DNA polymerase, Φ29 phage DNA polymerase, MS-2 phage DNA polymerase, Z -Taq DNA polymerase, Pfu DNA polymerase, Pfu turbo DNA polymerase, KOD DNA polymerase, 9 ° Nm DNA polymerase, Therminater DNA polymerase and the like.

  Furthermore, in the nucleic acid amplification reaction, by using a DNA polymerase having reverse transcription activity, for example, BcaBEST DNA polymerase, Bca (exo-) DNA polymerase, etc., reverse transcription reaction from total RNA or mRNA and cDNA as a template. It is possible to perform the DNA polymerase reaction with one kind of polymerase. Alternatively, a DNA polymerase and a reverse transcriptase such as MMLV reverse transcriptase may be used in combination.

  Other reagents used in the nucleic acid amplification reaction include, for example, catalysts such as magnesium chloride, magnesium acetate, magnesium sulfate, substrates such as dNTP mix, Tris-HCl buffer, tricine buffer, sodium phosphate buffer, potassium phosphate buffer, etc. Can be used. Furthermore, additives such as dimethyl sulfoxide and betaine (N, N, N-trimethylglycine), acidic substances described in International Publication No. 99/54455 pamphlet, cation complexes and the like may be used.

  In the nucleic acid amplification reaction, a melting temperature adjusting agent can be added to the reaction solution in order to increase the amplification efficiency of the nucleic acid. The melting temperature (Tm) of a nucleic acid is generally determined by the specific nucleotide sequence of the double stranded portion in the nucleic acid. By adding a melting temperature adjusting agent to the reaction solution, this melting temperature can be changed. Therefore, under a certain temperature, the intensity of double strand formation in the nucleic acid can be adjusted. A general melting temperature adjusting agent has an effect of lowering the melting temperature. By adding such a melting temperature adjusting agent, the melting temperature of the duplex forming part between two nucleic acids can be lowered, in other words, the strength of the duplex formation can be lowered. It becomes. Therefore, when such a melting temperature adjusting agent is added to the reaction solution in the nucleic acid amplification reaction, it is efficiently used in a GC-rich nucleic acid region that forms a strong double strand or a region that forms a complex secondary structure. The double-stranded portion can be made into a single strand, and this makes it easy for the next primer to hybridize to the target region after the extension reaction with the primer is completed, so that the nucleic acid amplification efficiency can be increased. The melting temperature adjusting agent used in the present invention and its concentration in the reaction solution are appropriately selected by those skilled in the art in consideration of other reaction conditions that affect the hybridization conditions, such as salt concentration, reaction temperature, etc. The Therefore, the melting temperature adjusting agent is not particularly limited, but is preferably dimethyl sulfoxide (DMSO), betaine, formamide or glycerol, or any combination thereof, more preferably dimethyl sulfoxide (DMSO). .

  Furthermore, in the nucleic acid amplification reaction, an enzyme stabilizer can be added to the reaction solution. Thereby, since the enzyme in the reaction solution is stabilized, the amplification efficiency of the nucleic acid can be increased. The enzyme stabilizer used in the present invention may be any known in the art, such as glycerol, bovine serum albumin, saccharides, etc., and is not particularly limited.

  Furthermore, in the nucleic acid amplification reaction, a reagent for enhancing the heat resistance of an enzyme such as DNA polymerase or reverse transcriptase can be added to the reaction solution. As a result, the enzyme in the reaction solution is stabilized, so that the nucleic acid synthesis efficiency and amplification efficiency can be increased. Such a reagent may be any known in the art, such as trehalose, and is not particularly limited.

  The nucleic acid amplification reaction using the primer set according to the present invention can be performed isothermally. Therefore, according to a preferred embodiment of the present invention, the nucleic acid amplification reaction comprises the steps of preparing a nucleic acid amplification solution comprising a template nucleic acid or nucleic acid sample and the primer set according to the present invention, and the nucleic acid amplification solution. Incubating isothermally. Here, “isothermal” refers to maintaining an approximately constant temperature condition such that the enzyme and the primer can substantially function. Furthermore, the “substantially constant temperature condition” means that not only the set temperature is accurately maintained but also a temperature change that does not impair the substantial functions of the enzyme and the primer is allowed. To do.

