JP2003534790A - Phosphorylated polypeptides and uses related thereto - Google Patents

Abstract

(57) Abstract: Modified polypeptides, modified antibodies, stably phosphorylated modified polypeptides, stably phosphorylated modified antibodies, methods for producing polynucleotide sequences encoding the polypeptides, and uses thereof Is provided. Computer-assisted molecular modeling methods are also provided for making modified phosphorylated polypeptides, particularly monoclonal antibodies for use in the diagnosis and treatment of cancer and other diseases. The corresponding monoclonal antibody contains a heterologous recognition site for the polypeptide kinase and can be labeled with a identifiable label, such as the radioactive isotope ³² P. The phosphate groups attached to the phosphorylated polypeptide are very stable due to engineered intramolecular interactions between the phosphate groups and groups in the vicinity. Polynucleotide sequences encoding monoclonal antibodies, including sequences encoding putative phosphorylation sites, and methods of analyzing the biochemical properties of the polypeptide using molecular modeling tools are also contemplated.

Description

Detailed Description of the Invention

[0001] mutual citation TO RELATED APPLICATIONS This application is, at least partially Provisional Application No. 60 / 208,24060 (May 31, 2000 application)
And provisional application 60 / 255,29660 (filed Dec. 13, 2000), the contents of each of which are hereby incorporated by reference.

The present invention relates to an improved method for producing a polypeptide capable of phosphorylation, a polypeptide produced using said method, a DN encoding said polypeptide.
A sequences and their use in the diagnosis and treatment of cancer and other diseases.

Prior Art Labeled polypeptides have been used with various applications. For example, labeled monoclonal antibodies (MAbs) have been widely used for radioimmunotherapy, imaging and staging of tumors. Labeled MAbs have high applicability in cancer diagnosis and treatment for several reasons. First, most tumor populations express tumor antigens in a heterogeneous pattern. Some of the cells within the population do not express the target tumor antigen and are therefore not recognized by the monoclonal antibody. When using MAbs to deliver drugs or toxins to tumor cells, cells that lack the tumor antigen are still inaccessible. In contrast, radiolabeled MAbs offer the advantage of destroying cells within the diameter range of a few cells present around the tumor cells to which they bind. ^{The 131} I-labeled MAb is
It has been shown that a therapeutic dose of radiation can be delivered to antigen negative cells. Secondly,
In the case of carcinoma, the tumor antigen is stable on the cell surface and is not internalized. For a drug or toxin to be effective, it must enter the cell. In contrast, radiolabeled MAbs kill tumor cells after binding to the cell surface and do not require intracellular entry. Therefore, this technique can be applied to a wide variety of cancers. In addition, interferons and other cytokines have been used to enhance expression of tumor-associated antigens on cells, providing better targets for monoclonal antibodies and to cells previously not expressing tumor antigens. It is possible to minimize or even eliminate such cells.

In radioimmunotherapy, ¹³¹ I is commonly used to treat cancer. However, since iodine labeling is not regiospecific, it results in a heterogeneous population of labeled MAbs with varying affinities for the antigen, leading to significant inactivation of MAbs. It may be subject to iodinated polypeptide or dehalogenation reaction, the reaction ¹³¹ I to remove the ¹³¹ I from the tumor before starting the function. Another drawback of iodine labeling is
Iodine is concentrated in the thyroid gland, salivary glands and stomach, which will pose health problems to patients and hospital staff. Compared to ¹³¹ I, ³² P is considered to be a better choice for radioimmunotherapy. Being a pure β-emitter, ³² P has a high energy (E
The max is 1700 keV vs. 182 keV for ¹³¹ I), which is powerful enough to treat cancer. However, the use of this radioisotope requires that the MAb be ³² P.
It was largely restricted due to the difficulty of labeling. ^{The 32} P-labeled peptide can also be chemically linked to the polypeptide via a lysine residue. However, the peptide-MAb conjugates are not regiospecific, which again would impair the Ag binding capacity of MAbs as well as the iodine labeling.

Until a simple and rapid labeling method was developed to construct a fusion polypeptide that can be phosphorylated by introducing a peptide kinase recognition site into the polypeptide, the problem of ³² P labeling is sufficient. Was not solved. See, for example, US Pat. No. 5,986,061, the contents of which are incorporated herein by reference. This is a simple and effective method of labeling polypeptides with radioactive nucleotides and is applicable to virtually any polypeptide. Multiple polypeptide kinase recognition sites can be introduced into a polypeptide to serve as useful tags for a variety of purposes. Introduction of a polypeptide kinase recognition site into a polypeptide can be accomplished without altering the essential structure or function of said polypeptide. Since the polypeptides modified by these methods retain their activity after phosphorylation, the modified polypeptides can be used in many applications.

MAbs capable of phosphorylation (MAb-chB72.3-P, MAb-c
hCC49K1, MAb-chCC49CKI, MAb-chCC49CKII
And MAb-chCC49Tyr) are the heavy chain constant regions of MAb-chB72.3-P or MAb-chCC49 by cAMP-dependent polypeptide kinases and other polypeptide kinases (eg casein kinase I, casein kinase II and Src tyrosine kinase). It can be generated by inserting a predicted phosphorylation consensus sequence into the carboxy terminus of These MAbs are purified and phosphorylated with [γ- ³² P] ATP together with the appropriate polypeptide kinase with high specific activity. These [ ³² P] MAbs bind to cells expressing the TAG-72 antigen with high specific activity. In all of these cases, phosphate was in vitro in various sera.
It is stable at ro and less than 8% of phosphoric acid hydrolyzes in 24 hours.

However, the bound ³² P in the above-mentioned phosphorylatable antibody is not sufficiently stable in buffer or serum for in vivo use in animals and humans. Several methods have been proposed for improving the stability of the MAb capable of phosphorylation. Since RRX (S / T) is a PKA recognition site, alteration of amino acid residue X or amino acid residues downstream of this site alters the stability of this phosphorylatable MAb. Furthermore, the use of threonine instead of serine at the PKA recognition site increases the stability of MAbs that can be phosphorylated, which would significantly reduce the efficiency of phosphorylation. Alternatively, the stability of phosphorylatable MAbs may also be altered when using other phosphatases. There is no guarantee that these measures will bring satisfaction.

The selection of hypothetical phosphorylation sites can sometimes be a daunting problem. because,
Many point mutations, insertions or deletions may change the structure of the entire molecule or at least reduce the function of the polypeptide. Moreover, such sites may potentially be inaccessible to the kinase in question due to steric hindrance. In the past, these problems have been dealt with in an inefficient and time-consuming way, such as random hits. Therefore, what is needed is a fairly accurate way to carry out this step, not only for labeling monoclonal antibodies that can phosphorylate, but also as a general method for producing any phosphorylatable polypeptide. Moreover, it is an efficient means.

