JP2005095022A - Method for producing optically active alcohol - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new carbonyl-reducing enzyme useful for producing an optically active alcohol. <P>SOLUTION: This new carbonyl-reducing enzyme having a property for reducing 2,3'-dichloroacetophenone to produce >90 % ee (R)-2,3'-dichloro-1-phenylethanol. A vector for expressing the enzyme, and a transformant transduced with the vector. A method for producing the optically active alcohol having a high optical purity. The new carbonyl-reducing enzyme is provided, whereby the optically active alcohol having a high optical purity can be synthesized. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a novel carbonyl reductase useful for the production of an optically active alcohol, a method for producing an optically active alcohol with high optical purity using the enzyme, and the like.

  Optically active alcohols are useful as synthetic intermediates for various medical and agricultural chemicals. This is because optical isomers may have different physiological activities. For example, when only one of the enantiomers shows effective physiological activity, the coexistence of both causes the other isomer to simply have activity. In addition to the problem of not having it, it may cause competitive inhibition against an effective enantiomer. Therefore, how to obtain (synthesize or split) an optically pure enantiomer is an important industrial issue.

  For this problem, a method of synthesizing a racemate and effectively optically resolving it is widely used. However, in the method based on the division after the synthesis, since the antipodes that are not intended are always synthesized as by-products, there remains a problem in terms of effective use of raw materials. Even if the recovered by-product is recycled as a raw material, the synthesis of a constant amount of by-product is always repeated. Therefore, optical resolution by an enzymatic method that does not produce a by-product or a large amount of waste liquid has attracted attention. The optical resolution by the enzyme method is a method for specifically generating a necessary enantiomer using the specificity of the enzyme. Since the synthesis of an unnecessary enantiomer can be suppressed to a low level, a product excellent in optical purity can be easily obtained. It is also advantageous in terms of effective use of raw materials.

Among optically active alcohols, optically active α-halophenylethanol derivatives are compounds that can be very easily derived into optically active styrene oxide derivatives that are useful as raw materials or synthetic intermediates for various pharmaceuticals and agricultural chemicals. Active metachlorostyrene oxide is a very important compound as a synthetic intermediate of a β3 adrenoceptor agonist. As an enzymatic method for producing (R) -2,3′-dichloro-1-phenylethanol derived from this optically active metachlorostyrene oxide, asymmetric reduction using microbial cells such as yeast and bacteria ( JP-A-4-218384, JP-A-11-215995, JP-A-2003-290, and Japanese Patent Application 2002-109916) are known. However, these reactions are reactions utilizing wild-type microorganisms, and have problems such as low optical purity and low accumulated concentration. As a means for solving this, substance production by genetically modified bacteria using genetic engineering techniques can be mentioned. For this purpose, it is necessary to find an enzyme capable of asymmetric reduction of a carbonyl compound to produce alcohol with high optical purity, and to create a gene recombinant that can be expressed efficiently. As an example of this, there have been reports on the production of (R) -2,3′-dichloro-1-phenylethanol by Escherichia coli expressing a phenylacetaldehyde reductase derived from Corynebacterium sp. ST-10 (Eur. J Biochem. 269, 2394-2402 (2002)).
JP-A-4-218384 JP 11-215995 JP2003-290 Japanese Patent Application 2002-109916 Eur. J. Biochem. 269, 2394-2402 (2002)

  The present invention relates to a novel carbonyl reductase useful for the production of optically active alcohols, a vector capable of expressing the enzyme at a high level, a host cell introduced with the vector, a method for producing the enzyme, and the use of the enzyme It is an object of the present invention to provide a method for producing an optically active alcohol having high optical purity. The present invention is particularly useful for producing (R) -2,3′-dichloro-1-phenylethanol.

  In order to solve the above-mentioned problems, the present inventors considered using a carbonyl reductase derived from Streptomyces. And we focused on an amino acid sequence (AL939131-111) encoded by ORF estimated by the genome project of Streptomyces coelicolor. The amino acid sequence of this ORF showed 65% homology with the amino acid sequence of Corynebacterium sp. ST-10-derived phenylacetaldehyde reductase. However, this ORF is only presumed as a result of the genome project, and whether this ORF encodes an active protein and its ability to reduce ketones and produce high optical purity alcohols. It was unclear as to whether or not to have it. Thus, as a result of intensive studies on the protein encoded by this gene, the present inventors succeeded for the first time in expressing and recovering a protein having carbonyl reduction activity from this gene. Furthermore, the present inventors show that the expressed protein reduces 2,3′-dichloroacetophenone and produces (R) -2,3′-dichloro-1-phenylethanol with extremely high optical purity. I found it. According to the present invention, it is possible to produce an optically active alcohol with high purity by allowing the present protein to act on a ketone such as 2,3′-dichloroacetophenone.

That is, the present invention relates to a novel carbonyl reductase derived from Streptomyces, a vector containing the enzyme, and a transformant thereof. Furthermore, this invention relates to the manufacturing method of the optically active alcohol using this enzyme. The present invention is more specifically [1] a carbonyl reductase comprising the protein according to any one of the following (a) to (e) and having the physicochemical properties shown in the following (i) and (ii);
(A) a protein encoded by a polynucleotide comprising the base sequence set forth in SEQ ID NO: 1.
(B) A protein comprising the amino acid sequence set forth in SEQ ID NO: 2.
(C) A protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted, and / or added in the amino acid sequence set forth in SEQ ID NO: 2.
(D) A protein comprising an amino acid sequence having 70% or more homology with the amino acid sequence set forth in SEQ ID NO: 2.
(E) a protein encoded by a polynucleotide that hybridizes under stringent conditions with a polynucleotide comprising a complementary sequence of the nucleotide sequence set forth in SEQ ID NO: 1.
(I) Action The reduced β-nicotinamide adenine dinucleotide is used as a coenzyme to reduce the ketone to produce (S) alcohol.
(Ii) Substrate specificity Reduction of 2,3′-dichloroacetophenone to produce (R) -2,3′-dichloro-1-phenylethanol with asymmetric selectivity greater than 70% (> 70% ee) To do.
[2] A vector encoding the carbonyl reductase according to [1];
[3] The vector of [2], which expresses the enzyme in at least one bacterium belonging to the genus Streptomyces;
[4] The vector according to [2] or [3], wherein the vector comprises DNA in which the DNA encoding the enzyme is operably linked downstream of the promoter of the L11 protein gene;
[5] A transformant transformed with the vector according to [2];
[6] The transformant according to [5], which belongs to the genus Streptomyces;
[7] A method for producing a carbonyl reductase, comprising a step of culturing the transformant according to [5] or [6] and recovering the expressed carbonyl reductase;
[8] The carbonyl reductase according to [1], a transformant transformed with a vector encoding the enzyme, or a treated product of the transformant is brought into contact with a ketone, and the optically active alcohol produced is collected. A method for producing an optically active alcohol comprising a step.

  According to the present invention, a novel carbonyl reductase that generates an optically active alcohol is provided. Further, according to the present invention, a vector containing the enzyme and a transformant are provided. This enzyme has the property of reducing 2,3′-dichloroacetophenone to produce> 70% ee (R) -2,3′-dichloro-1-phenylethanol. According to the present invention, a method for producing an optically active alcohol having a high optical purity becomes possible.

  The present invention relates to a carbonyl reductase comprising the amino acid sequence set forth in SEQ ID NO: 2. The present invention also includes a protein homologue consisting of the amino acid sequence set forth in SEQ ID NO: 2. The homologue of the carbonyl reductase of the present invention includes an amino acid sequence in which one or more amino acids are deleted, substituted, inserted and / or added to the amino acid sequence described in SEQ ID NO: 2, and is described in SEQ ID NO: 2. A protein functionally equivalent to a protein consisting of the amino acid sequence of In the amino acid sequence shown in SEQ ID NO: 2, for example, mutation of amino acid residues of 100 or less, usually 50 or less, preferably 30 or less, more preferably 15 or less, still more preferably 10 or less, or 5 or less is allowed. In general, in order to maintain the function of a protein, the amino acid to be substituted is preferably an amino acid having properties similar to the amino acid before substitution. Such substitution of amino acid residues is called conservative substitution. For example, Ala, Val, Leu, Ile, Pro, Met, Phe, and Trp are all classified as nonpolar amino acids, and thus have similar properties to each other. Further, examples of the non-chargeability include Gly, Ser, Thr, Cys, Tyr, Asn, and Gln. Moreover, Asp and Glu are mentioned as an acidic amino acid. Examples of basic amino acids include Lys, Arg, and His. Amino acid substitutions within each of these groups are allowed.

In the present invention, functionally equivalent to the protein consisting of the amino acid sequence shown in SEQ ID NO: 2 means that the protein has the following physicochemical properties.
(1) Action The reduced β-nicotinamide adenine dinucleotide is used as a coenzyme to reduce the ketone to produce (S) alcohol.
(2) Substrate specificity 2,3′-dichloroacetophenone is reduced to produce> 70% ee (R) -2,3′-dichloro-1-phenylethanol.

