JP2005106745A - Skin speckle predicting method using speckle site accelerating genes as index, and method of screening skin speckle-formation inhibitor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a skin inspection method for predicting skin speckle formation. <P>SOLUTION: A skin inspection method for predicting skin speckle formation, characterized in that, in the case where the expression of a polynucleotide hybridizable under high stringent conditions with respect to an MCP-2 gene in the epidermis, or a mouse AK012157 gene, a human FLJ21763 gene or a rat S74257 gene is accelerated as compared with the expression thereof in the normal epidermis, the skin inspected is judged to be the skin on which a speckle is easily formed. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a skin examination method for predicting the formation of skin spots.

  When the action of the enzyme tyrosinase in melanocytes (pigmented cells) is activated abnormally due to UV, hormonal imbalance, mental stress, etc., melanin pigments are produced one after another and sent to surrounding epidermal cells. End up. Melanin pigments are produced at a fast pace, and if the turnover is not normal due to the influence of ultraviolet rays etc., the melanin pigments are not discharged to the outside and remain on the skin, resulting in skin spots it is conceivable that.

  If a stain has occurred, it is preferable to clean it as soon as possible.For this purpose, a sensory evaluation of the stain by visual perception (visual) by a beauty technician, a device that uses an imaging device, a colorimeter, etc. Therefore, early determination of the presence or absence of blots is desired (Japanese Patent Laid-Open No. 2003-144393).

Once a stain has been made, it is not easy to remove it, and care is required to improve the skin metabolism, expel unnecessary melanin quickly, and avoid making unnecessary melanin. Therefore, it is preferable to take care of the skin before it is stained. However, since there are individual differences in the ease of stains and the conditions that cause them are various, it is generally difficult to predict that stains will occur. Therefore, if there is a means for predicting whether or not the spot is likely to be spotted before the spot is spotted, it is extremely effective as a spot prevention measure.
M. Naganuma et al., Journal of Dermatological Science 25 (2001) 29-35

  In view of the above problems, the present inventor has eagerly studied whether it is possible to provide a means for predicting whether or not the skin is likely to be stained before the skin is stained. Then, the present inventor stopped ultraviolet irradiation and then stopped the irradiation, and after the sun-like coloration was decolorized, a stain model mouse (M. Naganuma et al. , Journal of Dermatological Science 25 (2001) 29-35), as a result of microarray analysis of the RNA derived from the epidermis of each of the spot site and the non-stain site, the AK012157 gene (SEQ ID NO: 1) in the epidermis of the spot site compared to the non-stain site ) And MCP-2 (Monocyte Chemoattracting Protein 2: Monocyte Chemoattracting Protein-2) genes were found to be specifically enhanced. Therefore, in the human epidermis, it is possible to determine that the skin is easily stained by examining the expression of the FLJ21763 gene (SEQ ID NO: 2) and the MCP-2 gene, which are human genes homologous to the AK012157 gene. It became clear.

  The mouse AK012157 gene is a gene for which only the base sequence of the gene is known and no report has been made on its function (Meth. Enzymol. 303, 19-44 (1999)). Although there is a report that a gene (S74257; SEQ ID NO: 3) approximately 80% homologous to this gene is related to cancer invasion / metastasis in rats (Oncogene, 1994, 9 (12), 3591-3600) There are no skin pigment related reports for this gene. In addition, the existence of a gene (human FLJ21763 gene) approximately 70% homologous to the mouse AK012157 gene is known in humans, but there is no report relating to skin pigment in this gene. In addition, MCP-2 is a kind of chemokine (a small cytokine family with a molecular weight of about 10,000), and MCP-1 in the family reports that non-tumorigenic melanoma cells are formed into tumors through monocyte attraction. (Journal Immunol. Jun 1; 166 (11): 6483-6490), but there are no reports related to skin pigment.

  Therefore, it is a surprising fact that the expression of these genes is enhanced in relation to the stain.

In a first aspect, the present invention provides a skin examination method for predicting skin blemishes formation. This method is characterized in that when the expression of MCP2 in the epidermis is increased as compared with the expression in the normal epidermis, the skin is judged to be susceptible to stain formation. As used herein, “stain” refers to a brown or dark brown planar patch appearing on the skin (Kojien). In particular, the stains described for this stain model mouse mainly refer to senile pigment-like pigment spots.
In a preferred embodiment, the skin blemishes are caused by UVB irradiation.
In a more preferred embodiment, the enhanced expression of MCP2 in the epidermis is determined by measuring the amount of MCP2 in the epidermis.
In a further preferred embodiment, the measurement is performed by ELISA or RIA using an antibody specific for MCP2.
In a more preferred embodiment, the enhanced expression of MCP2 in the epidermis is determined by measuring the amount of mRNA encoding MCP2 extracted from the epidermis.
In a more preferred embodiment, the mRNA is measured by a polymerase chain reaction method.

