JP2004008030A - Primer for diagnosing lipid metabolism abnormality and new medium chain fatty acid acyl-coa synthetase and gene therefor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a nucleic acid molecule which can be used for the genetic diagnose of lipid metabolism abnormality. <P>SOLUTION: This nucleic acid molecule is a nucleic acid molecule capable of detecting the mutation of a leucine residue at the 513-position of a medium chain fatty acid acyl-CoA synthetase (MACS2), and contains a nucleotide fragment capable of hybridizing to a polynucleotide encoding a protein containing a specific amino acid sequence or a polynucleotide complementary to the above polynucleotide. <P>COPYRIGHT: (C)2004,JPO

Description

Ｇｌｎ

【図面の簡単な説明】
【図１】ＭＡＣＳ２のアミノ酸配列と、ＳＡＨのアミノ酸配列（配列番号５）、ＫＳ２のアミノ酸配列（配列番号６）、およびＭＡＣＳ１のアミノ酸配列（配列番号７）とを整列させて示した図である。Ｍｏｔｉｆ　１はＡＴＰ結合領域を示す。Ｍｏｔｉｆ　２は中鎖脂肪酸アシル−ＣｏＡ合成酵素に特異的な領域を示す。
【図２】ＭＡＣＳ２遺伝子のｅｘｏｎの存在位置を示した図である。
【図３】ＭＡＣＳ２遺伝子のｅｘｏｎの存在位置を示した図である。
【図４】ＭＡＣＳ２遺伝子のｅｘｏｎの存在位置を示した図である。[0001]
BACKGROUND OF THE INVENTION
Field of the invention
The present invention relates to a diagnostic primer for abnormal lipid metabolism, a novel medium-chain fatty acyl-CoA synthetase, and a gene thereof.
[0002]
Background art
Diseases such as diabetes, obesity, heart disease, and hypertension are known to be associated with abnormal lipid metabolism. In recent years, enzymes and their genes involved in the metabolism of medium-chain fatty acids have been studied, and some of the enzymes and their genes have been sequenced. For example, medium chain fatty acyl-CoA synthetase 1 (MACS1) is known to be an enzyme that controls lipid metabolism, and the amino acid sequence and gene of this enzyme have been sequenced, respectively (Fujino T. et al. , {J. Biol. Chem., 276 (38), pp35961-35966 (2001)). In addition, it has been reported that the polymorphism of the SA gene belonging to the acyl-CoA synthetase for medium-chain fatty acids is associated with abnormal lipid metabolism (Iwai N. et al., Circulation, 105, pp41-47 (2002)). .
[0003]
Summary of the Invention
The present inventors specified a medium-chain fatty acid acyl-CoA synthetase, which has not been reported, and determined the amino acid sequence and the gene thereof. The present inventors further identified a mutation at the 513th leucine residue as a polymorphism of this synthase, and found that this mutation was associated with abnormal lipid metabolism. The present invention is based on these findings.
[0004]
An object of the present invention is to provide a nucleic acid molecule that can be used for genetic diagnosis of abnormal lipid metabolism.
[0005]
According to the present invention, there is provided a nucleic acid molecule capable of detecting a mutation at the 513th leucine residue of a medium-chain fatty acyl-CoA synthetase (MACS2), comprising a protein comprising the amino acid sequence of SEQ ID NO: 2. There is provided a nucleic acid molecule comprising a nucleotide fragment capable of hybridizing to the encoding polynucleotide or a polynucleotide complementary thereto (hereinafter, referred to as “nucleic acid molecule according to the present invention”).
[0006]
Another object of the present invention is to provide a novel medium-chain fatty acyl-CoA synthetase and a gene thereof.
[0007]
According to the present invention there is provided a medium-chain fatty acyl-CoA synthase (MACS2) comprising the following amino acid sequence:
(A) the amino acid sequence of SEQ ID NO: 4, or
(B) a modified amino acid sequence of the amino acid sequence of SEQ ID NO: 4 having at least one modification selected from substitution, deletion, addition, and insertion and having a medium-chain fatty acyl-CoA synthase activity;
[0008]
According to the present invention, there is provided a medium-chain fatty acyl-CoA synthetase gene comprising a polynucleotide encoding the above protein.
[0009]
DETAILED DESCRIPTION OF THE INVENTION
The nucleic acid molecule according to the present invention can detect a mutation at the 513th leucine residue of MACS2. As used herein, “mutation” is used in the sense including substitution and deletion.