Preferably, the protein of the present invention is a protein capable of producing an optically active alcohol having an optical purity higher than 75% ee, desirably higher than 80% ee, more preferably higher than 90% ee using a ketone as a substrate. is there. The optical purity of the product can be confirmed by analyzing the reaction product with an optical resolution column or the like.
The “optically active alcohol” in the present invention means an alcohol containing a certain optical isomer more than another optical isomer, or an alcohol consisting of only a certain optical isomer. Furthermore, the “optical isomer” of the present invention may be generally referred to as “optically active form” and “enantiomer”.
Therefore, an enzyme that can generate an optically active alcohol by asymmetric reduction of a ketone is defined as an enzyme that can generate a corresponding optically active alcohol when a certain ketone compound is used as a substrate.

  A person skilled in the art can perform site-directed mutagenesis (Nucleic Acid Res. 10, pp. 6487 (1982), Methods in Enzymol. 100, pp. 448 (1983), Molecular Cloning 2ndEdt., Cold Spring Harbor Laboratory Press (1989), PCR A Practical Approach IRL Press pp.200 (1991)), etc., to introduce the substitution, deletion, insertion, and / or addition mutation as appropriate. A polynucleotide encoding a reductase homolog can be obtained. The carbonyl reductase homologue described in SEQ ID NO: 2 can be obtained by introducing a polynucleotide encoding the carbonyl reductase homologue into a host and expressing it.

  Furthermore, the homologue of the carbonyl reductase of the present invention is at least 70%, preferably at least 80%, more preferably 85% or more, more preferably 90% or more, more preferably the amino acid sequence shown in SEQ ID NO: 2. A protein having a homology of 95% or more. The identity of the amino acid sequences can be calculated as the ratio of the matching amino acids to the total length of SEQ ID NO: 2 by aligning the two sequences to be compared with appropriate gaps so that the amino acids match as much as possible. For alignment of amino acid sequences, a desired computer program can be used. For example, CLUSTAL W (Higgins, D. et al. (1994) Nucleic Acids Res. 22: 4673-4680) or BLAST (National Center) for Biothchnology Information). The gap is handled in the same manner as the mismatched amino acid, and the identity is determined as the ratio of the number of amino acids matching the both sequences out of the total number of amino acids (including the gap). However, if a gap is inserted at the same position in both sequences, the gap is excluded from the calculation.

  Protein homology search is specifically performed by BLAST (National Center for Biothchnology Information, Altschul, SF et al., 1990, J. Mol. Biol. 215: 403-410), FASTA (WR Pearson and DJ Lipman. Proc. Natl. Acad. Sci. USA, 85: 2444-448, 1988) can be used for various amino acid sequence databases and DNA databases. For example, a database related to amino acid sequences of proteins such as DAD, SWISS-PROT, and PIR, a database related to DNA sequences such as DDBJ, EMBL, and Genebank, and a database related to predicted amino acid sequences based on DNA sequences may be used. it can. Any of these databases can be used through the Internet.

  Using the amino acid sequence described in SEQ ID NO: 2, a homology search was performed using the BLAST program for DAD. As a result, no protein having an identity of 70% or more was found. The homology to Rhodococcus ruber secondary alcohol dehydrogenase, which showed the highest homology, was calculated using the Maximum Matching program of Genetyx-win (Software Development Co., Ltd.) software (J. Biochem., 92 , 1173-1177 (1984)), and the result was 66%. The homology of 70% or more of the present invention represents, for example, a homology value using the Maximum Matching program.

  The carbonyl reductase of the present invention can bind an additional amino acid sequence as long as it has an activity functionally equivalent to the protein consisting of the amino acid sequence shown in SEQ ID NO: 2. For example, tag sequences such as histidine tags and HA tags can be added. Alternatively, it can be a fusion protein with another protein. The carbonyl reductase of the present invention or a homologue thereof may be a fragment as long as it has an activity functionally equivalent to the protein consisting of the amino acid sequence shown in SEQ ID NO: 2.

The polynucleotide (which may be DNA or RNA) encoding the carbonyl reductase of the present invention can be isolated, for example, by the following method.
For example, a DNA primer encoding the carbonyl reductase of the present invention is designed by designing a primer for PCR based on the base sequence described in SEQ ID NO: 1 and performing PCR using a chromosomal DNA of an enzyme production strain or a cDNA library as a template. Can be obtained.
Furthermore, using the obtained DNA fragment as a probe, a restriction enzyme digest of a chromosomal DNA of an enzyme producing strain is introduced into a phage, plasmid, etc., and a library or cDNA library obtained by transforming E. coli is used. The polynucleotide encoding the carbonyl reductase of the present invention can be obtained by colony hybridization, plaque hybridization and the like.
The polynucleotide encoding the carbonyl reductase of the present invention includes genomic DNA cloned by the above method, or DNA obtained by synthesis in addition to cDNA.

  In hybridization, a nucleic acid (DNA or RNA) consisting of a complementary sequence of SEQ ID NO: 1 or a partial sequence thereof is used as a probe, the target nucleic acid is hybridized, and the probe is washed after washing under stringent conditions. Check if it is significantly hybridized to the nucleic acid of interest. The length of the probe is, for example, continuous 20 bases or more, preferably 25 bases or more, more preferably 30 bases or more, more preferably 40 bases or more, more preferably 80 bases or more, more preferably 100 bases or more (for example, SEQ ID NO: 1 full length). If the probe contains an irrelevant sequence (such as a vector-derived sequence) other than SEQ ID NO: 1 or its complementary sequence, hybridization is performed in the same manner using only that sequence as a probe as a negative control. After washing, it may be confirmed that the probe does not significantly hybridize to the target sequence. Hybridization can be performed by a conventional method using nitrocellulose membrane or nylon membrane (Sambrook et al. (1989) Molecular Cloning, Cold Spring Harbor Laboratories; Ausubel, FM et al. (1994) Current. Protocols in Molecular Biology, Greene Publisher Associates / John Wiley and Sons, New York. NY).

  Specific examples of hybridization stringent conditions include, for example, 6 × SSC, 0.5% (W / V) SDS, 100 μg / ml denatured salmon sperm DNA, 5 × Denhardt solution (1 × Denhardt solution is 0.2% poly In a solution containing vinylpyrrolidone, 0.2% bovine serum albumin, and 0.2% ficoll), hybridization is performed overnight at 45 ° C, preferably 55 ° C, more preferably 60 ° C, and even more preferably 65 ° C. The subsequent washing is a condition in which 4 × SSC, 0.5% SDS, and 20 minutes are washed three times at the same temperature as the hybridization. More preferably, the post-hybridization washing is performed under the same conditions as washing at 4 × SSC, 0.5% SDS, 20 minutes twice, 2 × SSC, 0.5% SDS, 20 minutes once at the same temperature as the hybridization. is there. More preferably, the conditions are such that washing after hybridization is performed twice at 4 × SSC, 0.5% SDS, 20 minutes, followed by 1 × SSC, 0.5% SDS, 20 minutes at the same temperature as hybridization. . More preferably, post-hybridization washing is performed at the same temperature as the hybridization, 2 × SSC, 0.5% SDS, 20 minutes once, followed by 1 × SSC, 0.5% SDS, 20 minutes once, then 0.5 × SSC, 0.5% SDS, 20 minutes once. More preferably, post-hybridization washing is performed at the same temperature as the hybridization, 2 × SSC, 0.5% SDS, 20 minutes once, followed by 1 × SSC, 0.5% SDS, 20 minutes once, then 0.5 This is a condition in which × SSC, 0.5% SDS, 20 minutes once, followed by 0.1 × SSC, 0.5% SDS, 20 minutes once.

  By inserting the isolated polynucleotide encoding the carbonyl reductase according to the present invention into the expression vector, a carbonyl reductase expression vector is provided.

The present invention also relates to a transformant carrying the vector of the present invention so that it can be expressed.
In order to express carbonyl reductase in the present invention, a microorganism to be transformed is transformed with a recombinant vector containing a polynucleotide encoding a polypeptide having carbonyl reductase and expresses carbonyl reductase activity. There is no particular limitation as long as it is an organism that can be used. Examples of the microorganisms that can be used include the following microorganisms.
Streptomyces spp.Rhodococcus sp. Corynebacterium genus Streptococcus genus Lactobacillus genus Bacteria whose host vector system has been developed Saccharomyces genus Kluyveromyces genus Saccharomyces genus Yarrowia genus Trichosporon genus Rhodosporidium genus Pichia genus Candida genus Yeast Neurospora genus Neurospora genus (Aspergillus) genus Pharos poly Um (Cephalosporium) genus Trichoderma (Trichoderma) mold that has been developed host vector system such as the genus

Gene expression from actinomycetes is often difficult. The actinomycetes gene has a high GC content, and the codon usage is also biased. It is also expected that RNA has a complex higher order structure. Therefore, when a gene derived from actinomycetes is expressed in a host of another genus, for example, E. coli, the protein may not be expressed. In fact, in the present invention, an expression vector is constructed by inserting a polynucleotide having a sequence derived from the genus Streptomyces (SEQ ID NO: 1) into an expression vector pSE420D (Japanese Patent Laid-Open No. 2000-189170) and introduced into E. coli. However, carbonyl reductase was not expressed.
However, the present inventors have introduced the polynucleotide of SEQ ID NO: 1 into the vector pSK1127 (Reference Example 2) constructed so that it can be expressed in Streptomyces actinomycetes, thereby producing Streptomyces actinomycetes. Succeeded in highly expressing carbonyl reductase. Therefore, the enzyme of the present invention is preferably expressed in actinomycetes such as Streptomyces, and the L11 protein gene (rplK gene) as used in pSK1127 and pSK811 described in the examples is used as an expression vector in this case. Those having a promoter that functions in actinomycetes, such as these promoters, are preferred. However, for efficient expression in various genera, the polynucleotide of SEQ ID NO: 1 can be mutated into a form suitable for each host. For example, in order to increase the efficiency of expression in a host of another genus, the polynucleotide may be changed according to the codon usage frequency of the host.