In a second aspect, the present invention provides a method of screening for a skin stain formation inhibitor and / or a skin stain removal factor. This method is characterized in that a candidate compound is evaluated for the ability to inhibit the expression and / or activity of MCP2, and an MCP2 inhibitor having the inhibitory ability is selected as a skin blemishes formation inhibitor and / or a skin blemishes removal factor. .
In a preferred embodiment, the method further comprises applying an MCP2 inhibitor having the above-mentioned inhibitory ability to a stain formation model animal, and selecting an inhibitor having a skin stain formation inhibitory effect and / or a skin stain removal effect.

In a third aspect, the present invention provides a skin examination method for predicting skin blemishes formation. This method is performed by using a polynucleotide (human FLJ21763 gene) comprising the nucleotide sequence shown in SEQ ID NO: 2 in the epidermis or at least 50, preferably at least 100, more preferably at least 200, particularly preferably at least 400 consecutive nucleotides therein. Expression of a polynucleotide consisting of the sequence of SEQ ID NO: 2, or a polynucleotide consisting of the base sequence shown in SEQ ID NO: 2 in the epidermis (human FLJ21763 gene), a polynucleotide consisting of the base sequence shown in SEQ ID NO: 1 (mouse AK012157 gene) or SEQ ID NO: 3 Or a polynucleotide comprising the nucleotide sequence shown in (Rat S74257 gene) or at least 50, preferably at least 100, more preferably at least 200, particularly preferably at least 400 of them. When the expression of a polynucleotide capable of hybridizing to a polynucleotide comprising a nucleotide sequence under high stringency conditions is increased as compared with the expression in normal epidermis, it is determined that the skin is susceptible to stain formation. It is characterized by that. The human FLJ21763 gene and rat S74257 gene are highly homologous to the mouse AK012157 gene (about 70% and about 80%, respectively). A comparison of mouse AK012157 gene, human FLJ21763 gene and rat S74257 gene is shown in FIGS. Hybridization can be performed according to a well-known method or a method analogous thereto, for example, the method described in J. Sambrook et al., Molecular Cloning 2nd, Cold Spring Harbor Lab. Press, 1989, and high stringency hybridization conditions include, for example, The conditions include that the sodium concentration is about 10 to 40 mM, preferably about 20 mM, and the temperature is about 50 to 70 ° C., preferably about 60 to 65 ° C.
In a preferred embodiment, the skin blemishes are caused by UVB irradiation.
In a further preferred embodiment, the enhanced expression of the polynucleotide in the epidermis is determined by measuring the amount of mRNA complementary to the polynucleotide extracted from the epidermis.
In a more preferred embodiment, the mRNA is measured by a polymerase chain reaction method.

In a fourth aspect, the present invention provides a method of screening for a skin stain formation inhibitor and / or a skin stain removal factor. In this method, a candidate compound is a polynucleotide (human FLJ21763 gene) comprising the base sequence shown in SEQ ID NO: 2 in the epidermis or at least 50, preferably at least 100, more preferably at least 200, particularly preferably at least 400 therein. Expression of a polynucleotide consisting of the sequence of consecutive nucleotides, or a polynucleotide consisting of the base sequence shown in SEQ ID NO: 2 in the epidermis (human FLJ21763 gene), a polynucleotide consisting of the base sequence shown in SEQ ID NO: 1 (mouse AK012157 gene) or A polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 3 (rat S74257 gene) or at least 50, preferably at least 100, more preferably at least 200, particularly preferably at least A polynucleotide comprising a sequence of 00 contiguous nucleotides is evaluated for the ability to inhibit the expression of a polynucleotide capable of hybridizing under high stringency conditions, and an inhibitor having the inhibitory ability is used as a skin stain formation inhibitor and / or It is selected as a skin stain removing factor.
In a preferred embodiment, the method further comprises applying the inhibitor having the above-mentioned inhibitory ability to a stain formation model animal, and selecting an inhibitor having a skin stain formation suppressing effect and / or a skin stain removing effect.

  According to the present invention, it is possible to provide a skin inspection method for predicting the formation of skin spots.

  As described above, there is no skin pigment related report regarding mouse AK012157 gene or rat S74257 gene or human FLJ21763 gene showing high homology to this gene. There are also no skin pigment related reports for mouse and human MCP-2. As a result of microarray analysis of the RNA derived from each of the spot site and the non-stain site of the blot model mouse subjected to ultraviolet irradiation, the present inventor found that the AK012157 gene and the MCP-2 gene in the epidermis of the spot site compared to the non-stain site. It was found that expression was specifically enhanced. In particular, the increased expression of these genes is not limited to the UV irradiation period in the stain model mice, but after the UV irradiation, the bleaching period where the brown color of the epidermis begins to decolorize, and then the stain begins to appear, and the stain begins to appear. It was also observed during the pigment spot formation stage. Since the expression of these genes in the epidermis of the blot model mouse is also increased during the decolorization period, even in humans, if a gene homologous to these genes is used as an index, even in the decolorization period before the stain is formed It will be possible to predict that a spot will be formed in the future.