[0009] INVENTION It is an object the present invention is a polypeptide (i.e. MAb problems, for example, MAb-ChCC4
In 9) an improved method for finding the position of phosphorylation site is provided, eg computer assisted molecular modeling. The advantage of this method is that the optimal selection can be identified by rapidly exploring the myriad of potential phosphorylation sites within the target polypeptide and predicting potential intramolecular stabilization-promoting interactions. Is. Hydrogen bonding between the phosphate groups to be attached and their neighboring groups provides a simple way to determine the location of the region where surrounding residues protect the phosphate groups from hydrolysis. Thus, a reliable prediction of the stability of the phosphate groups attached is provided in a short time, thus providing an improvement over time-consuming rather inefficient hit-and-miss approaches.

In a broad sense, the invention provides a computer capable of producing a polypeptide capable of phosphorylation, such as a radiolabeled polypeptide (especially a monoclonal antibody (MAb)) and a polypeptide which can be labeled with said radioactivity. The purpose is to create an assisted molecular model. In one aspect, the invention provides improved methods for producing radiolabeled polypeptides. In one embodiment, the invention provides, inter alia, a method for producing a MAb capable of stable phosphorylation with high radioactivity-specific activity while retaining biological activity (affinity for the antigen to which they aim). And Ag-binding polypeptides; MAbs modified with various phosphorus (eg ³² P, ³³ P) or sulfur (eg ³⁵ S, ³⁸ S) isotopes; and MAbs labeled with phosphorus or analogs. According to the invention, the MAbs and modified polypeptides can have only one or multiple radiolabels.

The present invention also provides a method of producing a polypeptide other than a MAb, said polypeptide allowing a higher radioactivity specific activity than the corresponding unmodified polypeptide having only one phosphorylation site, And modified by adding multiple phosphorylation sites that are labeled with high radioactivity. According to the present invention, the phosphorylation site is "
By "added" is also intended to include polypeptides in which phosphorylation sites previously unavailable or inaccessible have been modified to render said sites accessible. The present invention further comprises threonine. And / or polypeptides phosphorylated by suitable kinases on amino acids other than serine residues such as tyrosine residues (especially MAb and Ag binding polypeptides), and one or more putative phosphorylation sites There is provided a method for producing a DNA sequence coding for, wherein said sequence encodes these polypeptides.

In addition, the invention provides polypeptides such as interferons, cytokines,
Methods for producing peptides having growth factors, receptor binding proteins, and phosphorylation sites for binding to receptors or other cellular targets are provided. According to the invention, the native polypeptide sequence is a phosphorylation recognition sequence (eg A
When including the remaining (or other complementary) amino acids of rg-Arg-Ala-Ser, SEQ ID NO: 1), it is sufficient to add a portion of the phosphorylation recognition sequence, unlike the complete sequence. In such an embodiment of the invention, amino acids 1 to 4 of the sequence (for Arg-Arg-Ala-Ser-Val (SEQ ID NO: 2)) are provided to the polypeptide, whereby the Ser-containing recognition sequence. Can be configured. This illustrates the versatility of the present invention for the localization of nucleotide sequences encoding amino acid recognition sequences that contain putative phosphorylation sites.

In addition, the availability of the three-dimensional structure of template molecules for computer-aided modeling allows us to modify the natural amino acid sequence when creating a putative phosphorylation site in a test polypeptide, such as the phosphate group. By introducing, and by identifying the region where the phosphate group is protected by nearby residues (
That is, the hydrogen bonds serve as surrogate markers for easy localization of such regions) and their potential for formation of intramolecular stabilization-promoting interactions can be accurately predicted. . This will greatly speed up the conventional trial and error process and thus provide more accurate and more predictable results.

Phosphorylated MAbs produced using the methods provided by the present invention are unexpectedly stable. In one of the preferred embodiments of the invention, monoclonal antibodies are produced which have optimized phosphorylation sites, so that the phosphate groups attached to such sites are usually in vitro or in vivo. Resistant to hydrolysis at. In a preferred embodiment, at least 80%, more preferably 95%, most preferably 99% of the phosphate groups are after at least 5 days, more preferably 1%.
It remains bound in serum or in buffer after 0 days, most preferably 18 days.

Furthermore, it is also unexpected that such stable monoclonal antibodies have much improved blood clearance and biodistribution properties when compared to other phosphorylated MAbs produced by conventional methods. Was found. In a preferred embodiment, only 70% of the phosphorylated MAb (compared to 90% of the control phosphorylated MAb) was removed from the blood in the blood clearance assay. In another preferred embodiment, the phosphorylated MAbs accumulated in much larger amounts in the tumor than in all other organs. The kinase recognition sequence can be located at the end of the DNA coding sequence or at other positions regardless of the individual phosphorylated amino acid.

The invention also provides polypeptides that can be labeled and labeled polypeptides such as hormones and modified streptavidin. The modified streptavidin can be attached to individual biotinylated antibodies. Each of said streptavidins has been modified by a single phosphorylating group or by a large number of phosphorylating groups, resulting in extremely strong radiation and thus high diagnostic and therapeutic potential. The present invention also provides a polypeptide capable of phosphorylation, said polypeptide comprising at least one phosphorylation recognition site for a protein kinase, which in addition upon phosphorylation at said site by the kinase, a nearby It contains a particularly stable phosphate group due to its ability to form intramolecular stabilizing promoting interactions with the group (ie the amino acid side chain). The intramolecular stabilization-promoting interaction may be a charge-based interaction, a hydrophobic and / or covalent interaction that prevents the hydroxy group from attacking or contacting the phosphate group. Assessing the regions that hydrogen bond serves as a way to determine the location of regions where the phosphate groups are protected from hydrolysis.

The present invention also provides a phosphorylated polypeptide for a protein kinase, which contains an engineered phosphorylation recognition site. Furthermore, the phosphate groups are particularly stable due to their ability to form intramolecular stabilizing promoting interactions with nearby groups (ie amino acid side chains). The intramolecular stabilization-promoting interaction may be a charge interaction, a hydrophobic and / or other non-covalent interaction that prevents the hydroxy group from attacking or contacting the phosphate group. Assessing the regions that hydrogen bond serves as a way to determine the location of regions where the phosphate groups are protected from hydrolysis.

The present invention also provides a recombinant DNA sequence encoding a functional polypeptide having one or more putative phosphorylation sites; an expression vector expressing said functional polypeptide; a transformed host cell; A method of expressing a modified polypeptide; and said modified polypeptide. The present invention also relates to MAbs and polypeptides produced by recombinant DNA technology (phosphorus or sulfur labeled MAbs, and recombinant DNA.
Including a radiolabeled polypeptide produced in.