The procedure for producing transformants and the construction of a recombinant vector suitable for the host can be performed according to techniques commonly used in the fields of molecular biology, biotechnology, and genetic engineering (for example, Sambrook et al., Molecular cloning, Cold Spring Harbor Laboratories). In order to express the carbonyl reductase gene of the present invention in a microorganism or the like, it is necessary to first introduce this DNA into a plasmid vector or a phage vector that is stably present in the microorganism, and to transcribe and translate the genetic information. is there.
For that purpose, a promoter corresponding to a unit that controls transcription / translation may be incorporated upstream of the 5′-side of the DNA strand of the present invention, and more preferably a terminator is incorporated downstream of the 3′-side. As the promoter and terminator, a promoter and terminator known to function in a microorganism used as a host is used. Regarding the vectors, promoters, terminators, etc. that can be used in these various microorganisms, “Basic Course of Microbiology 8 Genetic Engineering / Kyoritsu Shuppan”, especially regarding actinomycetes, Practical Streptomyces Genetics, The John Innes Foundation (2000), Adv. Biochem. Eng. 43, 75-102 (1990), Yeast 8, 423-488 (1992), and the like.

For example, in the genus Streptomyces, pIJ101, SCP2 * -type plasmid, oriT (RK2) vector, etc. can be used. Among these, vectors pSK1127 and pSK811 (Reference Example 2) incorporating the rplK promoter and ssgA terminator can be preferably used.
In the genus Rhodococcus, a plasmid vector isolated from Rhodococcus rhodochrous can be used (J. Gen. Microbiol. 138,1003 (1992)).

In the genus Escherichia, especially Escherichia coli, pBR and pUC plasmids can be used as plasmid vectors, and lac (β-galactosidase), trp (tryptophan operon), tac, trc (lac, trp fusion) ), Promoters derived from λ phage PL, PR, etc. can be used. Moreover, as the terminator, a terminator derived from trpA, phage, or rrnB ribosomal RNA can be used. Among these, the vector pSE420D (described in JP-A-2000-189170) obtained by partially modifying the multicloning site of commercially available pSE420 (manufactured by Invitrogen) can be suitably used.
In the genus Bacillus, pUB110 series plasmids, pC194 series plasmids and the like can be used as vectors, and can be integrated into chromosomes. Further, apr (alkaline protease), npr (neutral protease), amy (α-amylase) and the like can be used as promoters and terminators.
In the genus Pseudomonas, host vector systems have been developed for Pseudomonas putida and Pseudomonas cepacia. A broad host range vector (including genes necessary for autonomous replication derived from RSF1010, etc.) pKT240 based on the plasmid TOL plasmid, which is involved in the degradation of toluene compounds, can be used, and lipase (specialized as a promoter and terminator) can be used. Kaihei 5-284973) Genes can be used.

In the genus Brevibacterium, in particular, Brevibacterium lactofermentum, plasmid vectors such as pAJ43 (Gene 39, 281 (1985)) can be used. As the promoter and terminator, promoters and terminators used in Escherichia coli can be used as they are.
In the genus Corynebacterium, especially Corynebacterium glutamicum, plasmid vectors such as pCS11 (JP 57-183799) and pCB101 (Mol. Gen. Genet. 196, 175 (1984)) can be used. It is.
In the genus Streptococcus, pHV1301 (FEMS Microbiol. Lett. 26, 239 (1985), pGK1 (Appl. Environ. Microbiol. 50, 94 (1985)), etc. can be used as a plasmid vector.
In the genus Lactobacillus, pAMβ1 (J. Bacteriol. 137, 614 (1979)) developed for Streptococcus can be used, and those used in Escherichia coli as promoters can be used. .

In the genus Saccharomyces (especially Saccharomyces cerevisiae), YRp, YEp, YCp, and YIp plasmids can be used and use homologous recombination with ribosomal DNA present in multiple copies in the chromosome. Such integration vectors (such as EP 537456) are extremely useful because they can introduce genes in multiple copies and can stably hold genes. In addition, ADH (alcohol dehydrogenase), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), PHO (acid phosphatase), GAL (β-galactosidase), PGK (phosphoglycerate kinase), ENO (enolase) Promoters and terminators such as can be used.
In the genus Klayveromyces, especially Kluyveromyces lactis, 2 μm plasmid derived from Saccharomyces cerevisiae, pKD1 plasmid (J. Bacteriol. 145, 382-390 (1981)), involved in killer activity A plasmid derived from pGKl1, an autonomously proliferating gene KARS plasmid in the genus Kleberomyces, a vector plasmid (EP 537456, etc.) that can be integrated into the chromosome by homologous recombination with ribosomal DNA and the like can be used. In addition, promoters and terminators derived from ADH, PGK and the like can be used.

In the genus Schizosaccharomyces, plasmid vectors containing ARS (genes involved in autonomous replication) derived from Schizosaccharomyces pombe and selection markers that complement the auxotrophy derived from Saccharomyces cerevisiae are available ( Mol. Cell. Biol. 6, 80 (1986)). Moreover, the ADH promoter derived from Schizosaccharomyces pombe can be used (EMBO J. 6, 729 (1987)). In particular, pAUR224 is commercially available from Takara Shuzo and can be easily used.
In the genus Zygosaccharomyces, plasmid vectors derived from pSB3 (Nucleic Acids Res. 13, 4267 (1985)) derived from Zygosaccharomyces rouxii are available, and the PHO5 promoter derived from Saccharomyces cerevisiae In addition, the promoter of GAP-Zr (glyceraldehyde-3-phosphate dehydrogenase) derived from Tigosaccharomyces rouxi (Agri. Biol. Chem. 54, 2521 (1990)) can be used.

In the genus Pichia, a host vector system has been developed in Pichia Angasta (formerly Hansenula polymorpha). As vectors, genes involved in autonomous replication derived from Pichia Angusta (HARS1, HARS2) can be used, but because they are relatively unstable, multicopy integration into the chromosome is effective (Yeast 7, 431- 443 (1991)). In addition, AOX (alcohol oxidase) induced by methanol or the like, FDH (formate dehydrogenase) promoter, etc. can be used. In addition, host vector systems using Pichia pastoris and other genes (PARS1, PARS2) that are involved in Pichia-derived autonomous replication have been developed (Mol. Cell. Biol. 5, 3376 (1985)). Strong promoters such as high concentration culture and methanol-inducible AOX can be used (Nucleic Acids Res. 15, 3859 (1987)).
In the genus Candida, the host vector system in Candida maltosa, Candida albicans, Candida tropicalis, Candida utilis, etc. Has been developed. In Candida maltosa, ARS derived from Candida maltosa has been cloned (Agri. Biol. Chem. 51, 51, 1587 (1987)), and vectors using this have been developed. In Candida utilis, a strong promoter has been developed for the chromosome integration type vector (Japanese Patent Laid-Open No. 08-173170).

In the genus Aspergillus, Aspergillus niger, Aspergillus oryzae, etc. are the most studied among molds, and integration into plasmids and chromosomes is available. Promoters derived from external proteases or amylases are available (Trends in Biotechnology 7, 283-287 (1989)).
In the genus Trichoderma, a host vector system using Trichoderma reesei has been developed, and an extracellular cellulase gene-derived promoter or the like can be used (Biotechnology 7, 596-603 (1989)).
In addition to microorganisms, various host and vector systems have been developed in plants and animals, especially in plants using moths (Nature 315, 592-594 (1985)), rapeseed, corn, potatoes and other plants. A system for expressing heterogeneous proteins in large quantities has been developed and can be used suitably

  The procedure for producing a transformant and the construction of a recombinant vector suitable for the host can be performed according to techniques commonly used in the fields of molecular biology, biotechnology, and genetic engineering (for example, Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratories, 1989; Microbiology Basic Course 8 Genetic Engineering / Kyoritsu Shuppan). For example, in the genus Streptomyces, it can be carried out according to the method described in Hopwood et al., Genetic Manipulation of Streptomyces: A Laboratory Manual Cold Spring Harbor Laboratories (1985). Transformation is described, for example, in the literature (Hopwood, DA, MJ Bibb, KF Chater, T. Kieser, CJ Bruton, HM Kieser, DJ Lydiate, CP Smith, JM Ward, and H. Schrempf. 1985. Genetic manipulation of Streptomyces: a laboratory. mannual. The John Innes Foundation, Norwich, United Kingdom).