[0010]
The substitution of leucine at position 513 of MACS2 includes substitution of leucine with serine (L513S).
[0011]
The amino acid sequence of MACS2 having L513S is set forth in SEQ ID NO: 2, and an example of the nucleotide sequence encoding it is set forth in SEQ ID NO: 1. Accordingly, the nucleic acid molecule according to the present invention can be a nucleotide fragment capable of hybridizing to the DNA sequence set forth in SEQ ID NO: 1 or a DNA sequence complementary thereto.
[0012]
In the present invention, "hybridize" means that the nucleic acid molecule according to the present invention hybridizes to a target nucleotide molecule under stringent conditions and does not hybridize to a nucleotide molecule other than the target nucleotide molecule. Stringent conditions can be determined depending on the melting temperature Tm (° C.) of the duplex of the nucleic acid molecule of the present invention and its complementary strand, the salt concentration of the hybridization solution, and the like. Sambrook, E. F. Frisch, T. {Maniatis; Molecular Cloning} 2nd edition, Cold Spring Harbor Laboratory (1989) and the like can be referred to. For example, when hybridization is performed at a temperature slightly lower than the melting temperature of the nucleic acid molecule used, the nucleic acid molecule specifically hybridizes to the target nucleotide molecule but does not hybridize to nucleotide molecules other than the target nucleotide molecule.
[0013]
In the present invention, the term “nucleic acid molecule” is used to include DNA, RNA, and PNA (peptide @ nucleoic @ acid).
[0014]
The length of the nucleic acid molecule according to the present invention is not particularly limited as long as a mutation existing in the medium-chain fatty acid acyl-CoA synthetase can be detected, but can be, for example, in the range of 10 to 100 nucleotides, and is preferably Is at least 12 nucleotides, more preferably at least 15 nucleotides, even more preferably 12 to 30 nucleotides. Therefore, the nucleic acid molecule according to the present invention comprises at least 12 consecutive nucleotides, preferably at least 15 nucleotides, more preferably a polynucleotide encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 2 or a polynucleotide complementary thereto. It can be a nucleotide fragment consisting of 12 to 30 nucleotides. The nucleic acid molecule according to the invention is preferably a DNA fragment consisting of at least 12 contiguous nucleotides, preferably at least 15 nucleotides, more preferably 12 to 30 nucleotides of the DNA sequence of SEQ ID NO: 1 or a DNA sequence complementary thereto. be able to.
[0015]
Mutation of the leucine residue at position 513 of MACS2 is associated with abnormal lipid metabolism (see Example 2). Therefore, the nucleic acid molecule according to the present invention can be used for diagnosis of diseases caused by abnormal lipid metabolism (abnormal fatty acid metabolism). Diseases caused by abnormal lipid metabolism (abnormal fatty acid metabolism) include diabetes; heart diseases such as ischemic heart disease; obesity; and hypertension.
[0016]
Further, according to the present invention, there is provided a method for detecting a disease caused by abnormal lipid metabolism by detecting a mutation in the MACS2 gene, wherein the 513rd position of MACS2 is detected using the nucleic acid molecule according to the present invention or a primer pair described later. The step of detecting the presence or absence of a mutation in the leucine residue of the present invention.
[0017]
Specifically, the nucleic acid molecule according to the present invention can be used as a primer for detecting a mutation by a nucleic acid amplification method such as a PCR method, and more specifically, a nucleotide portion corresponding to the 513th leucine residue of MACS2. Can be used as a primer for amplifying by a nucleic acid amplification method. Therefore, according to the present invention, a step of amplifying a nucleic acid sample by a nucleic acid amplification method using the nucleic acid molecule according to the present invention and detecting the presence or absence of an amplification product containing a nucleotide portion corresponding to the 513th leucine residue of MACS2 is performed. Methods for detecting and diagnosing diseases caused by abnormal lipid metabolism are provided. The presence of the mutated amplification product indicates the presence of a mutation in the MACS2 gene.