The present invention further has a target Ag having one or more labeling sites.
To the unmodified MAb because it has a substantially similar affinity to the unmodified MAb.
b provides a DNA sequence encoding a functional MAb that is sufficiently reproducible with b. Also provided are a recombinant DNA comprising a coding sequence for a putative recognition sequence for a kinase; a recombinant expression vector; a host organism transformed with said expression vector comprising said DNA sequence; and an expressed modified polypeptide. .. Also provided are methods involving site-directed mutagenesis to construct suitable expression vectors, hosts transformed with the vector and expressing modified polypeptides, particularly modified human interferons.

The present invention, in one of its several embodiments, provides: a DNA sequence encoding one or more putative phosphorylation sites, said sequence being a functional M
Said DNA sequence encoding an Ab, each of said MAbs having at least one putative phosphorylation site, and each having at least substantially similar affinity for its intended Ag; An expression vector for expressing said functional MAb under the control of a promoter (eg the lambda P _L promoter or other promoters mentioned below); and a biologically active phosphorylated MAb.

The invention also provides at least one phosphorylatable polypeptide having at least one genetically engineered phosphorylation site, or a polynucleotide encoding said phosphorylatable polypeptide. A sequence; at least one protein kinase capable of phosphorylating said polypeptide at said genetically engineered phosphorylation site, or a polynucleotide sequence encoding a protein kinase; and said phosphorylatable poly Provided is a kit containing at least one nucleic acid or a derivative thereof that can be used by the protein kinase as a substrate for labeling a peptide. Thus, according to the present invention, a nucleotide sequence encoding the required number of specific amino acids required to create a putative phosphorylation site is constructed. The invention also provides a separate product, or as one of the components of certain kits,
Provided are polypeptides that can be phosphorylated or are phosphorylated. The present invention also provides a method for analyzing a molecule's biochemical properties using a molecular modeling tool.

As used herein, an “internal sequence” of a polypeptide generally refers to the presence of at least one amino acid N-terminus corresponding to the first amino acid of said internal polypeptide sequence, and further said It is meant that there is at least one amino acid C-terminus corresponding to the last amino acid. "Biological activity" generally refers to the essential biochemical and / or biological activity of any given polypeptide (eg, catalytic activity of an enzyme, certain molecules (ie, other polypeptides, nucleic acids). , Metal ions, steroid hormones, lipids, polysaccharides, etc.) and the ability to activate or inhibit the function of other molecules, but is not limited to these).

“Genetically engineered” means according to some predetermined criteria, usually by means of site-directed mutagenesis of a polynucleotide sequence encoding a target amino acid sequence. It is generally meant to intentionally alter a molecule using conventional molecular biology techniques such as PCR and / or subcloning. The above description is not intended to identify all features or embodiments of the present invention, nor is it intended to limit the present invention. The accompanying drawings and examples included in the specification and forming a part of the specification illustrate various embodiments of the invention and, in conjunction with the specification and claims, describe the invention. Serves to explain the principle of.

Means for Solving the Problem Polypeptides that are not normally phosphorylated can be modified to become phosphorylated (see, eg, US Pat. No. 5,986,061:
Said document is included herein by reference). A method for obtaining this result (especially without compromising the biological activity of the polypeptide in question) is described by other polypeptides (
Modified antibodies (eg, monoclonal antibodies) to provide the potential to phosphorylate them. However, the choice of ideal hypothetical phosphorylation sites is a difficult problem, largely due to uncertainty (eg, unpredictability of mutagenesis effects on overall polypeptide structure). Therefore, the improvements disclosed in the present invention not only alleviate this problem, but also predict intramolecular interactions between the added phosphate group and its nearby groups, resulting in It also has the unexpected advantage of being able to predict overall stability. The stability of the bound phosphate group is a crucial parameter for many of the utilities of polypeptides that can be phosphorylated.

One of the features of the present invention relates to the use of said three-dimensional molecular model for the template polypeptide three-dimensional molecular model and computer-aided modeling of the polypeptide in question. The essential step of this approach to design phosphorylation sites is
Including the construction of a computer graphics model of the polypeptides in question and their variants, said computer graphics model being used to introduce such mutations into the overall conformation (and thus biological activity) of those peptides. The consequences; the effect of the phosphate groups on neighboring groups; and the stability of the bound phosphate groups can be determined on the basis of their potential to form intramolecular interactions with neighboring groups. For example, in order for a hypothetical phosphorylation site to be effective, it should be deeply embedded within other structures so that there is no steric hindrance and the polypeptide kinase is easily accessible to that site. Instead, it is preferably exposed on the surface of the polypeptide. In addition, other factors, including electrostatic interactions, hydrogen bonding, hydrophobic interactions and desolvation, all contribute to the stability of the bound phosphate group, which is an important parameter for many of the utilities of the present invention. Influence). Therefore, all these factors should be considered in an attempt to design an ideal hypothetical phosphorylation site.

Computer-generated molecular models of the subject polypeptides can be made, as described in the Examples below. In a preferred embodiment, at least the C ″ -carbon position of the MAb is mapped by homologous modeling to the individual coordination pattern (eg, MAb31 coordination shown in FIG. 2). Such protocols mainly involve predicting the conformation of the side chains of the modeled polypeptide, while the main chain signature obtained from the three-dimensional structure as provided, for example, in FIGS. 1 and 2. Molecular models are usually created using computer programs that perform routine procedures for energy minimization, eg, CHARMM (Brooks et al. (1983) J. Comput. Chem.
4: 187-217) and AMBER (Weiner et al. (1981) J. Comput. Chem. 106: 7.
65) The algorithm both handles all of the molecular system setup, force field calculations, and analysis (see, eg, Eisenfield et al. (199).
1) Am. J. Physiol. 261: C376-386; Lybrand (1991) J. Pharm. Belg. 46: 49-54;
Froimowitz (1990) Biotechniques 8: 640-644; Burbam et al. (1990) Polypep
tides 7: 99-111; Pedersen (1985) Environ. Health Perspect 61: 185-190; and Kini et al. (1991) J. Biomol. Struct. Dyn. 9: 475-488). The aforementioned documents are incorporated herein by reference.

At the center of the program, given the position of all atoms in the model,
There is a series of subroutines that calculate the total potential energy of the system and the force on each atom. These programs can utilize the starting atomic coordinate set (eg, model coordination provided in FIG. 1 or 2), parameters for various terms of the latent energy function, and the type of molecular topology (covalent bond structure). it can. Common features of such molecular modeling methods include: provisions for handling hydrogen bonds and other restraints; use of periodic boundary conditions; and temperature, pressure, volume, restraint forces, Or provisions for the occasional adjustment of position, velocity or other parameters to maintain or change other externally controlled conditions.

