JP2004267215A - Method for assaying nucleic acid, nucleic acid probe therefor, and method for analyzing data obtained thereby - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a means capable of accurately achieving purposes in a short time in a method for assaying a nucleic acid using a nucleic acid probe labelled by a fluorochrome, a real-time quantitative PCR method using the method and a method for analyzing the data obtained by the PCR method. <P>SOLUTION: The novel method for assaying a nucleic acid comprises the nucleic acid probe labelled by the fluorochome, 2-O-methyloligonucleotide, a chimeric oligonucleotide or the like, or comprises hybridizing the nucleic acid probes comprising oligonucleotides mediated by them to a target nucleic acid and measuring decrease in the fluorescence of the fluorochome before and after the hybridization. The real-time quantitative PCR method comprises the assaying method. The method for analyzing data has a process of correcting fluorescence intensity in annealing reaction by that in denaturation reaction when the data obtained by the PCR method are analyzed. <P>COPYRIGHT: (C)2004,JPO&NCIPI

Description

  The present invention relates to a method for measuring the concentration of a target nucleic acid, a nucleic acid probe for the method, and a method for analyzing data obtained by the method. More specifically, the present invention relates to various methods for measuring the concentration of various nucleic acids using a nucleic acid probe labeled with a fluorescent dye, and it is said that when a nucleic acid probe labeled with a fluorescent dye is hybridized to a target nucleic acid, the emission of the fluorescent dye decreases. Based on the principle, that is, various novel methods for measuring the concentration of various nucleic acids by measuring the amount of decrease in the emission of a fluorescent dye before and after hybridization, nucleic acid probes and devices used therein, and one of those measuring methods. The present invention relates to a method for analyzing data obtained by a PCR method, an analyzing apparatus provided with means for executing each of the analyzing methods, and a computer-readable recording medium which records each procedure of the analyzing method as a program.

Conventionally, various methods for measuring a nucleic acid concentration using a nucleic acid probe labeled with a fluorescent dye are known. The method includes the following.
(1) Dot blotting method In this method, after a target nucleic acid and a nucleic acid probe labeled with a fluorescent dye are hybridized on a membrane, unreacted nucleic acid probes are washed away, and the nucleic acid probe hybridized with the target nucleic acid is labeled. This is to measure the fluorescence intensity of only the fluorescent dye molecules.

(2) Intercalator method (Non-Patent Document 1)
According to this method, when a certain fluorescent dye called an intercalator gets stuck in the double strand of a nucleic acid, it emits strong light, and thus the amount of increase in the light emission is measured. Examples of the fluorescent dye include ethidium bromide (Non-Patent Document 2) and SYBR R Green (Green) I (Non-Patent Document 3).

(3) Method using FRET (fluorescence energy transfer) (Non-Patent Document 4)
The method comprises hybridizing two nucleic acid probes to a target nucleic acid. Each of the two nucleic acid probes is labeled with a different fluorescent dye. One fluorescent dye of the two probes can transfer energy to the fluorescent dye of the other probe to emit light through the FRET phenomenon. The two probes are designed so that the fluorescent dyes face each other and hybridize 1 to 9 bases apart. Thus, when the two nucleic acid probes hybridize to the target nucleic acid, the latter fluorescent dye emits light, and the intensity of the light emission is proportional to the amount of replication of the target nucleic acid.

(4) Molecular beacon method (Non-Patent Document 5)
The nucleic acid probe used in this method has one end labeled with a reporter dye and the other end labeled with a quencher dye. And since both ends are mutually complementary in a base sequence, a base sequence is designed so that a probe may form a hairpin structure (hairpin stem) as a whole. When suspended in liquid due to its structure, the emission of the reporter dye is suppressed by the quencher dye due to Forster resonance energy. However, when hybridized to the target nucleic acid, the hairpin structure is broken, and the distance between the reporter dye and the quencher dye is increased, so that transfer of Forster resonance energy does not occur. This causes the reporter dye to emit light.

(5) Davis method (Non-Patent Document 6)
Davis created a probe in which a fluorescent dye was attached to the 3 'end of the oligonucleotide via a spacer having 18 carbon atoms. This was applied to flow cytometry. It has been reported that a 10-fold fluorescence intensity is obtained when hybridized compared to the case where a fluorescent dye is directly bound to the 3 ′ end.
These methods include various nucleic acid measurement methods, FISH method (fluorescent in situ hybridization assays), PCR method, LCR method (ligase chain reaction), SD method (strand displacement assays), competitive hybridization method, and the like. It has been applied to a remarkable development.

  These methods are currently generally used, but after performing a hybridization reaction between a nucleic acid probe labeled with a fluorescent dye and a target nucleic acid, it is necessary to wash the unhybridized nucleic acid probe from the reaction system. You have an unfavorable procedure. Obviously, omitting such a procedure results in a reduction in measurement time, simplicity of measurement, and accuracy of measurement. Therefore, development of a nucleic acid measurement method that does not have such a procedure has been desired.

Glazer et al., Nature 359: 959,1992 Experimental Medicine, Vol. 15, No. 7, pp. 46-51, 1997, Yodosha LightCyclerTM System; Brochure issued by Roche Diagnostics, Inc. on April 5, 1999 Mergney et al., Nucleic Acid Res., 22: 920-928, 1994. Tyagi et al., Nature Biotech., 14: 303-308, 1996. Davis et al., Nucleic acids Res. 24: 702-706, 1996.

  In view of the above circumstances, an object of the present invention is to provide a method for measuring a target nucleic acid concentration using a nucleic acid probe labeled with a fluorescent dye, in a shorter time, more simply and more accurately measuring the concentration of the target nucleic acid. To provide.

  In order to solve the above problems, the present inventors have repeatedly studied a method for measuring the concentration of a nucleic acid using a nucleic acid probe. As a result, when a nucleic acid probe labeled with a fluorescent dye is hybridized to a target nucleic acid, there is a phenomenon (fluorescence quenching phenomenon) in which the emission of the fluorescent dye decreases (fluorescence quenching phenomenon). In particular, it has been discovered that the degree of the decrease depends on the type or base sequence of the base to which the fluorescent dye is bound. The present invention has been completed based on such findings.

That is, the present invention
1) In the nucleic acid measurement method using a nucleic acid probe labeled with a fluorescent dye, the fluorescent dye is a nucleic acid probe that reduces its emission when the nucleic acid probe hybridizes to a target nucleic acid, and the nucleic acid probe is used as a target nucleic acid. The method for measuring the concentration of the target nucleic acid, characterized by measuring the amount of decrease in luminescence of the fluorescent dye before and after hybridization,

2) When a nucleic acid probe labeled with a fluorescent dye is hybridized to a target nucleic acid, the fluorescent dye is a nucleic acid probe that reduces its emission, and the probe is labeled with the fluorescent dye at its end. When the nucleic acid probe hybridizes to the target nucleic acid at the terminal portion, G (guanine) is added to the base sequence of the target nucleic acid by 1 to 3 bases apart from the terminal base of the target nucleic acid hybridized to the probe. A nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid, characterized in that the base sequence of the probe is designed so that at least one base is present;
3) The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of the target nucleic acid according to the above 2), wherein the nucleic acid probe is labeled with a fluorescent dye at the 3 ′ end; The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of the target nucleic acid according to the above 2), which is labeled with

  5) When a nucleic acid probe labeled with a fluorescent dye hybridizes to a target nucleic acid, the fluorescent dye is a nucleic acid probe that reduces its emission, and the probe is labeled with the fluorescent dye at its terminal. When the nucleic acid probe hybridizes to the target nucleic acid, a plurality of base pairs of the probe-nucleic acid hybrid complex form at least one G (guanine) and C (cytosine) pair at the terminal portion. As described above, a nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid, wherein the base sequence of the probe is designed,

6) The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to 5) above, wherein the 3 ′ terminal base of the nucleic acid probe is G or C, and the 3 ′ end is labeled with a fluorescent dye. ,
7) The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to 5) above, wherein the 5 ′ terminal base of the nucleic acid probe is G or C and the 5 ′ end is labeled with a fluorescent dye; ,

  8) The nucleic acid probe according to 4) or 7) above, wherein the 3′-carbon hydroxyl group of 3′-terminal ribose or deoxyribose or the 3′- or 2′-carbon hydroxyl group of 3′-terminal ribose is phosphorylated. Nucleic acid probe labeled with a fluorescent dye for measuring the concentration of the target nucleic acid described,

9) The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to any one of 2) to 8) above, wherein the oligonucleotide of the nucleic acid probe for nucleic acid measurement is a chemically modified nucleic acid. Also,
10) The method according to 9), wherein the chemically modified nucleic acid is a 2′- O -methyl oligonucleotide, a 2′- O -ethyl oligonucleotide, a 2′- O -butyl oligonucleotide, or a 2′- O -benzyl oligonucleotide. Nucleic acid probe labeled with a fluorescent dye for measuring the concentration of the target nucleic acid described,
11) The concentration measurement of the target nucleic acid according to any one of the above 2) to 8), wherein the oligonucleotide of the nucleic acid probe for nucleic acid measurement is a chimeric oligonucleotide containing ribonucleotides and deoxyribonucleotides. Nucleic acid probe labeled with a fluorescent dye for

12) The chimeric oligonucleotide is 2'- O -methyl oligoribonucleotide, 2'- O -ethyl oligonucleotide, 2'- O -butyl oligonucleotide, 2'- O -alkylene oligonucleotide or 2'- The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of the target nucleic acid according to the above 11), wherein the nucleic acid probe intervenes an O -benzyl oligonucleotide,
13) A target characterized in that the nucleic acid probe for nucleic acid measurement according to any one of 2) to 8) above is hybridized to a target nucleic acid, and the amount of decrease in emission of a fluorescent dye before and after hybridization is measured. Nucleic acid concentration measuring method,

14) A target characterized in that the nucleic acid probe for nucleic acid measurement according to any one of 9) to 12) is hybridized to a target nucleic acid, and the amount of decrease in emission of a fluorescent dye before and after hybridization is measured. Nucleic acid concentration measurement method,
15) The method for measuring the concentration of a target nucleic acid according to 14), wherein the nucleic acid probe is hybridized with the target nucleic acid after heat treatment of the target nucleic acid under conditions suitable for sufficiently destroying its higher-order structure.
16) The method for measuring the concentration of a target nucleic acid according to the above 14) or 15), wherein a helper probe is added to a hybridization reaction system for performing a hybridization reaction before the hybridization reaction;

17) The method for measuring the concentration of a target nucleic acid according to 16), wherein the base sequence of the helper probe is (5 ′) TCCTTTGAGT TCCCGGCCGG A (3 ′) or / and (5 ′) CCCTGGTCGT AAGGGCCATG ATGACTTGAC GT (3 ′). ,
18) The method for measuring the concentration of a target nucleic acid according to any one of the above 15) to 17), wherein the heat treatment conditions are 80 to 100 ° C. for 1 to 15 minutes,
19) The method for measuring the concentration of a target nucleic acid according to any one of the above 13) to 18), wherein the target nucleic acid is RNA;
20) A kit for measuring the concentration of a target nucleic acid, the kit for measuring the concentration of a target nucleic acid comprising or accompanying the nucleic acid probe according to any one of the above 2) to 12);
21) The kit for measuring the concentration of a target nucleic acid according to the above 20), which contains or accompanies a helper probe,

22) In a method for analyzing or measuring polymorphism and / or mutation of a target nucleic acid, the nucleic acid probe according to any one of the above 2) to 12) is hybridized to the target nucleic acid, A method for analyzing or measuring a polymorphism or / and mutation of a target nucleic acid, characterized by measuring a change in intensity,
23) A measurement kit for analyzing or measuring a polymorphism and / or mutation of a target nucleic acid, which contains or accompanies the nucleic acid probe according to any one of 2) to 12) above. A kit for analyzing or measuring the type or / and mutation,

24) A kit for analyzing or measuring a polymorphism and / or mutation of a target nucleic acid according to the above 23), which contains or accompanies a helper probe to be added to a hybridization reaction system,
25) In the method for analyzing data obtained by the method described in 22) above, the fluorescence intensity value of the reaction system when the target nucleic acid is hybridized with a nucleic acid probe labeled with a fluorescent dye is hybridized. A data analysis method for a method of analyzing or measuring a polymorphism or / and mutation of a target nucleic acid, characterized by having a process of correcting by the fluorescence intensity value of the reaction system when no,

26) A target nucleic acid polymorphism or / and / or a measurement device for analyzing or measuring a polymorphism or / and mutation of a target nucleic acid, which comprises means for performing the data analysis method described in 25) above. A measuring device for analyzing or measuring mutations,
27) a computer-readable recording medium that records, as a program, a procedure for causing a computer to execute the correction process described in 25) above;

  28) The nucleic acid probe according to any one of the above 2) to 12), or two fluorescent dyes having two different fluorescent dyes in one molecule and not hybridizing to the target nucleic acid Are quenched or emitted by the interaction of the target nucleic acid, but a plurality of other nucleic acid probes having a structure designed to emit or quench when hybridized to the target nucleic acid are bound to the surface of the solid support, and the target nucleic acid is hybridized thereto. A device for measuring the concentration of one or more nucleic acids, characterized in that the concentration of the target nucleic acid can be measured by soybean,

29) In the device for nucleic acid measurement according to the above 28), a device (chip) for measuring the concentration of one or more nucleic acids in which nucleic acid probes are arrayed and bound on the surface of the solid support in an array, respectively. Also,
30) For each nucleic acid probe bound to the surface of the solid support, at least one temperature sensor and a heater are installed on the opposite surface, and the temperature can be adjusted so that the nucleic acid probe binding region has an optimal temperature condition. ) Or a device for measuring the concentration of one or more nucleic acids described in 29) above, and 31) a nucleic acid probe bound to the surface of a solid support at an end not labeled with a fluorescent dye. A device for measuring the concentration of one or more nucleic acids according to any one of the above 28) to 30),

32) A method for measuring a concentration of a target nucleic acid, comprising measuring a target nucleic acid using the nucleic acid measuring device according to any one of the above 28) to 30);
33) The method for measuring a nucleic acid according to any one of the above 1), 13) to 19) or the nucleic acid measurement method according to the above 32), wherein the target nucleic acid is derived from a microorganism obtained by pure separation or from an animal. Characteristic target nucleic acid concentration measurement method,
34) The target nucleic acid according to any one of the above 1) or 13) to 19), wherein the target nucleic acid is a nucleic acid contained in a cell of a complex microbial system or a symbiotic microbial system or in a homogenate of the cell, or 32). A method for measuring the concentration of a target nucleic acid,

  35) In the PCR method, a reaction is carried out using the nucleic acid probe according to any one of the above 2) to 3), 5), 6), or 8) to 12). A reaction system in which the fluorescence intensity value of a reaction system that has been decomposed and removed by a polymerase or a nucleic acid denaturation reaction or a reaction system in which a nucleic acid denaturation reaction has been completed and a target nucleic acid or an amplified target nucleic acid hybridizes with the nucleic acid probe The method for measuring the concentration of the target nucleic acid amplified by PCR, which comprises measuring the fluorescence intensity value of the former, and calculating the rate of decrease in the fluorescence intensity value from the former,

36) In the PCR method, a reaction is performed using the nucleic acid probe according to 4) or 7) as a primer, and the fluorescence intensity value of the reaction system in which the probe and the target nucleic acid or the amplified target nucleic acid are not hybridized and the nucleic acid probe Measuring the fluorescence intensity value of the reaction system when is hybridized with the target nucleic acid or amplified target nucleic acid, and calculating the decrease rate of the former fluorescence intensity value, the concentration of the target nucleic acid amplified by PCR Measurement method,
37) The method for measuring the concentration of a target amplified nucleic acid of the PCR method according to the above 35) or 36), wherein the PCR method is a real-time quantitative PCR method;

  38) In the method for analyzing data obtained by the nucleic acid measurement method according to any one of the above 1), 13) to 19), or any one of the above 32) to 37), the target nucleic acid may be fluorescent. Correcting the fluorescence intensity value of the reaction system after hybridizing with the dye-labeled nucleic acid probe by the fluorescence intensity value of the reaction system obtained after dissociation of the probe-nucleic acid hybrid complex thus formed. A data analysis method for measuring the concentration of a target nucleic acid,

  39) The method for analyzing data obtained by the real-time quantitative PCR method according to 37) above, wherein the amplified nucleic acid in each cycle is combined with a fluorescent dye, or the amplified nucleic acid is labeled with a fluorescent dye. The fluorescence intensity value of the reaction system after hybridization with the probe is determined by the reaction obtained after the fluorescent dye-nucleic acid complex formed in each cycle or the probe-nucleic acid hybrid complex thus formed is dissociated. A data analysis method for a real-time quantitative PCR method, comprising an arithmetic processing step for correcting the fluorescence intensity value of the system (hereinafter, referred to as a correction arithmetic processing step);

40) The data analysis method for the real-time quantitative PCR method according to 39), wherein the correction operation processing step according to 39) is based on the following [Equation 1] or [Equation 2].
f _n = f _{hyb, n} / f _{den, n} [Equation 1]
f _n = f _{den, n} / f _{hyb, n} [Equation 2]
(In the formula,
f _n : correction operation processing value in the nth cycle calculated by [Equation 1] or [Equation 2],
f _{hyb, n} : the fluorescence intensity value of the reaction system after the amplified nucleic acid binds to the fluorescent dye or after the amplified nucleic acid hybridizes with the nucleic acid probe labeled with the fluorescent dye in the nth cycle,
f _{den, n} : the fluorescence intensity value of the reaction system after dissociation of the formed fluorescent dye-nucleic acid complex or the formed probe-nucleic acid hybrid complex in the nth cycle],

41) The method according to the above item 40) for analyzing the data obtained by the real-time quantitative PCR method according to the above item 37), wherein the correction operation processing value calculated by [Equation 1] or [Equation 2] in each cycle. Is substituted into the following [Equation 3] or [Equation 4] to calculate a fluorescence change ratio or a fluorescence change ratio between each sample in each cycle, and to compare them. Data analysis method,
F _n = f _n / f _a [Equation 3]
F _n = f _a / f _n [Equation 4]
(In the formula,
F _n : the rate of change of fluorescence or the rate of change of fluorescence calculated by [Equation 3] or [Equation 4] in the _n- th cycle;
f _n : Correction calculation processing value by [Equation 1] or [Equation 2] f _a : Correction calculation processing value by [Equation 1] or [Equation 2] and an arbitrary number of cycles before a change in f _n is observed Thing),