  The nucleic acid amplification reaction under a certain temperature condition can be carried out by keeping the temperature at which the activity of the enzyme used can be maintained. In this nucleic acid amplification reaction, in order for the primer to anneal to the target nucleic acid, for example, the reaction temperature is preferably set to a temperature near or below the melting temperature (Tm) of the primer, The level of stringency is preferably set in consideration of the melting temperature (Tm) of the primer. Therefore, this temperature is preferably about 20 ° C to about 75 ° C, more preferably about 35 ° C to about 65 ° C.

  In the nucleic acid amplification reaction, the amplification reaction is repeated until the enzyme is deactivated or one of the reagents including the primer is used up.

  The amplification product obtained by the nucleic acid amplification reaction can be detected by observing the aggregation of the solid phase carrier. Here, the presence of the amplification product is confirmed when aggregation of the solid phase carrier is observed, and the presence of the amplification product is not confirmed when aggregation of the solid phase carrier is not observed. Therefore, in the method for determining the presence or absence of the target nucleic acid in the nucleic acid sample using this nucleic acid amplification reaction, it is determined that the target nucleic acid is present when aggregation of the solid phase carrier is observed. Is not observed, it is determined that the target nucleic acid is not present. When both the first primer and the second primer do not contain a solid phase carrier, it is necessary to bind the solid phase carrier to a site capable of binding to the solid phase carrier contained in at least one of these primers. There is. In addition, when either one of the first primer and the second primer includes a site capable of binding to a solid phase carrier, the solid phase carrier may be bound as necessary. When a plurality of target nucleic acids are to be amplified, solid phase carriers that can be distinguished from each other in primer sets designed for each target nucleic acid (for example, solid phase carriers having different colors, shapes, etc.) are used. A nucleic acid amplification reaction can be performed using a single reaction solution containing these. In that case, the presence or absence of each target nucleic acid can be known by confirming the presence or absence of aggregation of each bead.

  In addition, the presence of the amplification product obtained by the nucleic acid amplification reaction can be detected by any other method. When performing another detection method, when either one of the first primer and the second primer includes a solid phase carrier, the solid phase carrier is separated from the amplification product as necessary. May be. Separation of the solid phase carrier from the amplification product can be performed by a method known to those skilled in the art, for example, a method of shaking the reaction solution.

  Another detection method is detection of an amplification product of a specific size by general gel electrophoresis. In this method, for example, it can be detected by a fluorescent substance such as ethidium bromide or cyber green. As yet another method, detection can be performed by using a labeled probe having a label such as biotin and hybridizing it to the amplification product. Biotin can be detected by binding to fluorescently labeled avidin, avidin bound to an enzyme such as peroxidase, and the like. As yet another method, there is a method using an immunochromatograph. In this method, it has been devised to use a chromatographic medium utilizing a label detectable with the naked eye (immunochromatography method). If the amplified fragment and the labeled probe are hybridized, and a capture probe capable of hybridizing with a further different sequence of the amplified fragment is fixed to the chromatographic medium, the trapped portion can be trapped. Detection with is possible. As a result, it is possible to perform simple detection with the naked eye.

  In the nucleic acid amplification reaction using the primer set according to the present invention, only when the primer anneals to the target nucleic acid and the extension reaction product from the primer is a complementary strand of the target nucleic acid, the 5 ′ end of the primer is a self-extension product. Only then can the next new primer be annealed to the template. Therefore, according to this nucleic acid amplification reaction, only the target nucleic acid sequence can be accurately amplified. Therefore, even when the template nucleic acid or the nucleic acid sample does not contain the target nucleic acid and contains a sequence having high homology with the target nucleic acid, amplification is inhibited. For the amplification of such highly specific target nucleic acid, the homology of the 3 ′ end region of the primer is important, and further, the homology of the folded sequence portion at the 5 ′ end of the primer is very important. . Therefore, by providing such a region with a mutation that can discriminate between the target nucleic acid to be detected and the other nucleic acid, by observing the presence or absence of aggregation of the solid phase carrier, the mutation of the nucleic acid sequence can be determined. Presence / absence, nucleotide deletion or insertion, or genetic polymorphism such as SNP can be analyzed. Furthermore, it is possible to specifically detect the target mRNA in a nucleic acid sample in which genomes are mixed.