[0018]
For diagnosis, for example, a sample such as blood is isolated from a subject, a nucleic acid sample such as genomic DNA or mRNA is extracted from the isolated sample, and cDNA is prepared from the mRNA using reverse transcriptase if necessary. Using the nucleic acid sample obtained as a template, a nucleic acid molecule according to the present invention designed to amplify the region containing the 513th leucine residue is used to carry out a nucleic acid amplification method, and the nucleotide sequence of the obtained amplification product is analyzed. By doing so, the presence or absence of a mutation at the 513th leucine residue can be detected. In the amplification of nucleic acids, when genomic DNA or cDNA is used as a template, an ordinary PCR method or the like can be used. When mRNA is used as a template, an RT-PCR method, NASBA method, or the like can be used. The nucleic acid amplification method and the mutation detection method by the nucleic acid amplification method are well-known, and any known methods can be used.
[0019]
The nucleic acid amplification method is usually performed using a pair of primers. Therefore, according to the present invention, there is provided a primer pair capable of detecting a mutation at the 513th leucine residue of MACS2, wherein the primer pair comprises two types of nucleic acid molecules according to the present invention. Nucleic acid amplification methods using primer pairs are well known, and selection of primer pairs in nucleic acid amplification methods will be obvious to those skilled in the art. For example, in the PCR method, one of two primers is paired with one strand of the double-stranded DNA of the MACS2 gene, the other primer is paired with the other strand of the double-stranded DNA, and The primer can be selected such that the other primer is paired with the extended strand extended by the primer.
[0020]
As the primer pair, for example, one primer is composed of a nucleotide fragment that can hybridize to a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 2, and the other primer is a nucleotide fragment of SEQ ID NO: 2. A primer pair consisting of a nucleotide fragment capable of hybridizing to a polynucleotide complementary to a polynucleotide encoding a protein comprising the amino acid sequence of
[0021]
As a preferred primer pair, one primer is composed of a nucleotide fragment capable of hybridizing to the DNA sequence of SEQ ID NO: 1, and the other primer is hybridized to a DNA sequence complementary to the DNA sequence of SEQ ID NO: 1. A primer pair consisting of a nucleotide fragment that can be soyed is exemplified.
[0022]
As a more preferred primer pair, one of the primers is composed of a continuous DNA fragment of at least 12 nucleotides of the DNA sequence of SEQ ID NO: 1, and the other primer is a DNA sequence complementary to the DNA sequence of SEQ ID NO: 1. A primer pair consisting of a continuous DNA fragment of at least 12 nucleotides is exemplified.
[0023]
In selecting a primer, a primer can be selected so that a region containing a nucleotide portion corresponding to the 513th leucine residue of MACS2 can be amplified by a nucleic acid amplification method such as a PCR method. Specifically, the primer includes a nucleotide portion corresponding to the 513th leucine residue by being selected so as to pair with the 5 ′ upstream region of the nucleotide portion corresponding to the 513th leucine residue. The region can be amplified.
[0024]
Analysis of the nucleotide sequence of the amplification product obtained by the nucleic acid amplification method is performed, for example, by treating the amplification product with various restriction enzymes, subjecting the obtained restriction enzyme fragment to electrophoresis, and examining the electrophoresis pattern. Can be. That is, when a mutation is contained in the amplification product, a change occurs in the cleavage of the mutated portion by the restriction enzyme, and the mutation can be recognized as a change in the fragment pattern of the restriction enzyme fragment.
[0025]
In the diagnostic method according to the present invention, primers can be designed so that allele-specific PCR can be performed. Specifically, one of the primers can be designed to be able to pair with the mutated portion, and the other can be designed to be able to pair with a conserved region containing no mutation. When a nucleic acid amplification method is performed using a primer pair designed in this manner, an amplification product is obtained when a mutation is present in the nucleic acid sample, and an amplification product is not obtained when the mutation is not present. Therefore, the presence or absence of a mutation can be determined by detecting the presence or absence of an amplification product.
[0026]
The nucleic acid molecule according to the present invention can be used as a probe for detecting mutation by a hybridization method or the like. Therefore, according to the present invention, a method for detecting and diagnosing a disease caused by abnormal lipid metabolism, comprising a step of hybridizing a nucleic acid molecule according to the present invention and a nucleic acid sample and then detecting the presence of a hybridization complex. Is provided. The presence of the hybridization complex indicates the presence of a mutation in the MACS2 gene.