42) The method according to 41), wherein the data obtained by the real-time quantitative PCR method according to 37) is analyzed.
(A) a process of performing an arithmetic processing by [Equation 5], [Equation 6] or [Equation 7] using the fluorescence change ratio or the data of the fluorescence change rate calculated by [Equation 3] or [Equation 4];
log _b (F _n ), ln (F _n ) [Equation 5]
log _b {(1-F _n ) × A}, ln {(1-F _n ) × A} [Equation 6]
log _b {(F _n -1) × A}, ln {(F _n -1) × A} [Equation 7]
(In the formula,
A, b: arbitrary numerical values,
F _n : the rate of change in fluorescence or the rate of change in fluorescence in the nth cycle calculated by [Equation 3] or [Equation 4],
(B) an arithmetic processing step of calculating the number of cycles in which the arithmetic processing value of (a) has reached a constant value;
(C) an arithmetic processing step of calculating a relational expression between the number of cycles in a nucleic acid sample of a known concentration and the number of copies of the target nucleic acid at the start of the reaction,
(D) a process of calculating the copy number of the target nucleic acid at the start of PCR in the unknown sample;
A data analysis method for a real-time quantitative PCR method, characterized by having

43) Performing PCR on the target nucleic acid using the nucleic acid probe according to any one of 2) to 12) above, and analyzing the melting curve of the target nucleic acid to determine the Tm value of each amplified nucleic acid. Method for analyzing the melting curve of the target nucleic acid
44) A target characterized in that PCR is performed on the target nucleic acid using the nucleic acid probe described in 4) or 7) above as a primer, and the melting curve of the target nucleic acid is analyzed to determine the Tm value of each amplified nucleic acid. Analysis method of melting curve of nucleic acid,

45) The data analysis method for a real-time quantitative PCR method according to any one of the above items 39) to 42), wherein the nucleic acid amplified by the PCR method is cooled from a low temperature until the nucleic acid is completely denatured. The process of gradually increasing the fluorescence intensity, measuring the fluorescence intensity at predetermined time intervals, displaying the measurement results on the display as a function of time, and drawing the melting curve of the nucleic acid on the display. Differentiating and obtaining a differentiated value (-dF / dT, F: fluorescence intensity, T: time), displaying the differentiated value as a differential value on a display, and obtaining an inflection point from the differential value A data analysis method for a real-time quantitative PCR method, characterized by having
46) a step of analyzing data by the data analysis method according to 39), a step of analyzing data by the data analysis method of 40), a step of analyzing data by the data analysis method of 41), Real-time quantitative PCR, characterized by having means for performing a step of analyzing data by the data analysis method according to the above (42) and a step of analyzing data by the data analysis method according to the above (45). Measurement and / or analysis device,

  47) a process of analyzing data by the data analysis method of 39), a process of analyzing data by the data analysis method of 40), a process of analyzing data by the data analysis method of 41), A computer-readable recording medium storing a program for causing a computer to execute the step of analyzing data by the data analysis method according to 42) and the step of analyzing data by the data analysis method according to 45); Also,

48) A method for quantifying a nucleic acid, comprising using the data analysis method for a real-time quantitative PCR method according to any one of the above 39) to 42) or the above 45), ,
49) A method for quantifying a nucleic acid, which comprises using the device according to 46) above,
50) A method for quantifying a nucleic acid, which comprises using the computer-readable recording medium according to the above item 47).
I will provide a.

The present invention has the following effects.
1) The method for measuring the concentration of a target nucleic acid of the present invention, various nucleic acid probes of the present invention, particularly chemical modifications such as 2-O-alkyl oligonucleotides, 2-O-alkylene oligonucleotides, and 2-O-benzyl oligonucleotides The nucleic acid probe of the present invention consisting of an oligonucleotide or the like, the nucleic acid probe of the present invention consisting of a chimeric oligonucleotide or the like in which an oligoribonucleotide and an oligodeoxyribonucleotide intervene, a target nucleic acid containing or accompanied by the nucleic acid probe of the present invention Using a measurement kit for measuring the concentration of a nucleic acid, and a nucleic acid chip or a nucleic acid device such as a DNA chip to which the nucleic acid probe of the present invention is bound, operations such as removing unreacted nucleic acid probes from the measurement system can be performed. No target nucleic acid concentration in a short time One can be easily measured. Further, when applied to a complex microbial system or a symbiotic microbial system, the abundance of a specific strain in the system can be measured specifically and in a short time. The present invention also provides a simple method for analyzing or measuring polymorphisms or mutations such as SNPs of a target nucleic acid or gene.
2) The quantitative PCR method of the present invention has the following effects.
a. Since a factor that inhibits the amplification of the target nucleic acid by Taq DNA polymerase is not added, quantitative PCR can be performed under the same conditions as those of a conventionally known specific PCR.
b. In addition, since the specificity of PCR can be kept high, the amplification of the primer dimer is slowed, so that the quantification limit is reduced by about one order of magnitude as compared with conventionally known quantitative PCR.
c. Since there is no need to prepare a complicated nucleic acid probe, the time and cost required for the preparation can be saved.
d. The effect of amplifying the target nucleic acid is large, and the amplification process can be monitored in real time.
3) In addition, when analyzing data obtained by the real-time quantitative PCR method, a calibration line for obtaining the copy number of a nucleic acid for a nucleic acid sample having an unknown nucleic acid copy number is prepared using the data analysis method of the present invention. The correlation coefficient of the line is much higher than that obtained by the conventional method. Thus, the use of the data analysis method of the present invention makes it possible to determine the exact copy number of a nucleic acid.
4) Also, data analysis software according to the method for analyzing data obtained by the real-time quantitative PCR method of the present invention, a computer-readable recording medium recording the procedure of the analysis method as a program, and By using a real-time quantitative PCR measurement or analysis apparatus using the above, a calibration straight line having a high correlation coefficient can be automatically created.
5) In addition, by using the novel nucleic acid melting curve analysis method of the present invention, a highly accurate Tm value of a nucleic acid can be obtained. Furthermore, using the software for data analysis according to the method, and a computer-readable recording medium recording the procedure of the analysis method as a program, and a real-time quantitative PCR measurement or analysis device using the same, Accurate Tm value can be obtained

Next, the present invention will be described in more detail with reference to preferred embodiments.
The first feature of the present invention is a method for measuring the concentration of a target nucleic acid using a nucleic acid probe labeled with a fluorescent dye, which occurs when the nucleic acid probe hybridizes to the target nucleic acid, the fluorescent dye before and after hybridization. It is to measure the amount of decrease in luminescence.
In the present invention, the probe-nucleic acid hybrid complex refers to a complex (complex) in which a nucleic acid probe labeled with the fluorescent dye of the present invention is hybridized with a target nucleic acid. For the sake of simplicity, hereinafter, it is abbreviated as a nucleic acid hybrid complex.
The fluorescent dye-nucleic acid complex refers to a complex in which a fluorescent dye is bound to a target nucleic acid. For example, a double-stranded nucleic acid with an intercalator bound thereto can be mentioned.
In the present invention, DNA, RNA, cDNA, mRNA, rRNA, XTPs, dXTPs, NTPs, dNTPs, nucleic acid probes, helper nucleic acid probes (or nucleic acid helper probes, or simply helper probes), hybridization, hybridization, intercalator , Primer, annealing, extension reaction, heat denaturation reaction, nucleic acid melting curve, PCR, RT-PCR, RNA-primed PCR, Stretch PCR, reverse PCR, PCR using Alu sequence, multiplex PCR, PCR using mixed primers, PCR using PNA, hybridization assay (hybridization assays), FISH (fluorescent in situ hybridization assays), PCR (polymerase chain assays), LCR (ligase chain reaction), SD (strand displacement assays), Terms such as competitive hybridization, DNA chip, nucleic acid detection (gene detection) device, SNP (snip: single nucleotide substitution polymorphism), and complex microbial system are currently used in molecular biology and genetic engineering. Have the same meanings as those commonly used in microbial engineering and the like.

In the present invention, measuring the concentration of a target nucleic acid refers to quantifying the concentration, performing quantitative detection, simply detecting, or performing polymorphism / mutation for one or more nucleic acids in a measurement system. Analysis of such as. In the case of multiple types of nucleic acids, quantitative detection of multiple types of nucleic acids at the same time, simple detection of multiple types of nucleic acids at the same time, or analysis of polymorphisms / mutations of multiple types of nucleic acids at the same time, etc. Naturally, it is within the technical scope of the present invention.
The device for measuring a target nucleic acid concentration refers to various DNA chips and the like. Specific examples thereof include various types of DNA chips. In the present invention, any type of DNA chip may be used as long as the nucleic acid probe of the present invention can be applied.
A method for measuring the concentration of a target nucleic acid using a nucleic acid probe labeled with a fluorescent dye (hereinafter simply referred to as the nucleic acid probe of the present invention or the probe of the present invention) (hereinafter simply referred to as a nucleic acid measuring method for simplicity) ) Means the hybridization method (hybridization assays), FISH method (fluorescent in situ hybridization assays), PCR method (polymerase chain assays), LCR method (ligase chain reaction), SD method (strand displacement assays), competitive It refers to measuring the concentration of a target nucleic acid by a method such as a competitive hybridization.
Conventionally, in these methods, after adding a nucleic acid probe labeled with a fluorescent dye, the fluorescent dye of the unreacted nucleic acid probe that did not hybridize to the target nucleic acid was removed from the measurement system by washing or the like, and the target was removed. A fluorescent dye labeled on the nucleic acid probe hybridized to the nucleic acid is directly emitted from the probe or by indirectly applying the probe to the probe (for example, by acting an enzyme) to emit light. This is a method for measuring the amount of light emission. The present invention is characterized in that a target nucleic acid is measured without performing such a complicated operation in these methods.

In the present invention, a target nucleic acid refers to a nucleic acid or a gene whose concentration is to be measured. With or without purification. Also, the magnitude of the concentration does not matter. Various nucleic acids may be mixed. For example, a specific nucleic acid for the purpose of measuring the concentration in a complex microorganism system (mixed system of RNA or gene DNA of multiple microorganisms) or a symbiotic microorganism system (mixed system of RNA or gene DNA of multiple animals and plants and / or multiple microorganisms) It is. When the target nucleic acid needs to be purified, it can be performed by a conventionally known method. For example, it can be performed using a commercially available purification kit or the like. Specific examples of the above nucleic acid include DNA, RNA, PNA, oligodeoxyribonucleotides, oligoribonucleotides, and the like, and chemically modified nucleic acids of the nucleic acid. Examples of chemically modified nucleic acids include 2'- O -methyl (Me) RNA.

  In the present invention, a fluorescent dye generally used for labeling a nucleic acid probe and used for measurement and detection of nucleic acid can be conveniently used.However, when a nucleic acid probe labeled with a fluorescent dye hybridizes to a target nucleic acid, Preferably, the fluorescent dye labeled as described above reduces its emission. For example, fluorescein or derivatives thereof such as fluorescein isothiocyanate (FITC) or derivatives thereof, such as Alexa 488, Alexa 532, cy3, cy5, and EDANS (5- (2′-aminoethyl) amino- 1-naphthalene sulfonic acid)｝, rhodamine 6G (R6G) or a derivative thereof (for example, tetramethylrhodamine (TMR), tetramethylrhodamine isothiocyanate (TMRITC), x-rhodamine (x -rhodamine), Texas red, BODIPY FL (trade name; Molecular Probes, USA), BODIPY FL / C3 (trade name; Molecular Probes ), United States), BODIPY FL / C6 (trade name; Molecular Probes, USA), BODIPY (BODIPY) ) 5-FAM (trade name; manufactured by Molecular Probes, USA), BODIPYTMR (trade name; manufactured by Molecular Probes, USA), or a derivative thereof (for example, Bodepy) (BODIPY) TR (trade name; molecular probe (Molecular Probes), USA), Depey (BODIPY) R6G (trade name; molecular probe (Molecular Probes), USA), bodypi (BODIPY) 564 (trademark) (Molecular Probes, USA), BODIPY 581 (trade name; Molecular Probes, USA), etc. Among them, FITC, EDANS , 6-joe, TMR, Alexa 488, Alexa 532, BODIPY FL / C3 (trade name; manufactured by Molecular Probes, USA), BODIPY FL / C6 (trade name) Molecular Probes (Molecular Probes, USA) and the like, and FITC, TMR, 6-jeo, BODIPY FL / C3 (trade name; Molecular Probes), US) and BODIPY FL / C6 (trade name; manufactured by Molecular Probes, USA) can be mentioned as more preferable ones.

  The nucleic acid probe of the present invention that hybridizes to a target nucleic acid may be composed of oligodeoxyribonucleotides or oligoribonucleotides. Also, a chimeric oligonucleodite containing both of them may be used. These oligonucleotides may be chemically modified. The chemically modified oligonucleotide may be interposed in the chimeric oligonucleotide chain.

Examples of the modified site of the chemically modified oligonucleotide include a terminal hydroxyl group or a terminal phosphate group at the end of the oligonucleotide, an internucleoside phosphate site, a carbon at the 5-position of a pyrimidine ring, and a sugar of a nucleoside (ribose or deoxyribose). ) Site. Preferably, a ribose or deoxyribose site can be mentioned. Specifically, 2'O - alkyl oligoribonucleotide (2'- O -alkyloligoribonucleotides) (hereinafter, 2'- O -. The abbreviated to 2-O-), 2-O- alkylene oligoribonucleotides ( Examples thereof include 2-o-alkyleneoligoribonucleotides) and 2-O-benzyloligoribonucleotides. The oligonucleotide is one in which the OH group at the 2′-position carbon of one or more riboses at any position of the oligoribonucleotide is modified (by an ether bond) with an alkyl group, an alkylene group or a benzyl group. In the present invention, preferably, among the 2-O-alkyl oligoribonucleotides, 2-O-methyl oligoribonucleotide, 2-O-ethyl oligoribonucleotide, 2-O-butyl oligoribonucleotide, O-benzyl oligoribonucleotide, among 2-O-alkylene oligoribonucleotides, 2-O-ethylene oligoribonucleotide, and 2-O-benzyl oligoribonucleotide, particularly preferably 2-O- Methyl oligoribonucleotide (hereinafter simply referred to as 2-O-Me oligoribonucleotide) is used. By applying such a chemical modification to the oligonucleotide, the affinity with the target nucleic acid is increased, and the hybridization efficiency of the nucleic acid probe of the present invention is improved. When the hybridization efficiency increases, the rate of decrease in the fluorescence intensity of the fluorescent dye of the nucleic acid probe of the present invention further increases, so that the measurement of the concentration of the target nucleic acid further improves.
In the present invention, the term “oligonucleotide” means oligodeoxyribonucleotide or oligoribonucleotide or both, and is generically referred to.
2-O-alkyl oligoribonucleotides, 2-O-alkylene oligoribonucleotides, and 2-O-benzyl oligoribonucleotides can be synthesized by known methods (Nucleic Acids Research, Vol. 26, pp. 2224-2229, 1998). . In addition, GENSET (Ltd.) (France) has commissioned synthesis, so it can be easily obtained. The present inventors commissioned the company to synthesize the compound and conducted experiments to complete the present invention.

The nucleic acid probe of the present invention in which a modified RNA such as 2-O-methyl oligoribonucleotide (hereinafter simply referred to as 2-O-Me oligoribonucleotide) is interposed in an oligodeoxyribonucleotide is mainly used. Preferred results are obtained when used for measuring RNA, especially rRNA.
When measuring RNA using the nucleic acid probe of the present invention, before hybridizing with the probe, an RNA solution as a sample is subjected to 80 to 100 ° C, preferably 90 to 100 ° C, optimally 93 to 97 ° C. Heat treatment for 1 to 15 minutes, preferably 2 to 10 minutes, optimally 3 to 7 minutes to destroy the higher-order structure of RNA is suitable for improving the hybridization efficiency.

Further, it is preferable to add a helper probe to the hybridization reaction solution in order to further increase the hybridization efficiency of the nucleic acid probe of the present invention to the hybridization sequence region. In this case, the oligonucleotide of the helper probe may be an oligodeoxyribonucleotide or an oligoribonucleotide, or may be an oligonucleotide subjected to the same chemical modification as described above. Examples of the oligonucleotides include (5 ′) TCCTTTGAGT TCCCGGCCGG A (3 ′) as a forward type, and (5 ′) CCCTGGTCGT AAGGGCCATG ATGACTTGAC GT (5 ′) as a backward type or a reverse ward type. 3 '). Preferred examples of oligonucleotides that have been chemically modified include 2-O-alkyl oligoribonucleotides, particularly 2-O-Me oligoribonucleotides.
When the nucleic acid probe of the present invention has a base chain of 35 bases or less, the use of a helper probe is particularly effective. When using the nucleic acid probe of the present invention having a length of more than 35 base chains, it may be sufficient to simply heat denature the target RNA.
As described above, when the nucleic acid probe of the present invention is hybridized to RNA, the hybridization efficiency is increased, so that the fluorescence intensity is reduced according to the amount of RNA in the reaction solution, and the RNA is reduced to a final RNA concentration of about 150 pM. Be able to measure.
Thus, the present invention is also a measurement kit for measuring the concentration of a target nucleic acid, which contains or accompanies the helper probe in a measurement kit for measuring the concentration of a target nucleic acid, which contains or accompanies the nucleic acid probe of the present invention.

  In the measurement of RNA by a conventional hybridization method using a nucleic acid probe, an oligodeoxyribonucleotide or oligoribonucleotide has been used as the nucleic acid probe. Since RNA itself has a strong higher-order structure, the hybridization efficiency between the probe and the target RNA is poor, and the quantification is poor. For this purpose, the conventional method has the complexity of denaturing the RNA, fixing it to a membrane, and then performing a hybridization reaction. On the other hand, the method of the present invention uses a ribose moiety-modified nucleic acid probe having a high affinity for a specific structural part of RNA, so that the hybridization reaction can be performed at a higher temperature than in the conventional method. . Therefore, the above-mentioned adverse effects of the higher-order structure of RNA can be overcome only by using a heat denaturation treatment as a pretreatment and a combined use of a helper probe. Thereby, in the method of the present invention, the hybridization efficiency becomes substantially 100%, and the quantification is improved. In addition, it is much simpler than the conventional method.

  The number of bases of the probe of the present invention is 5 to 50, preferably 10 to 25, particularly preferably 15 to 20. When it exceeds 50, the permeability of the cell membrane becomes poor when used in the FISH method, and the application range of the present invention is narrowed. If it is less than 5, non-specific hybridization is likely to occur, resulting in a large measurement error.

