JP2004344172A - Gene encoding adseverin - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a gene encoding adseverin being an actin-regulating protein. <P>SOLUTION: There are provided a base sequence encoding a specific amino acid sequence, a base sequence corresponding to partially substituted, deleted or added amino acid sequences or a DNA including a base sequence hybridizable to these base sequences; a recombinant vector including the gene, a transformant formed by the vector, a method for producing adseverin using the gene, a recombinant adseverin protein obtained by the production method, an oligonucleotide hybridizable to a base sequence encoding a specific amino acid sequence, a method for inhibiting the formation of adseverin in animals through administration of the oligonucleotide to the animals, and an antibody for recognizing the adseverin protein. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

The present invention relates to a gene encoding an adseverin protein, which is a Ca ²⁺ -dependent actin filament cleaving protein and has a function of controlling exocytosis, a recombinant vector containing the gene, and a transformant using the vector. And a method for producing adseverin using the gene, and a recombinant adseverin protein obtained by the method. In the present invention, an oligonucleotide capable of specifically hybridizing with the nucleotide sequence encoding the adseverin protein and an oligonucleotide capable of specifically hybridizing with the nucleotide sequence encoding the adseverin protein are administered to the animal. A method for suppressing the production of adseverin, and an antibody that recognizes adseverin protein.

  In many secretory cells, secreted products, such as neurotransmitters and hormones, are stored in the form of granules or vesicles in the resting state, and when cells receive an appropriate signal, they excrete from the cell by exocytosis. Is released. In the course of exocytosis, granules and vesicles move toward the plasma membrane, contact and fuse with it, opening the membrane.

This exocytosis is largely controlled by the intracellular free calcium concentration [Ca ²⁺ ] _i (Knight et al., Ann. NY Acad. Sci. 493: 504-523, 1987). That is, [Ca ²⁺ ] _i is low in resting cells, and exocytosis is thought to be inhibited by several [Ca ²⁺ ] _i- dependent steps (Burgoyne, Biochem. BiophySs. Acta 779: 201-216, 1984). Many secretory cells, including chromaffin cells, which are secretory cells of the adrenal medulla, have a submembrane microfilament network consisting of actin filaments, which migrate granules and vesicles to the plasma membrane. (Seek et al., FEBS Lett. 207: 110-114, 1986; Lelkes et al., FEBS Lett. 208: 357-363, 1986). Prior to release of secretory products by exocytosis, [Ca ²⁺ ] _i is increased by a Ca ²⁺ -dependent mechanism and this network is degraded (Vitale et al., J. Cell Biol. 113: 1057). -1067, 1991).

  Here, actin is a globular protein having a molecular weight of 42 kD which is universally present in eukaryotic cells and is a cytoskeletal protein closely involved in contraction of muscle cells and the like, and mono-actin polymerizes into filaments. Approximately 100% of actin polymerizes in vitro under physiological ionic strength to form a filament, but in actual cells, filament (gel) and monomer (sol) are acted upon by various actin regulatory proteins. Is reversibly regulated and changes in response to extracellular stimuli.

Gelsolin, a protein that appears to be directly involved in this process, has been identified in ucyclomuffin cells (Yin et al., Nature 281: 583-586, 1979). Gelsolin has a Ca ²⁺ -dependent actin filament cleaving activity in vitro, and also has a barbed end capping and nucleation activity of actin filaments. More recently, a different substance, adseverin (a 74 kDa protein) having similar activity to gelsolin, has been isolated from bovine adrenal medulla by a group of Professor Nonomura et al., Department of Pharmacology, School of Medicine, The University of Tokyo (Maekawa et al.). , J. Biol. Chem. 265: 10940-10942, 1990).

  Gelsolin is relatively widely distributed in various tissues and plasma (Stosselet al., Annu. Rev Cell Biol. 1: 353-402, 1985), but the distribution of adseverin is mainly limited to tissues having a secretory function. (Sakurai et al., Neuroscience 38: 743-756, 1990). Such a difference in tissue distribution suggests that adseverin is more involved in the secretory process than gelsolin, that is, in controlling the release of neurotransmitters, endocrine substances or bioactive substances. Therefore, elucidating the structure and function of adseverin will be very interesting because it will clarify the role of actin filaments in exocytosis and its regulatory mechanism.

  Conventionally, the idea that this process is regulated by the action of a fusion protein or the like has been mainly used (Takamichi Nishizaki, “Role of cytoplasmic protein in exocytosis”, Cell Engineering, 13: 353-360, 1994). Nonomura's hypothesis is new in that this process is ultimately due to the actin-myosin interaction, and the regulation of myosin by myosin light chain kinase (Sumiko Mochida, "Myosin light chain kinase neurotransmitters"). ROLE OF MYOSIN LIGHT CHAIN KINASE IN RELEASE AND ITS REGULATION ", Cell Engineering, 13: 381-388, 1994), but a completely new breakthrough in which actin-mediated regulation from the actin side is occurring in non-myocytes. Concept.

  Actin is thought to be exposed extracellularly due to cell disruption, induce or enhance platelet aggregation in blood, and trigger thrombus growth (Scarborough et al., Bio, chem. Biophys. Res. Commun.). .100: 1314-1319, 1981). On the other hand, adseverin has an activity similar to gelsolin, that is, an actin filament cutting activity, in vivo as described above. From these facts, it is considered that adseverin may be used for pharmaceutical applications such as thrombus-related drugs (eg, thrombostatic agents).

  Furthermore, by producing and administering an antisense DNA sequence from a base sequence encoding adseverin, for example, release of a physiologically active substance may be suppressed at the gene level. In particular, since adseverin may be deeply involved in the growth of vascular smooth muscle, it is considered that administration of antisense DNA suppresses the function of adseverin, thereby suppressing smooth muscle proliferation. Therefore, administration of the antisense DNA of adseverin can be used as an inhibitor of vascular stenosis at the time of vascular transplantation such as bypass surgery or an inhibitor of restenosis after percutaneous transluminal coronary angioplasty (PTCA). Has the potential.

  To use adseverin, which is an actin regulatory protein, for the above-mentioned pharmaceutical uses, it is necessary to obtain it in a large amount and uniformly. However, conventionally, it has been difficult to obtain a large amount of uniform adseverin by a method of isolating adseverin from animal tissue itself or a culture supernatant of a cell producing the same. Therefore, it has been desired to clarify the nucleotide sequence of the gene encoding adseverin and to produce adseverin in large quantities by using gene recombination technology.

  An object of the present invention is to determine the nucleotide sequence of a gene encoding adseverin. In addition, a large amount of adseverin is produced using a gene recombination technique using a recombinant vector containing the sequence, and screening using the same is performed. It is to show the possibility of developing a new drug by constructing a system. Another object is to produce antisense DNA based on the nucleotide sequence of the gene encoding adseverin and use it as an inhibitor of adseverin production. Another object is to provide an antibody that recognizes adseverin protein.

  The present inventors isolated and purified adseverin from bovine adrenal medulla and characterized it (Sakurai et al., Neuroscience 38: 743-756, 1990; Sakurai et al., J. Biol. Ohm). 266: 4581-4584, 1991: Sakurai et al., J. Biol. Chem. 266: 15979-15983, 1991).

Furthermore, a hydrolyzed fragment of this protein is obtained, an oligonucleotide primer is synthesized based on partial information of the amino acid sequence, and MDBK cells (JCRB-Cell: Cancer Research Promotion Foundation), a cell line established from bovine kidney. CDNA was prepared from mRNA prepared from the Foundation Co., Ltd.) by reverse transcription reaction, and a DNA fragment encoding bovine adseverin was specifically amplified by polymerase chain reaction (PCR) using the synthetic primers described above. Next, a cDNA library prepared from bovine adrenal medulla was screened using this ³² P-labeled DNA fragment as a probe, and a gene encoding the target actin filament-cleaving protein was assembled from the three overlapping clones obtained. We succeeded in elucidating the nucleotide sequence.