Moreover, the carbonyl reductase of this invention can be obtained from a recombinant by culturing the transformant transformed with this expression vector.
The recombinant is cultured in a medium suitable for host growth. After sufficiently growing, the cells are collected and crushed in a buffer solution containing a reducing agent such as 2-mercaptoethanol or phenylmethanesulfonyl fluoride or a protease inhibitor to obtain a cell-free extract. From cell-free extracts, fractionation by protein solubility (precipitation with organic solvents, salting out with ammonium sulfate, etc.), cation exchange, anion exchange, gel filtration, hydrophobic chromatography, chelates, dyes, antibodies, etc. The carbonyl reductase of the present invention can be purified by an appropriate combination of affinity chromatography and the like.

Examples of expression vectors suitable for expressing the carbonyl reductase of the present invention in actinomycetes are shown below. This vector is an expression vector containing DNA in which the DNA encoding the carbonyl reductase of the present invention is operably linked downstream of the promoter sequence of the L11 protein gene (rplK). In the present invention, the L11 protein gene refers to a gene encoding the ribosomal protein L11, and specifically includes the S. griseus rplK gene described in SEQ ID NO: 3 and its counterpart in other actinomycetes. Since the L11 protein gene is a highly conserved gene, it is easy for those skilled in the art to identify this gene. The following nucleic acids can be shown as the L11 protein gene.
(A) a nucleic acid encoding the amino acid sequence of SEQ ID NO: 4,
(B) a nucleic acid comprising an amino acid sequence in which one or more amino acids are deleted, substituted, inserted and / or added to the amino acid sequence set forth in SEQ ID NO: 4, and encoding a ribosomal protein;
(C) a nucleic acid comprising an amino acid sequence having 70% or more homology (identity) with the amino acid sequence set forth in SEQ ID NO: 4 and encoding a ribosomal protein, and (d) complementation of DNA set forth in SEQ ID NO: 3 A nucleic acid that contains a nucleic acid that hybridizes with a chain under stringent conditions and encodes a ribosomal protein. The number of amino acids modified in (b) above is, for example, 100 or less, usually 50 or less, preferably 30 or less, more preferably 15 Hereinafter, it is more preferably 10 or less, or 5 or less. The homology of the amino acid sequence with SEQ ID NO: 4 is preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 95% or more. The stringent conditions for hybridization are as described above.

  The DNA in the upstream region of the translation initiation codon of this L11 protein gene (also referred to as L11 gene) can be suitably used for the construction of an expression vector that expresses the carbonyl reductase of the present invention. One aspect of this vector is a DNA sequence comprising the base sequence set forth in SEQ ID NO: 5, or a base sequence having one or more bases substituted, deleted, and / or inserted in the base sequence and having promoter activity. An expression vector comprising a base sequence functionally linked to a DNA encoding the carbonyl reductase of the present invention downstream of the base sequence, wherein the enzyme of the present invention is detectably expressed in actinomycetes. Promoter activity is the activity to transcribe a gene linked downstream. The promoter activity can be detected by, for example, RT-PCR using a primer designed based on the coding sequence of the enzyme of the present invention, or Western blotting using an antibody that binds to the enzyme of the present invention. The downstream means the 3 ′ direction of the transcribed polynucleotide chain, and the upstream means the 5 ′ direction of the transcribed polynucleotide chain.

  In the present invention, a gene refers to a nucleic acid containing a base sequence to be transcribed. The DNA vector of the present invention is usually a double-stranded DNA, but as long as a double-stranded DNA is produced when introduced into actinomycetes, a vector containing a DNA consisting of either strand (for example, a phage containing a single-stranded DNA) Etc.). That is, in the present invention, a DNA vector comprising a certain base sequence is a DNA vector comprising the base sequence and / or its complementary sequence so that a double-stranded DNA comprising the base sequence can be generated.

  The sequence shown in SEQ ID NO: 5 is a promoter fragment of the L11 gene of actinomycetes S. griseus and has a strong promoter activity. The promoter region of the L11 gene in actinomycetes, including S. griseus, S. lavendulae (SEQ ID NO: 7), S. virginia (SEQ ID NO: 8), and S. coelicolor (SEQ ID NO: 9). As a result, the sequence of this region was found to be extremely conserved (Puttikhunt, C. et al., 1995, Mol. Gen. Genet. 247: 118-122). Of the four actinomycetes examined, the -10 region, transcription start point, and Shine-Dalgarno (SD) sequence were 100% conserved, and the other regions were also highly conserved. In the present invention, the promoter sequence of the L11 protein gene of these actinomycetes can be preferably used. For example, a preferred expression vector includes a base sequence from about 3 bases to about 176 bases upstream from the translation initiation codon of the desired actinomycete ribosomal protein L11 gene, and functionally encodes the enzyme of the present invention downstream thereof. An expression vector having an expression cassette to which a nucleotide sequence of a gene and a transcription termination sequence are bound is included.

  The promoter may have an L11 gene upstream region over a wider range than a base sequence from about 3 bases upstream to about 176 bases upstream from the translation initiation codon. For example, SEQ ID NO: 6 which is a DNA fragment longer than SEQ ID NO: 5 and including the upstream region of the L11 gene can be preferably used. More specifically, the base sequence from about 3 bases to about 197 bases, more preferably from about 3 bases to about 277 bases upstream from the translation initiation codon of actinomycetes ribosomal protein L11 gene may be included. Good.

  In addition, as a promoter, a base sequence from about 3 bases upstream to about 176 bases upstream from the translation initiation codon of Streptomyces L11 protein gene (eg, SEQ ID NO: 5), more preferably from about 3 bases upstream to about 277 bases upstream from the translation start codon. A base sequence having a promoter activity including a base sequence in which one or more bases are substituted, deleted, and / or added in the above base sequence (for example, SEQ ID NO: 6) can also be used. Examples of such base sequences include DNA containing sequences derived from S. lavendulae, S. virginia, and S. coelicolor (SEQ ID NOs: 7, 8, and 9 respectively). Such a sequence may be artificially mutated or may be a naturally mutated sequence. For example, the base sequence may be modified by base substitution by site-directed mutagenesis, or deletion or insertion of one or more bases to increase promoter activity or remove sequences that do not affect promoter activity. (Sambrook et al. (1989) Molecular Cloning, Cold Spring Harbor Laboratories; Ausubel, FM et al. (1994) Current Protocols in Molecular Biology, Greene Publisher Associates / John Wiley and Sons, New York. NY). The promoter activity of the sequence thus modified can be evaluated by constructing an expression vector as shown in the Examples and examining the expression of the gene linked downstream. By comparing the promoter activity with the sequence before modification, a sequence in which the promoter activity is maintained (or stronger) can be appropriately selected.

  As a base sequence suitable for use as a promoter, specifically, a base sequence from about 3 bases to about 176 bases upstream from the translation initiation codon of Actinomyces ribosomal protein L11 gene (particularly SEQ ID NO: 5) is more preferable. Is within 50 bases, preferably within 40 bases, more preferably within 30 bases, still more preferably within 20 bases, in a base sequence from about 3 bases to about 277 bases upstream from the translation initiation codon (eg, SEQ ID NO: 6). Most preferably, it is a base sequence in which bases within 10 bases (for example, within 5 bases) are substituted, deleted, and / or added, and have promoter activity. Substitutions, deletions, and additions may be combined arbitrarily. In the base modification, it is preferable that the sequence from about the 60th base to about the 84th base upstream from the translation start codon of the wild type L11 gene is retained without being modified. More specifically, it contains 5'-ATACCCGTTATCGT [G / T] GTGCGGTATGCCT-3 '(SEQ ID NO: 10) conserved from about 57 to about 84 bases upstream from the translation initiation codon of Actinomyces L11 gene (A slash indicates any base). In a more preferred embodiment, it is preferable that the sequence from about the 101st base to about the 115th base upstream from the translation start codon of the wild type L11 gene is retained without modification. More specifically, 5′-TCTGACCTGCT [G / C] GGTTTT-3 ′ (SEQ ID NO: 11) conserved from about 98 to about 115 bases upstream from the translation initiation codon of L11 gene It is preferable to include (slash indicates any base).

  In addition, as a base sequence suitable for the promoter, a base sequence from about 3 bases to about 176 bases upstream from the translation initiation codon of actinomyces ribosomal protein L11 gene (for example, SEQ ID NO: 5), more preferably upstream from the translation start codon. A base sequence from about 3 bases to about 277 bases (eg, SEQ ID NO: 6) and 60% or more, preferably 70% or more, more preferably 80% or more, more preferably 85% or more, and most preferably 90% or more ( For example, a base sequence having 95% or more identity and having a promoter activity can be mentioned.

  Alternatively, DNA or RNA comprising a base sequence (particularly SEQ ID NO: 5) from about 3 bases to about 176 bases upstream from the translation initiation codon of actinomycete ribosomal protein L11 gene or its complementary sequence, more preferably upstream from the translation start codon A base sequence of DNA that hybridizes under stringent conditions with a DNA or RNA comprising a base sequence of about 3 bases to about 277 bases (eg, SEQ ID NO: 6) or its complementary sequence, and has a promoter activity Examples include sequences. The hybridization conditions may be those described in this specification.