The base sequence of the probe is not particularly limited as long as it specifically hybridizes to the target nucleic acid. Preferably, when the nucleic acid probe labeled with a fluorescent dye hybridizes to the target nucleic acid,
(1) The base sequence of the probe is 1 to 3 bases away from the terminal base of the target nucleic acid hybridized to the probe, so that at least one base G (guanine) is present in the base sequence of the target nucleic acid. The designed nucleotide sequence,
(2) The nucleotide sequence of the probe is designed such that a plurality of base pairs of the nucleic acid hybrid complex form at least one pair of G (guanine) and C (cytosine) at the terminal portion of the probe. A base sequence is preferred.

  The oligonucleotide of the nucleic acid probe of the present invention can be produced by a general method for producing an oligonucleotide. For example, it can be produced by a chemical synthesis method, a microbial method using a plasmid vector, a phage vector, or the like (Tetrahedron letters, 22, 1859-1862, 1981; Nucleic acids Research, 14, 6227-6245, 1986). ). It is preferable to use a commercially available nucleic acid synthesizer (for example, ABI394 (manufactured by Perkin Elmer, USA)).

In order to label the oligonucleotide with a fluorescent dye, any of the conventionally known labeling methods can be used (Nature Biotechnology, 14, 303-308, 1996; Applied and Environmental Microbiology, 63). Pp. 1143-1147, 1997; Nucleic acids Research, 24, 4532-4535, 1996). For example, when a fluorescent dye molecule is bound to the 5 'end, first, for example,-(CH ₂ ) _n -SH is introduced as a spacer into the phosphate group at the 5' end according to a conventional method. These transductants are commercially available and may be purchased commercially (Midland Certified Reagent Company). In this case, n is 3 to 8, preferably 6. A labeled oligonucleotide can be synthesized by binding a fluorescent dye having SH group reactivity or a derivative thereof to this spacer. The thus synthesized oligonucleotide labeled with a fluorescent dye can be purified by chromatography such as reverse phase or the like to obtain the nucleic acid probe of the present invention.

Further, a fluorescent dye can be bound to the 3 ′ end of the oligonucleotide. In this case, for example,-(CH ₂ ) _n -NH ₂ is introduced as a spacer into the OH group at the 3′-position C of ribose or deoxyribose. Since these transfectants are also commercially available in the same manner as described above, commercial products may be purchased (Midland Certified Reagent Company). In addition, a phosphate group is introduced, and for example,-(CH ₂ ) _n -SH is introduced as a spacer to the OH group of the phosphate group. In these cases, n is 3-8, preferably 4-7. A labeled oligonucleotide can be synthesized by binding a fluorescent dye or a derivative thereof reactive to an amino group or SH group to this spacer. The thus synthesized oligonucleotide labeled with a fluorescent dye can be purified by chromatography such as reverse phase or the like to obtain the nucleic acid probe of the present invention. When introducing this amino group, kit reagents (for example, Uni-link aminomodifier (manufactured by CLONTECH, USA), Fluo Reporter Kit (FluoReporter Kit) F-6082, F-6083, F-6084, F-10220 ( In any case, it is convenient to use Molecular Probes (USA)). Then, a fluorescent dye molecule can be bound to the oligoribonucleotide according to a conventional method. It is also possible to introduce a fluorescent dye molecule into the strand of the probe nucleic acid (ANALYTICAL BIOCHEMISTRY 225, pp. 32-38 (1998)).

  Although the nucleic acid probe of the present invention can be prepared as described above, a preferred form of the probe is one in which the 3 ′ or 5 ′ end is labeled with a fluorescent dye, and the labeled base is G or C. It is what is. When the 5 ′ end is labeled and the 3 ′ end is unlabeled, the 3 ′ terminal OH group of the 3 ′ terminal ribose or deoxyribose is replaced with a phosphate group or the like, and the 3 ′ terminal ribose 2 ′ position carbon of the ribose or deoxyribose. May be modified with a phosphate group or the like without any limitation.

  The nucleic acid probe of the present invention can be suitably used not only for nucleic acid measurement but also for a method for analyzing or measuring polymorphism and / or mutation of a target nucleic acid. In particular, a more convenient device for measuring the concentration of a target nucleic acid is provided by applying it to a device for measuring the concentration of a target nucleic acid {DNA chip (protein nucleic acid enzyme, vol. 43, 2004-2011, 1998)}. Also, a method for analyzing or measuring polymorphism and / or mutation of a target nucleic acid using the device is an extremely convenient method. That is, in the hybridization with the nucleic acid probe of the present invention, the fluorescence intensity changes depending on whether or not a GC pair is formed. Thus, by hybridizing the nucleic acid probe of the present invention to the target nucleic acid and measuring the luminescence intensity, polymorphism and / or mutation of the target nucleic acid can be analyzed or measured. The specific method is described in Examples 14 and 15. In this case, the target nucleic acid may be an amplified product amplified by one of various nucleic acid amplification methods, or may be an extracted product. Further, the type of the target nucleic acid is not limited. However, a guanine base or a cytosine base may be present in the chain or at the terminal. If no guanine base or cytosine base is present in the chain or at the end, the fluorescence intensity does not decrease. Therefore, according to the method of the present invention, mutation or substitution of G → A, G ← A, C → T, C ← T, G → C, G ← C, that is, single nucleotide polymorphism (SNP) Can be analyzed or measured. At present, polymorphism analysis is currently performed by determining the base sequence of a target nucleic acid using the Maxam-Gilbert method and the dideoxy method.

  Thus, by including the nucleic acid probe of the present invention in a measurement kit for analyzing or measuring polymorphism and mutation of the target nucleic acid, polymorphism or / and mutation of the target nucleic acid can be detected. It can be suitably used as a measurement kit for analysis or measurement.

When analyzing data obtained by a method for analyzing or measuring polymorphism and / or mutation of a target nucleic acid of the present invention, a reaction system when the target nucleic acid hybridizes with the nucleic acid probe of the present invention. If the processing step of correcting the fluorescence intensity value of the above by the fluorescence intensity value of the reaction system when the above-mentioned one is not hybridized is provided, the processed data becomes highly reliable.
Thus, the present invention provides a data analysis method for a method of analyzing or measuring polymorphism and / or mutation of a target nucleic acid.

  Further, a feature of the present invention is that in a measurement device for analyzing or measuring polymorphism and / or mutation of a target nucleic acid, the fluorescence of a reaction system when the target nucleic acid hybridizes with the nucleic acid probe of the present invention. Analyzing polymorphism and / or mutation of a target nucleic acid, comprising a means for correcting the intensity value with the fluorescence intensity value of the reaction system when the above-mentioned one is not hybridized Alternatively, it is a measuring device for measuring.

  Also, a feature of the present invention is that when analyzing data obtained by a method for analyzing or measuring polymorphism and / or mutation of a target nucleic acid, the target nucleic acid hybridizes with the nucleic acid probe of the present invention. A computer readable recording as a program a procedure for causing a computer to execute a process of correcting the fluorescence intensity value of the reaction system at the time of the above, by the fluorescence intensity value of the reaction system when the above-mentioned ones are not hybridized. It is a recording medium.

  The nucleic acid probe of the present invention may be immobilized on a solid (support layer) surface, for example, a surface of a slide glass. In this case, it is preferable that the end not labeled with the fluorescent dye is fixed. This format is now called a DNA chip. It can be used for monitoring gene expression, determining base sequence, mutation analysis, polymorphism analysis such as single nucleotide polymorphism (SNP), etc. . Of course, it can also be used as a device (chip) for nucleic acid measurement.

  For binding the nucleic acid probe of the present invention to, for example, the surface of a slide glass, a slide glass coated with a polycation such as polylysine, polyethyleneimine or polyalkylamine, a slide glass into which an aldehyde group has been introduced, or a slide into which an amino group has been introduced First, prepare the glass. And i) reacting the phosphate glass of the probe with the slide glass coated with the polycation, ii) reacting the slide glass with the introduced aldehyde group with the probe with the introduced amino group, iii) reacting the amino group with the probe. Can be achieved by introducing a PDC (pyridinium dichromate) or reacting a probe introduced with an amino group or an aldehyde group (Fodor, PA, et al., Science, 251, 767-773 (1991); Acad. Sci., USA, 93, 10614-10619 (1996); McGal, G., et al., Proc. Natl. Acad. Sci., USA, 93, 13555-13560 (1996); Blanchard, AP, et al., Biosens. Bioelectron., 11, 687-690 (1996)).

A device in which the nucleic acid probes of the present invention are arrayed and bound on a solid surface in an array makes nucleic acid measurement more convenient.
In this case, many types of target nucleic acids can be measured simultaneously by making a device in which many nucleic acid probes having different base sequences are individually bonded on the same solid surface.
In this device, for each probe, at least one temperature sensor and a heater are provided on the surface opposite to the surface to which the solid nucleic acid probe of the present invention is bonded, and the region of the solid to which the probe is bonded is set to an optimum temperature condition. Preferably, it is designed so that the temperature can be adjusted so that

  In this device, the probe other than the nucleic acid probe of the present invention, for example, has two different fluorescent dyes in one molecule, and when not hybridized to the target nucleic acid, the interaction of the two fluorescent dyes Nucleic acid probe having a structure designed to quench or emit light but emit or quench when hybridized to a target nucleic acid, that is, the molecular beacon (Tyagi et al., Nature Biotech., 14: 303- 308, 1996) can also be preferably used. Therefore, such a device is also included in the technical scope of the present invention.

  The basic operation of the measurement method using the device of the present invention is simply to place a solution containing a target nucleic acid such as mRNA, cDNA, rRNA or the like on a solid surface to which a nucleic acid probe is bound, and to hybridize. Thus, the amount of fluorescence changes according to the amount of the target nucleic acid, and the measurement of the target nucleic acid can be performed from the amount of change in the fluorescence. In addition, by binding a large number of nucleic acid probes of the present invention having different base sequences on one solid surface, the concentration of many target nucleic acids can be measured at once. Therefore, it is a novel DNA chip because it can be used for the measurement of a target nucleic acid in exactly the same application as the DNA chip. Under optimal reaction conditions, nucleic acids other than the target nucleic acid do not change the amount of fluorescence emitted, so that there is no need to perform an operation to wash unreacted nucleic acids. Further, by controlling the temperature of each nucleic acid probe of the present invention with a micro heater, it is possible to control the reaction conditions to the optimum for each probe, so that accurate concentration measurement is possible. Further, the dissociation curve between the nucleic acid probe of the present invention and the target nucleic acid can be analyzed by continuously changing the temperature with a micro heater and measuring the amount of fluorescence during that time. From the difference in the dissociation curves, the properties of the hybridized nucleic acid can be determined, and the SNP can be detected.

A conventional device for measuring the concentration of a target nucleic acid binds (fixes) a nucleic acid probe that is not modified with a fluorescent dye to a solid surface, hybridizes the target nucleic acid labeled with the fluorescent dye, and then hybridizes. Unremoved target nucleic acid was washed away, and the fluorescence intensity of the remaining fluorescent dye was measured.
To label a target nucleic acid with a fluorescent dye, for example, if a specific mRNA is targeted, take the following steps: (1) Extract all of the mRNA extracted from the cells. (2) Then, cDNA is synthesized using reverse transcriptase while incorporating a nucleoside modified with a fluorescent dye. Such an operation is not necessary in the present invention.

  Although a large number of various probes are spotted on the device, the optimal hybridization conditions, such as temperature, for nucleic acids that hybridize to each probe are different. Therefore, the hybridization reaction and the washing operation must be performed under optimum conditions for each probe (for each spot). However, since it is physically impossible, hybridization is carried out at the same temperature for all probes, and washing is carried out at the same temperature with the same washing liquid. Therefore, the nucleic acid expected to be hybridized has a drawback that it does not hybridize, and even if it hybridizes, it is easily washed away because the hybridization is not strong. Due to such reasons, the quantification of nucleic acids was low. The present invention does not have such a disadvantage because this washing operation is not required. Further, by providing a micro heater at the bottom of the spot and controlling the hybridization temperature, the hybridization reaction can be performed at the optimum temperature for each probe of the present invention. Therefore, in the present invention, the quantitativeness is remarkably improved.

In the present invention, the use of the above-described nucleic acid probe or device of the present invention enables the concentration of a target nucleic acid to be measured in a short time, simply and specifically. The measurement method is described below.
In the measurement method of the present invention, first, the nucleic acid probe of the present invention is added to a measurement system and hybridized to a target nucleic acid. The method can be carried out by a commonly known method (Analytical Biochemistry, 183, 231-244, 1989; Nature Biotechnology, 14, 303-308, 1996; Applied and Environmental Microbiology, 63, 1143-1147, 1997). For example, hybridization conditions include a salt concentration of 0 to 2 molar, preferably 0.1 to 1.0 molar, and a pH of 6 to 8, preferably 6.5 to 7.5.

  The reaction temperature is preferably within the range of the Tm value of the nucleic acid hybrid complex obtained by hybridizing the nucleic acid probe of the present invention to a specific site of the target nucleic acid ± 10 ° C. By doing so, non-specific hybridization can be prevented. When the temperature is lower than Tm−10 ° C., nonspecific hybridization occurs. When the temperature exceeds Tm + 10 ° C., no hybridization occurs. The Tm value can be determined in the same manner as in the experiment necessary for designing the nucleic acid probe of the present invention. That is, an oligonucleotide (having a base sequence complementary to the nucleic acid probe) that hybridizes with the nucleic acid probe of the present invention is chemically synthesized using the above-described nucleic acid synthesizer or the like, and the Tm value of a nucleic acid hybrid complex with the nucleic acid probe is synthesized Is measured in the usual way.

The reaction time is 1 second to 180 minutes, preferably 5 seconds to 90 minutes. When the time is less than 1 second, the number of unreacted nucleic acid probes of the present invention in hybridization increases. Further, it is meaningless if the reaction time is too long. The reaction time is greatly affected by the nucleic acid species, that is, the length of the nucleic acid or the base sequence.
As described above, the nucleic acid probe of the present invention is hybridized to the target nucleic acid. Then, before and after the hybridization, the amount of emission of the fluorescent dye is measured with a fluorometer, and the amount of decrease in emission is calculated. Since the magnitude of the decrease is proportional to the concentration of the target nucleic acid, the concentration of the target nucleic acid can be determined.

  The concentration of the target nucleic acid in the reaction solution: preferably 0.1 to 10.0 nM. The concentration of the nucleic acid probe of the present invention in the reaction solution is preferably 1.0 to 25.0 nM. When preparing a calibration curve, it is desirable to use the nucleic acid probe of the present invention at a ratio of 1.0 to 2.5 with respect to the target nucleic acid.

  In practice, when measuring an unknown concentration of a target nucleic acid in a sample, a calibration curve is first prepared under the above conditions. Then, a plurality of concentrations of the corresponding nucleic acid probes of the present invention are added to the sample, and the decrease in the fluorescence intensity value is measured. Then, a probe concentration corresponding to the largest one of the measured decrease values of the fluorescence intensity is set as a preferable probe concentration. The quantitative value of the target nucleic acid is determined from the calibration curve based on the decrease in the fluorescence intensity measured with the probe at the preferable concentration.

  Although the principle of the nucleic acid measurement method of the present invention is as described above, the present invention relates to various nucleic acid measurement methods, for example, FISH method, PCR method, LCR method, SD method, competitive hybridization method, TAS method, etc. Applicable to

An example is described below.
a) When applied to the FISH method In other words, the present invention provides a method of mixing microorganisms of various types or a microorganism system in which one or more types of microorganisms are mixed with cells derived from animals or plants and cannot be isolated from each other. The present invention can be suitably applied to nucleic acid measurement of intracellular or homogenate of cells of a complex microbial system or a symbiotic microbial system). The microorganism here is a microorganism generally referred to, and is not particularly limited. For example, eukaryotic microorganisms, prokaryotic microorganisms, mycoplasmas, viruses, rickettsies, and the like can be mentioned. The term "target nucleic acid" as used herein refers to, for example, a nucleic acid having a nucleotide sequence having specificity for cells of a bacterial strain to be examined in these microbial systems. For example, the specific sequence of 5S rRNA, 16S rRNA or 23S rRNA of a specific strain or the DNA of the gene thereof.

  By adding the nucleic acid probe of the present invention to a complex microbial system or a symbiotic microbial system and measuring the amount of 5S rRNA, 16S rRNA or 23S rRNA of a specific strain or their gene DNA, thereby measuring the abundance of the specific strain in the system. it can. In addition, a method of adding the nucleic acid probe to a complex microbial or symbiotic microbial homogenate, measuring the amount of decrease in luminescence of a fluorescent dye before and after hybridization, and measuring the abundance of a specific strain is also disclosed in the present invention. Within the target range.

The measuring method is, for example, as follows. That is, before adding the nucleic acid probe of the present invention, the temperature, salt concentration and pH of the complex microorganism system or symbiotic microorganism system are adjusted to the above-mentioned conditions. The specific strain in the complex microbial system or the symbiotic microbial system is adjusted to a cell number of 10 ⁷ to 10 ¹² cells / ml, preferably 10 ⁹ to 10 ¹⁰ cells / ml. It can be carried out by dilution or concentration by centrifugation or the like. When the number of cells is less than 10 ⁷ cells / ml, the fluorescence intensity is weak and the measurement error increases. When it exceeds 10 ¹² cells / ml, the fluorescence intensity of the complex microorganism system or the symbiotic microorganism system is too strong, so that the amount of the specific microorganism cannot be quantitatively measured.

The concentration of the nucleic acid probe of the present invention to be added depends on the number of cells of a specific strain in a complex or symbiotic microorganism system. The concentration is 0.1 to 10.0 nM, preferably 0.5 to 5 nM, more preferably 1.0 nM per 1 × 10 ⁸ cells / ml. When the concentration is less than 0.1 nM, the data does not accurately reflect the abundance of the specific microorganism. However, the optimal amount of the nucleic acid probe of the present invention cannot be determined unconditionally because it depends on the amount of the target nucleic acid in the cell.

Next, in the present invention, the reaction temperature when hybridizing the nucleic acid probe with 5S rRNA, 16S rRNA or 23S rRNA of a specific strain or its gene DNA is the same as the above-mentioned conditions. The reaction time is also the same as the above conditions.
Under the conditions described above, the nucleic acid probe of the present invention is hybridized to 5S rRNA, 16S rRNA or 23S rRNA of a specific strain or the gene DNA thereof, and the amount of decrease in the emission of the fluorescent dye of the complex microorganism or symbiotic microorganism before and after hybridization is measured. Measure.

  The amount of decrease in the emission of the fluorescent dye measured as described above is proportional to the amount of the specific strain present in the complex microorganism system or the symbiotic microorganism system. This is because the amount of 5S rRNA, 16S rRNA, 23S rRNA or their gene DNA is proportional to the amount of the specific strain.