The most general method for energy minimization is the input data described above and the latent energy function is a function of the Cartesian coordination that is clear and identifiable, and the latent energy for any atomic configuration set. And the fact that its slope can be calculated. Using the above information, a new coordinate set was created to reduce the total potential energy and the above process was repeated many times to optimize the molecular structure under a given set of external conditions. can do. These methods for energy minimization are routinely applicable to molecules similar to the polypeptides of the invention, as are nucleic acids, polymers and zeolites.

In general, the energy minimization method can be performed for a given temperature, T _i, which may be different than the docking simulation temperature, T _o . Upon energy minimization of a molecule at T _i , the coordinates and velocities of all atoms in the system are computed. Furthermore, the normal mode of the system is also calculated. It will be appreciated by those skilled in the art that each of the normal modes is a collective, periodic motion (where all parts of the system move in concert with each other) and the motion of the molecule is a superposition of all the normal modes. Will be understood. For a given temperature, the mean squared motion amplitude in an individual mode is inversely proportional to the effective force constant for that mode, so that molecular motion will often be suppressed by low frequency oscillations.

After the energy minimization at T _i of the molecular model is achieved, the system is “warmed” or “cooled” to the simulation temperature T _o . The warming or cooling is accomplished by performing a balancing operation of measuring at a desired temperature T _o stepwise manner the speed of the atoms to reach. The system is further equilibrated for a certain time until certain properties of the system, such as the average kinetic energy, remain constant. The coordinates and velocities of each atom are then obtained from the equilibrated system.

Still other minimization routines can be performed. For example, this second type of method involves calculating an approximate solution of the constrained EOM for the polypeptide. These methods use an iterative approach to obtain a solution for the Lagrange multiplier, and typically require only a few iterations if the correction required is small. The most popular method of this type is SHAKE (Ryck
aert et al. (1977) J. Comput. Phys. 23: 327; Van Gunsteren et al. (1977)
Mol. Phys. 34: 1311) is easy to implement and is measured as O (N) when the number of constraints increases. Therefore, the method is directed to macromolecules (eg, polypeptides of the invention).
Can be used for. Another method, RATTLE (Anderson (1983) J. Com
put. Phys. 52:24) is based on the speed conversion of the Berlet algorithm. Like SHAKE, RATTLE is an iterative algorithm and can be used for energy minimization of the polypeptide model of the invention. These documents are incorporated herein by reference in their entirety. From the above considerations, the same principles as described above can be applied to the construction of any amino acid sequence other than the specific amino acid recognition sequence described above.

When the phosphorylation site is other than serine (as explained above), the DNA sequence encodes part or all of the appropriate amino acid sequence containing a hypothetical recognition site including threonine, tyrosine, etc. Thus, in any individual polypeptide, if one or more amino acids (which occur anywhere in this amino acid sequence) is the same as that of the amino acid recognition sequence for the kinase, then that sequence is It is sufficient to add (modify) the complementary amino acids of the amino acid recognition sequence for completeness. This is accomplished by constructing a DNA sequence that encodes the desired amino acid sequence. When it is important to maintain the integrity of the polypeptide molecule to be modified (eg to minimize the risk of affecting a particular activity (eg biological activity)), or genetic manipulation is simple As such, or because one or both ends or other locations are more accessible, there may actually be situations in which such addition (or modification) is a more desirable method.

According to the present invention, phosphorylation of a polypeptide capable of phosphorylation can be performed by any suitable phosphorylation means. Phosphorylation and dephosphorylation of polypeptides catalyzed by polypeptide kinases and polypeptide phosphatases has been found to affect a large number of polypeptides. Numerous polypeptide kinases have been reported and are available to those of skill in the art for use in the present invention. Such polypeptide kinases can be divided into two main groups: those that catalyze the phosphorylation of serine and / or threonine residues within polypeptides and peptides; and that catalyze the phosphorylation of tyrosine residues. What to do. The two main categories can be further subdivided into new groups. For example, serine and / or threonine polypeptide kinases are cyclic AMP (cAMP) dependent polypeptide kinases, cyclic GM
It can be subdivided into P (cGMP) -dependent kinases, and cyclic nucleotide-dependent polypeptide kinases. Recognition sites for many polypeptide kinases have been postulated.

A short synthetic peptide, the cAMP-dependent polypeptide kinase has the sequence Arg-Ar
It recognizes g-Xxx-Ser-Xxx, where Xxx represents an amino acid. As noted above, the cAMP-dependent polypeptide kinase is Arg-Arg-Xxx.
-Ser-XXX but recognizes some other specific sequences such as Arg-T
hr-Lys-Arg-Ser-Gly-Ser-Val (SEQ ID NO: 3) can also be recognized. Many other polypeptide serine and / or threonine kinases have been reported, such as: glycogen synthase kinase,
Phosphorylase kinase, casein kinase I and II, pyruvate dehydrogenase kinase, polypeptide kinase C, and myosin light chain kinase.

A polypeptide kinase that phosphorylates tyrosine on a peptide substrate (rather than serine, threonine or hydroxyproline) and exhibits specificity for this is the polypeptide tyrosine kinase (PKT). The PKT is described in the literature. PKT is yet another type of kinase and is available for use in the present invention. Another type of available kinase is the cyclic GMP-dependent (cGMP-dependent) polypeptide kinase. cGMP-dependent polypeptide kinases exhibit substrate specificities that are similar, but not identical, to the specificities exhibited by cAMP-dependent polypeptide kinases. Peptide Arg-Lys-Arg-Ser-Arg-Lys-Gl
u (SEQ ID NO: 4) is phosphorylated on serine by cGMP-dependent polypeptide kinase better than by cAMP-dependent polypeptide kinase.
The cAMP-dependent polypeptide kinase is a synthetic peptide Leu-Arg-Arg-
The hydroxyproline of Ala-Hyp-Leu-Gly (SEQ ID NO: 5) can be phosphorylated.