  The present inventors then screened a cDNA library prepared from human kidney mRNA by plaque hybridization under low-rigidity conditions using the bovine adseverin cDNA as a probe.As a result, the human adseverin cDNA was isolated and its entire nucleotide sequence was determined. Successfully clarified.

  That is, the present invention provides a gene encoding adseverin. More specifically, the present invention includes a base sequence encoding the amino acid sequence shown in SEQ ID NO: 4 or 5 in the sequence listing, a base sequence obtained by partially substituting, deleting or adding the same, or a base sequence hybridizing thereto DNA is provided.

  The present invention also provides a recombinant vector containing a gene encoding the adseverin protein.

  The present invention further provides a prokaryotic or eukaryotic host cell transformed with a recombinant vector comprising a gene encoding the adseverin protein.

  The present invention further comprises culturing a transformant obtained by transforming with a recombinant vector containing a gene encoding an adseverin protein, isolating and purifying the produced target protein, and Provided is a method for producing an adseverin protein.

  The present invention further provides a recombinant adseverin protein produced by the above production method.

  The present invention further provides an oligonucleotide capable of specifically hybridizing with a gene encoding adseverin.

  The present invention further provides a method for suppressing the production of adseverin in an animal, the method comprising administering to the animal an oligonucleotide capable of specifically hybridizing with a gene encoding adseverin.

  The present invention further provides an antibody that recognizes the adseverin protein.

  Furthermore, the present inventors performed in situ hybridization using a labeled adseverin cDNA fragment as a probe, examined the expression of adseverin mRNA in tissues, and clarified the distribution of adseverin in tissues. In addition, the actin cleavage domain in adseverin was also examined.

  The cDNA encoding adseverin can be obtained, for example, by preparing mRNA from cells producing adseverin and converting it to double-stranded cDNA by a known method.

  In the present invention, as a source of mRNA, for bovine adseverin, MDBK cells and bovine adrenal medulla (Madin et al., Proc. Soc. Exp. Biol. 98: 574-576, 1958), which are cell lines established from bovine kidney, are used. Regarding human adseverin, CLONTECH Laboratories Inc. Although human kidney mRNA purchased from the company was used, the invention is not limited thereto, and adrenal medulla chromaffin cells, kidney medulla, thyroid tissue homogenate, and the like may be used.

  To prepare RNA, total RNA can be prepared, for example, by guanidine thiocyanate treatment followed by cesium chloride density gradient centrifugation according to the method of Chirgwin et al. (Biochemistry 18: 5294-5299, 1979). In addition, the method can also be carried out by a method used when cloning a gene of another physiologically active protein, for example, a treatment with a surfactant or a phenol in the presence of a ribonuclease inhibitor such as a vanadium complex.

  To obtain a double-stranded cDNA from the mRNA thus obtained, for example, using the mRNA as a template, an oligo (dT) or random primer complementary to the poly A-chain at the 3 ′ end, or a part of the amino acid sequence of adseverin A reverse transcription reaction is performed using a synthetic oligonucleotide corresponding to the part as a primer to synthesize DNA (cDNA) complementary to mRNA.

In the present invention, cDNA of bovine adseverin was obtained by the following method. That is, a reverse transcription reaction using a random hexamer as a primer was performed, and then amplified by PCR using a degenerate primer to obtain a PCR product representing about 700 bp of adseverin partial cDNA. The PCR product was subcloned into pBluescript SK (-) (Stratagene). The λgt11 cDNA library prepared from bovine adrenal medulla was then screened using the ³² P-labeled cloned PCR product as a probe. In the present invention, three plaques were thus obtained, and a cDNA encoding the desired adseverin was assembled from the overlapping nucleotide sequences. The open reading frame was found to be a 80527 dalton protein consisting of 715 amino acids (see SEQ ID NO: 4 in the sequence listing).

In addition, cDNA of human adseverin was obtained by the following method. That is, double-stranded cDNA was synthesized using TimeSaver ^™ cDNA Synthesis Kit purchased from PharmaCia.

The synthesized double-stranded cDNA was subjected to size fractionation by Spun Column or agarose electrophoresis contained in the above Kit. In the former case, the size was about 400 base pairs (bp) or more. Only cDNA having a size of 3 kbp was recovered. An adapter was ligated to this end and incorporated into the vector. The cDNA incorporated into the vector was packaged using GIGAPACK ^R II PACKAGING EXTRACT purchased from STRATAGENE to obtain a cDNA library.

Then, using a bovine adseverin cDNA labeled with ³² P and heat-denatured bovine adseverin cDNA as a probe, a cDNA library was screened under reduced strictness conditions to obtain one positive phage clone. This cDNA portion was amplified by the PCR method and incorporated into a plasmid vector to obtain clone pADa-17. When the nucleotide sequence of this clone was partially determined, it showed very high homology (80-90%) with the nucleotide sequence of bovine adseverin cDNA. On the other hand, this clone is a human counterpart of adseverin because it is a family protein of adseverin, shows only 60% or less homology with gelsolin whose nucleotide sequence has already been reported, and is a distinctly different gene. It was speculated. However, this clone was about 1 kbp in total length and was not considered to contain the entire coding region, so further screening was required.

Therefore, plaque hybridization was performed under normal conditions with an increased degree of rigor, using the above clone pADa-17 as a probe. At that time, for the purpose of efficiently obtaining a full-length clone, a library newly prepared from human kidney mRNA and enriched with only 2-3 kbp cDNA was used. From this, five positive phage clones were obtained and cut out into a plasmid (pBluescript ^R SK (-) vector) by ExAssist ^™ / SOLR SYSTEM to obtain plasmid clones phAD-2 to phAD-2-6. Of these, the base sequences of phAD-2 and phAD-4 were determined, and the sequences shown in SEQ ID NO: 5 in the sequence listing were determined by combining both sequences. From this nucleotide sequence, an open reading frame consisting of 715 amino acids with the ATG starting at position 79 as the start codon (Met) was found. FIG. 9 shows the result of comparing this amino acid sequence with the amino acid sequence of bovine adseverin. Both show about 92% homology at the amino acid level, and are considered to be very well conserved across species. It was also revealed that amino acids having high similarity were often used for amino acids that did not completely match. Also, at the base level, about 90% homology is observed in the coding region, but the homology is rapidly lost after the stop codon, which is considered to reflect the species difference.

In FIG. 9, a portion surrounded by a square is a region where phospholipids are presumed to be bound. Both (112) KGGLKYKA (119) and (138) RLLHVKGRR (146), which are considered to be phospholipid binding regions in bovine adseverin, were completely conserved in human adseverin. It was suggested that the difference in sensitivity between adseverin and gelsolin to phospholipids might be due to the difference in amino acid sequence in this region. It has been suggested that adseverin is present in the cell near the cell membrane, and it would be important if the activity is regulated by the components of the cell membrane. In particular, considering that gelsolin is similarly activated by Ca ²⁺ , it is highly likely that the proper use of both depends on regulation by this phospholipid.

  Using the thus-obtained gene encoding the cloned adseverin of the present invention, it is possible to produce adseverin in large quantities by genetic recombination techniques and use it for pharmaceutical applications.

  That is, prokaryotic or eukaryotic host cells can be transformed by incorporating the gene encoding adseverin of the present invention into an appropriate vector.

  Furthermore, the gene can be expressed in each host cell by introducing an appropriate promoter or a sequence relating to expression into these vectors. In addition, by linking a gene encoding another polypeptide to the gene of interest and expressing it as a fusion protein, facilitating purification, increasing the expression level, or by performing an appropriate treatment in the purification step, It is also possible to cut out the target protein.

  In general, eukaryotic genes are considered to exhibit polymorphism, as is known for the human interferon gene, which may replace one or more amino acids, In some cases, there is a change in the sequence but no change in the amino acid.

  In addition, a polypeptide lacking or adding one or more amino acids in the amino acid sequence of SEQ ID NO: 4 or 5 in the sequence listing, or a polypeptide in which amino acids are substituted with one or more amino acids, may be an actin filament. May have cleavage activity. For example, it has already been known that a polypeptide obtained by converting a nucleotide sequence corresponding to cysteine of the human interleukin 2 (IL-2) gene to a nucleotide sequence corresponding to serine retains IL-2 activity. (Wang et al., Science 224: 1431, 1984). Techniques for preparing these variants of the gene encoding adseverin are known to those skilled in the art.