In the present invention, components other than microorganisms in a complex microbial system or a symbiotic microbial system are not limited as long as they do not inhibit hybridization of the nucleic acid probe of the present invention with 5S rRNA, 16S rRNA or 23S rRNA of a specific strain or their gene DNA, The nucleic acid probe of the present invention is not particularly limited as long as it does not inhibit the emission of the fluorescent dye. For _{example, KH 2 PO 4, K 2} HPO 4, NaH 2 PO 4, Na 2 phosphate HPO _4, etc., ammonium sulfate, ammonium nitrate, inorganic nitrogen such as urea, magnesium, sodium, potassium, calcium ion or the like of metal ions And various salts such as sulfates, hydrochlorides, and carbonates of trace metal ions such as manganese, zinc, iron, and cobalt ions, and vitamins. If the above-mentioned inhibition is observed, cells may be separated from a cell line in which a plurality of microorganisms are mixed by an operation such as centrifugation, and then suspended again in a buffer solution or the like.

  As the above buffer, various buffers such as a phosphate buffer, a carbonate buffer, a Tris / HCl buffer, a Tris / glycine buffer, a citrate buffer, and a Goodt buffer can also be used. The concentration of the buffer is a concentration that does not inhibit the hybridization, the FRET phenomenon, and the emission of the fluorescent dye. Its concentration depends on the type of buffer. The pH of the buffer is 4-12, preferably 5-9.

b) When applied to a PCR method Any method can be applied as long as it is a PCR method. The case where the method is applied to a real-time quantitative PCR method is described below.
That is, in the real-time quantitative PCR method, PCR is performed using the specific nucleic acid probe of the present invention, and the decrease in emission of the fluorescent dye before and after the reaction is measured in real time.
The PCR of the present invention means PCR by various methods. For example, RT-PCR, RNA-primed PCR, Stretch PCR, reverse PCR, PCR using Alu sequence, multiplex PCR, PCR using mixed primers, PCR using PNA, and the like are also included. Further, the term “quantitative” means quantitative measurement of the degree of detection in addition to the original quantitative measurement, as described above.

  As described above, the target nucleic acid refers to a nucleic acid whose abundance is to be measured. With or without purification. Also, the magnitude of the concentration does not matter. Various nucleic acids may be mixed. For example, the specific nucleic acid to be amplified in a complex microbial system (mixed system of RNA or gene DNA of multiple microorganisms) or a symbiotic microbial system (mixed system of RNA or gene DNA of multiple microorganisms and / or multiple microorganisms). When the target nucleic acid needs to be purified, it can be performed by a conventionally known method. For example, it can be performed using a commercially available purification kit or the like.

  Conventionally known quantitative PCR methods include dATP, dGTP, dCTP, dTTP or dUTP, target nucleic acid (DNA or RNA), Taq polymerase, primers, and a nucleic acid probe or an intercalator labeled with a fluorescent dye in the presence of Mg ions. In addition, the target nucleic acid is amplified while repeating low and high temperatures, and the increase in the emission of the fluorescent dye during the amplification process is monitored in real time (Experimental Medicine, Vol. 15, No. 7, pp. 46-51, 1997). Year, Yodosha).

  The quantitative PCR method of the present invention is characterized in that a target nucleic acid is amplified using the nucleic acid probe of the present invention, and the amount of decrease in the emission of a fluorescent dye is measured in the amplification process. In the quantitative PCR of the present invention, a preferable nucleic acid probe of the present invention has a base number of 5 to 50, preferably 10 to 25, particularly preferably 15 to 20, and an amplification product of a target nucleic acid during a PCR cycle. Any substance can be used as long as it hybridizes with the above. Further, it may be designed as either a forward type or a reverse type.

For example, the following can be mentioned.
(1) The terminal, preferably the terminal, of the nucleic acid probe is labeled with the fluorescent dye of the present invention, and when the nucleic acid probe hybridizes to the target nucleic acid, the terminal or terminal labeled with the fluorescent dye of the probe. The base sequence of the probe is designed such that at least one base G (guanine) is present in the base sequence of the target nucleic acid at a distance of 1 to 3 bases from the terminal base of the target nucleic acid hybridized with the target nucleic acid.
(2) In the above (1), the nucleic acid probe is labeled with a fluorescent dye at the 3 ′ end.

(3) In the above (1), the nucleic acid probe is labeled with a fluorescent dye at the 5 ′ end.
(4) When the nucleic acid probe hybridizes to the target nucleic acid, the probe is so formed that a plurality of base pairs of the nucleic acid hybrid complex form at least one pair of G (guanine) and C (cytosine) at the probe terminal. Has been designed.
(5) In the above (4), the 3 ′ terminal base of the nucleic acid probe is G or C, and the 3 ′ terminal is labeled with a fluorescent dye.
(6) In the above (4), the 5 ′ terminal base of the nucleic acid probe is G or C, and the 5 ′ terminal is labeled with a fluorescent dye.
(7) The nucleic acid probe of (1) to (6) above, wherein the 3′-terminal hydroxyl group of ribose or deoxyribose at the 3 ′ terminal or the 3′-terminal or 2′-carbon hydroxyl group of 3′-terminal ribose is present. Phosphorylated.
(8) The oligonucleotides of the nucleic acid probes (1) to (6) are chemically modified.

  In the case of the above (6), if the 3 ′ or 5 ′ end cannot be designed as G or C from the base sequence of the target nucleic acid, the oligonucleotide is a primer designed from the base sequence of the target nucleic acid at the 5 ′ end. Even if 5'-guanylic acid or guanosine or 5'-cytidylic acid or cytidine is added, the object of the present invention can be suitably achieved. Even if 5'-guanylic acid or 5'-cytidylic acid is added to the 3 'end, the object of the present invention can be suitably achieved. Therefore, in the present invention, a nucleic acid probe designed so that the base at the 3 ′ or 5 ′ end is G or C means, in addition to a probe designed from the base sequence of a target nucleic acid, a 5 ′ end of the probe. A probe obtained by adding 5′-guanylic acid or guanosine or 5′-cytidylic acid or cytidine to a probe, and a probe obtained by adding 5′-guanylic acid or 5′-cytidylic acid to the 5 ′ end of the probe. It is defined as including.

  In particular, the nucleic acid probe of the present invention (7) is designed so as not to be used as a primer. Instead of two probes (labeled with a fluorescent dye) used in the real-time quantitative PCR method using the FRET phenomenon, PCR is performed using one nucleic acid probe of the present invention. The probe is added to the PCR reaction system, and PCR is performed. At the time of the nucleic acid extension reaction, the probe hybridized to the target nucleic acid or the amplified target nucleic acid is decomposed by the polymerase and decomposed and removed from the nucleic acid hybrid complex. At this time, the fluorescence intensity value of the reaction system or the reaction system in which the nucleic acid denaturation reaction is completed is measured. In addition, the fluorescence of a reaction system in which the target nucleic acid or the amplified target nucleic acid is hybridized with the probe (a reaction system during an annealing reaction or a nucleic acid extension reaction until the probe is removed from the nucleic acid hybrid complex by a polymerase). Measure the intensity value. Then, the amplified nucleic acid is measured by calculating the decrease rate of the fluorescence intensity value from the former. Fluorescence when the probe is completely dissociated from the target nucleic acid or amplified target nucleic acid by a nucleic acid denaturation reaction, or decomposed and removed from the nucleic acid hybrid complex of the probe and the target nucleic acid or amplified target nucleic acid by polymerase during nucleic acid extension The intensity value is large. However, a nucleic acid hybrid complex of the probe and the target nucleic acid or the amplified target nucleic acid by a polymerase during an annealing reaction or a nucleic acid extension reaction in which the annealing reaction is completed or the probe is sufficiently hybridized to the target nucleic acid or the amplified target nucleic acid The fluorescence intensity value of the reaction system until it is decomposed and removed from is smaller than the former. The decrease in the fluorescence intensity value is proportional to the amount of the amplified nucleic acid.

  In this case, the Tm of the nucleic acid hybrid complex when the probe hybridizes to the target nucleic acid is within the range of ± 15 ° C., preferably ± 5 ° C. of the Tm value of the nucleic acid hybrid complex of the primer ( It is desirable that the nucleotide sequence of the probe in 7) is designed. When the Tm value of the probe is lower than the primer Tm value of −5 ° C., particularly −15 ° C., the emission of the fluorescent dye does not decrease because the probe does not hybridize. Conversely, if the Tm value of the primer exceeds + 5 ° C., especially + 15 ° C., the probe hybridizes to nucleic acids other than the target nucleic acid, and the specificity of the probe is lost.

  Probes other than the above (7), particularly the probe of (6), are added to the PCR reaction system as primers. A PCR method using a primer labeled with a fluorescent dye has not yet been known other than the present invention. As the PCR reaction proceeds, the amplified nucleic acid is secondarily labeled with a fluorescent dye useful for practicing the present invention. Thus, the fluorescence intensity value of the reaction system in which the nucleic acid denaturation reaction is completed is large, but the fluorescence intensity of the reaction system is lower than that of the former system in the case of the annealing reaction being completed or in the reaction system during the nucleic acid extension reaction. I do.

  The PCR reaction can be performed under the same reaction conditions as in a general PCR method. Thus, the target nucleic acid can be amplified in a reaction system having a low Mg ion concentration (1-2 mM). Of course, the present invention can also be carried out in a reaction system in the presence of a high concentration (2 to 4 mM) of Mg ions used in conventionally known quantitative PCR.

In the PCR method of the present invention, the Tm value can be obtained by performing the PCR of the present invention and analyzing the nucleic acid melting curve of the amplified product. This method is a novel method for analyzing a melting curve of a nucleic acid. In the present method, the nucleic acid probe used in the PCR method of the present invention or the nucleic acid probe of the present invention used as a primer can be suitably used.
In this case, the nucleotide sequence of the nucleic acid probe of the present invention is set to a sequence complementary to a region containing a SNP (snip; single nucleotide substitution polymorphism), so that the nucleic acid is dissociated from the nucleic acid probe of the present invention after completion of PCR. By analyzing the curve, the SNP can be detected from the difference in the dissociation curve. When a nucleotide sequence complementary to a sequence containing an SNP is used as the sequence of the nucleic acid probe of the present invention, the Tm value obtained from the dissociation curve between the probe sequence and the sequence containing the SNP is a dissociation curve between the probe sequence and the sequence not containing the SNP. Higher than the Tm value obtained from

A second feature of the present invention is an invention of a method for analyzing data obtained by the real-time quantitative PCR method.
The real-time quantitative PCR method is currently a computer that can program a reaction device for performing PCR, a device for detecting the emission of a fluorescent dye, a user interface, that is, a data analysis method, and record the program. A medium (also called Sequence Detection Software System) and a device that consists of a computer that controls them and analyzes data, and is measured in real time. Thus, the measurement according to the invention is also performed with such a device.

First, an analysis apparatus for real-time quantitative PCR will be described below. Device used in the present invention, PCR may be any device as long as device can be monitored in real time but, for example, ABI PRISM ^TM 7700 base sequence detection system (Sequence Detection System SDS 7700) (Perkin Elmer Applied Biosystems System Company (Perkin Elmer Applied Biosytems, USA)), LightCycler ^™ System (Roche Diagnostics, Germany) and the like can be mentioned as particularly suitable ones.

  The PCR reaction apparatus is an apparatus that repeatedly performs a thermal denaturation reaction, an annealing reaction, and an elongation reaction of a target nucleic acid (for example, the temperature can be repeatedly set to 95 ° C., 60 ° C., and 72 ° C.). . The detection system includes an argon laser for fluorescence excitation, a spectrograph, and a CCD camera. Furthermore, each procedure of the data analysis method is programmed, and a computer-readable recording medium recording the program is installed and used in a computer, controls the above system via the computer, and is output from the detection system. It records a program for analyzing and processing data.

  The data analysis program recorded on the computer-readable recording medium is a process for measuring the fluorescence intensity for each cycle, and the measured fluorescence intensity is displayed on a computer display as a function of the cycle, that is, as an amplification plot of PCR. A displaying process, a process of calculating a PCR cycle number (threshold cycle number: Ct) at which the fluorescence intensity starts to be detected, a process of creating a calibration curve for obtaining a copy number of the sample nucleic acid from the Ct value, data of each process, and plot values Printing process. When the PCR progresses exponentially, a linear relationship holds between the Log value of the copy number of the target nucleic acid at the start of the PCR and Ct. Therefore, by preparing a calibration curve using a known number of copies of the target nucleic acid and detecting the Ct of the sample containing the unknown number of copies of the target nucleic acid, the copy number of the target nucleic acid at the start of PCR can be calculated.

A PCR-related invention such as the data analysis method described above is a method for analyzing data obtained by the above-described real-time quantitative PCR method. Each feature is described below.
The first feature is that, in a method for analyzing data obtained by a real-time quantitative PCR method, when the amplified nucleic acid in each cycle binds to a fluorescent dye or the amplified nucleic acid hybridizes with the nucleic acid probe of the present invention. The fluorescence intensity value of the reaction system at the time, the fluorescent dye and nucleic acid bound in each cycle, that is, the fluorescent dye-nucleic acid complex, or the nucleic acid probe of the present invention and the target nucleic acid hybridized, that is, nucleic acid This is an arithmetic processing step of correcting with the fluorescence intensity value of the reaction system when the hybrid complex is dissociated, that is, a correction arithmetic processing step.

"A reaction system when the amplified target nucleic acid binds to the fluorescent dye or when the amplified target nucleic acid hybridizes with the nucleic acid probe of the present invention" is specifically exemplified by 40 to 85 in each cycle of PCR. And a reaction system at the time of nucleic acid extension reaction or annealing having a reaction temperature of 50 ° C, preferably 50 to 80 ° C. And, it means a reaction system in which the reaction is completed. The actual temperature depends on the length of the amplified nucleic acid.
The “reaction system when the fluorescent dye-nucleic acid complex or the nucleic acid hybrid complex is dissociated” is a reaction system for heat denaturation of nucleic acid in each cycle of PCR, specifically, a reaction temperature. A system at a temperature of 90 to 100 ° C, preferably 94 to 96 ° C, in which the reaction is completed can be exemplified.

As the correction calculation process in the correction calculation process, any process may be used as long as it meets the object of the present invention. Can be exemplified.
f _n = f _{hyb, n} / f _{den, n} [Equation 1]
f _n = f _{den, n} / f _{hyb, n} [Equation 2]
(In the formula,
f _n : correction operation processing value in the nth cycle calculated by [Equation 1] or [Equation 2],
f _{hyb, n} : the fluorescence intensity value of the reaction system in the nth cycle when the amplified nucleic acid binds to the fluorescent dye or when the amplified nucleic acid hybridizes with the nucleic acid probe of the present invention;
f _{den, n} : the fluorescence intensity value of the reaction system when the above-mentioned fluorescent dye-nucleic acid complex or nucleic acid hybrid complex is dissociated in the nth cycle]
In this process, the sub-displays and / or prints the corrected calculation processing values obtained in the above processing on a computer display and / or the graphs as a function of the number of cycles. It includes steps.

  The second characteristic is that the correction calculation processing value obtained by [Equation 1] or [Equation 2] in each cycle is substituted into the following [Equation 3] or [Equation 4], and the fluorescence change rate or the fluorescence change rate between each sample is obtained. Is a data analysis method for calculating and comparing them.

F _n = f _n / f _a [Equation 3]
F _n = f _a / f _n [Equation 4]
(In the formula,
F _n : the rate of change of fluorescence or the rate of change of fluorescence calculated by [Equation 3] or [Equation 4] in the _n- th cycle;
f _n : Correction operation processing value according to [Equation 1] or [Equation 2] in the nth cycle f _a : Correction operation processing value according to [Equation 1] or [Equation 2] before a change in f _n is observed The number of cycles is arbitrary, but usually, for example, 10 to 40 cycles, preferably 15 to 30 cycles, and more preferably 20 to 30 cycles. ]
In this process, the calculated value obtained in the above process is displayed and / or printed on a computer display, or the comparison value or the value is similarly displayed and / or graphed as a function of each cycle number. Although it includes a sub-step for printing, the above-described sub-step may or may not be applied to the correction operation processing value obtained by [Equation 1] or [Equation 2].

The third feature is
(3.1) A process of performing an arithmetic processing by [Equation 5], [Equation 6] or [Equation 7] using the fluorescence change ratio or the data of the fluorescence change rate calculated by [Equation 3] or [Equation 4]. ,
log _b (F _n ), ln (F _n ) [Equation 5]
log _b {(1-F _n ) × A}, ln {(1-F _n ) × A} [Equation 6]
log _b {(F _n -1) × A}, ln {(F _n -1) × A} [Equation 7]

(In the formula,
A, b: arbitrary numerical values, preferably integer values, more preferably natural numbers. When A = 100 and b = 10, {(F _n −1) × A} is expressed as a percentage (%).
F _n : Fluorescence change rate or fluorescence change rate in n cycles calculated by [Equation 3] or [Equation 4],
(3.2) an arithmetic processing step of calculating the number of cycles in which the arithmetic processing value of (3.1) has reached a constant value;
(3.3) an arithmetic processing step of calculating a relational expression between the number of cycles in a nucleic acid sample having a known concentration and the number of copies of the target nucleic acid at the start of the reaction,
(3.4) a process of calculating the copy number of the target nucleic acid at the start of PCR in the unknown sample;
This is a data analysis method having the following. Then, a process consisting of (3.1) → (3.2) → (3.3) → (3.4) is preferred.

In each of the steps (3.1) to (3.3), the operation processing value obtained in each processing is displayed on a computer display and / or the value is displayed in the form of a graph as a function of each cycle number. It may include a sub-step of displaying and / or printing as described above. Since the operation processing value obtained in the process (3.4) needs to be printed at least, the process includes a printing sub-step. The operation processing value obtained in (3.4) may be further displayed on a display of a computer.
In addition, the correction calculation processing value by [Equation 1] or [Equation 2] and the calculation processing value by [Equation 3] or [Equation 4] are displayed on a computer display in the form of a graph as a function of the number of cycles. Since they may or may not be printed, their display and / or printing sub-steps may be added as needed.

  The data analysis method is particularly effective when the real-time quantitative PCR method measures the amount of decrease in the emission of a fluorescent dye. A specific example is the aforementioned real-time quantitative PCR method of the present invention.

  A fourth feature is that in the real-time quantitative PCR analysis device, the real-time quantitative PCR measurement and / or analysis device has an operation and storage means for executing the data analysis method for the real-time quantitative PCR method of the present invention. It is.

  A fifth feature is that each procedure of a data analysis method for analyzing PCR using a real-time quantitative PCR analyzer is programmed, and the data analysis method of the present invention is stored in a computer-readable recording medium on which the program is recorded. Fig. 4 is a computer-readable recording medium that records a program that allows a computer to execute each procedure of the method.