Casein kinases (widely distributed in eukaryotes and preferentially utilizing acidic peptides as substrates, eg casein), have been divided into two groups, casein kinases I and II. Casein kinase II is a synthetic peptide, Ser-Glu-G.
lu-Glu-Glu-Glu (SEQ ID NO: 6) was phosphorylated. Evaluation of the results with synthetic peptides and natural polypeptide substrates revealed that the relatively short amino acid sequence surrounding the phosphate acceptor site provided the basis for the specificity of casein kinase. Therefore, the acidic residues at positions 3 and 5 with respect to the carboxy terminal side of serine seem to be most important. In another experiment, the peptide, Arg-Arg-Arg-Glu-Glu-Glu-Thr-Gl.
u-Glu-Glu (SEQ ID NO: 7) is a specific substrate for casein kinase II, however, Arg-Arg-Arg-Glu-Glu-Gku-
Ser-Glu-Glu-Glu (SEQ ID NO: 8) is a better substrate,
Further Arg-Arg-Arg-Asp-Asp-Asp-Ser-Asp-A
sp-Asp is Arg-Arg-Arg-Glu-Glu-Glu-Ser-.
It was found to be a better substrate than Glu-Glu-Glu (SEQ ID NO: 9). Therefore, aspartate is preferred over glutamate.

The COOH-terminal acidic residue of serine (threonine) is absolutely necessary as far as is known today, while the amino-terminal acidic residue of serine (threonine) enhances phosphorylation. , Not absolutely necessary. Therefore, Ala-
Ala-Ala-Ala-Ala-Ala-Ser (Thr) -Glu-Glu
-Glu (SEQ ID NO: 10) functions as a substrate for Casein Kinase II, but Ala-Ala-Ala-Glu-Glu-Glu-Ser (Thr)
It is less effective than -Glu-Glu-Glu (SEQ ID NO: 11) (the Ser (Thr) designation means serine or threonine). Casein kinase I and II phosphorylate many of the same substrates, except that casein kinase I does not phosphorylate any of the 10-mer peptide substrates described herein. From experiments with different synthetic peptides, the sequence Ser-Xxx-Xxx-Glu (and by inference Ser-Xxx-Xxx-Asp) shows that the sequence of the sequence fulfills the minimum requirement for recognition by casein kinase II. It is concluded that it represents a species (although some other peptides and sequences could also meet the above conditions).

As noted above, other kinases have been reported. Mitogen-activated S6 kinase phosphorylates the synthetic peptide Arg-Arg-Leu-Ser-Ser-Leu-Arg-Ala (SEQ ID NO: 12) like liver-derived protease activated kinase. The rhodopsin kinase is the peptide Thr-Glu-
Thr-Ser-Gln-Val-Ala-Pro-Ala (SEQ ID NO: 13
) Is catalyzed by phosphorylation. Serine / threonine kinases of other polypeptides have also been reported and their phosphorylation sites have been elucidated. Therefore, the person skilled in the art can very appropriately select the available kinases to be used in the present invention. The kinases have a relatively high degree of specificity with respect to the recognition process, however with some flexibility for specific amino acid recognition sequences. Such kinases provide the means for phosphorylation of putative phosphorylation sites on the desired polypeptide.

The choice of the most suitable position for modification of the molecule depends on the particular polypeptide (and its conformation). If a number of putative phosphorylation sites (and sites capable of phosphorylation) are included in the modified polypeptide, one or both ends of the molecule or other positions may potentially be present to provide the amino acid recognition sequence. It will be considered whether it is available or not. Therefore, according to the invention,
The phosphorylation recognition sequence is introduced at any position of the naturally occurring polypeptide sequence, provided that the introduced sequence does not adversely affect the biological activity, in which case said activity is desired. can do.

Once the recognition sequences for individual polypeptide kinases have been identified, the invention provides a method by recombinant DNA technology to generate DNA sequences encoding the recognition sequences for said kinases. The DNA sequence is fused or linked to a DNA sequence that encodes a functional polypeptide that is expected to contain the corresponding hypothetical labeling site. Because of the essential advantages of the present invention, molecular modeling can be used to rapidly scan a large number of potential sites, resulting in adverse effects on the three-dimensional structure and / or biological activity of the target polypeptide. Does not reach,
Only sites with or without bound phosphate groups will be selected for further study.

The present invention contemplates any polypeptide which can be radioactively labeled by the method of the present invention and which has at least one property of the corresponding polypeptide which is unlabeled (unlabeled). , And include them further. According to the present invention, non-phosphorylated (or incapable of phosphorylating) polypeptides can be modified to introduce a putative phosphorylatable site in the amino acid sequence. This is done after modifying the DNA sequence coding for the amino acid sequence of the polypeptide with the DNA sequence coding for a hypothetical phosphorylation site (part or all). In the case of MAbs, the invention includes all MAbs, which include the structurally modified MAs reported in the literature as discussed above.
b (eg humanized MAb, hybrid antibody, chimeric antibody and modified MAb F
ab or Fc fragment), and other modified MAbs to be developed in the future.

In a preferred embodiment of the invention, the recognition site for the cAMP-dependent polypeptide kinase is introduced into Mab-chCC49 by site-directed mutation of its coding sequence and comprises a highly stable phosphate group. Mab-ch CC49 capable
Variants are produced. In order to design such MAbs without altering their immunoreactivity or biological properties, molecular modeling was used to identify regions suitable for the introduction of cAMP-dependent phosphorylation sites with the desired properties. Determine the position.
Using molecular modeling, we selected a position on the heavy chain and mutated it. A vector expressing the mutant was constructed and high levels of synthetic MAbs-WW5, -WW6 were constructed.
And -WW7 expressing mouse myeloma NS0 cells. Said variant contains a cAMP-dependent phosphorylation site in the hinge region of the heavy chain,
[Γ- ³² P] AT by the catalytic subunit of MP-dependent polypeptide kinase
It is phosphorylated by P with a high specific activity, and the phosphate group can be stably retained. Ma
Another phosphorylatable variant of Mab-chCC49 (M-chCC49K1 (Lin et al., Int. J. Oncology, 13: 115-120, 1998) compared to M-chCC49K1.
Ab-WW5, -WW6 and -WW7 with phosphate groups attached show much improved stability (resistance to hydrolysis increased about 10-fold). They also Mab-to the TAG-72 antigen on MCF-7-4C10 breast cancer cells.
It shows the same binding specificity as that observed with chCC49K1. The improved stability of the bound phosphate group provides MAbs with the potential to be used in the diagnosis and treatment of adenocarcinoma.

Radiolabeled monoclonal antibodies (MAbs) directed against tumor associated antigens (TAA) are used clinically as well as therapeutically for the early detection and staging of said diseases.
Chimeric Mab-chCC49 is a TAA expressed on the surface of a wide range of human adenocarcinomas.
It is one of these MAbs that reacts with. Chimeric Mab-chCC49 is a variable region of mouse MAb-CC49 (GenBank Accession No: M95575) and human Ig.
G1 heavy chain (GenBank Accession No: J00228) constant region and human chain (GenBank A
ccession No: J00241).