Blot model mouse Blot model mice can be prepared as described in M. Naganuma et al., Supra. Briefly, for example, mice around 7 weeks old are irradiated with UV light at an intensity of about 99 mJ / cm ² for about 8 weeks under an ultraviolet light source (Toshiba FL-SE; UVB) (UV irradiation period). . During this UV irradiation period, uniform pigmentation of the skin (browning of the skin) will be observed. This pigmentation disappears almost completely in about 2 weeks after the UV irradiation is stopped (decolorization period). Thereafter, small, light brown pigment spots (so-called senile pigment spot-like “stains”) having a diameter of about 2 mm or less begin to appear (pigment spot appearance and formation stage).

The present invention provides a skin test method for predicting skin, preferably human skin stain formation. In this method, the expression of a polynucleotide capable of hybridizing to MCP-2 gene or human FLJ21763 gene in human epidermis or human FLJ21763 gene, mouse AK012157 gene or rat S74257 gene under high stringency conditions is normal. When it is increased compared to the expression, it is judged that the skin is easy to form a stain. As the evaluation criteria, for example, the expression of polynucleotides capable of hybridizing under high stringency conditions in the control epidermis to the MCP-2 gene or human FLJ21763 gene in the epidermis, or to the human FLJ21763 gene, mouse AK012157 gene or rat S74257 gene. 10% or more, or 20% or more, or 30% or more, or 50% or more, or 70% or more, or 100% or more compared to those of the above, it is judged that the skin is easy to stain. , And may be. The skin to be examined may be the epidermis of any part that is easily spotted, such as the face, neck, arms, limbs, etc. The normal epidermis without stain formation, that is, the control epidermis, may be, for example, the epidermis of a part of the same individual that is difficult to be exposed to, for example, ultraviolet rays and is relatively difficult to stain, for example, the epidermis of the abdomen and buttocks.

  Hybridization can be performed according to a well-known method or a method analogous thereto, for example, the method described in J. Sambrook et al., Molecular Cloning 2nd, Cold Spring Harbor Lab. Press, 1989, and high stringency hybridization conditions include, for example, The conditions include that the sodium concentration is about 10 to 40 mM, preferably about 20 mM, and the temperature is about 50 to 70 ° C., preferably about 60 to 65 ° C.

  Enhancement of MCP-2 expression in the epidermis is determined, for example, by measuring the amount of MCP-2 in the epidermis. Preferably, this measurement uses an antibody specific for human MCP-2, and is well known in the art, for example, immunostaining using a fluorescent substance, dye, enzyme, etc., Western blotting, immunoassay, such as Various methods such as ELISA and RIA can be used. It can also be determined by extracting RNA from the epidermis and measuring the amount of mRNA encoding human MCP-2. Extraction of mRNA and measurement of the amount thereof are also well known in the art. For example, RNA is quantified by quantitative polymerase chain reaction (PCR).

  Expression of a polynucleotide capable of hybridizing under high stringency conditions to the human FLJ21763 gene, human FLJ21763 gene, mouse AK012157 gene or rat S74257 gene in the epidermis corresponds to the above-mentioned polynucleotide by extracting RNA from the epidermis It can also be determined by measuring the amount of mRNA. Extraction of mRNA and measurement of the amount thereof are also well known in the art. For example, RNA is quantified by quantitative polymerase chain reaction (PCR).

  As described above, the present invention shows that, as a result of microarray analysis of the RNA derived from the epidermis of each of the blot site and the non-stain site of the blot model mouse subjected to ultraviolet irradiation, the AK012157 gene and MCP in the epidermis of the blot site compared to the non-stain site. -2 based on finding that the expression of the gene is specifically enhanced. Accordingly, the expression of MCP-2 gene in the epidermis and / or the activity of MCP-2 is suppressed, the expression of human FLJ21763 gene in the epidermis is suppressed, or the human FLJ21763 gene, mouse AK012157 gene or rat S74257 gene is highly stringent. It is presumed that it is possible to develop an agent that suppresses and / or removes the formation of skin blots by suppressing the expression of polynucleotides that can hybridize under conditions.

  Accordingly, the present invention provides a pharmaceutical or external composition for skin comprising an inhibitor that inhibits the expression of the above gene as a skin stain formation inhibitor and / or a skin stain remover. The composition according to the present invention can prevent or remove the formation of skin blemishes.

As an inhibitor that inhibits the activity of MCP-2, for example, it corresponds to amino acids 1, 1-2, 1-3, 1-4, or 1-5 of natural MCP-2 described in JP-T-2001-518296 to NH ₂ - lacks terminal amino acids, and amino-terminal truncated version MCP-2 having chemokine antagonistic activity.