  Further, as described above, bovine adseverin and human adseverin have high homology, and amino acids that are not completely identical often use similar amino acids. Therefore, genes in which bovine adseverin and human adseverin are partially substituted or chimeric genes thereof are also within the scope of the present invention.

  In addition, when expressed in eukaryotic cells, many of them are added with sugar chains and can control sugar chain addition by converting one or more amino acids. May have. Therefore, all of the genes encoding those polypeptides are included in the present invention as long as the obtained polypeptides have the actin filament cleavage activity using the artificially modified human adseverin encoding gene of the present invention. It is.

  Furthermore, the present invention also includes a gene in which the obtained polypeptide has an actin filament cleaving activity and hybridizes with the gene shown in SEQ ID NO: 4 or 5. It should be noted that the hybridization conditions can be the same as those used in ordinary probe hybridization (for example, Molecular Cloning: A Laboratory Manual, Sambrook et al., Cold Spring Harbor Laboratory Press, 1989).

  Expression vectors can include an origin of replication, a selectable marker, a promoter, an RNA splice site, a polyadenylation signal, and the like.

  Prokaryotic host cells among the hosts used in the expression system include, for example, Escherichia coli and Bacillus subtilis. Among eukaryotes, host cells for eukaryotic microorganisms include, for example, yeast and slime mold. Alternatively, insect cells such as Sf9 may be used as host cells. Furthermore, host cells derived from animal cells include, for example, COS cells, CHO cells, and the like.

  The protein produced by culturing the transformant transformed with the gene encoding adseverin as described above can be isolated and purified from the inside or outside of the cell.

  In addition, for separation and purification of adseverin, separation and purification methods used for ordinary proteins can be used. For example, various types of chromatography, ultrafiltration, salting out, dialysis and the like can be appropriately selected and used in combination.

  According to the present invention, antisense DNA can be prepared based on the nucleotide sequence of a gene encoding adseverin. Antisense DNA has a complementary nucleotide sequence to mRNA, and forms a base pair with mRNA to block the flow of genetic information and suppress the synthesis of the end product, adseverin protein. The antisense DNA that can be used in the present invention is an oligonucleotide that can specifically hybridize with a base sequence encoding the amino acid sequence shown in the range number 4 or 5 in the sequence listing.

As used herein, the term "oligonucleotide" refers to oligonucleotides and analogs thereof formed from naturally occurring bases and sugar moieties linked by native phosphodiester bonds. Thus, the first group included by the term is a naturally occurring species or a synthetic species produced from a naturally occurring subunit or a homolog thereof. A subunit refers to a base-sugar combination bonded to an adjacent subunit by a phosphodiester bond or another bond. Also, a second group of oligonucleotides are analogs thereof, which refers to residues that function similarly to oligonucleotides, but have non-naturally occurring portions. These include oligonucleotides that have been chemically modified at the phosphate group, sugar moiety, 3 ', 5' end to increase stability. For example, oligo phosphorothioates obtained by substituting one of oxygen atoms of the phosphodiester group between nucleotides sulfur, such as oligo-methyl phosphonate substituted on -CH ₃ and the like. Further, the phosphodiester bond may be substituted with another structure that is nonionic and nonchiral. In addition, modified oligonucleotide forms may be used as oligonucleotide analogs, ie, species containing purines and pyrimidines other than those normally found in nature.

  The oligonucleotide according to the invention preferably has 8 to 40, more preferably 15 to 30 subunits.

  In the present invention, the target portion of the mRNA to which the oligonucleotide hybridizes is preferably a transcription initiation site, a translation initiation site, an intron / exon binding site or a 5 ′ cap site, but the steric hindrance is considered in consideration of the secondary structure of the mRNA. There should be no sites selected.

  The oligonucleotide according to the present invention can be produced by a synthesis method known in the art, for example, a solid phase synthesis method using a synthesizer such as Applied Biosystems. Other oligonucleotide analogs, such as phosphorothioate and alkylated derivatives, can be produced using similar methods (Akira Murakami et al., “Synthesis of Functional Antisense DNA”, Organic Synthetic Chemistry, 48 (3)). : 180-193, 1990).

  The administration of an oligonucleotide capable of specifically hybridizing with the gene encoding adseverin of the present invention to an animal can suppress the production of adseverin in the animal. Also, adseverin may be involved in the proliferation of vascular smooth muscle as described above. Proliferation of vascular smooth muscle is considered to be one of the causes of vascular stenosis at the time of vascular transplantation such as bypass surgery and vascular restenosis observed in 30 to 40% of PTCA cases. Therefore, the administration of antisense DNA of the gene encoding adseverin suppresses the proliferation of vascular smooth muscle, and can be used as an agent for preventing or treating such stenosis. For example, it is conceivable to prevent blood vessel stenosis by immersing a transplanted blood vessel in a solution containing the oligonucleotide of the present invention before transplantation, and then transplanting the oligonucleotide after taking up the oligonucleotide into cells. In addition, restenosis can be suppressed by administering the oligonucleotide of the present invention using a PTCA catheter or a stent.

  In order to prepare an antibody recognizing the adseverin protein of the present invention, adseverin, which serves as an antigen, is added to an animal using an ordinary method (see, for example, Shinsei Kagaku Kenkyusho 1, Protein I, 389-397, 1992). It can be obtained by immunizing and collecting and purifying antibodies produced in the living body. The anti-adseverin antibody thus obtained can be used for various immunological measurement methods such as an enzyme immunoassay such as ELISA, a radioimmunoassay, and an immunofluorescence method.

  The method for obtaining the gene encoding adseverin of the present invention and the expression of the gene in a host cell will be described in detail in the following examples, but the present invention is not limited by these examples.

Example 1 Isolation and Purification of Bovine Adseverin Bovine adrenal gland was obtained from a slaughterhouse. All the following operations were performed at 4 ° C. The adrenal medulla was carefully separated from the cortex and minced with scissors. 80 g of the obtained adrenal medulla was mixed with 40 mM of Tris-HCl, 4 mM of EGTA, 2 mM of EDTA, 1 mM of DTT, 1 mM of DFP, 1 mM of PMSF and 10 ⁻⁶ M E-64-c, 10 μg / ml aprotinin (Trasylol, Bayer) and 0 g in buffer a (pH 8.0) 3 volume containing .02% NaN _3, and homogenized in a Waring blender. The homogenate was centrifuged at up to 13,000 g for 30 minutes and the supernatant was filtered, then centrifuged at up to 150,000 g for 90 minutes. One mole of CaCl ₂ and MgCl ₂ solutions were added to the supernatant to a final concentration of 0.5 and 1 mM, respectively. This solution was DNase I-Affi previously equilibrated with buffer B (pH 7.5) containing 50 mM KCl, 20 mM Tris-HCl, 0.5 mM CaCl ₂ , 1 mM MgCl ₂ , 0.1 mM PMSF and 0.02% NaN _3. -Applied to a Gel 15 column. The column was washed with buffer B and then with buffer B where the KCl concentration was changed from 50 mM to 0.6M.

The Ca ²⁺ -sensitive protein was then eluted with Modification Buffer B containing 10 mM EGTA instead of 0.5 mM CaCl ₂ and then with Modification Buffer B containing 6 M urea. Three Ca2 ⁺ -sensitive actin binding proteins and actin (MW 42,000) were eluted by the EGTA-containing buffer. The molecular weights of these three proteins were estimated by SDS PAGE to be 86,000, 84,000 and 74,000, respectively (FIG. 1, lanes 1-4). The column was washed with buffer B, regenerated and stored at 4 ° C.