  The expression vector for expressing the enzyme of the present invention preferably contains a transcription termination sequence (terminator) downstream of the coding sequence of the enzyme of the present invention. As the transcription termination sequence, a desired sequence having the ability to terminate transcription from the upstream promoter can be used. For example, a transcription termination sequence of a desired actinomycete gene can be used. As the transcription termination sequence, a transcription termination sequence (that is, an intrinsic terminator) capable of terminating transcription preferably independently of Rho factor is used. By combining a terminator with the strongest transcription termination activity, it can be expected to improve the stabilization of mRNA. Such a transcription termination sequence generally has a palindromic sequence that forms a stem loop structure of 7 bp to 20 bp or more. It is also generally rich in GC. In particular, the decrease in free energy (ΔG) when a stem loop is formed is −50 Kcal or less, more preferably −55 Kcal or less, more preferably −60 Kcal or less, more preferably −65 Kcal or less, more preferably − A sequence of 70 Kcal or less is preferred. The ΔG of the stem loop can be calculated using, for example, an RNA secondary structure prediction program. Specifically, DNASIS (Hitachi Software Engineering Co., Ltd.) can be used.

  The stem portion may not form base pairs over the entire region. Preferably, a stem in which 70% or more, more preferably 80% or more, more preferably 90% or more of bases form a base pair over a region of 20 bases or more is preferable. More preferably, a stem in which 70% or more, more preferably 80% or more, more preferably 90% or more of bases form a base pair over a region of 30 bases is preferable. More preferably, a stem in which 70% or more, more preferably 80% or more, more preferably 90% or more of bases form a base pair over a region of 35 bases is preferable. The size of the loop portion is not particularly limited, but is typically 2 to 100 bases, for example 3 to 50 bases.

  In a more preferred embodiment, the transcription termination sequence of actinomyces ssgA gene is used as the transcription termination sequence. The transcription termination sequence of ssgA forms a stem of 20 base pairs or more and can terminate transcription independently of Rho. By using the transcription termination sequence of ssgA, it is possible to construct an expression vector with higher performance. A Rho-independent transcription termination sequence of ssgA which is suitably used is exemplified in SEQ ID NO: 12. This sequence is derived from the transcription termination sequence of S. griseus ssgA and forms a stem of 20 bases or more. In the vector of the present invention, a region containing 200, 250, or 300 bases from the base next to the translation stop codon of ssgA may be used. For example, DNA containing the base sequence shown in SEQ ID NO: 13 can be suitably used as the transcription termination sequence. The present invention also includes a base sequence of a transcription termination sequence (for example, SEQ ID NO: 12 or 13) of actinomycetes ssgA, or a base sequence in which one or more bases are substituted, deleted, and / or added in the sequence. A base sequence having an activity to terminate transcription can be preferably used.

  Specifically, within the transcription termination sequence of the actinomyces ssgA gene (eg, SEQ ID NO: 12, more preferably SEQ ID NO: 13), it is within 50 bases, preferably within 40 bases, more preferably within 30 bases, and even more preferably. Is a base sequence in which a base of 20 bases or less, most preferably 10 bases (for example, 5 bases or less) is substituted, deleted, and / or added, and has an activity to terminate transcription. Substitutions, deletions, and additions may be combined arbitrarily. In the base modification, as described above, ΔG is −50 Kcal or less, preferably −55 Kcal or less, more preferably −60 Kcal or less, more preferably −65 Kcal or less, more preferably −70 Kcal or less. Adjust as follows. Moreover, it is preferable that the stem length and the base pair ratio follow the above. Alternatively, the transcription termination sequence is 60% or more, preferably 70% or more, more preferably 80% or more, and still more preferably, the transcription termination sequence of the actinomyces ssgA gene (for example, SEQ ID NO: 12, more preferably SEQ ID NO: 13). A nucleotide sequence having 85% or more, most preferably 90% or more (eg, 95% or more) identity, or a transcription termination sequence of actinomyces ssgA gene (eg, SEQ ID NO: 12, more preferably SEQ ID NO: 13) or A base sequence of DNA that hybridizes with DNA or RNA containing the complementary sequence under stringent conditions and has an activity to terminate transcription can be preferably used. Calculation of nucleotide sequence identity and hybridization conditions are as described in this specification.

  One embodiment of the expression vector is a plasmid vector. The plasmid contains an origin of replication (ori) for amplification with actinomycetes. Furthermore, it may have an origin of replication for amplification in E. coli. A vector that can be amplified by both actinomycetes and E. coli can be used as an E. coli-actinomycetes shuttle vector. The origin of replication (ori) for amplification with actinomycetes may be low copy or multicopy. A low copy plasmid is a plasmid that causes plasmid amplification of 1 to 10 copies in actinomycetes, and a multicopy plasmid is more than that, specifically 40 to 400 copies or more. Refers to the plasmid that results in An example of low copy ori is SCP2 * ori (Lydiate, D.J. et al. (1985) Gene 35 (3): 223-235). Examples of the high copy ori include pIJ101 ori (Katz, E. et al., (1983) J. Gen. Microbiol. 129: 2703-2714). The plasmid vector preferably contains a marker gene such as an appropriate drug resistance gene or metabolic enzyme so that a host holding the plasmid vector can be selected. Such marker genes include, for example, ampicillin resistance gene, thiostrepton resistance gene, hygromycin resistance gene, and apramycin resistance gene, all of which are well known to those skilled in the art. In addition, for the construction of actinomycete plasmids, pIJ486 (Mol. Gen. Genet. 203, 468-478, 1986), pKC1064 (Gene 103,97-99 (1991)), pUWL-KS (Gene 165,149-150 (1995) )), PIJ702 (Katz, E. et al., (1983) J. Gen. Microbiol. 129: 2703-2714), pIJ8600 (Sun, J. et al. (1999) Microbiology 145: 2221-2227) Arrays can be used.

  Another embodiment of the expression vector is a genome integration type vector. A genome integration type vector is a vector that, when introduced into actinomycetes, is integrated into the actinomycetes genome and can express the integrated gene from the genome. Prior to introduction into actinomycetes, this vector can also be prepared in the form of a plasmid. In preparing a genome integration type vector, a recombination sequence necessary for integration of phage DNA into a host genome can be used. Specifically, for example, an int gene and attP of φ31 phage may be inserted into a vector (Bierman, M. et al., (1992) Gene 116: 43-49). In order to keep the plasmid in the fungus body, it is usually necessary to continue selection based on the drug corresponding to the drug resistance gene incorporated in the plasmid, but since the genome-integrated expression vector is stable, a recombinant bacterium was obtained once. Later, it is excellent in that there is no need for drug selection.

  It is possible to obtain a transformant that efficiently produces the enzyme of the present invention by incorporating the gene encoding the carbonyl reductase of the present invention into the actinomycetes expression vector shown above and transforming it into actinomycetes. is there. An example of such a transformant includes actinomycetes deposited under the deposit number FERM P-19465, but is not limited thereto.

  The enzyme activity obtained from the actinomycete transformant of the present invention is preferably 0.01 U / mg protein (unit per 1 mg of protein in the cell-free extract) or more, preferably 0.10 U / mg protein or more, preferably 0.30. U / mg protein or more, more preferably 0.50 U / mg protein or more, more preferably 0.70 U / mg protein or more, more preferably 0.80 U / mg protein or more, more preferably 1.00 U / mg protein or more. Here, 1 U enzyme activity refers to the amount of enzyme that catalyzes the decrease of 1 μmol of NADH per minute in the cell-free extract obtained from the transformant according to the present invention. Enzyme activity can be measured in a reaction solution containing 100 mM potassium phosphate buffer (pH 6.5), 0.2 mM NADH, 20 mM ethyl acetoacetate, and the above cell-free extract at 30 ° C. it can. The transformant according to the present invention, in a preferred embodiment, is actinomycetes, preferably Streptomyces lividans, more preferably S. lividans TK21 strain (Parro, V) in a form incorporated into a multicopy plasmid (eg pSK1127) containing pIJ101 ori and the like. , et al., 1999, Microbiology 145: 2255-2263; Hopwood, DA et al. (1985) Genetic Manipulation of Streptomyces: A Laboratory Manual (The John Innes Foundation, Norwich, England)) (John Innes Institute, Norwich, (Available from England).

The present invention also includes a step of recovering the optically active alcohol produced by allowing the carbonyl reductase of the present invention, the transformed strain having acquired the enzyme producing ability of the present invention, or a treated product thereof to act on a ketone. The present invention relates to a method for producing an active alcohol. The treated product refers to a product obtained by subjecting a biological cell to physical treatment, biochemical treatment, chemical treatment, or the like. For example, a disrupted product of a transformed strain, a crudely purified enzyme obtained from the transformant, and the like are included in the treated product. Biological cells include cells or microorganisms containing the enzyme, as well as transformants that retain the gene of the enzyme so that the gene can be expressed. The physical treatment for obtaining the treated product includes freeze-thaw treatment, ultrasonic treatment, pressure treatment, osmotic pressure difference treatment, grinding treatment, and the like. In addition, the biochemical treatment can specifically indicate cell wall lytic enzyme treatment such as lysozyme. Further, examples of the chemical treatment include contact treatment with an organic solvent such as a surfactant, toluene, xylene, or acetone. Microorganisms whose cell membrane permeability has been changed by such treatment, cell-free extracts obtained by crushing bacterial cells by glass beads or enzyme treatment, and partially purified products thereof are included in the treated product.
In addition, the microbial cells or treated cells of the present invention are known methods such as polyacrylamide method, sulfur-containing polysaccharide gel method (κ-carrageenan gel method, etc.), alginic acid gel method, agar gel method, ion exchange resin method and the like. It can also be used by immobilization.