[0027]
For diagnosis, for example, a sample such as blood is isolated from a subject, a nucleic acid sample such as genomic DNA or mRNA is extracted from the isolated sample, and if necessary, cDNA is prepared from mRNA using reverse transcriptase, By detecting the presence or absence of hybridization with the nucleic acid molecule according to the present invention under mild conditions, the presence or absence of a mutation at the 513th leucine residue can be detected. The nucleic acid sample can be subjected to restriction enzyme treatment or the like, if necessary, to have a length suitable for hybridization. Hybridization methods and methods for detecting mutations by hybridization methods are well known, and any known methods can be used. For example, it can be carried out using techniques such as Southern hybridization, colony hybridization, and the like. Sambrook, E. F. Frisch, T. Maniatis: Molecular Cloning 2nd edition, Cold Spring Harbor Laboratory (1989) can be referred to.
[0028]
In the detection method and the diagnostic method according to the present invention, when a mutation was present at the 513th leucine residue in the MACS2 gene, it was more specifically evaluated that the 513th leucine residue was replaced with serine. The sample can be diagnosed as having, or possibly developing, a disease caused by abnormal lipid metabolism. Further, according to the present invention, diagnosis can be made before birth and immediately after birth.
[0029]
In the detection method and the diagnostic method according to the present invention, a homozygote of an allele (allele 1) in which the number 513 is a leucine residue and a homozygote of an allele (allele 2) in which the number 513 is a serine residue are used. , Allele 1 and heterozygotes of allele 2 are preferably detected separately. Subjects with homozygotes of allele 2 have a higher probability of having a disease caused by abnormal lipid metabolism than subjects with homozygotes of allele 1 and subjects with heterozygotes of allele 1 and allele 2. Can be diagnosed as having or possibly developing it. In addition, a subject having a heterozygote of allele 1 and allele 2 is more likely to have a disease caused by abnormal lipid metabolism than a subject having a homozygote of allele 1 or has a higher possibility of developing the disease. It can be diagnosed that there is. Such genotype detection methods are already known, and can be detected, for example, by the Taq @ Man PCR method.
[0030]
According to the present invention, there is provided (a) the amino acid sequence of SEQ ID NO: 4, or (b) one or more modifications selected from substitution, deletion, addition, and insertion, and a medium-chain fatty acid acyl-CoA synthetase. There is provided a protein comprising a modified amino acid sequence of the amino acid sequence of SEQ ID NO: 4 having activity. The number of modifications can be one to several. Whether or not the modified amino acid sequence has “medium chain fatty acyl-CoA synthetase activity” can be evaluated by allowing a protein comprising the amino acid sequence to act on a substrate and detecting a reaction product. In the evaluation, for example, Fujino @ T. {Et} al. , @J. Biol. Chem. , 276 (38), pp35961-35966 (2001).
[0031]
According to the present invention, there is provided a polynucleotide encoding the above protein, a preferable example of which is the DNA sequence of SEQ ID NO: 3.
[0032]
The novel medium-chain fatty acyl-CoA synthetase and the gene encoding the same according to the present invention can be produced according to a method commonly used in the field of genetic engineering, and the equipment and materials required for the production are commercially available. Can be used. For example, a cDNA encoding a medium-chain fatty acyl-CoA synthetase is isolated from a cDNA library using an appropriate probe oligonucleotide, and if necessary, a recombinant vector linked so that the cDNA can be expressed is prepared. Then, a suitable host (for example, COS-7 cells) is transformed with cDNA or a recombinant vector, and the expression product is collected, whereby the medium-chain fatty acid acyl-CoA synthetase according to the present invention can be obtained. Fujino @ T. {Et} al. , @J. Biol. Chem. , 276 (38), pp35961-35966 (2001).
[0033]
【Example】
Example 1: Sequencing of MACS2 gene and identification of gene polymorphism
(1) Sequencing of MACS2 gene
The partial structure of MACS2 is registered in Genbank accession # HUAC003034. By comparing this partial structure with SAH which is a kind of medium-chain fatty acid acyl-CoA synthase gene, it was found that an unidentified structure of the MACS2 gene exists in Genbank accession # AC027346.
[0034]
Furthermore, the 5 'end of MACS2 mRNA was determined using human liver mRNA-derived Cap \ site \ cDNA (Nippon \ Gene). Maruyama @ K. & Sugano S. , Gene, 1994: 138: 171-174, using an antisense primer in the third exon.
[0035]
The MACS2 cDNA sequence was determined based on the obtained base sequence of the 5 'upstream portion. The cDNA sequence and amino acid sequence of MACS2 are as shown in SEQ ID NOs: 3 and 4.