Inhibitors of MCP-2 include CCR-1, 3 or 5 receptor antagonists known to bind to MCP-2. CCR-3 receptor antagonists are disclosed in, for example, JP-A Nos. 11-14882, 2002-512957, 2002-512960, 2002-530374, 2002-512957, 2003. No. 510248. As a specific example, for example,
N- {1- (S)-[4- (3,4-dichlorobenzyl) piperazin-1-ylmethyl] -2-methylpropyl} -4-methylbenzamide dihydrochloride;
N- {1- (S)-[4- (3,4-dichlorobenzyl) piperazin-1-ylmethyl] -2,2-dimethylpropyl} -4-methylbenzamide dihydrochloride;
N- {1- (S)-[4- (3,4-dichlorobenzyl) piperidin-1-ylmethyl] -2-methylpropyl} -4-methylbenzamide dihydrochloride;
N- {1- (R)-[4- (3,4-dichlorobenzyl) piperidin-1-ylmethyl] -2-methylpropyl} -4- (2-aminoethyl) benzamide dihydrochloride;
N- {1- (R)-[4- (3,4-dichlorobenzyl) piperidin-1-ylmethyl] -2-methylpropyl} -5-methylthiophene-2-carboxamide hydrochloride;
1- {1- (R)-[4- (3,4-dichlorobenzyl) piperazin-1-ylmethyl] -2-methylpropyl} -3- (3-methoxyphenyl) urea;
1- {1- (R)-[4- (3,4-dichlorobenzyl) piperidin-1-ylmethyl] -2-methylpropyl} -3- (3-methoxyphenyl) urea;
(S) -Ethyl-2- (4-methylbenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (5-dimethylaminonaphthalene-1-sulfonylamino) -3- (4-hydroxy-phenyl) propionate;

(S) -Ethyl-2- (naphthalene-2-sulfonylamino) -3- (4-hydroxyphenyl) propionate: (S) -Ethyl-2- (thiophene-2-sulfonylamino) -3- (4-hydroxy Phenyl) propionate;
(S) -Ethyl-2- (quinoline-8-sulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (2,4,6-trimethylbenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- (4-bromobenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (4-chlorobenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- (4-methoxybenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2-methanesulfonylamino-3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- [2- (E) -styrylsulfonylamino] -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- (3-trifluoromethylbenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (2,5-dichlorothiophene-3-sulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (2-bromobenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- [5- (2-pyridyl) thiophene-2-sulfonylamino] -3- (4-hydroxyphenyl) propionate;

(S) -ethyl-2- (1,3-dimethyl-5-chloro-2-pyrazolin-4-sulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (4-biphenylsulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- (2-nitro-4-methoxybenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (2,5-dichlorobenzenesulfonylamino) -3- [4- (2,5-dichlorobenzenesulfonyloxy) phenyl] propionate;
(S) -Ethyl-2- (2,4-difluorobenzenesulfonylamino) -3- [4- (2,4-difluorobenzenesulfonyloxyphenyl)] propionate;
(S) -Ethyl-2- (5-dimethylaminonaphthalene-1-sulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (thiophene-2-sulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (2,4,6-trimethylbenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- (4-bromobenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (4-chlorobenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- (4-methoxybenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- [2- (E) -styrylsulfonylamino] -3- (4-hydroxyphenyl) propionate;

(S) -Ethyl-2- (3-trifluoromethylbenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (2,5-dichlorothiophene-3-sulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (2-bromobenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- [5- (2-pyridyl) thiophene-2-sulfonylamino] -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- (2-nitro-4-methoxybenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (2,5-dichlorobenzenesulfonylamino) -3- [4- (2,5-dichlorobenzenesulfonyloxy) phenyl] propionate;
(S) -ethyl-2- (2,5-dichlorothiophene-3-sulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (2-bromobenzenesulfonylamino) -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- (2,5-dichlorobenzenesulfonylamino) -3- [4- (2,5-dichlorobenzenesulfonyloxy) phenyl] propionate
(S) -ethyl-2- (1-naphthoylamino) -3- (4-nitrophenyl) propionate;
(S) -isopropyl-2- (1-naphthoylamino) -3- (4-nitrophenyl) propionate;
(S) -methyl-2- (1-naphthoylamino) -3- (4-nitrophenyl) propionate;
(S) -benzyl-2- (1-naphthoylamino) -3- (4-nitrophenyl) propionate;
(S) -ethyl-2- (1-naphthoylamino) -3- (4-chlorophenyl) propionate;