  In the production method of the present invention, a method of allowing a microorganism, its fungus body, or its treated product to act on a reaction substrate is arbitrary. For example, by mixing both in a solution, a microorganism, its fungus body or its treated product can be allowed to act. Alternatively, the microorganism, its fungus body, or its treated product can be allowed to act through a membrane capable of exchanging the reaction substrate. By using the membrane, separation of microbial cells in the recovery of the reaction product can be omitted. Or when mixing both, a reaction product can be easily isolate | separated by using the immobilized microorganism, its microbial cell, or its processed material.

As reaction conditions, the following conditions can be shown, for example.
pH 4.0 to 9.0, preferably pH 6.0 to 8.0,
Temperature 15 to 50 ° C, preferably 20 to 35 ° C,
The reaction time is 4 to 7 days.

In the production method of the present invention, the microorganism, its fungus body, or its treated product can be allowed to act on the substrate compound in the presence of β-nicotinamide adenine dinucleotide reduced form (NADH). In general, the reduction reaction of a substrate by a microorganism is enhanced by supplying a source of reducing energy. β-nicotinamide adenine dinucleotide reduced form is desirable as a reducing energy source for the production method of the present invention.
In the present invention, a β-nicotinamide adenine dinucleotide reductant or a β-nicotinamide adenine dinucleotide phosphate reductant can be supplied by adding these compounds. In addition, a reaction system for regenerating the oxidant of these reduction energy sources, which is generated along with the above reaction, into a reductant can be combined.

Regeneration of the oxidant generated from the reduction energy source accompanying the reduction reaction to the reductant should be performed using the NAD ⁺ reducing ability of the microorganism (such as glycolysis, methylotrophic C1 compound utilization pathway). Can do. These NAD ⁺ reducing ability can be enhanced by adding glucose, ethanol, formic acid or the like to the reaction system. Moreover, it can also carry out by adding the microorganisms which have the capability to produce | generate NADH from NAD ⁺ , its processed material, and an enzyme to a reaction system. For example, microorganisms containing glucose dehydrogenase, formate dehydrogenase, alcohol dehydrogenase, amino acid dehydrogenase, organic acid dehydrogenase (malate dehydrogenase, etc.), processed products thereof, and partially purified or purified enzymes NADH can be reproduced using The components constituting the reaction required for NADH regeneration are added to the reaction system for alcohol production according to the present invention, the immobilized component is added, or the membrane is brought into contact via a membrane capable of exchanging NADH. be able to. Further, by utilizing the alcohol oxidation activity of the carbonyl reductase of the present invention, the enzyme itself can be used by adding a substrate suitable for the oxidation reaction of the enzyme of the present invention such as 2-propanol or 2-octanol to the reaction system. NADH can also be reproduced. These compounds can be added in a molar ratio of, for example, 0.1-20, preferably 1-15 times with respect to the substrate ketone. On the other hand, enzymes for regenerating NADH (or NADPH), such as glucose dehydrogenase and alcohol dehydrogenase, have an enzyme activity of, for example, 0.1 to 100 times, preferably 0.8, as compared with the carbonyl reductase of the present invention. About 5 to 20 times can be added.

Further, a more efficient reaction can be expected by performing an asymmetric reduction reaction in the presence of sugars, alcohols, sugar alcohols, or the like as a reducing energy source. The reducing energy to be used is not particularly limited as long as the microorganism can be used as reducing energy. For example, glucose, fructose, sucrose, etc. can be used as sugars. As alcohols, ethanol, isopropanol, glycerol and the like can be used. Moreover, sorbitol etc. can be shown as sugar alcohols. The compound added for reducing energy can be added according to the reactive group mass.
If there is a change in the pH of the reaction solution as the reducing energy source is consumed, adjust the pH within a certain range using an appropriate acid or alkali to maintain even better reactivity. It is also possible to carry out the reaction.

  In addition, when the carbonyl enzyme of the present invention is expressed in an expression vector, a microorganism having high regenerative activity to a reductant (NADH or NADPH) is used as a host, so that the reductant can be converted into a reductant in a reduction reaction using the transformant. An efficient reaction can be performed without adding an enzyme for regeneration. In addition, genes (coenzymes) such as glucose dehydrogenase, alcohol dehydrogenase, formate dehydrogenase, amino acid dehydrogenase, organic acid dehydrogenase (malate dehydrogenase, etc.) that can be used to regenerate reductants By introducing the dehydrogenase gene for regeneration) into the host simultaneously with the DNA encoding the carbonyl reductase of the present invention, regeneration into the reductant, expression of the carbonyl reductase of the present invention, and reduction reaction are more efficiently performed. It is also possible to perform. In order to introduce these two or more genes into the host, a method of transforming the host with a recombinant vector in which genes are separately introduced into a plurality of vectors different from the origin of replication in order to avoid incompatibility, A method of introducing both genes into a single vector, a method of introducing both genes into a chromosome, or the like can be used.

  When introducing multiple genes into a single vector, methods such as linking promoter- and terminator-related regions related to expression control to each gene, or expressing as an operon containing multiple cistrons such as the lactose operon. Is possible.

  The ketone in the method for producing an optically active alcohol according to the present invention is preferably β-ketoesters, more specifically 2,3′-dichloroacetophenone, acetophenone, ethyl acetoacetate, etc. Active alcohols can be produced.

A ketone, for example, 2,3′-dichloroacetophenone, which is a reaction substrate in the present invention, can be used at an appropriate concentration as long as it does not inhibit the reaction so that the target product can be efficiently produced. The concentration of 2,3′-dichloroacetophenone in the reaction solution can be, for example, 0.1 to 50% w / v, preferably 1 to 20% w / v.
2,3′-dichloroacetophenone generally has low solubility in water. Therefore, even when a high concentration of substrate is added, only the dissolved substrate reacts, and the reaction rate may be lower than the amount of substrate added. In order to increase the solubility of the substrate, a water-soluble solvent such as methanol, ethanol, acetone, tetrahydrofuran, or dimethyl sulfoxide can be added.
2,3′-Dichloroacetophenone can be added by any method such as batch (batch method), divided addition (fed batch method) or continuous addition (feed method). Further, for the purpose of reducing or avoiding the toxicity of the substrate and the product to the microbial cells, an organic solvent insoluble in water such as ethyl acetate, butyl acetate, isopropyl ether and toluene can be added.

In the asymmetric reduction reaction of the present invention, by-products may usually increase under aerobic conditions. In this case, a high yield can be expected by performing the reaction under anaerobic or oxygen-limited conditions. Specifically, for example, an improvement in yield can be expected by reacting nitrogen through a liquid or gas phase.
Thus, by the reaction of the present invention, 2,3′-dichloroacetophenone is asymmetrically reduced to produce optically active (R) -2,3′-dichloro-1-phenylethanol. The produced optically active (R) -2,3′-dichloro-1-phenylethanol can be easily isolated according to a conventional method. For example, after removing insoluble substances such as cells directly or directly from the reaction solution, extraction with ethyl acetate, hexane, diethyl ether, etc., followed by concentration under reduced pressure results in optically active (R) -2,3′- Dichloro-1-phenylethanol can be collected.

In order to further increase the purity of the reaction product, it can be highly purified by dissolving it in a small amount of solvent and performing silica gel column chromatography.
The optically active (R) -2,3′-dichloro-1-phenylethanol thus obtained is easily closed by heating at room temperature or in the presence of an equimolar amount of alkali such as caustic soda. It can be converted to active metachlorostyrene oxide.

  Hereinafter, the present invention will be described with reference to examples, but the present invention is not limited to these examples. References cited in this specification are incorporated as a part of this specification.

[Example 1] Acquisition of Streptomyces coelicolor carbonyl reductase gene Streptomyces coelicolor M145 strain was transformed into YEME medium (Difco yeast extract 3 g, Difco Bacto-peptone 5 g, Oxoid malt extract 3 g, Glucose 10 g) , Sucrose 340 g, 5 mM MgCl ₂ -6H ₂ O, 0.5% Glycine / L), and from the obtained cells, a known method described by Hopwood, DA et al. (Practical Streptomyces Genetics, The John Innes Foundation (2000 )) To prepare chromosomal DNA. In order to perform PCR cloning of AL939131-111 (SEQ ID NO: 1) of S. coelicolor M145 strain, primer SCP-ATG2 (GAAAGATCTAAAGGAGTTCGATCATGAAGGCACTGCAG / SEQ ID NO: 14) based on the 5 ′ and 3 ′ terminal sequences of this gene SCP-TGA2 (CCGACTAGTTCAGCCGTGGGGCAGGATCACC / SEQ ID NO: 15) was synthesized. Using S.coelicolor M145 strain chromosomal DNA as a template, and using SCP-ATG2 and SCP-TGA2 as primers, perform PCR (96 ° C, 30 seconds, 63 ° C, 30 seconds, 72 ° C, 2 minutes) for 30 cycles for specific Amplified DNA was obtained.