The pH of the collected EGTA eluate was adjusted to 8.2 with 1 M Tris, and a solution containing 50 mM KCl, 20 mM Tris-HCl, 1 mM EGTA, 0.1 mM PMSF, 7 mM 2-mercaptoethanol, and 0.02% NaN ₃ ( It was applied to a Q-Sepharose ion exchange column (1.5 × 12 cm) which had been equilibrated at pH 8.2). The protein was eluted with a linear gradient of 50 to 250 mM KCl, followed by 1 M KCl. The first peak corresponding to a KCl concentration of 0 to 150 mM contained a protein having a molecular weight of 74,000 and a small amount of contaminating proteins (FIG. 1, lane 6). Proteins with molecular weights of 86,000 and 84,000 as well as actin were contained in the second peak, 1M KCl eluate (FIG. 1, lane 7).

Fractions containing the protein with a molecular weight of 74,000 was recovered, NaCl 150 mM and concentrated, Tris-HCl 20mM, EGTA 1mM , equilibrated with a buffer containing DTT 0.1 mM and 0.02% NaN ₃ C (pH7.0) The gel was subjected to a gel filtration HPLC column (TSK-G3000SW, Tosoh Corporation) (FIG. 1, lane 8). Peak fractions were collected and stored on ice.

Example 2: Proteolysis of bovine adseverin (1) Degradation by Staphylococcus V8 protease Adseverin in digestion buffer C (1 mM EGTA, 1 mM DTT, 0.02% NaN ₃ and 50 mM NH ₄ HCO ₃ ) was added at room temperature to 1 : 25 (wt / wt) at a ratio of Staphylococcus V8 protease. The reaction was stopped by adding 1 mM of DFP and analyzed by SDS-PAGE. As a result, adseverin was degraded into two major fragments with molecular weights of 42,000 and 39,000. After prolonged digestion with V8 protease, the fragment with a molecular weight of 39,000 was further decomposed into fragments with a molecular weight of 28,000 and a molecular weight of 15,000, while the fragment with a molecular weight of 42,000 was stable.
(2) Degradation by Trypsin Adseverin in buffer D (1 mM EGTA, 1 mM DTT, 0.02% NaN ₃ and 20 mM Tris-HCl, pH 8.0) was degraded by trypsin at a ratio of 1: 200. After 60 minutes at 25 ° C., 200 mM PMSF in ethanol was added to a final concentration of 4 mM. Analysis by SDS-PAGE showed that in this case also, two fragments having a molecular weight of 42,000 and 39,000 were formed, and were not further decomposed over a long period of time.

In addition, by using a recognition reaction between the two kinds of anti-gelsolin polyclonal antibodies and the above two fragments, it was confirmed that the fragment having a molecular weight of 39,000 was not a decomposition product of the fragment having a molecular weight of 42,000.
(3) Purification of degradation product by V8 protease The degradation product by V8 protease was applied to an HPLC DEAE ion exchange column (DEAE-SPW, Tosoh) that had been equilibrated with buffer D in advance. Fragments with a molecular weight of 39,000 adsorbed on the column, whereas fragments with a molecular weight of 42,000 eluted with a gradient of 0-150 mM NaCl and were obtained as a single peak at 10 mM NaCl. Then, when buffer D containing 0.5 mM CaCl ₂ was used instead of 1 mM EGTA, a fragment having a molecular weight of 39,000 was eluted with 50 mM NaCl, and only a small amount of a fragment having a molecular weight of 42,000 was recovered. The two purified fragments derived from the V8 protease digestion showed almost the same pattern on trypsin digest and SDS-PAGE.
(4) Determination of N-terminal amino acid sequence The N-terminal amino acid sequences of the two fragments purified in (3) and natural adseverin were examined. The N-terminus of native adseverin and a fragment having a molecular weight of 42,000 were blocked, but the amino acid sequence near the N-terminus of the fragment having a molecular weight of 39,000 was analyzed by Edman degradation. :
KVAHVKQIPFDA
It became clear that it had. This sequence is linked to known actin filament cleaving proteins, gelsolin (Kwiatkowski et al., Nature 323: 455-458, 1986) and villin (Bazari et al., Proc. Natl. Acad. Sci. US. A. 85: 4986-4990, 1988). As a result, as shown in FIG. 2, this sequence was similar to the hinge region between segments 3 and 4 of the conserved repeats of gelsolin and villin, ie, near the middle of these molecules. Thus, fragments of molecular weight 42,000 is a protein in half the NH ₂ terminus of Adozeberin (hereinafter "N42" hereinafter), the protein fragments having a molecular weight of 39,000 in the half of the COOH-terminal side of Adozeberin (hereinafter (Referred to as "C39").
(5) Actin binding property of N42 and C39 The actin binding property of N42 and C39 obtained as described above was tested using an actin monomer (G-actin) bound to agarose beads. As a result, it was revealed that both N42 and C39 bind to G-actin in the presence of calcium, but do not bind to G-actin in the absence of calcium.
(6) Identification of functional domain of adseverin (N42 degradation by thermolysin)
When N42 was digested with one of the metalloproteinases, thermolysin, a total of 5 fragments were obtained, a fragment having a molecular weight of 31,000, 30,000, 16,000 and two different fragments having a molecular weight of 15,000. Was purified by HPLC. The fragments with molecular weights of 31,000 and 30,000 were named TL1 and TL2, respectively, and the other three fragments were designated TL3 (molecular weight 15,000), TL4 (molecular weight 16,000) and TL5 (molecular weight 15 , 000). The N-terminals of TL1 and TL3 were not detected by antibody A and were blocked in the same manner as N42 and native adseverin. Based on these results and the fact that TL2 and TL5 reacted with antibody A, N42 had two cleavage sites, and the fragment mapping was estimated as shown in FIG.

When the amino acid sequences of TL4 and TL5 in which the N-terminus was not blocked were analyzed by Edman degradation, the N-terminal amino acid sequence of TL4 was the sequence of SEQ ID NO: 2 in the following sequence listing:
VLTNDLTAQ
Which shares homology with the sequence of the hinge region between segments 1 and 2 of gelsolin. On the other hand, the N-terminal amino acid sequence of TL5 is the sequence of SEQ ID NO: 3 in the following sequence listing:
ITNRK
Which had homology to the sequence of the hinge region between segments 2 and 3 of gelsolin (FIG. 3).

  Therefore, it is considered that adseverin has a similar structure to gelsolin. The N-terminal half of adseverin, like gelsolin, consists of three repetitive segments, each corresponding to a ~ 15 kDa proteolytic fragment.

Example 3: Synthesis of degenerate primers Includes the N-terminal amino acid sequence of the second segment of N42 (S2) determined in Example 2 and all possible codons for the gene encoding the N-terminal amino acid sequence of C39 Mixed primers were synthesized with an Applied Biosystems 380B DNA synthesizer. BamHI and ClaI sites were added to the 5 'ends of the sense and antisense primers, respectively.

The sequence of the degenerate primer is as follows:
5 '. . . GATGCGGATCCAA (C / T) GA (C / T) (C / T) T (A / C / G / T) AC (A / C / G / T) GC (A / C / G / T) CA. . . . 3 'and 5'. . . GATGCATCGATAC (A / G) TG (A / C / G / T) GC (A / C / G / T) AC (C / T) TT (C / T) TC. . . 3 '.

Example 4: Reverse transcription reaction and PCR
From MDBK cells, a cell line established from bovine kidney (JCRB-Cell: obtained from Cancer Research Foundation: Madin et al., Proc. Soc. Exp. Biol. Med. 98: 574-576, 1958). RNA was prepared according to the method of Chirgwin et al. (Biochemistry 18: 5294-5299, 1979).

  Reverse transcription and PCR were performed by the method of Kawasaki (in PCR Protocols: A Guide to Methods and Application (Innis et al. Eds) pp. 21-27, Academic Press, San Diego, 1990). Random hexamer (Pharmacia) was used for reverse transcription, and the degenerate primers obtained in Example 3 were used for PCR (Lee et al., In PCR Protocols: Guide to Methods and Application (Innis et al.) Eds) pp. 46-53, Academic Press, San Diego, 1990). The conditions of PCR were as follows: First, 5 cycles were performed at 94 ° C. for 1 minute, 37 ° C. for 1 minute, and 72 ° C. for 2 minutes. However, at this time, the temperature was slowly raised from 37 ° C. to 72 ° C. over 2 minutes and 30 seconds. Next, 29 cycles were carried out by a normal method at 94 ° C. for 1 minute, 50 ° C. for 1 minute and 72 ° C. for 2 minutes as one cycle. After one cycle of 10 minutes, it was placed at 4 ° C.