  A sixth feature is a novel nucleic acid measurement method using the data analysis method, the measurement and / or analysis device, and the recording medium of the present invention in the nucleic acid measurement method.

A seventh feature is a method for analyzing the melting curve of a nucleic acid of the present invention, that is, a method for analyzing data obtained by a method for obtaining a Tm value of a nucleic acid by performing a PCR method of the present invention.
That is, for a nucleic acid amplified by the PCR method of the present invention, a step of gradually increasing the temperature from a low temperature until the nucleic acid is completely denatured (for example, from 50 ° C. to 95 ° C.), and a short time interval ( (E.g., an interval corresponding to a temperature rise of 0.2 ° C. to 0.5 ° C.), a process of measuring the fluorescence intensity, a process of displaying the measurement results on a display as a function of time, that is, a melting curve of the nucleic acid is displayed. Process, differentiating this melting curve to obtain a differential value (-dF / dT, F: fluorescence intensity, T: time), displaying the value as a differential value on a display, inflection point from the differential value This is an analysis method consisting of the process of obtaining In the present invention, the fluorescence intensity increases as the temperature increases. In the present invention, at the time of nucleic acid extension reaction in each cycle, preferably, by adding to the above-described process, a process of performing an arithmetic process of dividing the fluorescence intensity value at the end of the PCR reaction using the fluorescence intensity value at the time of the thermal denaturation reaction, More favorable results are obtained.

  The real-time quantitative PCR measurement and / or analysis apparatus of the present invention, which is obtained by adding a method of analyzing a melting curve of a nucleic acid of the present invention to the data analysis method of the novel PCR method of the present invention, is also provided by the present invention. Within technical scope.

  Furthermore, one of the features of the present invention is a computer-readable recording medium that records a program that enables a computer to execute each step of the method for analyzing a melting curve of a nucleic acid of the present invention, Each of the methods for analyzing the melting curve of the nucleic acid of the present invention in a computer-readable recording medium storing a program capable of causing a computer to execute each procedure of the data analysis method of the PCR method of the present invention. This is a computer-readable recording medium in which a program that allows a computer to execute a procedure is additionally recorded.

  The data analysis method, device, and recording medium of the present invention can be used in various fields such as medicine, forensics, anthropology, ancient biology, biology, genetic engineering, molecular biology, agriculture, and plant breeding. . Also referred to as a complex microbial system, a symbiotic microbial system, a microbial system in which various types of microorganisms are mixed or at least one type of microorganism is mixed with cells derived from other animals or plants and cannot be mutually isolated. It can be suitably used. The microorganism referred to here is a microorganism generally referred to, and is not particularly limited. For example, eukaryotic microorganisms, prokaryotic microorganisms, other mycoplasmas, viruses, rickettsies and the like can be mentioned.

  Further, using one or more of the data analysis method, apparatus and recording medium of the present invention, the copy number of 5S rRNA, 16S rRNA or 23S rRNA of a specific strain in a complex microbial system or a symbiotic microbial system or their gene DNA is determined. By doing so, the amount of the specific strain in the system can be measured. This is because the copy number of the gene DNA of 5S rRNA, 16S rRNA or 23S rRNA is constant depending on the strain. In the present invention, it is possible to measure the abundance of a specific strain by performing the real-time quantitative PCR of the present invention using a complex microbial or symbiotic microbial homogenate. This method is also within the technical scope of the present invention.

Next, the present invention will be described more specifically with reference to examples and comparative examples.
Example 1
A nucleic acid probe that hybridizes to the nucleic acid base sequence of 16S rRNA of Escherichia coli , that is, has a base sequence of (3 ′) CCGCTCACGC ATC (5 ′) was prepared as follows.

Preparation of nucleic acid probe : (3 ′) CCGCTCACGC-(CH ₂ ) ₇ —NH ₂ was added to the OH group at the 3′-carbon of deoxyribose at the 3 ′ end of oligodeoxyribonucleotide having the base sequence of ATC (5 ′). The conjugate was purchased from Midland Certified Reagent Company (USA). Furthermore, in addition to the FluoroReporter Kit F-6082 (BODIPY FL propionic acid succinimidyl ester) from Molecular Probes, the compound was used as an amine for oligonucleotides. Kit containing a reagent that binds to the derivative). The kit was allowed to act on the purchased oligonucleotide to synthesize a nucleic acid probe labeled with bodypi FL used in this example.

Purification of synthesized product : The obtained synthesized product was dried to obtain a dried product. It was dissolved in a 0.5 M NaHCO ₃ / Na ₂ CO ₃ buffer (pH 9.0). The lysate was subjected to gel filtration using a NAP-25 column (manufactured by Pharmacia) to remove unreacted substances. Further, reverse phase HPLC (B gradient: 15 to 65%, 25 minutes) was performed under the following conditions. Then, the eluting main peak was collected. The fractionated fraction was freeze-dried to obtain a nucleic acid probe in a yield of 23% from the initial oligonucleotide starting material of 2 mM.

Example 2
Using a 200 ml (sterilized) Erlenmeyer flask to which 50 ml of sterilized Nutrient Broth (NB) (manufactured by Difco) liquid medium (composition: NB, 0.08 g / 100 ml) was added, 37 strains of E. coli JM109 were cultured. The cells were cultured overnight at 37 ° C with shaking. Next, an equivalent amount of 99.7% ethanol was added to the main culture solution. 2 ml of the ethanol-added culture was centrifuged in a 2.0 ml Eppendorf centrifuge tube to obtain bacterial cells. The cells were washed once with 100 μl of 30 mM phosphate buffer (soda salt) (pH: 7.2). The cells were suspended in 100 μl of the above phosphate buffer containing 130 mM NaCl. The suspension was subjected to ultrasonic treatment in ice cooling for 40 minutes (output: 33 w, oscillation frequency: 20 kHz, oscillation method: 0.5 second oscillation, 0.5 second pause) to produce a homogenate.

  After centrifugation of the homogenate, the supernatant was collected and transferred to a cell of a fluorometer. It was adjusted to 36 ° C. Then, a solution of the nucleic acid probe previously heated to 36 ° C. was added to a final concentration of 5 nM. Escherichia coli 16S rRNA was hybridized with the nucleic acid probe for 90 minutes while controlling the temperature at 36 ° C. Then, the emission amount of the fluorescent dye was measured with a fluorometer.

  The amount of luminescence of the fluorescent dye before hybridization is a value measured by using a 30 mM phosphate buffer (soda salt) (pH: 7.2) containing 130 mM NaCl instead of the supernatant. did. The amount of luminescence was measured by changing the ratio of the amount of the nucleic acid probe to the amount of the supernatant (excitation light: 503 nm; measured fluorescence color: 512 nm). The result is shown in FIG. As can be seen from FIG. 1, the emission of the fluorescent dye decreased as the ratio of the supernatant increased. That is, in the present invention, it can be seen that the amount of decrease in the emission of the fluorescent dye increases in proportion to the amount of the target nucleic acid hybridized to the nucleic acid probe.

Example 3
Preparation of nucleic acid probe:-(CH ₂ ) is added to the OH group at the 3′-carbon of the 5′-terminal nucleotide of the oligonucleotide having the base sequence of (5 ′) CCCACATCGTTTTGTCTGGG (3 ′) that hybridizes to 23S rRNA of Escherichia coli JM109 strain. a material obtained by combining the ₇ -NH _2, in the same manner as in example 1 Medorando-Sateifaido-Rejinto Company, (Midland Certified Reagent Company, USA) was purchased from. Further, in the same manner as in Example 1, in addition to the FluoroReporter Kit F-6082 (BODIPY FL propionic acid succinimidyl ester) from Molecular Probes, Inc. Kit containing a reagent that binds the compound to the amine derivative of the oligonucleotide). The kit was allowed to act on the oligonucleotide to synthesize a nucleic acid probe labeled with bodypy FL. The obtained synthesized product was purified in the same manner as in Example 1 to obtain a nucleic acid probe labeled with bodypi FL in a yield of 25% from 2 mM of the initial oligonucleotide raw material.

Example 4
Pseudomonas paucimobilis (current name: Sphingomonas paucimobilis) (FERM P-5122) prepared on the cells of Escherichia coli JM109 obtained in Example 2 under the same medium and culture conditions as in Example 2 ) Was mixed with E. coli JM109 strain at the same concentration at OD660 value to prepare a complex microorganism system. A homogenate was prepared from the obtained mixed solution (the bacterial cell concentration of Escherichia coli JM109 was the same as in Example 2) in the same manner as in Example 2. Using the nucleic acid probe prepared in Example 3, an experiment similar to that of Example 2 was performed, except that the excitation light was set to 543 nm and the measured fluorescent color was set to 569 nm. Was.

Example 5
The base selectivity of the target nucleic acid in the fluorescence quenching phenomenon, that is, the base specificity of the present invention was examined. Ten types (poly a to poly j) of target synthetic deoxyribooligonucleotides (30 mer) shown below were prepared using a DNA synthesizer ABI394 (manufactured by Perkin Elmer, USA).

Further, a probe of the present invention shown below was prepared in which the deoxyribooligonucleotide corresponding to the above-mentioned synthetic DNA was labeled at the 5 'end with bodypy FL.
The primer DNA corresponding to the above synthetic DNA was prepared by binding-(CH ₂ ) ₆ -NH ₂ to the phosphate group at the 5 ′ end of the primer DNA, and was obtained from Midland Certified Reagent Company, USA ) Purchased from. Furthermore, in addition to the FluoroReporter Kit F-6082 (BODIPY FL propionic acid succinidyl ester) from Molecular Probes, Inc. Kit containing a reagent to be bound to the amine derivative). The kit was allowed to act on the purchased primer DNA to synthesize the probes a to d and f to h of the present invention labeled with the following bodypy FL. Then, the extent to which the emission of the fluorescent dye decreased when hybridized with the corresponding synthetic deoxyribooligonucleotide was examined under the following conditions, and the specificity of the probe of the present invention was examined.

  The results are shown in Table 1. As can be seen from Table 1, when the nucleic acid probe labeled with the fluorescent dye hybridized to the target DNA (oligodeoxyribonucleotide), at the end, the probe was shifted from the terminal base at which the probe and the target DNA hybridized by one. It is preferable that the nucleotide sequence of the probe is designed so that G (guanine) is present in the nucleotide sequence of the target DNA at least one or more nucleotides apart from each other by about 3 nucleotides. In addition, when a nucleic acid probe labeled with a fluorescent dye hybridizes to a target DNA, the probe is designed so that a plurality of base pairs of the nucleic acid hybrid complex form at least one pair of G and C at the terminal portion. It can be seen from Table 1 that the base sequence is preferably designed.

Example 6
A target nucleic acid having the following nucleotide sequence and a nucleic acid probe of the present invention were prepared. The influence of the number of G in the target nucleic acid and the number of G in the nucleic acid probe of the present invention was examined in the same manner as in the above example.

  As can be seen from Table 2, it is recognized that the number of G in the target nucleic acid and the number of G in the probe of the present invention do not significantly affect the decrease in fluorescence intensity.

Example 7
In the same manner as above, a target nucleic acid having the following base sequence and a nucleic acid probe of the present invention were prepared. The nucleic acid probe of the present invention in the present example is obtained by labeling the 5 ′ end of the oligonucleotide with bodypy FL / C6. The effects of the base species in the target nucleic acid and the base species in the nucleic acid probe of the present invention were examined in the same manner as in the above example.

  As can be seen from Table 3 and the above examples, (i) when the end of the probe of the present invention labeled with a fluorescent dye is composed of C, and when the target nucleic acid hybridizes, when forming a GC pair, (ii) ) When the end of the probe of the present invention which is labeled with a fluorescent dye is composed of a base other than C, the base pair of the base labeled with the fluorescent dye and the base of the target nucleic acid is used to determine the 3 'When at least one G exists on the terminal side, the decrease rate of the fluorescence intensity is large.

Example 8
The type of dye to be labeled on the nucleic acid probe of the present invention was examined in the same manner as in the above-mentioned Example. Note that the probe of the present invention used the probe z of Example 7 and the target nucleic acid used the oligonucleotide z of Example 7 above.
Table 4 shows the results. As can be seen from the table, preferred examples of the fluorescent dye used in the present invention include FITC, BODIPY FL, BODIPY FL / C3, 6-joe, and TMR.

Example 9 (Experiment of effect of heat treatment of target nucleic acid (16S rRNA))
Preparation of the nucleic acid probe of the present invention: (5 ′) CATCCCCACC TTCCTCCGAG TTGACCCCGG CAGTC which specifically hybridizes to the 16S rRNA nucleotide sequence of the KYM-7 strain corresponding to the nucleotide sequence from the 1156th to 1190 nucleotides of the 16S rRNA of the Escherichia coli JM109 strain 3 ′) (35 base pairs), bases 1 to 16 and 25 to 35 are modified with deoxyribonucleotides and bases 17 to 24 are modified with a methyl group at the OH group at the 2′-position carbon (modified with an ether bond). ), And the OH group of the phosphate group at the 5 ′ end of the oligonucleotide was modified with — (CH ₂ ) ₇ —NN ₂ and bound thereto, in the same manner as in Example 1.・ Purchased from Regent Company (Midland Certified Reagent Company, USA). A 2-O-Me oligonucleotide used for a 2-O-Me probe (a probe comprising a 2-O-Me oligonucleotide is simply referred to as a 2-O-Me probe) was synthesized by GENSET (France). Outsourced and obtained.
Further, in the same manner as in Example 1, other than FluoroReporter Kit F-6082 (BODIPY FL / C6 propionic acid succinimidyl ester) from Molecular Probes, Inc. And a kit containing a reagent that binds the compound to the amine derivative of the oligonucleotide. The kit was allowed to act on the oligonucleotide to synthesize a nucleic acid probe of the present invention labeled with bodypy FL / C6. The obtained synthesized product was purified in the same manner as in Example 1 to obtain a nucleic acid probe of the present invention labeled with bodypy FL / C6 in a yield of 23% from the initial oligonucleotide material of 2 mM. This probe was named 35 base chain 2-O-Me probe.

  An oligoribonucleotide having the nucleotide sequence of (5 ′) TCCTTTGAGT TCCCGGCCGG A (3 ′) was synthesized using a DNA synthesizer in the same manner as described above to obtain a forward-type helper probe. On the other hand, an oligoribonucleotide having a base sequence of (5 ′) CCCTGGTCGT AAGGGCCATG ATGACTTGAC GT (3 ′) is synthesized using a DNA synthesizer in the same manner as described above, and a backward (backward) type, that is, a reverse type helper probe. did.

A 35-base chain 2-O-Me probe, a forward type helper probe and a reverse type helper probe were each dissolved in a buffer solution having the following composition so as to have a concentration of 25 nM, and heated to 75 ° C. (probe solution).
After the above 16S rRNA was heat-treated at 95 ° C. for 5 minutes, it was added to the above-mentioned probe solution under the following reaction conditions, and the fluorescence intensity was measured with a fluorescence measurement instrument Perkin Elmer LS-50B. . The result is shown in FIG. The control using 16S rRNA not subjected to the heat treatment was used as a control. It can be seen from FIG. 2 that the decrease in the fluorescence intensity was large in the heat-treated experimental plot. This result indicates that the 16S rRNA was heat-treated at 95 ° C. to perform stronger hybridization with the probe of the present invention.

Example 10 (Experiment of Contribution to Improvement of Hybridization Efficiency of 2'-O-Me Oligonucleotide and Helper Probe)
The following various nucleic acid probes of the present invention and various helper probes that hybridize to the above 16S rRNA were prepared in the same manner as in Example 9. All the 2-O-Me oligonucleotides used for the 2-O-Me probe were obtained by outsourcing the synthesis to GENSET (France). Under the following conditions, the effects of the 2-O-Me probe of the present invention, the effects of the length of the base chain of the probe, and the effects of the helper probe were examined in the experiments shown in FIGS. The system was examined in the same manner as in Example 9. The result is shown in FIG.
From the figure, it can be seen that the 2-O-Me probe of the present invention contributes to the hybridization efficiency. In addition, when the base chain of the 2-O-Me probe is short, the helper probe is useful for increasing the hybridization efficiency.

1) 35 base chain 2-O-Me probe: the same probe as in Example 9 above,
2) 35 base chain DNA probe: a probe having the same base sequence as the 35 base chain 2-O-Me probe of the above 1), but having an oligonucleotide composed of deoxyribose;
3) 17-base chain 2-O-Me probe: The same base sequence as the 35-base chain 2-O-Me probe of 1), but 8 nucleotides from the 5 'end and 10 nucleotides from the 3' end Probe removed,
4) 17-base strand DNA probe: a probe having the same base sequence as the 33-base strand DNA probe of the above 2), except that nucleotides for 16 bases have been deleted from the 3 ′ end.

5) Forward 2-O-Me helper probe: OH group at the 2'-carbon of ribose at the center of 8 bases (9 to 16 bases counted from the 5 'end) of the forward-type helper probe of Example 9 Is a helper probe modified with a methyl group (ether bond),
6) Reverse type 2-O-Me helper probe: OH group at the 2'-position carbon of ribose at the central 8 bases (9 to 16 bases counted from the 5 'end) of the reverse type helper probe of Example 9 Is a helper probe modified with a methyl group (ether bond),
7) Forward type DNA helper probe: a helper probe having the same nucleotide sequence as that of the forward type helper probe of Example 9 but having an oligonucleotide composed of deoxyribonucleotides;
8) Reverse type DNA helper probe: a helper probe having the same nucleotide sequence as that of the reverse type helper probe of Example 9 but having an oligonucleotide composed of deoxyribonucleotides;
9) 35-base oligoribonucleotide: (5 ′) an oligoribonucleotide having a base sequence of CATCCCCACC TTCCTCCGAG TTGA CCCCGG CAGTC (3 ′),
10) 17-base chain oligoribonucleotide: An oligoribonucleotide having a base sequence of (5 ′) CCTTCCTCCG AGTTGAC (3 ′).

Example 11 (Creation of calibration curve for rRNA measurement)
After heating the rRNA at various concentrations ranging from 0.1 to 10 nM at 95 ° C. for 5 minutes, the obtained nucleic acid solution was added to a reaction solution which had been subjected to the following reaction conditions in advance. Reduction was measured using a Perkin Elmer LS-50B. The result is shown in FIG. The figure shows that the calibration curve shows linearity at 0.1 to 10 nM. The following 35 base chain 2-O-Me probe is the same probe as in Example 9.