[Example 2] Construction of plasmid pSK-SCP1 expressing carbonyl reductase gene derived from actinomycetes Plasmid pSK1127 (Reference Example 2) was double-digested with two restriction enzymes Bgl II and Spe I and prepared in Example 1 The DNA fragment containing the actinomycete-derived carbonyl reductase gene excised from the DNA fragment was ligated with T4 DNA ligase, and Escherichia coli JM109 strain was transformed to obtain plasmid pSK-SCP1. The insert fragment in the obtained plasmid was analyzed for nucleotide sequence, and it was confirmed that it matched with the nucleotide sequence of AL939131-111 (SEQ ID NO: 1). The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2.

[Example 3] Expression of actinomycete-derived carbonyl reductase gene
Streptomyces lividans TK21 strain transformed with pSK-SCP1 was cultured for 96 hours in YEME medium containing apramycin 50 mg / L. The obtained cells were collected, crushed with a sealed ultrasonic crusher UCD-200TM (manufactured by Cosmo Bio), and the centrifuged supernatant was used as a cell-free extract. The transformant used (Streptomyces lividans TK21 strain transformed with pSK-SCP1) was deposited at the Patent Organism Depositary as follows.

Deposit of Streptomyces lividans TK21 (pSK-SCP1):
(a) Name and address of depositary institution Name: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (Former name: Institute of Biotechnology, Institute of Industrial Science and Technology, Ministry of International Trade and Industry)
Address: Central 1-3, East 1-3, East 1-3, Tsukuba, Ibaraki Prefecture, Japan (zip code 305-8566)
(b) Date of deposit August 5, 2003
(c) Accession number FERM P-19465

[Example 4] Enzyme activity of actinomycete-derived carbonyl reductase Using the cell-free extract obtained in Example 3, ethyl acetoacetate, 2,3'-dichloroacetophenone, acetophenone, 2-propanol, (S)- Enzyme activity using 2-octanol as a substrate was measured. The reduction activity was measured using 100 mM potassium phosphate buffer (pH 6.5), 0.2 mM NADH, 20 mM ethyl acetoacetate (2 mM 2,3′-dichloro for 2,3′-dichloroacetophenone reduction activity measurement). The reaction was carried out at 30 ° C. in a reaction solution containing acetophenone and 5 mM acetophenone in the case of acetophenone and acetophenone reduction activity measurement) and an enzyme. 1 U was defined as the amount of enzyme that catalyzes the decrease of 1 μmol of NADH per minute. Oxidation activity was measured using 50 mM Tris-HCl buffer (pH 9.0), 2.5 mM NAD, 200 mM 2-propanol (in the case of (S) -2-octanol reduction activity measurement, 5 mM (S) -2. -Octanol) and a reaction solution containing an enzyme were reacted at 30 ° C. 1 U was defined as the amount of enzyme that catalyzes the production of 1 μmol of NADH per minute.

  The cell-free extract obtained from the recombinant bacterium showed NADH-dependent ethyl acetoacetate reduction activity, and the specific activity was 1.26 U / mg protein. On the other hand, the cell-free extract obtained from the S. lividans TK21 strain transformed with the vector plasmid pSK1127 into which no carbonyl reductase was inserted was 0.0036 U / mg protein. Moreover, the enzyme activity with respect to each substrate of the cell-free extract obtained from the recombinant bacterium is shown in the table below.

[Example 5] Synthesis of (R) -2,3'-dichloro-1-phenylethanol by actinomycete-derived carbonyl reductase
200 mM potassium phosphate buffer (pH 6.5), 1 mM NAD, 2.5 mM 2,3′-dichloroacetophenone, 1 U glucose dehydrogenase (Bacillus sp.), 250 mM glucose, 0.1% bovine serum albumin, Example 3 The reaction was carried out overnight at 25 ° C. using 1 mL of the reaction solution containing 0.05 U of the cell-free extract obtained in.
(R) -2,3′-dichloro-1-phenylethanol was extracted from the reaction solution using twice the amount of ethyl acetate, and after removing the solvent, high performance liquid chromatography using an optical resolution column (column, Daicel chemistry) Chiralcel OJ manufactured; mobile phase, n-hexane / 2-propanol (39/1); detection wavelength, 254 nm; flow rate, 1.0 mL / min). 2,3'-dichloroacetophenone at a retention time of 12.6 minutes, (R) -2,3'-dichloro-1-phenylethanol at a retention time of 18.1 minutes, (S) -2,3'-dichloro-1- at 20.8 minutes Phenylethanol was detected.
As a result, (R) -2,3′-dichloro-1-phenylethanol was produced at a conversion rate of 99.97%, and its optical purity was 96.5% ee (R).

[Reference Example 1] Construction of expression cassette using L11 ribosomal protein gene (rplK) promoter region When constructing an expression cassette, an approximately 280 bp S. griseus rplK gene promoter region (SEQ ID NO: 6) was used as a recombinant plasmid. PCR amplification was performed using pP34 (Kawamoto, S. et al., 1997, Mol. Gen. Genet. 255: 549-560) as a template. Restriction enzyme recognition sequences BamHI and EcoRI were introduced into the 5 ′ end and 3 ′ end of the PCR product, respectively. In addition, the ssgA gene terminator region of S. griseus (SEQ ID NO: 13) of about 340 bp was PCR amplified using the recombinant plasmid pNY22 (Kawamoto, S. and JC Ensign, 1995, Actinomycetologica 9: 136-151) as a template. Restriction enzyme recognition sequences EcoRI and BamHI were introduced into the 5 ′ end and 3 ′ end of the PCR product, respectively. The vector pGEM3Zf (-) (Promega) was digested with EcoRI, filled in with Klenow enzyme, self-ligated, and the plasmid pGΔE in which the EcoRI recognition sequence at the cloning site was crushed was obtained from the literature (Maniatis, T., EF Fritsch, and J. Sanbrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor). Next, using primers L11PBamF (5′-GCCA GGATCC ACGAGATCAACGCCG-3 ′ / SEQ ID NO: 16) (underlined is a restriction enzyme site) and L11PEcoR (5′-TTGGGAG GAATTC CTCTCTCCGGG-3 ′ / SEQ ID NO: 17) The rplK promoter region was amplified by PCR to obtain a 280 bp PCR product, which was then cleaved with BamHI and EcoRI. In addition, the ssgA terminator region was amplified by PCR using primers SsgATerEF (5'-GGGT GAATTC GACGGCAACCTG-3 '/ SEQ ID NO: 18) and SsgATerBR (5'-GTATCC GGATCC GGAGGGACC-3' / SEQ ID NO: 19). After obtaining a 350 bp product, it was cleaved with BamHI and EcoRI. pGΔE was cleaved with BamHI, BAP-treated, and the restriction enzyme-treated rplK promoter region and ssgA terminator region PCR products were ligated to prepare a recombinant plasmid pSK200. Primers PlinkF (5'-AATTCAGATCTTTAAATATTACTAGTAAGCTTG-3 '/ SEQ ID NO: 20) and PlinkR (5'-AATTCAAGCTTACTAGTAATATTTAAAGATCTG-3' / SEQ ID NO: 21) annealed at the 5 'end with a kinase are used to produce a plurality of restriction enzymes. A synthetic DNA linker having a recognition sequence (AT-rich restriction enzyme recognition sequence rarely present in actinomycetes with high GC content DNA) was prepared, and this was used as a restriction enzyme EcoRI (rplK gene promoter region and ssgA gene terminator region). The recombinant plasmid pSK201 was prepared by inserting it into pSK200 cleaved in the presence of a unique recognition sequence at the junction. An about 700 bp expression DNA cassette composed of an rplK gene promoter that can be excised with the restriction enzyme BamHI, a cloning site, and an ssgA gene terminator is inserted into this plasmid.

[Reference Example 2] Construction of expression plasmid Expression vector pSK210
PCR amplification of expression DNA cassette using pSK201 as a template and primers L11PSK (5'-GTCG GGATCC TCGGCCGCGAG-3 '/ SEQ ID NO: 22) and SsgATerBR (5'-GTATCC GGATCC GGAGGGACC-3' / SEQ ID NO: 19) did. The restriction enzyme recognition sequence BamHI was introduced into the 5 ′ end and 3 ′ end of the PCR product. The BamHI recognition sequence at the 5 ′ end was introduced to remove the BglII recognition sequence present at the 5 ′ end of the rplK gene promoter in the DNA expression cassette. The 650 bp PCR product cleaved with BamHI was inserted into the BglII cloning site of the actinomyces-E. Coli shuttle vector pV1 (Kawamoto, S. et al., 1997, Microbiology 143: 1077-1086) to prepare the expression vector pSK210 (FIG. 1). .
pSK210 is actinomycete, a low copy type, and selectable markers are ampicillin resistance (amp; E. coli), thiostrepton resistance (tsr; actinomycetes) and hygromycin resistance (hyg; actinomycetes).