Example 5: Cloning of PCR product When the PCR product obtained in Example 4 was subjected to 1% agarose electrophoresis containing 1 μg / ml of ethidium bromide, a major band was observed at about 700 bp. This was cut out and purified using a GENECLEAN II kit (BIO 101 Inc.). This size could be expected from the position of the fragment on which the degenerate primer was based, based on the assumption that the primary structure of adseverin and gelsolin is highly homologous. The purified product was digested with BamHI and ClaI and cloned into pBluescript SK (-) (Stratagene).

  When the sequence of the cloned PCR product was determined, the nucleotide sequence encoding the N-terminal portion of the third segment (S3) of N42 was contained in this PCR product, and this was actually a part of the adseverin CDNA. Was confirmed. The high homology between this sequence and the human gelsolin sequence (64% identity at the nucleotide level) also supported this view.

The PCR product thus obtained was labeled with ³² P and used as a probe in the following screening.

Example 6: Library screening A λgt11 cDNA library (CLONTECH) prepared from bovine adrenal medulla was subjected to a standard method (Sambrook et al., Molecular Cloning: A Laboratorv Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory). New York, 1989), and screened with a ³² P-labeled cloned PCR product representing the partial cDNA of adseverin obtained in Example 5. After the two rounds of screening, well-isolated positive plaques were removed and the phage in each plaque were released into 200 μl of distilled water and incubated for 1 hour at room temperature. The phage solution was frozen, thawed and heated at 90 ° C. for 10 minutes.

Using the appropriate amount of phage solution as a template, the recombinant phage DNA insert was amplified by PCR using two primers containing sequences from upstream and downstream of the EcoRI specific site of λgt11. The PCR conditions are the same as in Example 4. XhoI and NotI sites were added to the 5 'ends of these primers, respectively. One of the primers has the following sequence:
5 '. . . AAAACTCGAGGGTGGCGACGACTCC. . . 3 '
And the other one has the following sequence:
5 '. . . AAAGCGGCCGCTTGACACCAGACCCAA. . . 3 '
Had.

  After PCR, the reaction mixture was subjected to 1% agarose gel electrophoresis. The amplified insert DNA was cut out and purified with a GENECLEAN II kit. After digestion with XhoI and NotI, the inserted cDNA was cloned into pBluescript SK (-) which had been digested with XhoI and NotI in advance.

Using the cloned PCR product as a probe, a cDNA library of bovine adrenal medulla was screened. Three overlapping cDNA clones purified from 2 × 10 ⁶ recombinant phages to a single plaque were obtained.

  The three overlapping cDNA clones are indicated by numbers 19, 5 and 21 in FIG. The nucleotide sequences of these cloned DNAs were examined in both directions by the dideoxy chain termination method (Sanger et al., Proc. Natl. Acad. Sci. USA 74: 5463-5467, 1977). The entire nucleotide sequence of adseverin was determined. This nucleotide sequence is shown as SEQ ID NO: 4 in the sequence listing. FIG. 4 shows a restriction enzyme map of the assembled cDNA.

  The nucleotide sequence of the assembled cDNA and the amino acid sequence corresponding to the longest open reading frame are also shown in SEQ ID NO: 4 in the sequence listing. The open reading frame encodes a protein of 80527 daltons consisting of 715 amino acids. The first ATG is 27 nucleotides 3 'from the beginning of the clone and represents a sequence consistent with vertebrate translation initiation. Comparison of the adseverin cDNA sequence with gelsolin and villin sequences also supported that the ATG was the start codon and that the entire coding sequence of adseverin was included in the assembled cDNA.

  A 2418 bp cDNA containing the entire coding region of bovine adseverin assembled from the above three overlapping clones using the AccI and HindIII sites was then incorporated into the XhoI and NotI digestion sites of pBluescript SK (-) to produce pSK-adseverin. did.

Example 7: Comparison of the predicted amino acid sequence of adseverin with the amino acid sequence of human gelsolin and villin From biochemical analysis and the predicted amino acid sequence from the cDNA, both human gelsolin and villin have six homologous segments (Bazari et al. Natl.Acad.Sci.U.S.A. 85: 4986-4990, 1988; Matusdaira et al., Cell 5139-140, 1988; Way et al., J. Mol. Biol.203: 1127. −1133, 1988). Segments 1, 2, and 3 have higher homology with segments 4, 5, and 6, respectively, than in other combinations. Analysis of the predicted amino acid sequence of adseverin revealed that adseverin also had six homologous segments. Furthermore, segments 1 to 6 have homology to the corresponding segments of gelsolin and villin, respectively (FIG. 5). As is clear from FIG. 5, motifs B, A and C present in each of the six segments of gelsolin and villin were also present in each of the six segments of adseverin. Therefore, it was shown that adseverin belongs to the gelsolin family protein.

２つの推定配列のうちの１つはコンセンサス配列と完全に一致し、また第１セグメントにある他方はコンセンサス配列と１アミノ酸だけ異なっており、コンセンサス配列のＣＯＯＨ末端が塩基性アミノ酸の代わりにアラニンとなっている。このため、ゲルゾリンの対応するドメインよりもアドゼベリンのこのドメインの塩基性が低くなる。この相違は、ホスファチジルインシトール４，５−ビスリン酸やホスファチジルインシトール４−モノリン酸以外の酸性リン脂質、例えばホスファチジルインシトールやホスファチジルセリンがアドゼベリンの切断活性を阻害できても、ゲルゾリンの切断活性は阻害できない、ということを部分的に説明する理由となろう。 Putative polyphosphoinositide binding sequences present in gelsolin and villin were also found in regions corresponding to regions in gelsolin and villin, ie, the first and second segments of adseverin (S1, S2). This is consistent with the fact that the cleavage activity of the adseverin protein fragment corresponding to S1-2 is inhibited by polyphosphoinositide. These sequences are shown in boxes in FIG. 5 and are shown schematically in Table 1.

One of the two putative sequences completely matches the consensus sequence and the other in the first segment differs from the consensus sequence by one amino acid, and the COOH terminus of the consensus sequence is replaced by alanine instead of a basic amino acid. Has become. This makes the domain of adseverin less basic than the corresponding domain of gelsolin. The difference is that even if acidic phospholipids other than phosphatidyl insitol 4,5-bisphosphate and phosphatidyl insitol 4-monophosphate, for example, phosphatidyl insitol and phosphatidyl serine can inhibit the cleavage activity of adseverin, the cleavage activity of gelsolin is This may be a reason for partially explaining that it cannot be inhibited.

Example 8: Expression of adseverin cDNA in E. coli Bovine adseverin cDNA (pSK-adseverin) obtained in Example 6 was amplified by PCR. Primers used for PCR were designed such that the start codon (ATG) of the resulting cDNA constitutes a part of NdeI, and the XhoI site was located immediately after the stop codon (TAA). The resulting cDNA was integrated into the expression vector pET-23a (Novagen) via NdeI and XhoI sites. The recombinant vector pET-adseverin thus obtained was incorporated into competent cell BL21 (DE3) pLysS by the method of Chung et al. (Proc. Natl. Acad. Sci. USA 86: 2172-2175, 1988). . Selection of transformants, culture and induction with IPTG (isopropyl-β-D-thiogalactopyranoside) were described by Studier et al. (In Methods in Enzymology, Gene Expression Technology (Goeddel eds.) Vol. 185, pp. 60-89). Academic Press, San Diego, 1991). That is, ampicillin and chloramphenicol resistant colonies were selected and cultured in M9ZB medium supplemented with 50 μg / ml ampicillin. When the expression of cDNA was induced by IPTG, the production of a protein of about 74 kDa was observed by SDS-PAGE (A in FIG. 6, arrow). The untransformed control BL21 (DE3) pLysS did not produce any extra protein upon IPTG induction. The size of the derived protein in SDS-PAGE, 74 kDa, is the same as the size of adseverin prepared from bovine adrenal medulla.