Since molecular modeling is a powerful tool for constructing a three-dimensional model of a polypeptide, another method for obtaining structural information about MAb-chCC49 is to use the known MAb crystal structure as a template. Is to build a three-dimensional model. The present specification describes the development of a three-dimensional model of MAb-chCC49 and its variants, and
Provided is a summary of using the three-dimensional model to design a MAb-chCC49 mutant capable of phosphorylation, whose phosphate group exhibits increased resistance to hydrolysis. The phosphorylatable MAb-chCC49, termed MAb-WW5, is readily phosphorylated and its bound phosphate is resistant to hydrolysis and is similar to in vivo use in animal models and patients. MAb-chCC49 was shown to be a suitable candidate for use in. Therefore, in order to develop more effective labeled MAbs, the goal is to develop stable and effective radiolabeled MAbs for use in vivo, with the recognition site for the cAMP-dependent polypeptide kinase located at the position of its coding sequence. Introduced by specific mutation.

MAb-chC without altering their immunoreactivity or biological properties
To make variants of C49, it was useful to know the structure of these mutant antibodies. However, due to the inherent mobility and segmental flexibility of the antibody, obtaining a complete antibody crystal structure is extremely difficult. Two myeloma polypeptides D
The initial crystal structures of ob and Mcg are solved by the deletion of the hinge region.
Being constrained in construction, the structure exhibits a compact T-shape. further,
The structure of MAbKo1 is determined. It has a complete hinge region but MAb
The Fc part of is highly distorted and cannot have the correct orientation for the Fab component. So far, only the crystal structures of two MAbs have been elucidated.
One is MAb231 (mouse IgG2a MAb against canine lymphoma cells) and the other MAb 61.1.3 (murine IgG1MA against phenobarbital).
b). The crystal structures of both of these MAbs have elucidated the structures of the Fab, hinge and Fc regions, and their spatial orientation. Furthermore, both antibodies show a general asymmetry, which may indicate an intrinsic motility of the antibody's strength and segmental flexibility. The other structural features of the two MAbs are quite different. The following examples describe two preferred embodiments of the present invention.

[0046] Example Example 1 Example 1 is intended to show the preparation of phosphorylated monoclonal antibodies much more stable WW series than other phosphorylated monoclonal antibodies. I. Materials and Methods A. Enzymes, Reagents and Chemicals Enzymes All restriction endonucleases, Klenow fragment of DNA Polymerase I, are available from New England Biolabs, Gibco / BR
Purchased from Gibco / BRL Life Technologies or Boehringer-Mannheim Biochemicals. CAMP-dependent protein kinase derived from bovine heart (Cat. No. P-2645) is
Purchased from Sigma Chemical Co.

Reagents Goat anti-human IgG (Fc specific) antibody (Cat. No. I-2136) was purchased from Sigma Chemical Company. Mouse serum (Cat. No. 015-000-120) was purchased from Jackson ImmunoResearch Laboratories, Inc. Geneclean Kit (Geneclean, Cat.No.3106) is Bio 10
I bought it from 1. The hybridoma culture solution containing no PFHM-II protein was purchased from Zibco / BRL (Cat. No. 12040-077). Iscove's Modified Dulbecco's Medium is from Gibco BRL (Cat. No. 195786).
Purchased from 1).

3. Chemicals Sodium pyruvate (Cat.No.11360-013), L-glutamine (Cat.No.250-30)
-016) and non-essential amino acids (Cat. No. 11140-019) were purchased from Zibco / BRL. Insulin (Cat.No.I-5500) and Methotrexate (Cat.No.A-6770)
Was purchased from Sigma Chemical Company. Uridine (Cat. No. U-288-1) was purchased from Aldrich Chemical Company. Radioactive nucleotide [
γ- ³² P] ATP (6000 Ci / mmol) was purchased from DuPont / NEN. All other analytical grade chemicals were purchased from Fisher or United States Biochemical Co.

B. Cell lines and bacterial strains 1. Cell lines Indications in parentheses after the cell name indicate, if applicable, the American Bacterial Culture Collection (AT
CC) number. a. NS0 cells: mouse myeloma cell line. The cells are grown in Dulbecco's Modified Eagle Medium (DMEM), 10% fetal bovine serum (FBS) and 2 mg / mL L-glutamine. b. WISH cells (CCL-25): A description of the ATCC catalog is as follows: "This strain was initially thought to be derived from normal amniotic membrane, but then based on isoenzyme analysis, HeLa marker chromosomes and DNA fingerprints. To HeL
It was found that it was established by the contamination of a cells. The cells are keratin-positive by immunoperoxidase staining. The cells are grown in DMEM with 10% FBS. WISH cells are sensitive to VSV, poliovirus types 1, 2 and adenovirus type 2.

C. FS7 cells: Human foreskin cells with a limited life span of about 20 passages. The cells are grown in DMEM with 10% FBS. d. HeLaS3 cells (CCL-2.2): Human cervical epithelial adenocarcinoma cell line.
The cells are grown in DMEM with 5% FBS. HeLaS3 cells are VS
It is sensitive to V, poliovirus types 1, 2 and 3, adenovirus type 5, and interferon. e. HEp-2 cells (CCL-23): A description of the ATCC catalog is as follows: "This line was initially thought to be derived from epithelioid carcinoma of the larynx, but then
It was revealed that it was established by contamination of HeLa cells based on isoenzyme analysis, HeLa marker chromosome and DNA fingerprint. The cells are keratin-positive by immunoperoxidase staining. The cells are DM containing 10% FBS
Grow in EM. HEp-2 cells are sensitive to VSV, poliovirus 1 and adenovirus type 3.

F. MDBK cells (CCL-22): Bovine renal epithelial cell line. The cells are 10% F
Grow in DMEM with BS. MDBK cells are sensitive to VSV, and some other bovine viruses. g. Vero cells (CCL-81): Monkey renal epithelial cell line. 10 cells
Grow in DMEM with% FBS. Vero cells are VSV, poliovirus 1,
It is sensitive to types 2 and 3, and simian adenovirus. h. Daudi cells (CCL-213): Human peripheral blood cell line. The cells are grown in RPMI containing 10% FBS. The cells express Fc receptors on their surface.

I. MCF-7 / 4C10 cells (HTB-22): Human breast epithelial adenocarcinoma cell line M
CF-7 subclone. The cells are DMEM, 20% FBS, 0.05 mg /
Grow with mL of insulin, 0.5 x nonessential amino acids and 0.05 mg / mL sodium pyruvate. The cells express the TAG-72 tumor antigen on their surface. Bacterial strain DH5αF ′: It has the following genotype: F′φ80d lac ZΔM1
5Δ (lac XYA- arg F) U169 deo R rec A1 end A1 hsd R17 (r k -, m k +) sup E44λ - thi -1 gyr A96 rel A1. DH
5αF ′ was used as a host for the M13mp cloning vector and also for propagation of said plasmid.