2. Expression vector pSK220
The above-mentioned 650 bp PCR product cleaved with BamHI is inserted into the BglII cloning site of the actinomyces multicopy vector pIJ702 (Katz E. et al., 1983, J. Gen. Microbiol., 129: 2703-2714) to obtain a multicopy type. An expression vector pSK220 was prepared (FIG. 2A). The selection marker for this plasmid is thiostrepton resistance.

3. Actinomycetes-E. coli shuttle vector pSK1955
Using the vector pBluescript SK (+) (Stratagene) as a template, primers PBlueT7C (5'-CGCTGG CATATG TAGCGGTCACGCTGCGCG-3 '/ SEQ ID NO: 23) and PBlueT3N (5'-GCTGG GACGTC AGGTTTCCCGACTGGAAAG-3' / SEQ ID NO: 24 ) Was used to PCR amplify the approximately 580 bp multicloning site-lacZ gene region of this plasmid. Restriction enzyme recognition sequences AatII and NdeI were introduced at the 5 ′ end and 3 ′ end of the PCR product, respectively. PCR product cleaved with AatII and NdeI, approximately 2.9 kb NdeI-PstI DNA fragment (including rep gene required for replication in actinomycetes and pIJ101 ori) prepared from actinomyces multicopy vector pIJ702, and actinomycetes genome integration About 2.4 kb AatII-PstI DNA fragment (including apramycin resistance gene acc (3) IV and pUC18 ori) prepared from the type vector pIJ8600 (Sun, J. et al., Microbiology 145: 2221-2227) Ligation produced the actinomycetes-E. Coli shuttle vector pSK1955 (FIG. 2B). pSK1955 is a multi-copy type actinomycete and the selection marker is apramycin resistance (E. coli / actinomycetes).

4). Expression vector pSK1127
Using pSK220 as a template, primers L11ClaF (5'-CCTC ATCGAT ATCTTCGGCCGCGAGACCCC-3 '/ SEQ ID NO: 25) (for removal of BglII site) and SsgATmNde (5'-CTGG CATATG CGGGCGCGGCGCTGCCACTG-3' / SEQ ID NO: 26) The 605 bp expression DNA cassette was amplified by PCR. Restriction enzyme recognition sequences ClaI and NdeI were introduced into the 5 ′ end and 3 ′ end of the PCR product, respectively. An expression vector by ligating a PCR product cleaved with ClaI and NdeI and an approximately 5.1 kb ClaI-NdeI DNA fragment (including rep gene, pIJ101 ori, acc (3) IV gene and pUC18 ori) prepared from vector pSK1955 pSK1127 was produced (FIG. 3A). Actinomycetes-The E. coli shuttle vector pSK1127 is actinomycetes and is multicopy and the selectable marker is apramycin resistance (E. coli / actinomycetes).

5). Expression vector pSK811
Using pSK220 as a template, primers L11ClaF (5'-CCTC ATCGAT ATCTTCGGCCGCGAGACCCC-3 '/ SEQ ID NO: 25) (for removal of BglII site) and SsgATerBR (5'-GTATCC GGATCC GGAGGGACC-3' / SEQ ID NO: 19) The 655 bp expression DNA cassette was amplified by PCR. Restriction enzyme recognition sequences ClaI and BamHI were introduced into the 5 ′ end and 3 ′ end of the PCR product, respectively. An approximately 6.3 kb ClaI-BglII DNA fragment prepared from the PCR product cleaved with ClaI and BamHI and the genome integration vector pIJ8600 (int31 gene of phage 31 necessary for genome integration and attP, RK2 oriT, acc (3) The expression vector pSK811 was prepared by ligating IV gene (including pUC18 ori) (FIG. 3B). The actinomycetes-Escherichia coli shuttle vector pSK811 is a genome integration type, and the selection marker is apramycin resistance (E. coli / actinomycetes).

[Reference Example 3] Construction of plasmid pSE-PAR1 containing carbonyl reductase gene derived from actinomycetes
Synthesis of primers ScoPAR-ATG1 (CGATCATGAAAGCACTGCAGTACCGCAC / SEQ ID NO: 27) and ScoPAR-TAA1 (CAGTCTAGATTAGCCGTGTGGCAGGATCACCGCG / SEQ ID NO: 28) based on the 5 'and 3' end sequences of AL939131-111 (SEQ ID NO: 1) did. 30 cycles of PCR (96 ° C, 30 seconds, 58 ° C, 30 seconds, 72 ° C, 1 minute 20 seconds) using the plasmid pSK-SCP1 constructed in Example 2 as a template and ScoPAR-ATG1 and ScoPAR-TAA1 as primers The specific amplified DNA was obtained.
The resulting DNA fragment was double-digested with two restriction enzymes BspHI and XbaI, and the plasmid pSE420D (JP 2000-189170) was double-digested with two restriction enzymes NcoI and XbaI and ligated with T4 DNA ligase. Then, Escherichia coli JM109 strain was transformed to obtain plasmid pSE-PAR1. The insert fragment in the obtained plasmid was analyzed for the nucleotide sequence, and it was confirmed that it matched the nucleotide sequence of AL939131-111 (SEQ ID NO: 1) except for the portion mutated by the PCR primer. The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2.

[Reference Example 4] Expression of actinomycete-derived carbonyl reductase gene in Escherichia coli
Escherichia coli JM109 transformed with pSE-PAR1 is cultured overnight in LB medium (1% bacto-tryptone, 0.5% bacto-yeast extract, 1% sodium chloride) containing ampicillin 50 mg / L, and 0.1 mM. IPTG was added and further cultured for 4 hours. The obtained cells were collected, crushed with a sealed ultrasonic crusher UCD-200TM (manufactured by Cosmo Bio), and the centrifuged supernatant was used as a cell-free extract.
The enzyme activity of the obtained cell-free extract using ethyl acetoacetate as a substrate was measured by the method described in Example 4, but no NADH-dependent ethyl acetoacetate reduction activity was observed.

  According to the present invention, a novel carbonyl reductase useful for the production of an optically active alcohol, a vector capable of expressing the enzyme at a high level, a host cell into which the vector has been introduced, a method for producing the enzyme, and use of the enzyme A method for producing an optically active alcohol with high optical purity was provided. According to the present invention, a carbonyl of a ketone can be reduced to produce a high purity optically active alcohol. For example, optically active α-halophenylethanol derivatives are compounds that can be very easily derived into optically active styrene oxide derivatives that are useful as raw materials or synthetic intermediates for various pharmaceuticals, agricultural chemicals, and in particular optically active metachlorostyrene. Oxides are extremely important compounds as synthetic intermediates for β3 adrenoceptor agonists. According to the present invention, (R) -2,3′-dichloro-1-phenylethanol derived from this optically active metachlorostyrene oxide can be produced with very high optical purity.

It is a figure which shows the structure of pSK210. It is a figure which shows the structure of pSK220 (panel A) and pSK1955 (panel B). It is a figure which shows the structure of pSK1127 (panel A) and pSK811 (panel B).

Claims (8)

A carbonyl reductase comprising the protein according to any one of (a) to (e) below and having the physicochemical properties shown in the following (1) and (2).
(A) a protein encoded by a polynucleotide comprising the base sequence set forth in SEQ ID NO: 1.
(B) A protein comprising the amino acid sequence set forth in SEQ ID NO: 2.
(C) A protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted, and / or added in the amino acid sequence set forth in SEQ ID NO: 2.
(D) A protein comprising an amino acid sequence having 70% or more homology with the amino acid sequence set forth in SEQ ID NO: 2.
(E) a protein encoded by a polynucleotide that hybridizes under stringent conditions with a polynucleotide comprising a complementary sequence of the nucleotide sequence set forth in SEQ ID NO: 1.
(1) Action The reduced β-nicotinamide adenine dinucleotide is used as a coenzyme to reduce the ketone to produce (S) alcohol.
(2) Substrate specificity Reduction of 2,3'-dichloroacetophenone to produce (R) -2,3'-dichloro-1-phenylethanol with asymmetric selectivity greater than 70% (> 70% ee) To do.   A vector encoding the carbonyl reductase according to claim 1.   The vector according to claim 2, wherein the enzyme is expressed in at least one bacterium belonging to the genus Streptomyces.   The vector according to claim 2 or 3, wherein the vector comprises DNA in which the DNA encoding the enzyme is operably linked downstream of the promoter of the L11 protein gene.   A transformant transformed with the vector according to claim 2.   The transformant according to claim 5, which belongs to the genus Streptomyces.   A method for producing a carbonyl reductase, comprising a step of culturing the transformant according to claim 5 or 6 and collecting the expressed carbonyl reductase.   A step of contacting the ketone with the carbonyl reductase according to claim 1, a transformant transformed with a vector encoding the enzyme, or a treated product of the transformant, and collecting the optically active alcohol produced. The manufacturing method of optically active alcohol.

Images