  The culture supernatant of the transformed Escherichia coli was purified in substantially the same manner as in Example 1, which was separated and purified from bovine adrenal medulla. The purified protein was subjected to SDS-PAGE electrophoresis, transferred to a nitrocellulose membrane, and reacted with an antibody specific for adseverin. As shown in FIG. Reacted. From the apparent size of the protein on SDS-PAGE and the immune reaction with the adseverin-specific antibody, it was confirmed that this protein was cDNA encoding adseverin.

Example 9: Actin filament-cleaving activity of adseverin produced by Escherichia coli To test whether or not adseverin produced by Escherichia coli has the same Ca ²⁺ -dependent actin filament-cleaving activity as native adseverin, actin The effect of adseverin on the polymerization was measured with a viscometer.

Actin at a concentration of 0.15 mg / ml was treated with actin in buffer P (50 mM KCl, 2 mM MgCl ₂ and 20 mM imidazole-HCl, pH 7.2) in the presence of 1 mM EGTA or 0.1 mM CaCl ₂ at 25.5 ° C. Was polymerized in the presence or absence of adseverin at a molar ratio of 1:30.

As a result, as shown in FIG. 7, the viscosity of the actin solution was affected by adseverin only when Ca ²⁺ was present (compare A and B in FIG. 7), and in the presence of Ca ²⁺ , Has the effect of accelerating the nucleation of polymerization and reducing the final viscosity of the polymerized actin solution. When adseverin was added to the polymerized actin solution (indicated by the arrow in the figure), when Ca ²⁺ was contained in the solution, the specific viscosity dropped sharply.

  These results are substantially the same as those obtained using adseverin prepared from bovine adrenal medulla, indicating that the protein produced by the genetic recombination technique of the present invention has the same actin filament cutting activity as native adseverin. It has been shown.

Example 10: In situ hybridization A 329 bp fragment of bovine adseverin cDNA (# 2090- # 2418) was labeled with digoxigenin-dUTP using DIG DNA Labeling and Detection Kit (Boehringer Mannheim).

  Fresh bovine adrenal gland, including the area between the cortex and medulla, was fixed with 1% paraformaldehyde in phosphate buffered saline (PBS) at the slaughterhouse. Returning to the laboratory, it was cut into small pieces and washed with PBS. The samples were then immersed in 8, 12, 16 and 20% stepwise sucrose-PBS for 24 hours. The sample was placed in TISSUE-TEK (Miles Scientific) and frozen with liquid nitrogen. Frozen samples were cut into 5-7 μm sections with a microtome and collected on glass slides.

  Some of the sections were stained with 0.5% toluidine blue in PBS and 50% glycerol in PBS and kept in the same solution.

For immunofluorescent staining, sections were fixed with 1% paraformaldehyde-PBS for 1 minute and with acetone for 5 minutes. After treatment with 1% Triton X-100 in PBS and washing with PBS, the sections were placed in a blocking solution containing 2.5% bovine serum albumin and 2.5% chick serum in PBS to form a blocking solution. The mixture was incubated at 37 ° C. for 3 hours together with the anti-adseverin antibody therein (for the method of preparing the anti-adseverin antibody, see Example 18 described later). Sections were washed in a solution containing 400 mM MgCl ₂ and 20 mM Tris-HCl (pH 8.6), then washed in PBS, and then incubated with FITC-conjugated anti-rabbit IgG in blocking solution at 37 ° C. for 3 hours. After washing thoroughly with the same method and solution as described above, Nikon FEX- was added to PBS containing 50% glycerol and 2.5% 1,4-diazabicyclo [2,2,2] octane (Wako Chemical). A observed with a fluorescence microscope.

  For in situ hybridization, the sections were incubated for 10 minutes at room temperature with 2 × strength saline-citric acid (2 × SSC, 1 × SSC = 0.15 M NaCl, 15 mM Na-citrate, pH 7.0), It was then incubated for 1 hour at room temperature in prehybridization solution (5 × SSC, 50% formamide, 0.1% Tween 20, 50 μg / ml heparin, 100 μg / ml sonication, denatured salmon testis DNA).

  The prehybridization buffer was removed and a new prehybridization buffer containing 0.5 μg / ml of digoxigenin-labeled DNA probe was applied to the section. Sections were covered with cover slides and sealed with rubber cement.

  The DNA probe was denatured in an oven at 80 ° C. for 10 minutes. The incubation was then carried out in an oven at 42 ° C. overnight. The cover slide was removed with a glass cutter, and the sections were washed for 30 minutes at room temperature with 2 × SSC, 0.1 × SSC at 42 ° C. for 30 minutes, and 2 × SSC at room temperature for 15 minutes.

  Probes in the sections were detected using DIG DNA Labeling and Detection Kit (Boehringer Manheim). The section incubated with the digoxigenin-labeled DNA probe was washed for 10 minutes at room temperature in a washing buffer (100 mM Tris-HCl, 150 mM NaCl, pH 7.5), and 0.5% (w / v) Boehringer blocking reagent in the washing buffer was used. And finally washed with wash buffer.

Sections were then incubated with alkaline phosphatase-conjugated anti-digoxigenin antibody (150 mU / ml) at 37 ° C in the dark for 2 hours. After washing twice with wash buffer, 100 mM slide Tris-HCl, 100mMNaCl, 20mM MgCl 2, and briefly treated with a solution containing pH 9.5, nitroblue tetrazolium salt, 5-bromo-4-chloro-3- It was incubated with the same solution containing drill phosphate and 0.25 mg / ml levamisole for 3 hours at room temperature in the dark. Color development was stopped with 10 mM Tris-HCl, 1 mM EDTA, pH 8.0.

  Sections placed in glycerol were observed under a light microscope.

  As a result, when observed at low magnification, color development was observed in the medulla, but was not observed in the cortex other than the area adjacent to the medulla. The interface area between the medulla and cortex was then observed at high magnification. Staining with toluidine blue (FIG. 8a) shows that cells in the cortex are tightly packed, whereas cells in the medulla are loosely distributed and grouped by a sheath-like structure containing vesicles. It became clear that. The cortex and the medulla can be easily distinguished in in situ hybridization or immunofluorescent staining by the above-mentioned properties of the cells without using counterstaining. FIGS. 8c and 8f are the results of in situ hybridization observed at medium magnification and high magnification, respectively. Staining was mainly observed in loosely packed cells corresponding to medullary chromaffin cells. In addition, a few cortical cells facing the medulla were also stained as indicated by the arrows.

  The same pattern of adseverin distribution was observed by immunofluorescent staining with an anti-adseverin antibody (b and e in FIG. 8). That is, fluorescence was observed in chromaffin cells in the medulla, and also in cells in the cortical region facing the medulla. In chromaffin cells, fluorescence was mainly observed in the subplasma membrane region.

  Summarizing the above results, it was shown that both adseverin mRNA and adseverin protein are expressed in the adrenal medulla but not in most of the cortex. Exceptionally, expression of both adseverin mRNA and protein was observed in the part of the cortex facing the medulla. Therefore, it was concluded that the differential expression of adseverin at such tissue sites in the bovine adrenal gland was regulated at the transcriptional level. Because the secretion by the type of exocytosis occurs in the adrenal medulla and not in the cortex, such differentiated expression is more likely to be due to the secretion process by the type of exocytosis, rather than the involvement of adseverin in the general secretory process. Strongly suggests that it is only involved. Furthermore, the localization of adseverin in the subplasma region is consistent with the belief that the protein is involved in the control of exocytosis.

Example 11: Preparation of cDNA library derived from human kidney mRNA Human kidney mRNA was obtained from CLONTECH Laboratories, Inc. The one purchased from the company was used. From 2 μg of this mRNA, double-stranded cDNA was synthesized using Timesaver ^™ cDNA Synthesis Kit (Pharmacia) according to the attached protocol.