C. Preparation of a homologous model of MAb-chCC49 1. Software and Hardware In this experiment, we used the SYBYL molecular modeling package (version 6.5) for structural analysis and geometric refinement (Tripos Association, St. Louis, M.
O, 1999). Most of the homologous model and mutant model preparations are LOOK3.
． 5 programs (Molecular Application Group, Palo Alto,
CA). For geometric optimization, we use the Kollman united charge (Kollman united charge)
charges), molecular force field and SYBYL's MAXIMIN2 Minimizer. All of these visualization analyzes and simulations are done on the Silicon Graphics Octane workstation.
It was carried out in.

2. Template Crystal structure of complete MAb 231 (coordinated by Dr. Alexander McPher
(donated by Son and Dr. Lisa J. Harris) were used as templates for the modeling of MAb-chCC49. These coordinates are now ID1IGT
Available from the Protein Data Bank (PDB). Since the crystal structure of MAb231 was the only one available as a complete antibody at the time we started this project, MAb231 was used as a template for model building in this experiment. Furthermore, after the crystal structure of MAb 61.1.3 was reported, the length and sequence of the hinge region of MAb 231 was found to be more similar to that of MAb-chCC49 than the hinge region of MAb 61.1.3. As such, we used the hinge region of MAb 231 for the modeling of MAb-chCC49. Subsequently, a model of a MAb-chCC49 mutant was prepared using the obtained model of MAb-chCC49 as a template.

3. General Method The model of MAb-chCC49 was constructed using the homology modeling module of the LOOK3.5 program. After getting the IgG2aMAb coordination, MA
A molecular model of MAb-chCC49 was developed using the structure of b231 as a template. First, the four wedges of MAb 231 are individually separated to form L1, L2, H1,
And H2 (L represents a light chain and H represents a heavy chain). The coordination of each chain was extracted and stored separately. The procedure we used for model building of MAb-chCC49 was to perform homologous modeling separately for each chain of MAb-chCC49. First, we display the three-dimensional structure of the chain L1 of MAb231, then introduce the sequence of the light chain of MAb-chCC49 into the program, activate the automatic alignment mode, and align the sequence of the MAb-chCC49 light chain. This was done using an alignment of the light chain sequences of MAb231 (Fig. 1). The model was constructed and completely refined under an automated method using the program module SEGMOD. The coordination of chain L1 of MAb-chCC49 was then created and saved as a PDB file. The model and coordination of chains L2, H1 and H2 of MAb-chCC49 were made in the same way as described above.

4. Geometric refinement and energy minimization Further geometric refinement and optimization was performed using SYBYL molecular modeling software. The three-dimensional structure of chain L1 of MAb-chCC49, whose coordination was made as above, was displayed. Essential hydrogen atoms (hydrogen atoms bonded to nitrogen, oxygen and / or sulfur atoms potentially required for hydrogen bonding with surrounding atoms / residues) were added. In the first step, the side chains were scanned to minimize conformational constraints within the side chain groups and surrounding residues, if any. Proline is the only residue that contains a ring in its backbone and has a phi angle close to 70 °. Therefore, we maintained the geometry of proline using the "proline fixation" command in SYBYL. We also have Asn and Gln
It was scanned whether the orientation of the amide group of was favorable for hydrogen bonding with surrounding residues. Finally, Coleman's coalescing charge was loaded on chain L1 so that the energy calculations could include the electrostatic contribution. The three-dimensional structure of chains L2, H1, H2 was geometrically refined and further optimized by the same method used for chain L1. Subsequently, refined models of chains L1, L2, H1 and H2 of MAb-chCC49 were combined into a single molecule. After that, the side chains were fixed in the same manner as the amide groups of Asn and Gln to relax the tension in the synthetic molecule.

Since MAb-chCC49 is a large protein, the energy minimization step was divided into two parts. Before the energy minimization of the complete molecule, we first performed a side chain minimization. We fixed the scaffold by making it one aggregate set. Subsequent energy minimization of the side chains was achieved using Coleman's Kollman united force field option with 100 iterations. In the next step, the aggregates were removed and the energy minimization of the complete molecule was performed by the Powell method in the SYBYL program.

D. MAb-chCC49-6P, MAb-WW1, MAb-WW2, MAb
-WW3, MAb-WW4, MAb-WW5, MAb-WW6 and MAb-W
Construction of chimeric monoclonal antibody capable of phosphorylating W7 MAb-chCC49K1, MAb-CC49CKI, MAb-CC49C
KII, MAb-CC49Tyr, MAb-chCC49-6P, MAb-WW
1, MAb-WW2, MAb-WW3, MAb-WW4, MAb-WW5, MA
b-WW6, MAb-WW7 and MAb-WW8 homologous modeling This method was similar to the modeling of MAb-chCC49 described in section C above. MAb-chCC49K1, MAb-CC49CKI, MAb-CC49
CKII, MAb-CC49Tyr, MAb-chCC49-6P, MAb-W
W1, -WW2, -WW3, -WW4, -WW5, -WW6, -WW7 and-
Models of both chains of WW8 were made using the corresponding chains of MAb-chCC49 as template. Geometric refinement and energy minimization of the modified model MAb was performed using the same method as was performed to obtain the refined model of MAb-chCC49. 2. Phosphorylated MAb-chCC49K1, MAb-CC49CKI, M
Ab-CC49CKII, MAb-CC49Tyr, MAb-chCC49-6
P, MAb-WW1, MAb-WW2, MAb-WW3, MAb-WW4, MA
Systematic search and modeling of b-WW5, MAb-WW6, MAb-WW7 and MAb-WW8 After obtaining the model of each modified MAb, generate a phosphate group and use the "builder" module of the SYBYL model making package. The above-mentioned phosphate group was attached to the hydroxyl group of serine or threonine at the PKA recognition site. In the case of MAb-chCC49K1, the phosphate group is attached to Ser449 and Ser455; MAb-chC
In the case of C49-6P, Ser449, Ser455, Ser464, Ser47
0, Ser479 and Ser485; Se for MAb-CC49CKI
at r450 and Ser457; Ser43 in the case of MAb-CC49CKII
6; Tyr455 in the case of MAb-CC49Tyr; Ser13 in the case of MAb-WW1; Thr224 in the case of MAb-WW2; Ser21 in the case of MAb-WW3; Thr20 in the case of MAb-WW4; MAb- In case of WW5, to Ser224; in case of MAb-WW6, to Ser224; MAb-WW7
In case of MAb-WW8, a phosphate group was bound to Ser224 in the case of. In order to obtain an optimal position, and in addition to make a favorable interaction with the residues surrounding the phosphate moiety, we have established a Ser / Thr Cα-Cβ at the PKA recognition site.
And a search for systematic conformations along Cβ-Cγ was performed. For each of the allowed conformations of the Ser and Thr side chains,
We analyzed geometrically optimal hydrogen bonds with surrounding residues. continue,
From these conformations, the perfect molecule with the lowest intrinsic energy was selected and further refined. First, we limited the subset of amino acid residues that fit into the 7 sphere around the residue RRXS / T at each protein kinase recognition site. Then, using Powell's method, these four amino acid residues (
The minimized subset for RRXS / T) was performed for 100 iterations.