  In order to carry out the nucleic acid amplification method or nucleic acid detection method according to the present invention, necessary reagents can be put together into a kit. Accordingly, the kit according to the present invention comprises the primer set according to the present invention. Moreover, the nucleic acid amplification method or nucleic acid detection method according to the present invention has the advantage that no primer other than the primer set according to the present invention is required. Therefore, according to a preferred embodiment of the present invention, the kit according to the present invention does not contain primer components other than the primer set according to the present invention. Furthermore, when at least one of the first primer and the second primer constituting the primer set according to the present invention includes a site capable of binding to a solid phase carrier, the kit according to the present invention further includes the solid phase carrier. It is preferable to become. The kit according to the present invention may further contain the above-mentioned reagents such as DNA polymerase, dNTP, buffer, reaction vessel, instructions and the like.

  According to a preferred embodiment of the present invention, the kit comprises a reaction vessel containing a primer set according to the present invention and other reagents required for a nucleic acid amplification reaction. Examples of other reagents include the above-described reagents such as DNA polymerase, dNTP, and buffer solution. By using such a kit, a nucleic acid amplification reaction can be carried out simply by adding a template nucleic acid or a nucleic acid sample to the reaction vessel and keeping the reaction vessel at a constant temperature. Furthermore, when at least one of the first primer and the second primer constituting the primer set includes a solid phase carrier, the solid phase carrier aggregates at the same time as the amplification product is generated. This aggregation can be observed from the outside of the reaction vessel by using a transparent reaction vessel. Therefore, in this case, since the amplification product can be detected without opening the reaction vessel, the operation is simple, and further, contamination of the nucleic acid amplification product with other samples is prevented. You can also

  According to another aspect of the present invention, there are provided a nucleic acid amplification method and a nucleic acid detection method in which a substrate comprising a solid phase carrier or a site capable of binding to a solid phase carrier is used in the nucleic acid amplification reaction described above. This makes it possible to detect the amplification product by observing the aggregation of the solid phase carrier. When such a substrate is used, the primer used for the nucleic acid amplification reaction may not contain a solid phase carrier or a site capable of binding to the solid phase carrier. The solid phase carrier and the site capable of binding to the solid phase carrier, and the method for introducing them into the substrate are as described above for the primers used. By adding such a substrate to the amplification reagent, a solid phase carrier or a site capable of binding to the solid phase carrier is introduced into the amplification product obtained by the nucleic acid amplification reaction, and this is used as described above. Thus, the amplification product can be detected by observing the aggregation of the solid phase carrier. Preferable examples of such a substrate include DIG-labeled dUTP, biotin-labeled dUTP and the like, and solid phase carriers used in this case include binding partners capable of binding to these labels, such as anti-DIG antibodies, streptoids, etc. The thing containing avidin etc. is mentioned. According to this aspect of the present invention, it further comprises a primer set comprising two or more primers capable of amplifying the target nucleic acid sequence, and a substrate comprising a solid phase carrier or a site capable of binding to the solid phase carrier. A nucleic acid amplification kit, wherein the first primer included in the primer set includes a sequence (Ac ′) that hybridizes to the sequence (A) of the 3 ′ end portion of the target nucleic acid sequence in the 3 ′ end portion. And a sequence (B ′) that hybridizes to a complementary sequence (Bc) of the sequence (B) present 5 ′ to the sequence (A) in the target nucleic acid sequence is 5 of the sequence (Ac ′). A kit for nucleic acid amplification is provided which comprises the 'side. The primer set included in this kit is the same as the primer set according to the present invention except that all of the primers included therein may not contain a solid phase carrier or a site capable of binding to the solid phase carrier. Configured. Further, other points regarding this kit are as described above for the kit for carrying out the nucleic acid amplification method or the nucleic acid detection method.

  EXAMPLES Hereinafter, the present invention will be specifically described with reference to examples, but the scope of the present invention is not limited to these examples.

Example 1: Amplification of human STS DYS237 gene using a primer set including a site capable of binding to a solid phase carrier and human DNA (manufactured by Clontech) as a detection template for the amplification product, human STS DYS237 contained therein A specific region (SEQ ID NO: 1) in the gene was amplified. Moreover, in order to confirm the specificity of the amplification reaction, the following sample solutions I to III were used as samples, respectively:
Sample solution I: an aqueous solution containing 100 ng of the human DNA;
Sample solution II: aqueous solution containing 100 ng salmon sperm DNA;
Sample solution III: Sterile water not containing DNA.

  As a primer, a primer pair having the following sequence was used. The positional relationship of each primer region with respect to the template was as shown in FIG. Each primer has its 3 ′ end sequence (20 mer: underlined) annealed to the template, and after the extension reaction, the 5 ′ end sequence (13 mer) is It is designed to hybridize to a region starting from 16 bases downstream of the 3 'terminal residue of the primer, and its 5' end is labeled with biotin.