That is, the heat-denatured mRNA was added to First-Strand Reaction Mix containing Murine Reverse Transcriptase and Oligo (dT) _12-18 primer, and the mixture was incubated at 37 ° C. for 1 hour to synthesize the first strand. This reaction solution was then used for E. E. coli RNase H, and E. coli. The second strand was synthesized by adding the DNA to Second-Strand Reaction Mix containing Coli DNA polymerase I and keeping the mixture at 12 ° C for 30 minutes and then at 22 ° C for 1 hour. The synthesized double-stranded cDNA is subjected to size fractionation by Spun Column or agarose electrophoresis contained in Kit, and a cDNA having a size of about 400 bp or more in the former case and about 2-3 kbp in the latter case. Only recovered.

An adapter (EcoRI / NotI adapter) was ligated to this end, and unreacted adapters were removed with the above-mentioned Spun Column and inserted into a vector. Vector using two kinds of ExCell vector purchased from Pharmacia Inc. (λ ExCell EcoRI / CIP) or, Lambda ^ZAP R II vector purchased from STRATAGENE Co. ^{(PREDIGESTED LAMBDAZAP R II / EcoRI /} CIAP CLONING KIT). As the host Escherichia coli, the NM522 strain was used in the former case, and the XL1-Blue strain was used in the latter case. The cDNA incorporated in the vector was packaged according to the attached protocol using GIGAPACK ^R II PACKAGING EXTRACT purchased from STRATAGENE. That is, packaging was performed by mixing Freeze / Thaw extract, Sonic extract and DNA, and keeping the mixture at 22 ° C. for 2 hours to obtain a cDNA library.

Example 12: Screening of cDNA library by plaque hybridization (hybridization using bovine adseverin cDNA as a probe)
Screening is described in Sambrook, J .; Fritsch, E .; F. and Maniatis, T .; , Molecular Cloning, Cold Spring Harbor Lab. (1989) with reference to the standard method. That is, the phage plaque grown on the LB agar plate was transferred to a Hybond-N filter (Amersham), denatured with alkali, and then immobilized by irradiation with ultraviolet light. Pre-hybridization was carried out by incubating the filter in a hybridization solution at 40 ° C. for 3 hours, and then at ³² ° C. for 16 hours or more at 40 ° C. with a probe (about 1 μCi / ml) labeled with ³² P and heat denatured. Hybridization was performed by keeping the temperature. As a probe, a fragment which was cut out from bovine adseverin cDNA (pSK-adseverin) with PstI and NdeI and was almost the full length of cDNA was used. Hybridization solution containing 25% formamide (other composition: 4 × SSC, 50 mM HEPES pH 7.0, 10 × Denhardt's solution, 100 μg / ml heat-denatured salmon sperm DNA) Was used (Institute of Medical Science, The University of Tokyo, Cancer Research Division, New Cell Engineering Experimental Protocol, Cell Engineering (1993)). After the hybridization, the filter is first washed twice with a solution containing 2 × SSC and 0.1% SDS at room temperature for 15 minutes, and then gradually cooled from room temperature in a 1 × SSC and 0.1% SDS solution. Washing was continued until the background radioactivity disappeared while increasing the temperature. After the filter was dried, autoradiography was performed.

Labeling of the probe with ³² P was performed according to Ramdom Primer DNA Labeling Kit Ver. 2 (Takara Shuzo). According to the attached protocol, about 100 ng of the heat-denatured DNA was labeled by incubating with a random primer, 50 μCi [α- ³² P] dCTP and Klenow fragment at 37 ° C. for 30 minutes.

First, 1.6 × 10 ⁵ plaques of a cDNA library prepared from the human kidney mRNA obtained in Example 11 were screened using bovine adseverin cDNA as a probe, and one positive phage clone was obtained.

Example 13: Subcloning from a positive phage clone into a plasmid vector Amplification of the insert part of the clone obtained in Example 12 by PCR using primers synthesized from the base sequence of the λ ExCell vector (CAGCTATGACCATGATTACGCCCAA, ACGACGGCCAGTGAATTGCGTAAT) (Tokyo University Medical Science) This was cut with EcoRI, then cut with EcoRI in advance, and subcloned into a dephosphorylated pUC18 plasmid vector. The resulting clone was named pADa-17.

Example 14: Screening of cDNA library by plaque hybridization (hybridization using pADa-17 as a probe)
Using a library obtained by enriching only a 2-3 kbp cDNA newly prepared from human kidney mRNA according to the method of Example 11 and using the clone pADa-17 obtained in Example 13 as a probe, the strictness was increased ( Hybridization solution containing 50% formamide: Other composition is the same as in Example 12.) Plaque hybridization was performed under ordinary conditions. The vector used for the preparation of the cDNA library was a Lambda ZAP ^R II vector (PREDIGESTED LAMBDA ZAP ^R II / EcoRI / CIAP CLONING KIT) purchased from STRATAGENE, and the XL1-Blue strain was used as host Escherichia coli. Further, the labeling of the probe with ³² P was carried out by the same method as described in Example 12 and the fragment excised from the clone pADa-17 by EcoRI was purified by agarose gel electrophoresis and purified to obtain an equivalent amount of about 100 ng by 50 μCi. [Α- ³² P] dCTP. After hybridization, the filter was first washed twice with a solution containing 2 × SSC and 0.1% SDS at room temperature for 15 minutes and then with a 0.5 × SSC and 0.1% SDS solution at 50 ° C. for 15 minutes. After washing twice and drying the filter, autoradiography was performed.

As a result, 1.7 × 10 ⁵ plaques were screened to obtain 5 positive phage clones.

Example 15: Subcloning from a positive phage clone into a plasmid vector A plasmid (pBluescript ^R SK (-) vector) was cut out from the positive phage clone by ExAssist ^™ / SOLR ^™ SYSTEM using the characteristics of Lambda ZAP ^R II vector. Was. PREDIGESTED LAMBDA ZAP ^R II / accordance attached protocol to EcoRI / CIAPCLONING KIT (STRATAGENE Corp.), at 37 ° C. After infection with positive phage and ExAssist ^TM helper phage obtained in Example 14 in strain XL1-Blue E. coli 2. After culturing for 5 hours, the plasmid excised in the culture solution was incorporated into SOLR strain E. coli. Thus, plasmid clones phAD-2 to 6 were obtained.

Example 16: Determination of the nucleotide sequence of human adseverin cDNA The nucleotide sequence of the plasmid clones phAD-2 and phAD-4 obtained in Example 15 was determined. The nucleotide sequence was determined by the Diodexy sequencing method using Sequenase Version 2.0 (United States Biochemical), or the PRISM ^TM Terminator Mix (Analyzed by the use of the shared method of Applied Biosystems). It was decided by that.

  The nucleotide sequence of human adseverin cDNA obtained by combining the nucleotide sequences determined by phAD-2 and phAD-4 and the amino acid sequence corresponding to the longest open reading frame are shown in SEQ ID NO: 5 in the sequence listing. An open reading frame consisting of 715 amino acids with the ATG at position 79 as the start codon was found.

Example 17: Comparison between human adseverin and bovine adseverin The result of comparing the amino acid sequence of human adseverin obtained in Example 16 with the amino acid sequence of bovine adseverin obtained in Example 6 is shown in FIG. In the figure, the upper row shows the amino acid sequence of human and the lower row shows the amino acid sequence of bovine. Amino acids that are completely identical are indicated by *, and amino acids with high similarity are indicated by. Human adseverin and bovine adseverin have about 92% homology at the amino acid level, and amino acids that are not completely identical have high similarity. At the base level, about 90% homology was found in the coding region. However, the homology was rapidly lost after the stop codon.