(S) -ethyl-2-benzoylamino-3- (4-hydroxyphenyl) propionate;
(S, S) -ethyl-2- (2-benzyloxycarbonylamino-3-phenylpropionylamino) -3- (4-hydroxyphenyl) propionate;
(S, S) -ethyl-2- (N-acetylpyrrolidine-2-benzoylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2-cyclohexanylamino-3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (3,3-diphenylpropionylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (3-phenylpropionylamino) -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- [2- (2-naphthyl) acetylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (4-phenylbutyrylamino) -3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2-pentanylamino-3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2-pentanylamino-3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (4-benzoylbenzoylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (2-furanyl) amino-3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- (1-naphthoylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (5-hydroxyindonyl) amino-3- (4-hydroxyphenyl) propionate;

(S) -ethyl-2-piperonylamino-3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2-picolinylamino-3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- (3-nitro-4-chlorobenzoylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (3-hydroxy-4-nitrobenzoylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2- (8-quinolinylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2-benzoylamino-3-phenylpropionate;
(S) -methyl-2-benzoylamino-3- (4-hydroxyphenyl) propionate;
(S) -Benzyl-2-benzoylamino-3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2-benzoylamino-3- (4-methoxyphenyl) propionate;
(S) -ethyl-2-tert-butyloxycarbonylamino-3- (4-nitrophenyl) propionate;
(S) -ethyl-2-tert-butyloxycarbonylamino-3- (4-aminophenyl) propionate;
(S) -ethyl-2-benzoylamino-3- (3,5-diiodo-4-hydroxyphenyl) propionate;
(S) -Ethyl-2-carboxybenzoylamino-3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2-benzoylamino-3- (1-naphthyl) propionate;
(±) -ethyl-2-benzolylamino-3- [3- (benzoyloxy) phenyl] propionate;
(±) -ethyl-2-benzoylamino-3- (3-hydroxyphenyl) propionate;

(R, S) -ethyl-2-benzoylamino-3- (2-hydroxylphenyl) propionate;
(S) -ethyl-2-benzoylamino-3- (4-aminophenyl) propionate;
(S) -ethyl-2-benzoylamino-3- (4-nitrophenyl) propionate;
(S) -ethyl-2- (2-phenylacetylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2-benzoylamino-3- (3-indoyl) propionate;
(±) -ethyl-2- (benzoylamino) -2-phenylacetate;
(±) -ethyl-2- (benzoylamino) -4-phenylbutyrate;
(S) -ethyl-2- (1-naphthoylamino) -3- (4-nitrophenyl) propionate;
(S) -ethyl-2-benzoylamino-3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2-cyclohexanylamino-3- (4-hydroxyphenyl) propionate;
(S) -Ethyl-2- (1-naphthoylamino) -3- (4-hydroxyphenyl) propionate;
(S) -Benzyl-2-benzoylamino-3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2-benzoylamino-3- (4-methoxyphenyl) propionate;
(S) -ethyl-2-benzoylamino-3- (1-naphthyl) propionate;
(±) -ethyl-2-benzolylamino-3- [3- (benzoyloxy) phenyl] propionate;
(±) -ethyl-2-benzoylamino-3- (3-hydroxyphenyl) propionate;
(R, S) -ethyl-2-benzoylamino-3- (2-hydroxylphenyl) propionate;
(S) -ethyl-2-benzoylamino-3- (4-nitrophenyl) propionate;

(±) -ethyl-2- (benzoylamino) -2-phenylacetate;
(±) -ethyl-2- (benzoylamino) -4-phenylbutyrate;
(S) -ethyl-2- (1-naphthoylamino) -3- (4-nitrophenyl) propionate;
(S) -Ethyl-2- (1-naphthoylamino) -3- (4-hydroxyphenyl) propionate;
(S) -ethyl-2-benzoylamino-3- (4-nitrophenyl) propionate.

CCR-1 receptor antagonists include, for example, published patent applications WO 97/24325; Pfizer, Inc. WO 98/38167 by Teijin Ltd .; WO 97/44329 by Teijin Ltd .; WO 98/04554 by Eri Pharmaceutical Co. Ltd .; Merck & Co. , Inc. WO 98/27815, WO 98/25604, WO 98/25605, WO 98/25617 and WO 98/31364; LeukoSite, Inc. WO 98/02151 and WO 99/37617; LeukoSite, Inc. WO 99/37651 and WO 99/37619; US Provisional Patent Application No. 60 / 021,716 (filed July 12, 1996); US Patent Application Nos. 09 / 146,827 and 09 / No. 148,236 (filed Sep. 4, 1998); Hesselgersser et al. Biol. Chem. 273 (25): 15687-15692 (1998); and Howard et al., J. Biol. Medicinal Chem. 41 (13): 2184-2193 (1998).
Examples of the antagonist of CCR-5 receptor include those described in JP-T-2002-543186.