Biotin labeled primer:
SY153LP13-15: CATTTGTTCAGTA GCATCCTCATTTTATGTCCA (SEQ ID NO: 2);
SY153RP13-15: CTTGCAGCATCAC CAACCCAAAAGCACTGAGTA (SEQ ID NO: 3).

Reaction solution (25 μL) having the following composition: Tris-HCl (20 mM, pH 8.8), KCl (10 mM), (NH ₄ ) ₂ SO ₄ (10 mM), MgSO ₄ (4 mM), DMSO (6%), Triton X-100 (0.1%), dNTP (0.4 mM), each containing 1600 nM of the above primer pair and the sample solution, and further containing 8 U of Bst DNA polymerase (NEW ENGLAND BioLabs). Incubated for 1 hour at 60 ° C. The template was allowed to react with double strands.

  Using 5% of each reaction solution, 3% NuSieve 3: 1 Agarose (manufactured by BioWhittaker Molecular Applications (BMA); purchased from Takara Bio Inc .; “NuSieve” is a registered trademark of BMA) at 100 V for 1 hour. Electrophoresis was performed. Nucleic acids were detected by staining the gel after electrophoresis with ethidium bromide (EtBr). The results are as shown in FIG. Samples in each lane in FIG. 3 are as follows: Lane 1: 20 bp DNA Ladder size marker; Lane 2: Sample solution I containing the target nucleic acid; Lane 3: Sample solution II not containing the target nucleic acid; Lane 4: Target nucleic acid Sample solution III containing no

  Among the low-size bands shown in lane 2 of FIG. 3, a band around 160 bp is expected as an amplification product of the target nucleic acid. Therefore, an amplification product was confirmed in the sample solution I containing the target nucleic acid. On the other hand, amplification products were not confirmed in the sample solution II and the sample solution III not containing the target nucleic acid. Therefore, it was shown that the target nucleic acid was specifically amplified by the above method.

  Next, 2 μL of a superparamagnetic polymer bead solution (Dynal Biotech, purchased from Veritas) coated with streptavidin is added to each remaining reaction solution (20 μL each), and left at room temperature for 30 minutes. Thereafter, the presence or absence of aggregation was observed. In the reaction solution to which the sample solution I was added, aggregation of beads was observed. On the other hand, in the reaction solution to which the sample solutions II and III were respectively added, no aggregation of beads was observed, and the beads were merely precipitated. As a result, an amplification product with a biotin-labeled primer is obtained only when the sample solution contains the target nucleic acid, and then the biotin in the amplification product is added to the reaction solution by adding beads coated with streptavidin to the reaction solution. It is believed that they bound to streptavidin and eventually their aggregation was visually observed. Therefore, according to the above method, it is possible to determine the presence or absence of the target nucleic acid by observing the aggregation of beads.

Example 2: Amplification of human STS DYS237 gene using a primer set containing a solid phase carrier and detection of the amplification product Human DNA (manufactured by Clontech) was used, and a specific region in human STS DYS237 gene contained therein Amplification of (SEQ ID NO: 1) was performed. Moreover, in order to confirm the specificity of the amplification reaction, the following sample solutions I to III were used as samples, respectively:
Sample solution I: an aqueous solution containing 100 ng of the human DNA;
Sample solution II: aqueous solution containing 100 ng salmon sperm DNA;
Sample solution III: Sterile water not containing DNA.

  As a primer, a primer pair having the following sequence was used. The positional relationship of each primer region with respect to the template was as shown in FIG. Each primer has its 3 ′ end sequence (20 mer: underlined) annealed to the template, and after the extension reaction, the 5 ′ end sequence (13 mer) is The primer was designed to hybridize to a region starting from 16 bases downstream of the 3 ′ terminal residue of the primer, and each 5 ′ terminal was labeled with biotin. By mixing 50 μmol of each biotin-labeled primer with 2.5 μL of a superparamagnetic polymer polymer bead solution coated with streptavidin (Dynal Biotech, purchased from Veritas) and left at room temperature for 30 minutes Primers were immobilized on beads and these were used as immobilized primer solutions.

Fixed primer set:
SY153LP13-15: CATTTGTTCAGTA GCATCCTCATTTTATGTCCA (SEQ ID NO: 2);
SY153RP13-15: CTTGCAGCATCAC CAACCCAAAAGCACTGAGTA (SEQ ID NO: 3).