Example 12 (FISH method)
KYM-7 (FERM P-11339) and Agrobacterium (Agrobacterium) sp. KYM-8 (FERM P-16806) rRNA of each of the following 35 or 36 bases of the present invention which hybridize to each rRNA of Cellulomonas (Cellulomonas) sp. Strand oligodeoxyribonucleotide 2-O-Me probes were prepared as described above. The base sequence of each probe is as follows.

35-base oligodeoxyribonucleotide 2-O-Me probe for measuring rRNA of Cellulomonas sp.KYM-7:
(5 ') CATCCCCACC TTCCTC CGAG TTGA CCCCGG CAGTC (3') (The underlined portion is modified with a methyl group.)
36-base oligodeoxyribonucleotide 2-O-Me probe for rRNA measurement of Agrobacterium sp.KYM-8:
(5 ′) CATCCCCACC TTCCTC TCGG CTTAT CACCG GCAGTC (3 ′) (The underlined portion is modified with a methyl group.)

Cellulomonas sp.KYM-7 and Agrobacterium sp.KYM-8 were mixedly cultured in a medium having the following medium composition under the following culture conditions, and the culture was collected at each culture time. From them, rRNA was prepared using RNeasy Maxikit (QIAGEN). After heating the rRNA at 95 ° C. for 5 minutes, it was added to a reaction solution previously set in reaction conditions, reacted at 70 ° C. for 1000 seconds, and then the fluorescence intensity was measured using a Perkin Elmer LS-50B. The results are shown in FIG. The total rRNA was measured using RiboGreen total RNA Quantification Kit (company name: molecular probes, location name: Eugene, Oregon, USA).
As can be seen, the kinetics of the rRNA of each strain was consistent with the kinetics of the total rRNA. In addition, the total amount of rRNA of each strain coincided with the total rRNA. This indicates that the method of the present invention is an effective method in the FISH method.

- medium composition (g / l): starch, 10.0; aspartic _{acid, 0.1; K 2 HPO 4,} 5.0; KH 2 PO 4, 2.0; MgSO 4 · 7H 2 O, 0.2; NaCl, 0.1; (NH 4) 2 SO ₄ ; 0.1.
-100 ml of the medium was dispensed into a 500 ml conical flask, and the flask was sterilized at 120 ° C for 10 minutes using an autoclave kettle.
Culture conditions: The above strains were cultured in advance on a slant medium. One platinum loop of bacterial cells was taken from the slant medium and inoculated into the sterilized conical flask medium. Stirring culture was performed at 30 ° C. and 150 rpm.

Example 13 below describes a method for analyzing or measuring a polymorphism and mutation of a target nucleic acid.
Example 13
Four types of oligonucleotides having the base sequences shown below were synthesized using the DNA synthesizer of Example 5 described above. In the same manner as in Example 5, a nucleic acid probe of the present invention having the following nucleotide sequence was synthesized. After the probe and each oligonucleotide were hybridized in a solution, it was examined whether single base substitution can be evaluated from the change in fluorescence intensity. The nucleotide sequence of the nucleic acid probe of the present invention is designed so that when G is present at any of the 3 'ends of the target oligonucleotide, the nucleotide sequence matches 100% with the nucleotide sequence of the oligonucleotide. The hybridization temperature was set at 40 ° C. at which 100% of the base-pairs between the probe and the target oligonucleotide could hybridize. The concentration of the probe and the target oligonucleotide, the concentration of the buffer solution, the fluorescence measurement device, the fluorescence measurement conditions, the experimental operation, and the like are the same as those in Example 5.

Table 5 shows the results. From the table, the target oligonucleotide No. In Nos. 1 to 3, no change was observed in the fluorescence intensity, but the target oligonucleotide Nos. In No. 4, a 84% reduction was observed.

In the present invention, data obtained by a method for analyzing or measuring a polymorphism and / or mutation of a target nucleic acid (for example, the above target oligonucleotide Nos. 1 to 4) (for example, data of columns A and B in Table 5) is analyzed. In the method, the fluorescence intensity value of the reaction system when the target nucleic acid is hybridized with the nucleic acid probe of the present invention (the above nucleic acid probe) is corrected by the fluorescence intensity value of the reaction system when the target nucleic acid is not hybridized. This means the calculation of (AB) / B in Table 3.
From the above results, it has been clarified that when the target nucleic acid is double-stranded, substitution of G → A, G ← A, C → T, C ← T, G → C, G ← C can be detected.

Example 14
FIG. 6 shows an example of a model of the DNA chip of the present invention. First, a modified probe prepared by introducing an amino group into the OH group at the 3'-position carbon of the 3'-terminal ribose of 3'TTTTTTTTGGGGGGGGC5'BODIPY FL / C6 which is the probe of the present invention prepared in Example 13, and A surface-treated slide glass was prepared by treating the surface of the slide glass with a silane coupling agent having an epoxy group as a reactive group. The solution containing the modified probe was spotted on the surface-treated glass slide using a DNA chip preparing apparatus GMS ^™ 417ARRAYER (TAKARA). Then, the modified probe bound to the glass surface at the 3 'end. The slide glass was placed in a closed container for about 4 hours to complete the reaction. The slide glass was alternately soaked twice in a 0.2% SDS solution and water for about one minute. Further, it was placed in a boron solution (a solution of 1.0 g of NaBH _{4 in} 300 ml of water) for about 5 minutes. After soaking in water at 95 ° C. for 2 minutes, the reagent was quickly soaked twice alternately in a 0.2% SDS solution and water for about 1 minute to wash away the reagent. Dry at room temperature. Thus, the DNA chip of the present invention was prepared.

Further, by providing a minute temperature sensor and a heater as shown in the figure on the lower surface of the glass at positions corresponding to the respective spots of the modification probe, high performance could be imparted to the DNA chip of the present invention.
A case where a target nucleic acid is measured using this DNA chip will be described. When the target nucleic acid is not hybridized to the probe, or when it does not form a GC pair at the fluorescent dye-labeled end even when hybridized, or 1 to 3 bases from the terminal base portion where the probe and the target nucleic acid are hybridized When there is no G (guanine) or cytosine (C) in the base sequence of the target nucleic acid, the fluorescence intensity does not change. However, conversely, when a target nucleic acid is hybridized to the probe, or when a GC pair is formed at the fluorescent dye-labeled end even when hybridized, or when the probe and the target nucleic acid are hybridized. When at least one G (guanine) or cytosine (C) is present in the base sequence of the target nucleic acid at a distance of 1 to 3 bases from the terminal base, the fluorescence intensity decreases. This fluorescence intensity can be measured using a DNA chip analyzer GMS ^™ 418 Array Scanner (TAKARA).

Example 15: Detection experiment of single nucleotide polymorphisms (SNPs) using the DNA chip of the present invention I) Preparation of target nucleic acid: (5 ′) oligodeoxyribose having the base sequence of AAACGATGTG GGAAGGCCCA GACAG CCAGG ATGTTGGCTT AGAAGCAGCC (3 ′) Nucleotides were synthesized using a DNA synthesizer ABI394 (Perkin Elmer, USA) to obtain a target nucleic acid.
II) Preparation of nucleic acid probe: The following six oligodeoxyribonucleotides having a base sequence that hybridizes to a sequence (underlined) of 15 bases from the 5 ′ end of the target nucleic acid were synthesized with a DNA synthesizer ABI394 (Perkin Elmer). , USA). Then, the 3'-OH group of the 3'-terminal deoxyribose was aminated using 3'-Amino-Modifier C7 CPG (Glen Research, catalog number 20-2957). Further, the phosphate group at the 5 'end was labeled with BODIPY FL in the same manner as in Example 5.

1) Probe 100 (100% match): (5 ') CCTTCCCACA TCGTTT (3'),
2) Probe-T (1 base mismatch): (5 ′) CCTTCCCATA TCGTTT (3 ′),
3) Probe-A (1 base mismatch): (5 ′) CCTTCCCAAA TCGTTT (3 ′),
4) Probe-G (1 base mismatch): (5 ′) CCTTCCCAGA TCGTTT (3 ′),
5) Probe-TG (2 base mismatch): (5 ′) CCTTCCCTGA TCGTTT (3 ′),
6) Probe-TGT (3 base mismatch): (5 ′) CCTTCCCTGT TCGTTT (3 ′),

III) Preparation of DNA chip All DNA probes were dissolved in sterile distilled water to make a 1 μM concentration solution. Using a DNA microarrayer device (DNA microarrayer No. 439702, 32-pin type, manual type chip arrayer consisting of DNA slide index No. 439701. Greiner), slide glasses for DNA chips (Black silylated slides) The probe solution was spotted on a Greiner). After the completion of the spot, the reaction was performed for 10 minutes, and the probe was immobilized on a slide glass. Thereafter, the plate was washed with a 50 mM TE buffer (pH: 7.2). Each probe solution was spotted by four spots.
FIG. 6 shows a schematic diagram of the DNA chip of the present invention. When the probe of the present invention immobilized on a slide glass does not hybridize to the target nucleic acid, BODIPY FL develops a color, but when hybridized, the color develops, which is less than that when it does not hybridize. . That is, it decreases. The slide glass is heated by a micro-heater (in the present invention, the slide glass was heated using a transparent heating plate for a microscope (MP-10MH-PG, Kitasato Supply Co., Ltd.) as shown below).

IV) Detection and measurement of SNPs A target nucleic acid solution of 100 μM concentration (using 50 mM TE buffer (pH: 7.2)) was placed on the DNA chip prepared as described above. It was covered with a cover glass, and the cover glass was sealed with nail polish so that the target nucleic acid did not leak.
FIG. 7 shows an outline of devices for detection and measurement. First, a transparent heating plate for a microscope (MP-10MH-PG, Kitasato Supply Co., Ltd.) was placed on a sample stage of an Olympus upright microscope (AX80 type). The DNA chip of the present invention prepared above was placed on the plate, and the temperature was changed from 95 ° C. to 33 ° C. in steps of 3 ° C., and the reaction was performed for 30 minutes. The change in fluorescence intensity during the reaction process of each spot was measured in an image capture format using a cooled CCD camera (C5810, Hamamatsu Photonics).
The captured image was analyzed with an image analyzer (PC (NEC) installed with image analysis software (TPlab spectrum; Signal Analytics, Verginia)), the brightness of each spot was calculated, and the relationship between temperature and brightness was obtained. .

  The experimental results are shown in FIG. From the figure, it can be seen that the fluorescence intensity is reduced for all the probes. Therefore, the dissociation curve between the probe of the present invention and the target nucleic acid can be easily monitored by the method of the present invention. In addition, since the difference between the Tm value of the probe 100 that matches 100% with the target nucleic acid and the probe that mismatches by one base is 10 ° C. or more, both can be easily identified from the dissociation curve. That is, it can be understood that SNPs can be easily analyzed by using the DNA chip of the present invention.

Hereinafter, Examples 16 to 19 describe the PCR method of the present invention.
Example 16
Using the 16S rRNA gene in Escherichia coli genomic DNA as a target nucleic acid, a primer (labeled with BODIPY FL / C6) (a nucleic acid probe of the present invention) for amplification of the nucleic acid was prepared.

Preparation of primer 1 (Eu800R: reverse type): An oligodeoxyribonucleotide having the nucleotide sequence of (5 ′) CATCGTTTAC GGCGTGGAC (3 ′) was synthesized using a DNA synthesizer ABI394 (manufactured by Perkin Elmer, USA). The oligodeoxyribonucleotide was treated with a phosphatase at the 5′-terminal phosphate group to form a cytosine, and an oligonucleotide in which — (CH ₂ ) ₉ —NH ₂ was bonded to the 5′-carbon OH group of the cytosine was applied to Midland. Purchased from Certified Raided Company (USA). Furthermore, in addition to the Fluo Reporter Kits F-6082 (BODIPY FL propionic acid succinimidyl ester) from Molecular Probes, the compound was used as the amine derivative of the oligonucleotide. Kit containing reagents to be bound) was purchased. The kit was allowed to act on the purchased oligonucleotide to synthesize primer 1 of the present invention labeled with bodypi FL / C6.

Purification of synthesized product: The obtained synthesized product was dried to obtain a dried product. It was dissolved in a 0.5 M Na ₂ CO ₃ / NaHCO ₃ buffer (pH 9.0). The lysate was subjected to gel filtration using a NAP-25 column (manufactured by Pharmacia) to remove unreacted substances. Further, reverse phase HPLC (B gradient: 15 to 65%, 25 minutes) was performed under the following conditions. Then, the eluting main peak was collected. The fractionated fraction was freeze-dried to obtain the primer 1 of the present invention in a yield of 50% from the initial oligonucleotide starting material of 2 mM.

Example 17
Preparation of Primer 2 (Eu500R / forward: forward type): Primer 2 labeled with a fluorescent dye (BODIPY FL / C6) at the 5 ′ end of an oligodeoxyribonucleotide having a base sequence of (5 ′) CCAGCAGCCG CGGTAATAC (3 ′) Prepared in the same manner as in Example 14 with a yield of 50%.

Example 18
Using a test tube containing 5 ml of sterilized nutrient broth (NB) (manufactured by Difco) liquid medium (composition: NB, 0.08 g / 100 ml), Escherichia coli JM109 strain was cultured with shaking at 37 ° C. overnight. 1.5 ml of the culture was centrifuged in a 1.5 ml centrifuge tube to obtain cells. Genomic DNA was extracted from the cells using a DNeasy Tissue Kit (QIAGEN, Germany). The extraction followed the kit protocol. As a result, a 17 ng / μl DNA solution was obtained.

Example 19
Genomic DNA of the E. coli, using primers 1 and / or primer 2, PCR was carried out in a conventional manner by using the Roche Diagnostics Corporation launch of the LightCycler ^TM system (LightCycler ^TM System) . The operation followed the procedure manual of the system equipment.
In the above system, PCR is performed by replacing the nucleic acid probe (two probes utilizing the FRET phenomenon) and the normal primer (normal primer not labeled with a fluorescent dye) according to the present invention with the present invention. The procedure was performed according to the procedure except that primers 1 and / or 2 were used.

尚、標的核酸である大腸菌１６ＳｒＤＮＡは、図９の説明欄に示される実験区の濃度で、また、プライマーは、同様に図９の説明欄に示される実験区のプライマー１及び／又は２の組合せで実験を行った。 PCR was performed in a hybridization solution of the following components:

The target nucleic acid, Escherichia coli 16S rDNA, was used at the concentration of the experimental section shown in the description section of FIG. 9, and the primer was also a combination of the primers 1 and / or 2 of the experimental section shown in the description section of FIG. The experiment was carried out.

The above Taq solution is a mixture of the following reagents.

  The Taq solution and the Taq DNA polymerase solution are those of a DNA Master Hybridization Probes kit sold by Roche Diagnostics, Inc. In particular, the Taq DNA polymerase solution was used by diluting 10 × conc. (Red cap) 10-fold. Taq Start is an antibody for Taq DNA polymerase marketed by Clonetech (USA). By adding this to a reaction solution, the activity of Taq DNA polymerase can be suppressed to 70 ° C. That is, a hot start can be performed.

測定は、ライトサイクラー^TMシステムを用いて行った。その際、該システムにあるＦ１〜３の検出器にうち、Ｆ１の検出器を用い、その検出器のゲインは１０、励起強度は７５に固定した。

The measurement was performed using a LightCycler ^™ system. At that time, among the F1 to F3 detectors in the system, the F1 detector was used, and the gain of the detector was fixed at 10 and the excitation intensity was fixed at 75.

The results are shown in FIGS. From FIGS. 9 and 10, it can be seen that the cycle number at the time when the decrease in the emission of the fluorescent dye is observed is proportional to the copy number of Escherichia coli 16S rDNA of the target nucleic acid. In the figure, the amount of decrease in the emission of the fluorescent dye is represented as a decrease in the fluorescence intensity.
FIG. 11 shows a calibration curve of E. coli 16S rDNA expressing the copy number of E. coli 16S rDNA as a function of cycle number. The correlation coefficient was 0.9973, showing a very good correlation.
As can be seen from the above results, the use of the quantitative PCR method of the present invention makes it possible to measure the initial copy number of the target nucleic acid. That is, the concentration of the target nucleic acid can be measured.

Example 20
In Example 19, PCR was performed using the probe of the present invention as a primer, but in this example, the probe of the present invention was used in place of the two probes using the FRET phenomenon used in the conventional method under the following conditions. The PCR of the present invention was performed.
a) Target nucleic acid: 16S-rDNA of E. coli
b) Primers used:
-Forward primer E8F: (5 ') AGAGTTTGAT CCTGGCTCAG (3')
・ Reverse primer E1492R: (5 ') GGTTACCTTG TTACGACTT (3')
c) Probe used: BODIPY FL- (5 ') CGGGCGGTGT GTAC (3')
d) PCR measurement equipment used: LightCycler ^™ system e) PCR conditions:
Denaturation reaction: 95 ° C, 10 seconds (first time only, 60 seconds, 95 ° C)
Annealing reaction: 50 ° C, 5 seconds Nucleic acid extension reaction: 72 ° C, 70 seconds Total number of cycles: 70 cycles

FIG. 12 shows the result. From the figure, it can be seen that the cycle number at the time when the decrease in the emission of the fluorescent dye is observed is proportional to the copy number of E. coli 16S rDNA of the target nucleic acid.
As can be seen from the above results, the use of the quantitative PCR method of the present invention makes it possible to measure the initial copy number of the target nucleic acid. That is, the target nucleic acid can be measured.

Next, a data analysis method of the present invention for analyzing data obtained by using the above-described quantitative PCR method of the present invention will be described in the following examples.
Example 21
Human genomic DNA (human β-globin (TaKaRa catalog product number 9060) (manufactured by TaKaRa Co., Ltd.)) (hereinafter, referred to as human genomic DNA) was labeled as a target nucleic acid with a bodepy FL / C6 for amplification of the nucleic acid. Primers were prepared.

Preparation of primer KM38 + C (reverse type): An oligodeoxyribonucleotide having a base sequence of (5 ′) CTGGTCTCCT TAAACCTGTC TTG (3 ′) was synthesized using a DNA synthesizer ABI394 (manufactured by Perkin Elmer, USA), Furthermore, the oligodeoxyribonucleotide at the 5′-terminal phosphate group was treated with phosphatase to give a cytosine, and-(CH ₂ ) ₉ -NH ₂ was bonded to the carbon OH group at the 5′-position of the cytosine. Purchased from Certified Certified Company. Further, in addition to the reporter kit (FluoReporter Kit) F-6082 (BODIPY FL propionic acid succinimidyl ester) from Molecular Probes, the compound is bound to the amine derivative of the oligonucleotide. Kit containing reagents) was purchased. The kit was allowed to act on the purchased oligonucleotide to synthesize the primer KM38 + C labeled with the bodypy FL / C6 of the present invention.