  The pharmaceutical or external composition for skin of the present invention is applied in the form of, for example, an aqueous solution, oil solution, other solution, emulsion, cream, gel, suspension, microcapsule, powder, granule, capsule, solid preparation and the like. After preparing into these forms by a conventionally known method, a lotion preparation, emulsion, cream, ointment, plaster, haptic agent, aerosol, water-oil two-layer system, water-oil-powder three-layer As a system, injection, internal preparation (tablet, powder, granule, pill, syrup, troche, etc.), suppository, etc., it can be applied to the body, pasted, sprayed, injected, drunk, inserted. In the composition, the inhibitor is used as a skin stain formation inhibitor and / or a skin stain removal factor, without particular limitation, and based on the total amount of the composition, for example, 0.001 mM to 1 M, preferably 0.01 to 100 mM, more preferably It will contain about 0.1-10 mM.

  Among these dosage forms, external preparations for skin such as lotion preparations, emulsions, creams, ointments, plasters, haps, and aerosols are suitable for the purposes of the present invention. The topical skin preparations listed here include pharmaceuticals, quasi-drugs (ointments, etc.), cosmetics [basic cosmetics such as facial cleansers, emulsions, creams, gels, essences (beauty serums), packs, masks, etc .; foundations Makeup cosmetics such as lipsticks; oral cosmetics, aromatic cosmetics, hair cosmetics, body cosmetics, etc.]. In particular, the pharmaceutical or external composition for skin of the present invention is preferably applied as a cosmetic for preventing stains.

  In the pharmaceutical or skin external composition of the present invention, conventionally known excipients and fragrances according to the desired dosage form, fats and oils, surfactants, preservatives, sequestering agents, water-soluble polymers , Powder components such as thickeners and pigments, UV protection agents, humectants, antioxidants, pH adjusters, cleaning agents, desiccants, emulsifiers and the like are appropriately blended. Furthermore, it is possible to mix | blend this other medicinal component with the pharmaceutical or external composition for skin within the range which does not impair the effect by the mixing | blending.

Method for Screening Skin Blot Formation Suppressing Factor and / or Skin Blemish Removal Factor The present invention further provides a method for screening a skin blemishes formation inhibiting factor and / or skin blemishes removal factor. In this method, the candidate compound suppresses the expression and / or activity of MCP-2 in the epidermis, or the expression of a polynucleotide capable of hybridizing to the human FLJ21763 gene, mouse AK012157 gene or rat S74257 gene under high stringency conditions. It is characterized by evaluating the ability to suppress skin and selecting an inhibitor having the inhibitory ability as a skin stain formation inhibiting factor and / or a skin stain removing factor.
In a preferred embodiment, the screening method further comprises applying an inhibitor having the inhibitory ability to a stain model animal, and selecting an inhibitor having a skin stain formation suppressing effect and / or a skin stain removing effect.

  The step of confirming the inhibitory effect on the formation and / or removal of the skin stain of the inhibitor can be carried out using a stain model animal such as a stain model mouse. In addition to mice, various animals such as rats and rabbits can be used. In a preferred embodiment, the presence or absence of the above-described effect can be determined by preparing a solution of this inhibitor, for example, an aqueous solution, and repeatedly applying it to the skin of a skin blot model animal and evaluating the formation of the stain.

  Hereinafter, the present invention will be described more specifically with specific examples. In addition, this invention is not limited by this.

Preparation of a blot model mouse A blot model mouse was prepared as described in M. Naganuma et al., Supra. Briefly, 7-week-old mice were irradiated with ultraviolet rays at an intensity of 99 mJ / cm ² three times a week for 8 weeks under an ultraviolet light source (Toshiba FL-SE; UVB) (UV irradiation period). Between 15 and 23 weeks of age (up to about 8 weeks after the end of the UV irradiation period), and during the period of 23 to 35 weeks of age (about 18 to 30 weeks after the end of the UV irradiation period) The pigmentation appearance period was reached, and the pigmentation formation period was reached between 35 and 52 weeks of age (about 30 to 47 weeks after the end of the UV irradiation period).

RNA collection from the skin The entire skin layer of the back of the mouse is collected, the fat layer is removed, the epidermis is peeled off by heating, the RNA is extracted by ISOGEN (Nippon Gene, manufacturer recommended protocol), and purified by RNeasy (Qiagen) did. The dermis was cut into 1-centimeter squares, frozen with liquid nitrogen, crushed, extracted with ISOGEN (Nippon Gene, manufacturer recommended protocol), and purified with RNeasy (Qiagen). RNA was run on a TBE agarose gel and stained with SYBR green (Moleculer probes) to confirm the quality and purity.

  Samples in the UV irradiation period were collected from mice at about 10 weeks of age, and controls for this sample were collected from mice at about 14 weeks of age. Samples in the decolorization period were collected from mice at about 20 weeks of age, and controls for this sample were also collected from mice at about 20 weeks of age. Samples at the pigmentation stage were collected from mice at about 42 weeks of age and controls for this sample were collected from mice at about 40 weeks of age.