Reaction solution (25 μL) having the following composition: Tris-HCl (20 mM, pH 8.8), KCl (10 mM), (NH ₄ ) ₂ SO ₄ (10 mM), MgSO ₄ (4 mM), DMSO (6%), Triton X-100 (1%), dNTP (0.4 mM), each of the fixed primer solution and the sample solution, and 8 U of Bst DNA polymerase (NEW ENGLAND BioLabs) were prepared. Incubated for hours. The template was allowed to react with double strands. Thirty minutes after the start of the amplification reaction, the reaction reagent was lightly mixed by tapping, and then allowed to stand at 60 ° C. until the amplification reaction was completed.

  After the amplification reaction, the state of aggregation was visually observed to determine the presence or absence of amplification. In the reaction solution to which the sample solution I containing the target nucleic acid was added, bead aggregation was observed. On the other hand, in the reaction solution to which the sample solution II and the sample solution III not containing the target nucleic acid were added, the aggregation of beads was not observed, and the beads were merely precipitated. As a result, an amplification product is obtained only when the sample solution contains the target nucleic acid, and aggregation is considered to occur between the beads to which the primer is immobilized. Therefore, according to the above method, it is possible to determine the presence or absence of the target nucleic acid by observing the aggregation of beads.

  Further, in order to examine whether the amplification product is the target nucleic acid, the reaction solution after the amplification reaction was vigorously shaken, and then 5 μl of each reaction solution was mixed with 3% NuSieve 3: 1 Agarose (manufactured by BioWhittaker Molecular Applications (BMA) Purchased from Takara Bio Inc .; “NuSieve” is a registered trademark of BMA) and electrophoresed at 100 V for 1 hour. Nucleic acids were detected by staining the gel after electrophoresis with ethidium bromide (EtBr). The results are as shown in FIG. The samples in each lane in FIG. 4 are as follows: Lane 1: 20 bp DNA Ladder size marker; Lane 2: Sample solution I containing the target nucleic acid; Lane 3: Sample solution II not containing the target nucleic acid; Lane 4: Target nucleic acid Sample solution III containing no

  Among the low-size bands shown in lane 2 of FIG. 4, a band around 160 bp is expected as an amplification product of the target nucleic acid. Therefore, an amplification product was confirmed in the sample solution I containing the target nucleic acid. On the other hand, amplification products were not confirmed in the sample solution II and the sample solution III not containing the target nucleic acid. Thus, the result of electrophoresis and the result of the above-mentioned bead aggregation coincided. Therefore, according to the above method, it is possible to determine the presence or absence of the target nucleic acid by observing the aggregation of beads.

FIG. 1 is a diagram schematically showing the action mechanism of a nucleic acid amplification reaction in the present invention. FIG. 2 is a diagram showing the positions on the gene of the 5 ′ side sequence and 3 ′ side sequence of the primers used for amplification of the human STS DYS237 gene. FIG. 3 is a diagram showing the results of amplification of the human STS DYS237 gene using a primer set including a site capable of binding to a solid phase carrier. FIG. 4 is a diagram showing the results of amplification of the human STS DYS237 gene using a primer set containing a solid phase carrier.

Claims (22)