Purification of synthesized product: The obtained synthesized product was dried to obtain a dried product. It was dissolved in 0.5 M Na ₂ CO ₃ / NaHCO ₃ buffer (pH 9.0). The lysate was subjected to gel filtration using a NAP-25 column (manufactured by Pharmacia) to remove unreacted substances. Further, reverse phase HPLC (B gradient: 15 to 65% for 25 minutes) was performed under the following conditions. Then, the eluting main peak was collected. The fractionated fraction was freeze-dried to obtain the primer KM38 + C of the present invention in a yield of 50% from the initial oligonucleotide starting material of 2 mM.

Example 21
Preparation of primer KM29 (forward type): An oligodeoxyribonucleotide having the nucleotide sequence of (5 ′) GGTTGGCCAA TCTACTCCCA GG (3 ′) was synthesized in the same manner as in Example 18.

Comparative Example 1
This comparative example uses data analysis software that does not have an arithmetic processing step (the processing of equation (1)) in which the fluorescence intensity value during the nucleic acid extension reaction is divided by the fluorescence intensity value during the thermal denaturation reaction. It is related.
Using the above-mentioned human genomic DNA, primer KM38 + C and primer KM29, a PCR reaction was performed using a LightCycler ^™ system, and the fluorescence intensity in each cycle was measured.
The PCR of this comparative example uses the primer labeled with the fluorescent dye described above, and is a novel real-time quantitative PCR method for measuring the decrease, not the increase, of the fluorescence emission. Data analysis was performed using the software of the system. In the PCR of this comparative example, the nucleic acid probe (two probes utilizing the FRET phenomenon) and the normal primer (a normal primer not labeled with a fluorescent dye) described in the procedure manual were used instead of the present invention. Except for using the primers KM38 + C and KM29, the procedure was performed according to the procedure for the relevant apparatus.

尚、ヒトゲノムＤＮＡは、図１３の簡単な説明欄に示される実験区の濃度で実験を行った。MgCl₂の最終濃度は2mMであった。 PCR was performed in a hybridization solution of the following components:

The experiment was performed with human genomic DNA at the concentrations shown in the brief description column of FIG. The final concentration of MgCl ₂ was 2 mM.

The above Taq solution is next a mixture of reagents.

  The Taq solution and the Taq DNA polymerase solution are those of a DNA Master Hybridization Probes kit sold by Roche Diagnostics, Inc. In particular, the Taq DNA polymerase solution was used by diluting 10 × conc. (Red cap) 10-fold. Taq Start is an antibody for Taq DNA polymerase sold by Clonetech (USA). By adding this to a reaction solution, the activity of Taq DNA polymerase can be suppressed to 70 ° C. That is, a hot start can be performed.

測定は、ライトサイクラー^TMシステムを用いて行った。その際、該システムにあるＦ１〜３の検出器にうち、Ｆ１の検出器を用い、その検出器のゲインは１０、励起強度は７５に固定した。 The reaction conditions are as follows.

The measurement was performed using a LightCycler ^™ system. At that time, among the F1 to F3 detectors in the system, the F1 detector was used, and the gain of the detector was fixed at 10 and the excitation intensity was fixed at 75.

  PCR was performed as described above, and the fluorescence intensity of each cycle was actually measured. The result is shown in FIG. That is, the fluorescence intensity of each copy number of the human genomic DNA at the time of the denaturation reaction and the nucleic acid extension reaction of each cycle was measured and printed. In any cycle, the fluorescence intensity value is constant during the denaturation reaction, but during the nucleic acid extension reaction, the fluorescence intensity is observed to decrease from around the 25th cycle. Thus, it can be seen that the reduction occurs in the order of increasing copy number of human genomic DNA.

As shown in FIG. 13, the fluorescence intensity value at the initial cycle number was not uniform for each copy number of human genomic DNA. Therefore, the following steps (b) to (j) were added to the data analysis method used in this comparative example.
(B) a process of converting the fluorescence intensity value of each cycle with the fluorescence intensity value of the 10th cycle as 1, that is, a process of calculating by the following [Equation 8];
C _n = F _n (72) / F ₁₀ (72) [Equation 8]
Here, C _n = the converted value of the fluorescence intensity value in each cycle, F _n (72) = the fluorescence intensity value at 72 ° C. in each cycle, and F ₁₀ (72) = the fluorescence intensity after the extension reaction at 72 ° C. in the tenth cycle. value.
(C) displaying and / or printing each converted value obtained in the step (b) on a display as a function of the number of cycles;

(D) calculating the change rate (decrease rate, extinction rate) of the fluorescence intensity from the converted value of each cycle obtained in the process (b) according to the following [Equation 9];
[Equation 9]
F _dn = log ₁₀ {100−C _n × 100)}
F _dn = 2 log ₁₀ {1-C _n }
Here, F _dn = fluorescence intensity change rate (decrease rate, extinction rate), C _n = value obtained by [Equation 8].
(E) displaying and / or printing each converted value obtained in the step (d) on a display as a function of the number of cycles,

(F) comparing the data processed in the step (d) with 0.5 as a threshold, and counting the number of cycles reaching the value;
(G) creating a graph in which the values counted in the step (f) are plotted on the X-axis and the copy number before the start of the reaction is plotted on the Y-axis;
(H) displaying and / or printing the graph created in the step (g) on a display;
(I) calculating the correlation coefficient or the relational expression of the straight line drawn in the step (h); and (j) displaying the correlation coefficient or the relational expression calculated in the step (i) on the display. And / or printing process.

Using the data analysis software described above, the data obtained in FIG. 13 was subsequently processed as follows.
FIG. 14 shows the data processed in the above process (b) printed (process (c)). That is, the fluorescence intensity value of each cycle is converted with the fluorescence intensity value of the 10th cycle as 1, and the converted value is plotted against the corresponding cycle number.
FIG. 15 shows the data processed in the step (d) printed (the step (e)). That is, the reduction rate (quenching rate) of the fluorescence intensity was calculated from each plot value in FIG. 14, and each calculated value was plotted against each cycle number.

  FIG. 16 is a graph in which the graph created in the step (g) is printed on the data processed in the step (f) (the step (h)). That is, a graph in which the fluorescence intensity reduction rate = 0.5 is thresholded, the cycle number at which the value is reached is plotted on the X axis, and the copy number of the human genomic DNA before the start of the reaction is plotted on the Y axis. The correlation coefficient (R2) of the straight line in this graph was calculated in the process (i) and printed (process (j)), and was 0.9514. Thus, it was impossible to obtain an accurate copy number with this correlation coefficient.

Example 23 (Experimental example in which data processing was performed using the data analysis method of the present invention)
PCR was performed in the same manner as in Comparative Experimental Example 1.
The data processing was performed in the same manner as in Comparative Experimental Example 1 except that the following process (a) was performed before the process of (b) in Comparative Experimental Example 1, and the processes in (b) and (d) were changed as follows. A similar process was performed.
(A) The fluorescence intensity value of the reaction system when the amplified nucleic acid in each cycle is hybridized with the nucleic acid probe (labeled with a fluorescent dye) of the present invention (that is, at the time of nucleic acid extension reaction (72 ° C.)) Of the reaction system measured when the nucleic acid hybrid complex (the amplified nucleic acid hybridized with the nucleic acid primer) is dissociated (that is, at the completion of the nucleic acid thermal denaturation reaction (95 ° C.)). ), Ie, the correction calculation process, ie, the measured fluorescence intensity value was corrected by the following [Equation 1].
f _n = f _{hyb, n} / f _{den, n} [Equation 1]
[Wherein, f _n = correction value of fluorescence intensity for each cycle, f _{hyb, n} = fluorescence intensity value of 72 ° C. for each cycle, f _{den, n} = fluorescence intensity value of 95 ° C. for each cycle]
FIG. 17 shows the obtained values plotted for each cycle number.

(B) Substituting the correction operation processing value in [Equation 1] in each cycle into [Equation 3] and calculating the fluorescence change rate (decrease rate or extinction rate) between each sample in each cycle, that is, A process of performing an arithmetic process by the following [Equation 10],
F _n = f _n / f ₂₅ [Equation 10]
[Wherein, F _n = the value of the processing in each cycle, f _n = the value of each cycle obtained by [Equation 1], f ₂₅ = the value obtained by [Equation 1], and the number of cycles is the 25th. thing].
[Equation 10] is obtained when a = 25 in [Equation 3].

(D) applying the calculated value of each cycle obtained in the process (b) to a logarithmic value of a change rate (decrease rate or extinction rate) of the fluorescence intensity according to [Equation 6]; That is, a process of performing an arithmetic processing by the following [Equation 11],
log ₁₀ {(1-F _n ) × 100} [Equation 11]
[Where F _n = value obtained by [Equation 10]].
[Equation 11] is a case where b = 10 and A = 100 in [Equation 6].

The above results are shown in FIGS.
FIG. 18 is a graph in which the values processed in the steps (a) and (b) are plotted against the number of cycles and printed.
FIG. 19 is a graph in which the values obtained by processing the values obtained in FIG. 18 as in the process (d) are plotted against the number of cycles and printed.

Next, based on the graph of FIG. 19, processing was performed in the steps (f), (g), and (h). That is, based on the graph of FIG. 19, as in Comparative Example 1, the threshold values of log ₁₀ (fluorescence intensity change rate) were 0.1, 0.3, 0.5, 0.7, and 0.9. , 1.2 were selected, the number of cycles that reached that value was plotted on the X-axis, and the copy number of the human genomic DNA before the start of the reaction was plotted on the Y-axis, and a calibration curve was drawn. The result is shown in FIG. The correlation coefficients (R ² ) obtained by processing these calibration curves in the processes (i) and (j) are 0.998, 0.999, and .0 for each of the threshold values. 9993, 0.9985, 0.9989, 0.9988. From these correlation coefficients, it was recognized that it is desirable to adopt 0.5 (correlation coefficient 0.99993) as the threshold value. With the calibration curve having this correlation coefficient, it can be seen that the copy number before the start of the reaction can be accurately determined for the nucleic acid sample having the unknown copy number.

Example 24 (Example of melting curve analysis and Tm value analysis of nucleic acid)
51) for the nucleic acid amplified by the novel PCR method of the present invention, 51) a step of gradually increasing or decreasing the temperature from a low temperature until the nucleic acid is completely denatured (for example, from 50 ° C. to 95 ° C.); A) measuring the fluorescence intensity at short time intervals (e.g., intervals corresponding to a temperature rise of 0.2 ° C. to 0.5 ° C.); 53) displaying the measurement results of step 52) as a function of time; The process shown above, ie, the process of displaying the melting curve of nucleic acid, 54) the process of first-order differentiation of the melting curve of the above 53), 55) The differential value of the process 54) (−dF / dT, F: fluorescence (Intensity, T: time) on the display; 56) software for analyzing the data of the present invention; Coalesced to A. A novel real-time quantitative PCR reaction of the present invention was performed using the LightCycler ^™ system in which a computer-readable recording medium on which the data analysis software was recorded was installed, and a nucleic acid melting curve was analyzed. In the present invention, the fluorescence intensity increases as the temperature increases.

  The same PCR as in Example 21 was performed on 1 copy and 10 copies of the same human genomic DNA as in Example 23, and the data processed in the steps 51), 52), 53), 54) and 55) were printed. This is shown in FIG. FIG. 22 is a diagram of a nucleic acid melting curve obtained by treating the 75th amplification product of 1 copy and 10 copies in the steps 51), 52) and 53) of this example. FIG. 23 shows the result of differentiating this curve in the process of 54) and obtaining the inflection point (Tm value) in the processes of 55) and 56). From FIG. 23, it was found that the amplification products of one copy and ten copies had different Tm values, so that each amplification product was a different product.

The present invention has the following effects.
1) The method for measuring the concentration of the target nucleic acid of the present invention, various nucleic acid probes of the present invention, especially chemical modifications such as 2-O-alkyl oligonucleotides, 2-O-alkylene oligonucleotides, and 2-O-benzyl oligonucleotides The nucleic acid probe of the present invention consisting of an oligonucleotide or the like, or the nucleic acid probe of the present invention consisting of a chimeric oligonucleotide or the like in which an oligoribonucleotide and an oligodeoxyribonucleotide intervene, a target nucleic acid containing or accompanying those nucleic acid probes of the present invention When using a measurement kit for measuring the concentration of a nucleic acid and a nucleic acid chip or a nucleic acid device such as a DNA chip to which the nucleic acid probe of the present invention is bound, operations such as removing unreacted nucleic acid probes from the measurement system can be performed. Measurement of target nucleic acid concentration in a short time and easily That. Further, when applied to a complex microbial system or a symbiotic microbial system, the abundance of a specific strain in the system can be measured specifically and in a short time. The present invention also provides a simple method for analyzing or measuring polymorphisms or mutations such as SNPs of a target nucleic acid or gene.

2) The quantitative PCR method of the present invention has the following effects.
a. Since a factor that inhibits the amplification of the target nucleic acid by Taq DNA polymerase is not added, quantitative PCR can be performed under the same conditions as those of a conventionally known specific PCR.
b. In addition, since the specificity of PCR can be kept high, the amplification of the primer dimer is slowed, so that the quantification limit is reduced by about one order of magnitude as compared with conventionally known quantitative PCR.
c. Since there is no need to prepare a complicated nucleic acid probe, the time and cost required for the preparation can be saved.
d. The effect of amplifying the target nucleic acid is large, and the amplification process can be monitored in real time.

  3) In addition, when analyzing data obtained by the real-time quantitative PCR method, a calibration line for calculating the copy number of a nucleic acid for a nucleic acid sample having an unknown nucleic acid copy number is prepared using the data analysis method of the present invention. The correlation coefficient of the line is much higher than that obtained by the conventional method. Thus, using the data analysis method of the present invention, the exact copy number of a nucleic acid can be determined.

  4) Data analysis software according to the method for analyzing data obtained by the real-time quantitative PCR method of the present invention, a computer-readable recording medium recording the procedure of the analysis method as a program, and By using a real-time quantitative PCR measurement or analysis device using, a calibration line with a high correlation coefficient can be automatically created.

  5) Further, by using the novel nucleic acid melting curve analysis method of the present invention, a highly accurate Tm value of a nucleic acid can be obtained. Furthermore, using the software for data analysis according to the method, and a computer-readable recording medium recording the procedure of the analysis method as a program, and using a real-time quantitative PCR measurement or analysis device using the same, Accurate Tm value can be obtained

FIG. 7 is a diagram showing fluorescence intensity measurement data when the 335th to 358th nucleobase sequences counted from the 5 ′ end of 16S rRNA of Escherichia coli using the nucleic acid probe obtained in Example 1 are measured. Effect of heat treatment on hybridization of 35 base chain 2-O-Me probe to target nucleic acid. Dotted line: Target nucleic acid was added after heat treatment of rRNA. Solid line: unheated rRNA. The effect of the modification of the number of bases of the base chain of the probe, the helper probe and the methyl group modification of the 2'-carbon OH group of the 5'-terminal ribose of the probe on the hybridization between the probe and the target nucleic acid 16S rRNA. 4 is a calibration curve for measuring rRNA according to the method of the present invention. Analysis of the time course of the amount of rRNA in the combined culture system of the KYM7 strain and the KYM8 strain by the FISH method of the present invention. The figure explaining the DNA chip of the present invention. The figure explaining the apparatuses for SNPs detection measurement using the DNA chip of this invention. The figure which shows the experimental result of SNPs detection measurement using the DNA chip of this invention. The figure which shows the quantitative PCR method using the primers 1 and 2 which were labeled with Bodepy FL / C6: the relationship between the number of cycles and the decrease in the emission of the fluorescent dye. The symbols (1) to (8) in the figure have the following meanings. (1) E. coli genomic DNA copy number: 0; primer: primer 1 + primer 2, (2) E. coli genomic DNA copy number: 2.4 × 10 ⁶ ; primer: primer 1 + primer 2, (3) E. coli genomic DNA copy number: 2.4 × 10 ⁵ ; primer: primer 1 + primer 2, (4) E. coli genomic DNA copy number: 2.4 × 10 ⁴ ; primer: primer 1 + primer 2, (5) E. coli genomic DNA copy number: 2.4 × 10 ³ ; primer: primer 1, (6) E. coli genomic DNA copy number: 2.4 × 10 ² ; primer: primer 1, (7) E. coli genomic DNA copy number: 2.4 × 10 ¹ ; primer: primer 1, (8) E. coli genomic DNA copy number: 2.4 × 10 ⁰ ; primer: primer 1 The figure which shows the relationship between the number of cycles and the logarithmic value of the amount of decrease in luminescence of the fluorescent dye: quantitative PCR method using primers 1 and 2 labeled with Bodepy FL / C6. The symbols (1) to (8) in the figure represent the same meanings as in FIG. The figure which shows the calibration curve of Escherichia coli 16SrDNA produced using the quantitative PCR method of this invention. n: 10 ⁿ The upper figure shows the decrease in fluorescence intensity when performing real-time quantitative PCR using one probe of the present invention instead of two probes labeled with a fluorescent dye used in the real-time quantitative PCR method using the FRET phenomenon. It is a figure showing change of a rate. The lower figure is a diagram in which the number of cycles (threshold number: Ct value) at which the decrease in the fluorescence intensity starts to be significantly observed is calculated and a calibration curve is created. The figure which shows the fluorescence reduction curve obtained by the real-time quantitative PCR using the primer labeled with the bodypy FL / C6 of this invention, when the correction arithmetic processing of this invention is not performed. ■: target nucleic acid = 10 copies; temperature of reaction system for fluorescence intensity measurement = 72 ° C. ●: target nucleic acid = 100 copies; temperature of reaction system for fluorescence intensity measurement = 72 ° C. ▲: target nucleic acid = 1000 copies; fluorescence intensity Temperature of reaction system for measurement = 72 ° C., ◆: target nucleic acid = 10000 copies; temperature of reaction system for fluorescence intensity measurement = 72 ° C., □: target nucleic acid = 10 copies; temperature of reaction system for fluorescence intensity measurement = 95 ° C. ：: target nucleic acid = 100 copies; temperature of reaction system for measuring fluorescence intensity = 95 ° C. Δ: target nucleic acid = 1000 copies; temperature of reaction system for measuring fluorescence intensity = 95 ° C. Δ: target nucleic acid = 10000 copies; fluorescence intensity Measurement system temperature = 95 ° C FIG. 14 is a diagram showing a fluorescence reduction curve obtained by real-time quantitative PCR in the same manner as the curve in FIG. 13 except that the value at the 10th cycle of each curve is corrected to 1. ■: target nucleic acid = 10 copies; fluorescence intensity measurement temperature = 72 ° C. ●: target nucleic acid = 100 copies; fluorescence intensity measurement temperature = 72 ° C. ℃: target nucleic acid = 1000 copies; fluorescence intensity measurement temperature = 72 ° C. ◆: Target nucleic acid = 10000 copies; fluorescence intensity measurement temperature = 72 ° C., 5: target nucleic acid = 10000 copies; fluorescence intensity measurement temperature = 72 ° C. FIG. 15 is a view showing a curve in which the fluorescence intensity reduction rate (change rate) of [Equation 9] is calculated for each plot value of each curve in FIG. ■: target nucleic acid = 10 copies, ●: target nucleic acid = 100 copies, ▲: target nucleic acid = 1000 copies, ◆: target nucleic acid = 10000 copies FIG. 16 is a diagram showing a calibration line of human genomic DNA obtained from the data of FIG. 15. y = human β-globin gene copy number, x = cycle number (Ct), R ² = correlation coefficient FIG. 14 is a diagram showing a curve obtained by plotting a value obtained by performing a correction operation processing on the measured value of each cycle in FIG. 13 using [Equation 1] with respect to each cycle number. ■: target nucleic acid = 10 copies, ●: target nucleic acid = 100 copies, ▲: target nucleic acid = 1000 copies, ◆: target nucleic acid = 10000 copies FIG. 18 is a diagram showing a curve obtained by plotting a value obtained by performing an arithmetic processing on the arithmetic processing value of each cycle in [Equation 3] in FIG. 17 against the number of cycles. ■: target nucleic acid = 10 copies, ●: target nucleic acid = 100 copies, ▲: target nucleic acid = 1000 copies, ◆: target nucleic acid = 10000 copies The figure which shows the curve which plotted the value which carried out the arithmetic processing value of each cycle of FIG. 18 by the formula of [Formula 6] with respect to the number of cycles. ■: target nucleic acid = 10 copies, ●: target nucleic acid = 100 copies, ▲: target nucleic acid = 1000 copies, ◆: target nucleic acid = 10000 copies From the respective log (fluorescence change rate) values shown in FIG. 18, 0.1, 0.3, 0.5, 0.7, 0.9, and 1.2 are appropriately selected as candidates for the Ct value, and the corresponding values are selected. The figure when the calibration straight line was drawn. The correlation coefficients in each calibration curve are shown below. ▲: log ₁₀ (fluorescence change rate) = 0.1; correlation coefficient = 0.998, ■: log ₁₀ (fluorescence change rate) = 0.3; correlation coefficient = 0.999, ●: log ₁₀ (fluorescence Rate of change) = 0.5; correlation coefficient = 0.9993, Δ: log ₁₀ (fluorescence change rate) = 0.7; correlation coefficient = 0.9985, □: log ₁₀ (fluorescence change rate) = 0. 9; Correlation coefficient = 0.9989, ：: log ₁₀ (fluorescence change rate) = 1.2; Correlation coefficient = 0.9988 The figure which shows the fluorescence reduction curve at the time of performing real-time quantitative PCR about 1 copy and 10 copies of human genomic DNA using the primer labeled with the bodepy FL / C6 of this invention. However, the correction calculation processing of [Equation 1] was performed. 1: Target nucleic acid = 0 copy, 2: Target nucleic acid = 1 copy, 3: Target nucleic acid = 10 copies FIG. 22 is a diagram showing a nucleic acid melting curve when a nucleic acid melting curve analysis is performed on the PCR amplification product shown in FIG. 21. 1: Target nucleic acid = 0 copy, 2: Target nucleic acid = 1 copy, 3: Target nucleic acid = 10 copies The figure which shows the curve which shows the Tm value obtained by differentiating the curve of FIG. 22 (the valley is Tm value). 2: Target nucleic acid = 1 copy, 3: Target nucleic acid = 10 copies