[0036]
A homology search with a known gene was performed using homology search software (DNASIS). As a result, the amino acid sequence of SEQ ID NO: 4 was found to have 54.6%, 57.2%, and 55.5% identity to SAH, MACS1, and KS2, respectively, over the entire amino acid sequence. MACS1 and SAH have been confirmed to have acyl-CoA synthase activity on medium-chain fatty acids (Fujino T. et al., J. Biol. Chem., 276 (38), pp 35961-35966 (2001)). . MACS2 also had two motifs (see FIG. 1) specific to medium-chain fatty acyl-CoA synthase. In particular, the region of amino acid residues 457 to 502 which is considered to determine the substrate specificity shows 70% or more identity to MACS1. Therefore, it was concluded that MACS2 was a medium-chain fatty acyl-CoA synthase.
[0037]
(2) Identification of polymorphism of MACS2 gene
After determining the cDNA sequence of MACS2, based on the sequence of Genbank accession # NT_010441 and the like, primers sandwiching each exon of exon3 to exon13 were designed, and the sequence of each exon was targeted to about 100 volunteers from exon3 to exon13. A decision was made. Specifically, sense primers and antisense primers that sandwich each exon were designed so that the PCR product had a length of 300 to 500 base pairs. Unreacted nucleotides and the like were removed from the obtained PCR product by carrying out a PCR method and purified, and then sequenced by a dye terminator method (Big Dye, manufactured by ABI). As a result, among the found mutations, those with amino acid changes were D463N and L513S. Specifically, D463N was generated by replacing the 1483rd G of SEQ ID NO: 3 with A, and L513S was generated by replacing the 1538th T of SEQ ID NO: 3 with C.
[0038]
Example 2: Evaluation of association between mutation L513S and abnormal lipid metabolism
(1) Determination of genotype
L513S genotype was determined for 2012 volunteers living in Suita City, Osaka Prefecture. More specifically, the Taq Man method (Livak KJ, Genet. Anal., 14, 143 (1999); Morris T. et al., J. Clin. Microbiol., 34, 2933 (1996), etc.) Genotype was determined. The PCR reaction was performed by reacting at 95 ° C. for 10 minutes and then repeating a step of 95 ° C. for 15 seconds and 60 ° C. for 60 seconds 40 times. Probes and primers used were as follows.
[0039]
Probe for T-type allele: 5'-FAM-TCCTGGCCTTGCAGTTCCTGTCC-tamra-3 '(SEQ ID NO: 8) (FAM represents a fluorescent label, tamra represents a quencher)
Probe for C-type allele: 5'-VIC-TCCTGGCCTCGCAGTTCCTGTG-tamra-3 '(SEQ ID NO: 9) (VIC represents a fluorescent label, tamra represents a quencher)
Sense primer: TGACTACACACTCTAATCCCTTCCTCTCT (SEQ ID NO: 10)
Antisense primer: ACATGCTGCTGCAGCTCCTT (SEQ ID NO: 11)
As a result, 1141 volunteers whose 513th amino acid residue were LL-type (a group in which strong fluorescence of FAM was recognized) and 743 volunteers of LS-type (a group in which fluorescence of both FAM and VIC were recognized) And 128 SS-type volunteers (a group in which strong fluorescence of VIC was recognized).
[0040]
(2) Relationship with HDL cholesterol level
The average value of HDL cholesterol in each genotype group was as shown in Table 1.
[0041]
[Table 1]Genotype HDL cholesterol average (mg / dl) Std error ^*
LL 59.0841 0.4654
SL $ 58.482 @ 0.5768
SS 54.2578 1.3896 　
*: Std error used pooled error variance approximation.
[0042]
As shown in Table 1, the LL type was 59.0841, the LS type was 58.4822, and the SS type was 54.2578. With a significant difference of p = 0.0044, it was concluded that the HDL cholesterol level was low in the SS type. .
[0043]
Table 2 shows the results of multivariate analysis considering the effects of sex, alcohol intake, and smoking. The genotype was LL = 1, LS = 2, SS = 3.
[0044]
[Table 2]Source 　　　　　 Nparm 　 DF 　　　 Squares Sum of F Ratio 　　 Prob> F
L513S 2 2349.441 5.4538 0.0043
ALC / combined / day {1} 9568.768 {44.241} <. 0001
Sex {1} {1} 502223.037 {233.1663} <. 0001
Current smoking 1 　　　 1 　　　　 3290.098 　　　 15.2747 　 <. 0001
As a result, the effect of genotype was p = 0.0043, and it can be concluded that genotype significantly affects HDL cholesterol levels. When it was divided into SS type and LL + LS type, p was 0.0026 in SS type.