A primer set comprising two or more primers capable of amplifying a target nucleic acid sequence,
The first primer included in the primer set comprises a sequence (Ac ′) that hybridizes to the sequence (A) of the 3 ′ end portion of the target nucleic acid sequence at the 3 ′ end portion, and the target nucleic acid sequence The sequence (B ′) hybridizes to the complementary sequence (Bc) of the sequence (B) existing 5 ′ to the sequence (A) in the 5 ′ side of the sequence (Ac ′). Yes,
The primer set, wherein at least one primer contained in the primer set comprises a solid phase carrier or a site capable of binding to the solid phase carrier.   The primer set according to claim 1, wherein the solid phase carrier or the site capable of binding to the solid phase carrier is introduced at the 5 'end of the primer.   In the first primer, when there is no intervening sequence between the sequence (Ac ′) and the sequence (B ′), the number of bases of the sequence (Ac ′) is X, When the number of bases in the region between the sequence (A) and the sequence (B) is Y, (XY) / X is in the range of -1.00 to 1.00, and the sequence When there is an intervening sequence between (Ac ′) and the sequence (B ′), when X and Y are as described above, and the base number of the intervening sequence is Y ′, {X− The primer set according to claim 1, wherein (YY ')} / X is in the range of -1.00 to 1.00.   A second primer contained in the primer set comprises a sequence (Cc ′) that hybridizes to a sequence (C) of the 3 ′ end portion of the complementary sequence of the target nucleic acid sequence at the 3 ′ end portion; and A sequence (D ′) that hybridizes to a complementary sequence (Dc) of a sequence (D) existing 5 ′ of the sequence (C) in the complementary sequence of the target nucleic acid sequence is 5 ′ of the sequence (Cc ′). The primer set according to claim 1, which is included on the side.   In the second primer, when there is no intervening sequence between the sequence (Cc ′) and the sequence (D ′), the number of bases of the sequence (Cc ′) is X, and in the target nucleic acid sequence When the number of bases in the region between the sequence (C) and the sequence (D) is Y, (XY) / X is in the range of -1.00 to 1.00, and the sequence When an intervening sequence exists between (Cc ′) and the sequence (D ′), when X and Y are as described above, and the base number of the intervening sequence is Y ′, {X− The primer set according to claim 4, wherein (YY ')} / X is in the range of -1.00 to 1.00.   The solid phase carrier is selected from the group consisting of a water-insoluble organic polymer carrier, a water-insoluble inorganic polymer carrier, a synthetic polymer carrier, a phase transition carrier, a metal colloid, and magnetic particles. Primer set.   The primer set according to claim 1, wherein the site capable of binding to the solid phase carrier is selected from the group consisting of biotin, avidin, streptavidin, antigen, antibody, ligand, receptor, nucleic acid and protein. A method for amplifying a target nucleic acid sequence in a template nucleic acid, comprising:
(A) preparing a template nucleic acid containing a target nucleic acid sequence;
(B) preparing the primer set according to any one of claims 1 to 7, and (c) performing a nucleic acid amplification reaction with the primer set in the presence of the template nucleic acid. Method.   The method of claim 8, wherein the nucleic acid amplification reaction is performed isothermally.   The method according to claim 8, wherein a DNA polymerase having strand displacement ability is used.   The method according to claim 8, wherein the nucleic acid amplification reaction is performed in the presence of a melting temperature adjusting agent.   The method according to claim 11, wherein the melting temperature adjusting agent is dimethyl sulfoxide, betaine, formamide or glycerol, or a mixture thereof. A method for determining the presence or absence of a target nucleic acid in a nucleic acid sample,
(A) a step of preparing a nucleic acid sample;
(B) preparing the primer set according to any one of claims 1 to 7,
(C) performing a nucleic acid amplification reaction with the primer set in the presence of the nucleic acid sample;
(D) When none of the primers included in the primer set includes a solid phase carrier, the solid phase carrier is bound to a site capable of binding to the solid phase carrier included in at least one of these primers. And (e) observing the presence or absence of aggregation of the solid phase carrier. When the solid phase carrier aggregation is observed, it is determined that the target nucleic acid is present. A method wherein it is determined that the target nucleic acid is absent if not observed.   14. The method of claim 13, wherein the nucleic acid amplification reaction is performed isothermally.   The method according to claim 13, wherein a DNA polymerase having strand displacement ability is used.   The method according to claim 13, wherein the nucleic acid amplification reaction is performed in the presence of a melting temperature adjusting agent.   The method according to claim 16, wherein the melting temperature adjusting agent is dimethyl sulfoxide, betaine, formamide or glycerol, or a mixture thereof.   A kit for amplifying a target nucleic acid in a template nucleic acid, comprising the primer set according to any one of claims 1 to 7.   19. The kit according to claim 18, further comprising a solid phase carrier when at least one of the primers included in the primer set includes a site capable of binding to the solid phase carrier.   A kit for determining the presence or absence of a target nucleic acid in a nucleic acid sample, comprising the primer set according to any one of claims 1 to 7.   The kit according to claim 20, further comprising a solid phase carrier when at least one of the primers included in the primer set includes a site capable of binding to the solid phase carrier. A nucleic acid amplification kit comprising a primer set comprising two or more primers capable of amplifying a target nucleic acid sequence, and a solid phase carrier or a substrate comprising a site capable of binding to the solid phase carrier,
The first primer included in the primer set comprises a sequence (Ac ′) that hybridizes to the sequence (A) of the 3 ′ end portion of the target nucleic acid sequence at the 3 ′ end portion, and the target nucleic acid sequence The sequence (B ′) hybridizes to the complementary sequence (Bc) of the sequence (B) existing 5 ′ to the sequence (A) in the 5 ′ side of the sequence (Ac ′). A nucleic acid amplification kit.

Images