Affymetrix GeneChip was used for reaction microarray analysis of microarray samples .
Sample preparation for Affymetrix Inc. Reaction was carried out according to the Affymetrix recommended protocol. 10 μg of RNA was reacted with oligo-dT primer (24mer) and 100 pmol (Sigma) at 70 ° C. for 10 minutes. Thereafter, 4 μl of 5 × first strand reaction buffer, 2 μl of 0.1M DTT, 1 μl of 10 mM dNTP mix, and 2 μl of Superscript II (all from Invitrogen) were added and reacted at 42 ° C. for 1 hour. Rnase-free water 91 μl, 5 × second strand reaction buffer 30 μl, 10 mM dNTP mix 3 μl, 10 U / μl E. coli DNA ligase 1 μl, 10 U / μl E. coli DNA polymerase I 4 μl, 2 U / μl Rnase H 1 μl (All from Invitrogen) were added and reacted at 16 ° C. for 2 hours. Furthermore, 2 μl (10 U / μl) of T4 DNA polymerase (Invitrogen) was added and reacted at 16 ° C. for 5 minutes, and then 10 μl of 0.5 M EDTA was added to stop the reaction. It was cleaned up using Phase Lock Gels (Qiagen) and eluted in 12 μl of Rnase-free water. Biotin-added cRNA was prepared from the obtained cDNA by in vitro transcription reaction (Enzo, Farmingdale) and purified by RNeasy (Qiagen). The cRNA was fragmented in fragmentation buffer at 94 ° C. for 35 minutes and then used for gene chip hybridization. After the chip was washed, data was read with an Affymetrix scanner.

As a result of comprehensive analysis of the expression of about 9,000 genes, it was found that the expression of the AK012157 gene and the MCP-2 gene was significantly enhanced in the epidermis of the blot model mouse compared to the epidermis of the control mouse. It was issued. Interestingly, the increase in the expression of these genes is not limited to the UV irradiation period, but when the UV irradiation is finished, the brown color of the epidermis begins to decolorize due to UV irradiation, and then stains begin to appear and stains are formed. It was always observed even during the pigmentation stage. Since the expression of these genes in the epidermis of a blot model mouse is also increased in the decolorization period before the blotting occurs, if these genes are used as an index, the future stains will also occur in the decolorization period before the stain is formed. It can be predicted that it will be formed. The results are shown in the following table.

RT-PCR
1 μg of each RNA (skin site, non-spot site epidermis or dermis) collected from the skin was reacted with oligo-dT primer (24mer) 100 pmol (Sigma) at 70 ° C. for 10 minutes (total volume 20 μl). Thereafter, 4 μl of 5 × first strand reaction buffer, 2 μl of 0.1M DTT, 4 μl of 2.5 mM dNTP mix, and 1 μl of Superscript II (all invitrogen) were added and reacted at 42 ° C. for 1 hour. Finally, the reaction was allowed to extend at 70 ° C. for 10 minutes to prepare a cDNA template. 10 μl buffer for rTaq 5 μl, 25 mM MgCl ₂ 3 μl, 2.0 mM dNTP mix 5 μl, rTaq 0.5 μl (all TOYOBO), ddH ₂ O 33.5 μl, cDNA template 1 μl, primer (see sequence below), sense and antisense 1 μl of 20 mM (total volume of 50 μl) was added, and PCR reaction was performed (94 ° C. for 2 minutes, (94 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. for 1 minute) for 30 cycles, 72 ° C. for 10 minutes).

MCP-2 primer sequence Sense TTCTTTGCCTGCTGCTCATA (SEQ ID NO: 4)
Antisense GACAAGGATGAGAAAACACG (SEQ ID NO: 5)
AK012157 Primer sequence Sense ACTCCGGCTCCTTCACTATG (SEQ ID NO: 6)
Antisense CTTTGGAATGAGGACTTGGA (SEQ ID NO: 7)

  Finally, electrophoresis was performed on an agarose gel containing 1.5% ethidium bromide to obtain a band of about 300 bp. The result is shown in FIG. As is clear from FIG. 3, it was found that the AK012157 gene and the MCP-2 gene were remarkably expressed in the spot site of the epidermis and hardly expressed in the non-stain site of the epidermis. In addition, there was no difference in expression in the dermis.

in situ hybridization (ISH)
The mouse skin tissue was fixed with 10% neutral formalin, embedded in paraffin, and a tissue section slide was prepared according to a conventional method. This was subjected to an in situ hybridization reaction using a Ventana HX system automatic slide processor (protocol: Japan open blue 8.0). As a pretreatment, the tissue section was blocked, treated with protease, and hybridized with 500 ng of a Dig-labeled riboprobe prepared from the AK012157 sequence using T7 polymerase at 68 ° C. for 6 hours. Thereafter, the plate was washed and reacted with Anti-Dig-alkaline phosphatase, washed, colored with the substrate NBT / BCIP, encapsulated, and observed with an optical microscope.
The result is shown in FIG. As is clear from FIG. 4, it was recognized that the AK012157 gene was remarkably expressed in the spot site of the epidermis and hardly expressed in the non-stain site of the epidermis.