[0045]
(3) Relation to neutral fat level
The average value of triglycerides in each genotype group was as shown in Table 3.
[0046]
[Table 3]Genotype Triglyceride mean (mg / dl) Std error ^*
LL 124.638 3.0109
SL 125.04 3.73111
SS 153.484 8.9894 　
*: Std error used pooled error variance approximation.
[0047]
As shown in Table 3, the LL type was 124.638, the LS type was 125.047, and the SS type was 153.484. With a significant difference of p = 0.0086, it was concluded that the SS type had a high triglyceride value. Was.
[0048]
Table 4 shows the results of multivariate analysis considering the effects of sex, alcohol intake, and smoking. The genotype was LL = 1, LS = 2, SS = 3.
[0049]
[Table 4]Source 　　　　　 Nparm 　 DF 　　　 Squares Sum of F Ratio 　 Prob> F
L513S 2 2 90122.24 4.5485 0.0107
ALC / combination / day {1} 1 {100202.69} 10.145} 0.0015
The property {1} {1} 1936.20.92 {19.5442} <. 0001
Current smoking 1 　　　 1 　　　 115162.56 　　　 11.6246 　 0.0007
As a result, the effect of the genotype was p = 0.0107, and it can be concluded that the genotype significantly affects the triglyceride level. When it was divided into SS type and LL + LS type, p = 0.0027 in SS type.
[0050]
(4) Relationship with Body \ mass \ index
The average value of Body @ mass @ index in each genotype group was as shown in Table 5.
[0051]
[Table 5]Genotype Body mass index Average value (kg / m ² ) Std error ^*
LL 22.6188 0.08911
SL 22.8384 0.11043
SS 23.3489 0.26606 　
*: Std error used pooled error variance approximation.
[0052]
As shown in Table 5, LL type 22.6188, LS type 22.8384, and SS type 23.3489, with a significant difference of p = 0.0197, it was concluded that Body type mass index was high in SS type. .
[0053]
Table 6 shows the results of multivariate analysis considering the effects of sex, alcohol intake, and smoking. The genotype was LL = 1, LS = 2, SS = 3.
[0054]
[Table 6]Source 　　　　　 Nparm 　 DF 　　　 Squares Sum of F Ratio 　 Prob> F
L513S 2 2 63.23932 3.5522 0.0288
ALC / combination / day {1} 1 43.52167@4.8893 0.0271
Sex {1} 1 {151.06662 {16.9710} <. 0001
Current smoking 1 　　　 1 　　　　 55.53426 　　　　 6.2510 　 0.0125
As a result, the effect of the genotype was p = 0.0288, and it can be concluded that the genotype significantly affects the Body mass index. When it was divided into SS type and LS + LL type, p = 0.0341 for SS type.
[0055]
(5) Relationship with the Wait / Hip ratio
The average value of the Waist / Hip ratio in each genotype group was as shown in Table 7.
[0056]
[Table 7]Genotype Wait / Hip Ratio Std error ^*
LL 0.896985 0.00200
SL 0.905168 0.00248
SS 0.913359 0.00598
*: Std error used pooled error variance approximation.
[0057]
As shown in Table 7, the LL type was 0.896985, the LS type was 0.905168, and the SS type was 0.913359, with a significant difference of p = 0.0040, and it was concluded that the Waste / Hip ratio was higher in the SS type. Was.
[0058]
Table 8 shows the results of multivariate analysis considering the effects of sex, alcohol intake, and smoking. The genotype was LL = 1, LS = 2, SS = 3.
[0059]
[Table 8]Source 　　　　　 Nparm 　 DF 　　　 Squares Sum of F Ratio 　　 Prob> F
L513S 2 2 0.0488658 6.1033 0.0023
ALC / total / day {1} {0.0807091} 20.611} <. 0001
Sex 1 1 0.0128206 3.2026 0.0737
Current smoking 1 　　　 1 　　　 1.0354358 　　　 258.6519 　 <. 0001
As a result, the effect of the genotype was p = 0.0023, and it can be concluded that the genotype significantly affected the Wait / Hip ratio. When divided into SS type + SL type and LL type, p = 0.0093 for SS + SL type.