Example 18: Preparation of anti-adseverin antibody and anti-peptide antibody (antibody against human adseverin-derived peptide)
Preparation of anti-adseverin antibody 1 mg of adseverin purified from bovine adrenal medulla was mixed with Freund's complete adjuvant to prepare an emulsion, which was subcutaneously injected into rabbits at several sites. Further, an emulsion was prepared after mixing the same amount of protein with incomplete adjuvant every four weeks, and was similarly injected subcutaneously. One week after the injection, blood was collected from the ear vein, serum was separated, and the antibody titer was examined by ELISA. As a result, the antibody titer in the serum increased after 2-3 boosts. Since cross-reaction with gelsolin was observed, the obtained serum was absorbed with gelsolin immobilized on agarose beads, and then adsorbed on immobilized adseverin, and then 0.1 M glycine-HCl (pH 2.5), 0.1 M triethylamine- HCl (pH 11.5), eluted sequentially with 3.5 M MgCl ₂ , dialyzed against Tris buffered salt solution, and concentrated. The affinity-purified antibody thus obtained did not show any cross-reactivity with gelsolin, and showed a specific reaction to adseverin. This antibody was used at a concentration of 0.1-1 μg / ml in the immunoblot method and 1-10 μg / ml in the fluorescent antibody method.
Preparation of Anti-Peptide Antibody (Antibody Against Human Adseverin-Derived Peptide) A peptide sequence derived from human adseverin, which is exposed on the surface of a protein molecule, is highly conserved between bovine and human adseverins, and has low homology with gelsolin. (16 residues) were selected at two sites (SEQ ID NOs: 6 and 7). Peptide synthesis is started from a resin in which seven lysine residues are connected to a branched structure, and Multiple Antigen Peptide (MAP) is synthesized (Tam, JP, Proc. Natl. Acad. Sci. USA 85: 5409-5413). , 1988). Emulsions were prepared with complete adjuvant for the first time and incomplete adjuvant and peptide for the second and subsequent times, and were injected subcutaneously every other week into two rabbits. Blood was collected from the ear vein after 7, 8 and 9 weeks, and the antibody titer was examined by ELISA. As a result, an antibody which had little cross-reactivity with gelsolin and reacted with rat, bovine and human adseverin was obtained. Since a non-specific reaction was observed also in the serum before immunization, affinity purification with an antigen was performed in the same manner as an antibody obtained by immunizing the purified protein.

  According to the present invention, the sequence of a gene encoding adseverin, which is a protein having actin filament cleavage activity, has been clarified. Therefore, by preparing the antisense DNA sequence from the present gene sequence and administering it to humans, for example, the growth of vascular smooth muscle can be suppressed to prevent or treat vascular stenosis, or the release of bioactive substances can be controlled by the gene. It is believed that it can be suppressed at the level. In addition, by applying the gene sequence of the present invention to a gene recombination technique, it has become possible to produce adseverin in large quantities and uniformly. Therefore, the development of a new drug can be expected by constructing a screening system using human adseverin. Furthermore, since adseverin exhibits the same activity as gelsolin, it may be possible to use it for pharmaceutical uses such as thrombostatic agents.

FIG. 4 is a photograph of electrophoresis showing purification of adseverin obtained from bovine adrenal medulla in comparison with purification of gelsolin obtained from bovine aorta. SDS-PAGE was performed using a 6.5 to 10.5% linear gradient gel. Lanes 1 and 2 show the fraction obtained from the bovine aorta applied to a DNase I affinity column, in which lane 1 is the fraction eluted with EGTA and lane 2 is the fraction eluted with 6M urea. Lanes 3-8 show the fractions obtained from bovine adrenal medulla, of which lane 3 is the crude extract, lane 4 is the EGTA elution fraction of the DNase I affinity column, lane 5 is the 6 M urea elution fraction of the DNase I affinity column, Lane 6 is a Q-Sepharose fraction containing adseverin, lane 7 is a Q-Sepharose fraction containing plasma gelsolin, cytosolic gelsolin and actin, lane 8 is adseverin purified by HPLC gel filtration, and lane M is a molecular weight marker. From 94,000, 67,000, 43,000 and 30,000. 3 shows a comparison of the partial amino acid sequence of a fragment of adseverin with a molecular weight of 39,000 (C39) and the corresponding amino acid sequences of gelsolin and villin. The N-terminal amino acid sequence of the fragment obtained by thermolysin degradation of adseverin and its expected position are shown in comparison with gelsolin. 1 shows a restriction map of bovine adseverin cDNA. The part indicated by PCR indicates cDNA obtained by reverse transcription and PCR from RNA of MDBK cells. Portions indicated at 19, 5, and 21 represent the individual cDNAs isolated from the bovine adrenal medulla λgt11 cDNA library and used for the cDNA construction of adseverin. The amino acid sequence of bovine adseverin as revealed in the present invention is shown in comparison with the amino acid sequences of the corresponding segments of human gelsolin and human villin. The numbers shown on the right side of the sequence are the segment numbers of adseverin, gelsolin, and villin. Maximum homology exists between segments 1 and 4, segments 2 and 5, and segments 3 and 6. Highly conserved motifs are boxed in the figure. Also, the putative polyphosphoinositide binding site is indicated by a dotted line. In addition, the schematics shown below with elliptical numbers are the six homologous segments of these proteins. 1 is a photograph of electrophoresis showing expression in Escherichia coli and purification of adseverin. In the figure, A is an SDS-PAGE analysis showing the expression of adseverin in E. coli. Three hours after the transformants were incubated in the presence (lane 3) or absence (lane 2) of 0.4 mM IPTG, the pelleted cells were dissolved in SDS sample buffer, heated and subjected to SDS-polyacrylamide gel. On top. After electrophoresis, the gel was stained with Coomassie brilliant blue. Arrows indicate adseverin bands. Lane 1 is a molecular weight marker. In the figure, B is an immunoblot analysis performed after purifying adseverin expressed in E. coli. Purified adseverin was separated by SDS-PAGE and transferred to a nitrocellulose membrane. Blots were stained with Ponceau S (lane 2), destained, and immunodetected with an affinity-purified antibody against adseverin (lane 3). Lane 1 is a molecular weight marker. The result of having measured the effect of adseverin expressed in Escherichia coli on actin polymerization using a viscometer is shown. Actin was polymerized in buffer P containing 0.1 mM CaCl ₂ (A) or 1 mM EGTA (B). In the figure, ○ and △ show the results of polymerization in the presence of actin alone, and ● and ▲ show the results in the presence of adseverin added to actin at a molar ratio of 1:30. The results are shown below. At the point indicated by the arrow, adseverin was added to the actin solution at a molar ratio of 1:30. It is an optical micrograph (photograph showing the form of an organism) showing the expression of adseverin and mRNA in the boundary region between the cortex and medulla of bovine adrenal gland. The upper side of each photograph corresponds to the cortex, and the lower side corresponds to the medulla. Sections were stained with toluidine blue (panel a) or with anti-adseverin rabbit antibody followed by fluorescently conjugated anti-rabbit immunoglobulin (panels b and e). Panel d is an image obtained by observing the same field of view as panel e with a phase contrast microscope. Images of the in situ hybridization are shown in panels c and f. Panels ac have a magnification of 120 ×, and panels df have a magnification of 280 ×. It is a figure which shows the result of having compared the amino acid sequence of human adseverin with the amino acid sequence of bovine adseverin. In the figure, the upper row shows the amino acid sequence of human and the lower row shows the amino acid sequence of bovine. Amino acids that are completely identical are indicated by *, and amino acids with high similarity are indicated by. The portion surrounded by a square indicates a region where phospholipids are presumed to bind.

Claims (9)

  A DNA comprising a base sequence encoding the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing, a base sequence obtained by partially substituting, deleting or adding the same, or a base sequence hybridizing thereto.   A recombinant vector containing the DNA according to claim 1.   A prokaryotic or eukaryotic host cell transformed with the recombinant vector of claim 2.   A method for producing a recombinant protein, comprising culturing the host cell according to claim 3, and isolating and purifying the produced protein.   The method for producing a recombinant protein according to claim 4, wherein the recombinant protein is a protein having an actin filament cleavage activity.   A recombinant adseverin protein obtained by separating and purifying a culture obtained by culturing the host cell according to claim 3.   An oligonucleotide capable of specifically hybridizing with a base sequence encoding the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing.   A method for suppressing the production of adseverin in an animal, comprising administering to the animal an oligonucleotide capable of specifically hybridizing to the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing.   An antibody that recognizes bovine adseverin protein.

Images