Immunohistochemical staining (IHC)
The mouse skin tissue was fixed with neutral formalin and embedded in paraffin, and tissue sections were prepared according to a conventional method. This was treated with 1% H ₂ O ₂ for 15 minutes, then blocked for 30 minutes, and a 1/50 dilution of anti-mouse MCP2 antibody (R & D Systems) was reacted overnight. This was detected by a tyramide sensitization (TSA system, Perkin Elmer) kit. After washing, the HRP secondary antibody was reacted and washed, and FITC-labeled tyramide was reacted and washed, embedded, and observed with a fluorescence microscope.

  The result is shown in FIG. As is clear from FIG. 5, it was recognized that the MCP-2 gene was remarkably expressed in the spot site of the epidermis and hardly expressed in the non-stain site of the epidermis.

Comparison of mouse AK012157 gene, human FLJ21763 gene and rat S74257 gene. Continuation of FIG. The expression of AK012157 gene and MCP-2 gene in the epidermis and dermis of a blot model mouse by PCR is shown. The expression of the AK012157 gene in the epidermis of a blot model mouse by in situ hybridization is shown. The expression of MCP-2 in the epidermis of a blot model mouse | mouth by immunohistochemical staining is shown.

Claims (13)

  A skin test method for predicting skin blemishes, where the expression of MCP2 (Monocyte Chemoattracting Protein 2: Monocyte Chemoattracting Protein-2) in the epidermis is higher than that in normal epidermis A method characterized by judging that the skin is easy to form a stain.   The method of claim 1, wherein the skin blemishes are caused by UVB irradiation.   The method according to claim 1 or 2, wherein the enhanced expression of MCP2 in the epidermis is determined by measuring the amount of MCP2 in the epidermis.   The method according to claim 3, wherein the measurement is performed by ELISA or RIA using an antibody specific for MCP2.   The method according to any one of claims 1 to 4, wherein the enhanced expression of MCP2 in the epidermis is determined by measuring the amount of mRNA encoding MCP2 extracted from the epidermis.   The method according to claim 5, wherein the mRNA is measured by a polymerase chain reaction method.   A method for screening a skin stain formation inhibitor and / or a skin stain removal factor, wherein a candidate compound is evaluated for its ability to inhibit the expression and / or activity of MCP2, and an MCP2 inhibitor having the inhibitory ability is inhibited. A method characterized in that it is selected as a factor and / or a skin stain removal factor.   The method according to claim 7, further comprising applying the MCP2 inhibitor having the inhibitory ability to a stain formation model animal, and selecting an inhibitor having a skin stain formation inhibitory effect and / or a skin stain removal effect.   A skin test method for predicting skin blemishes, which is capable of hybridizing under high stringency conditions to a polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 2 in the epidermis (human FLJ21763 gene) or the polynucleotide. A polynucleotide, a polynucleotide comprising the base sequence shown in SEQ ID NO: 1 in the epidermis (mouse AK012157 gene), which can hybridize under high stringency conditions, or a base sequence shown in SEQ ID NO: 3 in the epidermis When the expression of a polynucleotide that can hybridize to a polynucleotide (rat S74257 gene) under high stringency conditions is increased compared to the expression in normal epidermis, it is determined that the skin is likely to be stained. That How to butterflies.   10. The method of claim 9, wherein the skin blemishes are caused by UVB irradiation.   The method according to claim 9 or 10, wherein the enhanced expression of the polynucleotide in the epidermis is determined by measuring the amount of mRNA complementary to the polynucleotide extracted from the epidermis.   A method for screening for a skin stain formation inhibitor and / or a skin stain removal factor, wherein the candidate compound is a polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 2 in the epidermis (human FLJ21763 gene) or a high stringency to the polynucleotide A polynucleotide capable of hybridizing under a gentle condition, a polynucleotide capable of hybridizing under a highly stringent condition to a polynucleotide comprising the base sequence shown in SEQ ID NO: 1 in the epidermis (mouse AK012157 gene), or a sequence in the epidermis The ability to inhibit the expression of a polynucleotide capable of hybridizing under high stringency conditions to the polynucleotide comprising the nucleotide sequence shown in No. 3 (rat S74257 gene) was evaluated and possessed the inhibitory ability. Wherein the selecting a that inhibitors as skin spots forming inhibitors and / or skin stain removal factor.   The method according to claim 12, further comprising applying the inhibitor having the inhibitory ability to a stain formation model animal, and selecting an inhibitor having a skin stain formation suppressing effect and / or a skin stain removing effect.

Images