[0060]
[Sequence list]

Gln

[Brief description of the drawings]
FIG. 1 is a diagram showing the amino acid sequence of MACS2 aligned with the amino acid sequence of SAH (SEQ ID NO: 5), the amino acid sequence of KS2 (SEQ ID NO: 6), and the amino acid sequence of MACS1 (SEQ ID NO: 7). . Motif 1 indicates the ATP binding region. Motif 2 indicates a region specific to medium-chain fatty acid acyl-CoA synthetase.
FIG. 2 is a view showing the location of exon in the MACS2 gene.
FIG. 3 shows the location of exon in the MACS2 gene.
FIG. 4 is a diagram showing the location of exon in the MACS2 gene.

Claims (20)

A nucleic acid molecule capable of detecting a mutation at the 513th leucine residue of medium-chain fatty acyl-CoA synthetase (MACS2), wherein the polynucleotide encodes a protein comprising the amino acid sequence of SEQ ID NO: 2 or a polynucleotide encoding the same. A nucleic acid molecule comprising a nucleotide fragment capable of hybridizing to a complementary polynucleotide. The nucleic acid molecule according to claim 1, consisting of a nucleotide fragment capable of hybridizing to the DNA sequence set forth in SEQ ID NO: 1 or a DNA sequence complementary thereto. The nucleic acid molecule according to claim 1 or 2, comprising a DNA fragment of at least 12 contiguous nucleotides of the DNA sequence of SEQ ID NO: 1 or a DNA sequence complementary thereto. The nucleic acid molecule according to any one of claims 1 to 3, wherein the substitution of the 513th leucine residue for serine (L513S) can be detected. The nucleic acid molecule according to any one of claims 1 to 4, wherein the nucleotide fragment corresponding to the 513th leucine residue has a nucleotide portion in the nucleotide fragment. The nucleic acid molecule according to any one of claims 1 to 5, wherein a region containing a nucleotide portion corresponding to the 513th leucine residue can be amplified by a nucleic acid amplification method. The nucleic acid molecule according to any one of claims 1 to 6, which is used for diagnosis of a disease caused by abnormal lipid metabolism. A primer pair capable of detecting a mutation at the 513th leucine residue of MACS2, wherein the primer pair comprises two types of nucleic acid molecules according to any one of claims 1 to 7. The primer pair according to claim 8, wherein a region containing a nucleotide portion corresponding to the 513th leucine residue can be amplified by a nucleic acid amplification method. One of the primers comprises a nucleotide fragment capable of hybridizing to a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 2, and the other primer comprises the amino acid sequence of SEQ ID NO: 2. The primer pair according to claim 8 or 9, comprising a nucleotide fragment capable of hybridizing to a polynucleotide complementary to the polynucleotide encoding the protein. One of the primers consists of a nucleotide fragment capable of hybridizing to the DNA sequence of SEQ ID NO: 1, and the other primer is a nucleotide capable of hybridizing to a DNA sequence complementary to the DNA sequence of SEQ ID NO: 1. The primer pair according to claim 8, comprising a fragment. One of the primers consists of a continuous DNA fragment of at least 12 nucleotides of the DNA sequence of SEQ ID NO: 1, and the other primer has a continuous DNA of at least 12 nucleotides of a DNA sequence complementary to the DNA sequence of SEQ ID NO: 1. The primer pair according to claim 8, comprising a fragment. The primer pair according to any one of claims 8 to 12, which is used for diagnosis of a disease caused by abnormal lipid metabolism. A method for detecting a disease caused by abnormal lipid metabolism by detecting a mutation in the MACS2 gene, the nucleic acid molecule according to any one of claims 1 to 7 or the nucleic acid molecule according to any one of claims 8 to 13. A step of detecting the presence or absence of a mutation at the 513th leucine residue of MACS2 using the primer pair described in (1). A protein comprising the following amino acid sequence:
(A) the amino acid sequence of SEQ ID NO: 4, or (b) SEQ ID NO: 4 having at least one modification selected from substitution, deletion, addition, and insertion and having medium-chain fatty acid acyl-CoA synthase activity Modified amino acid sequence of the amino acid sequence of A polynucleotide encoding the protein according to claim 15. 17. The polynucleotide of claim 16, consisting of the DNA sequence of SEQ ID NO: 3. A protein comprising the amino acid sequence of SEQ ID NO: 2. A polynucleotide encoding the protein of claim 18. 20. The polynucleotide of claim 19, consisting of the DNA sequence of SEQ ID NO: 1.

Images