Claims (48)

In the nucleic acid measurement method using a nucleic acid probe labeled with a fluorescent dye, when the nucleic acid probe hybridizes to a target nucleic acid, the fluorescent dye is a nucleic acid probe that reduces the emission thereof, and the nucleic acid probe is applied to the target nucleic acid. A method for measuring the concentration of a target nucleic acid, comprising performing hybridization and measuring the amount of decrease in luminescence of a fluorescent dye before and after hybridization. When a nucleic acid probe labeled with a fluorescent dye is hybridized to a target nucleic acid, the fluorescent dye is a nucleic acid probe that reduces its emission, and the probe is labeled with the fluorescent dye at its end. When the nucleic acid probe hybridizes to the target nucleic acid at the end, the base sequence of the target nucleic acid contains at least one G (guanine) at a distance of 1 to 3 bases from the terminal base of the target nucleic acid hybridized to the probe. A nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid, wherein the base sequence of the probe is designed so that a base is present. The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to claim 2, wherein the nucleic acid probe is labeled with a fluorescent dye at the 3 'end. The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to claim 2, wherein the nucleic acid probe is labeled with a fluorescent dye at the 5 'end. When a nucleic acid probe labeled with a fluorescent dye hybridizes to a target nucleic acid, the fluorescent dye is a nucleic acid probe that reduces its emission, and the probe is labeled with the fluorescent dye at its end. When the nucleic acid probe hybridizes to the target nucleic acid, a plurality of base pairs of the probe-nucleic acid hybrid form at least one G (guanine) and C (cytosine) pair at the terminal portion. A nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid, wherein the base sequence of the probe is designed. The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to claim 5, wherein the 3 'terminal base of the nucleic acid probe is G or C, and the 3' terminal is labeled with a fluorescent dye. The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to claim 5, wherein the 5 'terminal base of the nucleic acid probe is G or C, and the 5' terminal is labeled with a fluorescent dye. The target nucleic acid according to claim 4 or 7, wherein the nucleic acid probe has a phosphorylated 3′-carbon hydroxyl group of 3′-terminal ribose or deoxyribose or a 3′- or 2′-carbon hydroxyl group of 3′-terminal ribose. A nucleic acid probe labeled with a fluorescent dye for concentration measurement. The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to any one of claims 2 to 8, wherein the oligonucleotide of the nucleic acid probe for nucleic acid measurement is a chemically modified nucleic acid. When the chemically modified nucleic acid is 2'- O -methyl oligonucleotide, 2'- O -ethyl oligonucleotide, 2'- O -butyl oligonucleotide, 2'- O -ethylene oligonucleotide, or 2'- O -benzyl The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to claim 9, which is an oligonucleotide. The fluorescence for measuring the concentration of a target nucleic acid according to any one of claims 2 to 8, wherein the oligonucleotide of the nucleic acid probe for measuring a nucleic acid is a chimeric oligonucleotide containing ribonucleotides and deoxyribonucleotides. A nucleic acid probe labeled with a dye. Chimeric oligonucleotides are those that intervene 2'- O -methyl oligoribonucleotides, 2'- O -ethyl oligonucleotides, 2'- O -butyl oligonucleotides or 2'- O -benzyl oligonucleotides A nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to claim 11. A concentration of the target nucleic acid, wherein the nucleic acid probe for nucleic acid measurement according to any one of claims 2 to 8 is hybridized to a target nucleic acid, and a decrease in luminescence of a fluorescent dye before and after hybridization is measured. Measuring method. 13. The concentration of a target nucleic acid, wherein the nucleic acid probe for nucleic acid measurement according to any one of claims 9 to 12 is hybridized to a target nucleic acid, and a decrease in luminescence of a fluorescent dye before and after hybridization is measured. Measuring method. The method for measuring the concentration of a target nucleic acid according to claim 14, wherein the nucleic acid probe is hybridized with the target nucleic acid after the target nucleic acid is subjected to a heat treatment under conditions suitable for sufficiently destroying its higher-order structure. The method for measuring the concentration of a target nucleic acid according to claim 15, wherein the heat treatment conditions are 80 to 100C for 1 to 15 minutes. The method for measuring the concentration of a target nucleic acid according to any one of claims 13 to 16, wherein the target nucleic acid is RNA. A kit for measuring the concentration of a target nucleic acid, comprising or accompanying the nucleic acid probe according to any one of claims 2 to 12. 19. The kit for measuring the concentration of a target nucleic acid according to claim 18, which contains or is accompanied by a helper probe. 13. A method for analyzing or measuring polymorphism and / or mutation of a target nucleic acid, wherein the nucleic acid probe according to any one of claims 2 to 12 is hybridized to the target nucleic acid to change the fluorescence intensity. A method for analyzing or measuring a polymorphism and / or mutation of a target nucleic acid, which comprises measuring the amount. 13. A measurement kit for analyzing or measuring a polymorphism or / and mutation of a target nucleic acid, comprising the nucleic acid probe according to any one of claims 2 to 12, wherein the polymorphism or / and / or mutation of the target nucleic acid is characterized. A measurement kit for analyzing or measuring a protein. 22. The measurement kit for analyzing or measuring a polymorphism and / or mutation of a target nucleic acid according to claim 21, which contains or accompanies a helper probe. The method for analyzing data obtained by the method according to claim 20, wherein the fluorescence intensity value of the reaction system when the target nucleic acid is hybridized with a nucleic acid probe labeled with a fluorescent dye, when the hybridization is not performed. 3. A data analysis method for a method for analyzing or measuring a polymorphism and / or mutation of a target nucleic acid, the method comprising a step of performing a correction process based on the fluorescence intensity value of the reaction system. A measurement device for analyzing or measuring a polymorphism or / and mutation of a target nucleic acid, comprising a means for performing the data analysis method according to claim 23, wherein the polymorphism or / and / or mutation of the target nucleic acid is analyzed. A measuring device for analyzing or measuring. A computer-readable recording medium in which a procedure for causing a computer to execute the correction process according to claim 23 is recorded as a program. The nucleic acid probe according to any one of claims 2 to 12, or an interaction between two fluorescent dyes when the probe has two different fluorescent dyes in one molecule and is not hybridized to a target nucleic acid. Is quenched or luminescent by hybridization to the target nucleic acid, and a plurality of other nucleic acid probes having a structure designed to emit or quench when hybridized to the target nucleic acid are bound to the surface of the solid support, and the target nucleic acid is hybridized thereto. A device for measuring the concentration of one or more nucleic acids, characterized in that the concentration of a target nucleic acid can be measured. 27. The device (chip) for measuring the concentration of one or more nucleic acids in which the nucleic acid probes are arrayed and bound to the surface of the solid support in an array, according to the device for nucleic acid measurement according to claim 26. 27. For each nucleic acid probe bound to the solid support surface, at least one temperature sensor and heater are provided on the opposite surface, and the temperature can be adjusted so that the nucleic acid probe binding region is at the optimal temperature condition. 28. A device for measuring the concentration of one or more nucleic acids according to 27, respectively. The device for measuring the concentration of one or more nucleic acids according to any one of claims 26 to 28, wherein the nucleic acid probe is bound to the surface of the solid support at an end not labeled with a fluorescent dye. . A method for measuring the concentration of a target nucleic acid, comprising measuring a target nucleic acid using the device for nucleic acid measurement according to any one of claims 26 to 28. 31. The method for measuring a nucleic acid according to any one of claims 1, 13 to 17, or claim 30, wherein the target nucleic acid is derived from a microorganism obtained by pure separation or from an animal. A method for measuring the concentration of a nucleic acid. The concentration measurement of a target nucleic acid according to any one of claims 1, 13 to 17, or 30, wherein the target nucleic acid is a nucleic acid contained in a cell of a complex microbial system or a symbiotic microbial system or in a homogenate of the cell. Method. In the PCR method, a reaction is carried out using the nucleic acid probe according to any one of claims 2, 3, 5, 6, or 8 to 12, and the probe is decomposed and removed by a polymerase during a nucleic acid extension reaction. The fluorescence intensity value of the reaction system during the nucleic acid denaturation reaction or the reaction system during the nucleic acid denaturation reaction or when the target nucleic acid or amplified target nucleic acid is hybridized with the nucleic acid probe is measured. And a method of measuring the concentration of the target nucleic acid amplified by PCR, wherein the rate of decrease in the fluorescence intensity value from the former is calculated. In the PCR method, a reaction is performed using the nucleic acid probe according to claim 4 or 7 as a primer, and the fluorescence intensity value of a reaction system in which the probe and the target nucleic acid or the amplified target nucleic acid are not hybridized and the nucleic acid probe is a target nucleic acid or A method for measuring the concentration of a target nucleic acid amplified by PCR, comprising: measuring a fluorescence intensity value of a reaction system when hybridized with an amplified target nucleic acid; and calculating a reduction rate of the former fluorescence intensity value. 35. The method according to claim 33, wherein the PCR method is a real-time quantitative PCR method. The method for analyzing data obtained by the nucleic acid measurement method according to any one of claims 1, 13 to 17, or any one of claims 30 to 35, wherein the target nucleic acid is labeled with a fluorescent dye. A target, wherein the fluorescence intensity value of the reaction system after hybridization with the nucleic acid probe is corrected by the fluorescence intensity value of the reaction system obtained after the probe-nucleic acid hybrid complex thus formed is dissociated. Data analysis method for measuring nucleic acid concentration. The method for analyzing data obtained by the real-time quantitative PCR method according to claim 35, wherein the amplified nucleic acid in each cycle is combined with a fluorescent dye, or the amplified nucleic acid is labeled with a fluorescent dye. The fluorescence intensity value of the reaction system after hybridization is determined by comparing the fluorescence dye-nucleic acid complex formed in each cycle or the reaction system obtained after dissociating the probe-nucleic acid hybrid complex thus formed. A data analysis method for a real-time quantitative PCR method, comprising an arithmetic processing step of correcting with a fluorescence intensity value (hereinafter, referred to as a correction arithmetic processing step). 38. The data analysis method for a real-time quantitative PCR method according to claim 37, wherein the correction operation process according to claim 37 is based on the following [Equation 1] or [Equation 2].
f _n = f _{hyb, n} / f _{den, n} [Equation 1]
f _n = f _{den, n} / f _{hyb, n} [Equation 2]
(In the formula,
f _n : a correction operation processing value in n cycles calculated by [Equation 1] or [Equation 2],
f _{hyb, n} : the fluorescence intensity value of the reaction system after the amplified nucleic acid binds to the fluorescent dye or after the amplified nucleic acid hybridizes with the nucleic acid probe labeled with the fluorescent dye in the nth cycle,
f _{den, n} : the fluorescence intensity value of the reaction system after dissociation of the formed fluorescent dye-nucleic acid complex or formed probe-nucleic acid hybrid complex in the nth cycle] The method according to claim 38, wherein the data obtained by the real-time quantitative PCR method according to claim 35 is analyzed, wherein the correction calculation processing value calculated by [Equation 1] or [Equation 2] in each cycle is as follows. Substituting into [Equation 3] or [Equation 4], calculating the fluorescence change ratio or the fluorescence change ratio between each sample in each cycle, and comparing the calculated values. analysis method.
F _n = f _n / f _a [Equation 3]
F _n = f _a / f _n [Equation 4]
(In the formula,
F _n : the rate of change of fluorescence or the rate of change of fluorescence calculated by [Equation 3] or [Equation 4] in the _n- th cycle;
f _n : Correction calculation processing value by [Equation 1] or [Equation 2] f _a : Correction calculation processing value by [Equation 1] or [Equation 2] and an arbitrary number of cycles before a change in f _n is observed Thing) The method according to claim 39, wherein the data obtained by the real-time quantitative PCR method according to claim 35 is analyzed.
1) a process of performing an arithmetic processing by [Equation 5], [Equation 6] or [Equation 7] using the fluorescence change ratio or the data of the fluorescence change rate calculated by [Equation 3] or [Equation 4];
log _b (F _n ), ln (F _n ) [Equation 5]
log _b {(1-F _n ) × A}, ln {(1-F _n ) × A} [Equation 6]
log _b {(F _n -1) × A}, ln {(F _n -1) × A} [Equation 7]
(In the formula,
A, b: arbitrary numerical values,
F _n : the rate of change in fluorescence or the rate of change in fluorescence in the nth cycle calculated by [Equation 3] or [Equation 4],
2) an arithmetic processing step for obtaining the number of cycles at which the arithmetic processing value of 1) has reached a certain value; 3) an arithmetic operation for calculating the relational expression between the number of cycles in a nucleic acid sample of known concentration and the copy number of the target nucleic acid at the start of the reaction. Processing,
4) a process of calculating the copy number of the target nucleic acid at the start of PCR in the unknown sample;
A data analysis method for a real-time quantitative PCR method, comprising: A target nucleic acid, wherein PCR is performed on the target nucleic acid using the nucleic acid probe according to any one of claims 2 to 12, and a melting curve of the target nucleic acid is analyzed to determine the Tm value of each amplified nucleic acid. Analysis method of melting curve. A melting curve of the target nucleic acid, wherein PCR is performed on the target nucleic acid using the nucleic acid probe according to claim 4 or 7 as a primer, and the melting curve of the target nucleic acid is analyzed to determine the Tm value of each amplified nucleic acid. Analysis method. 41. The data analysis method for a real-time quantitative PCR method according to any one of claims 37 to 40, wherein the nucleic acid amplified by the PCR method is gradually heated from a low temperature until the nucleic acid is completely denatured. Raising, in this process, measuring the fluorescence intensity at predetermined time intervals, displaying the measurement results on the display as a function of time and drawing the nucleic acid melting curve on the display, differentiating this melting curve A step of obtaining a differentiated value (−dF / dT, F: fluorescence intensity, T: time), a step of displaying the differentiated value as a differential value on a display, and a step of finding an inflection point from the differential value. A data analysis method for a real-time quantitative PCR method, comprising: 39. A process of analyzing data by the data analysis method according to claim 37, a process of analyzing data by the data analysis method of claim 38, a process of analyzing data by the data analysis method of claim 39, 44. A real-time quantitative PCR measurement, comprising means for performing data analysis using the data analysis method according to claim 40 and performing data analysis using the data analysis method according to claim 43. And / or an analyzer. 39. A process of analyzing data by the data analysis method according to claim 37, a process of analyzing data by the data analysis method of claim 38, a process of analyzing data by the data analysis method of claim 39, 44. A computer-readable recording medium which records, as a program, a procedure for causing a computer to execute a step of analyzing data by the data analysis method according to claim 40 and a step of analyzing data by the data analysis method according to claim 43. A method for quantifying a nucleic acid, comprising using the data analysis method for a real-time quantitative PCR method according to any one of claims 37 to 40 and 43. A method for quantifying a nucleic acid, comprising using the apparatus according to claim 44. A method for nucleic acid quantification, comprising using the computer-readable recording medium according to claim 45.

Images