3. MAb-chCC49-6P, MAb-WW1, MAb-WW2, MAb-
Construction of WW3, MAb-WW4, MAb-WW5, MAb-WW6, MAb-WW7 and MAb-WW8 a. Construction of MAb-chCC49-6P Plasmid pdHL7-CC49K1 prepared before was used to construct plasmid pd
HL7-CC49-6P was prepared. MAb-chCC49K1 contains two phosphorylation sites in each heavy chain. To construct a heavy chain with a cassette of 6 phosphorylation sites, the synthetic fragment K2 was synthesized (Fig. 3). This fragment contained two phosphorylation sites, like fragment K1, but contained overhangs compatible with the XmaI site at each end. The XmaI site on the right side was modified by replacing C at the end with A. Therefore, when the right end was ligated to the overhang with the XmaI site, the religated product could not be cut with the endonuclease XmaI.
This double-stranded fragment was ligated into the XmaI site of plasmid pdHL7-CC49K1. Clones containing the insert were screened by digesting the resulting plasmid with XhoI. Clones containing the XhoI fragment that appeared to contain the two K2 fragments were selected for further screening by PCR. The resulting plasmid pdHL7-CC49-6P
Contains two complete K2 fragments and the original K1 fragment,
Sequences encoding 6 phosphorylation sites on each heavy chain were generated.

A vector for expression of a phosphorylable monoclonal antibody (MAb-chCC49K1) having two cAMP-dependent protein kinase recognition sites in each heavy chain was modified as follows to carry out site-specific mutations. Constructed and MAb-CC4
Phosphorylation sites were introduced at various positions in 9. To construct an expression vector for MAb-chCC49, which does not have a phosphokinase recognition site, the intermediate vector pdHL7-BH was created, whereby two X of pdHL7-CC49K1 were constructed.
One of the hoI restriction sites could be removed. To construct pdHL7-BH, vector pdHL7-CC49K1 was digested with BamHI and HindIII restriction endonucleases. The resulting 6854 bp fragment was isolated by agarose gel electrophoresis, subsequently purified, blunt-ended, and self-ligated to prepare the intermediate vector pdHL7-BH. pdHL7-CC49
To construct the 5'and 3'primers (GTGACCGCTGTACCAACCTCTGTCC (SEQ ID NO: 1 respectively)
4) and CCCTCGAGTCACTTGCCCGGGGACAGGGGAGA
PdHL7-CC49K1 by PCR using GG (SEQ ID NO: 15))
Amplified from. Subsequently, this PCR fragment was added to BsrGI and XhoI.
Digested with restriction endonuclease and purified. The vector pdHL7-BH was digested with the same restriction endonucleases to release and purify the 6463 bp fragment and ligated to the digested and purified 358 bp PCR fragment described above. The resulting plasmid pdHL-7CC49BH was subsequently digested with XmaI and EcoRI restriction endonucleases and two bands were obtained. The smaller band (272
Was 6 bp) was isolated and purified and subsequently ligated to the 6667 bp fragment. The 6667 bp fragment was obtained by digesting pdHL7-CC49K1 with the same restriction endonucleases, then isolating and purifying. The resulting construct pd
The properties of HL7-CC49 were examined by BsrGI and XhoI restriction endonuclease digestion and DNA sequencing.

[0061]   b. Construction of MAb-WW1   To construct the plasmid pWW1, the vector pdHL7-CC49 was hid.
digested with ndIII and PstI restriction endonucleases and flagged with 890 bp
Isolated. The fragment was isolated by agarose gel electrophoresis, followed by
Refined. Replication type (RF) DNA of M13mp18 phage was HindIII
And a large DNA fragment digested with PstI restriction endonuclease
Isolated. Subsequently, the HindIII and PstI sites of M13mp18 DNA
The 890 bp fragment was inserted into to obtain phage M13-W21. Followed by
Regiospecific mutagenesis was performed as listed. Large M13-W21 phage
It was introduced into Escherichia coli CJ236 strain (the E. coli strain isdut， ung The enzyme uracil N-glycan, which is a strain and normally removes uracil from DNA.
Lacking cosylase). This results in the incorporation of uridine into the DNA
. Subsequently, the uridine-containing single-stranded (SS) -DNA of M13-W21 phage was located.
A mutant M13-WW1 was prepared using as a template for site-directed mutagenesis.
It was Oligodeoxynucleotide m120 (5'-GCAGCCTCCCACCA
GGCGCCCATCATGGTC-3 '; SEQ ID NO: 16) was changed position-specifically
Used for induction. Oligonucleotide m120 is a phosphokinase recognition site
RRPS also contains a NarI recognition site. M for oligonucleotide m120
13-WW21 phage was annealed with uridine-containing SS-DNA, followed by phase
In vitro synthesis of complement chain was performed. Then, the resulting double-stranded (DS) -DNA
Escherichia coli DH5αF ′ strain having an active uracil N-glycosylase was transformed,
The parent strand was removed. NarI restriction endonuclease digestion of desired mutant properties
And DNA sequencing. Thus, the construct M13-WW1
was gotten. Subsequently, the M13-WW1 phage RF-DNA was replaced with HindIII.
And the 410 bp flakes obtained by digestion with BstEII restriction endonuclease
Insert the vector into the vector pCC49 digested with the same endonuclease
The plasmid pWW1 was obtained. Vector pWW1 is the heavy chain of MAb-chCC49
Expresses MAb-WW1 with amino acid substitutions K120R and G121R in
.

C. Construction of MAb-WW2 To construct plasmid pWW2, vector pCC49 was digested with HindIII and NaeI restriction endonucleases and a 1424 bp fragment was isolated. The fragment was isolated by agarose gel electrophoresis and subsequently purified. Replicative form (RF) DNA of M13mp19 phage was first digested with XbaI restriction endonuclease, followed by blunting with Klenow fragment of DNA polymerase. The DNA was then digested with the HindIII restriction endonuclease to isolate the large DNA fragment. Then, M13mp19
At the blunt-ended XbaI and HindIII sites of DNA, the above-mentioned 1424 bp
The fragment was inserted to obtain phage M13-W22. Regiospecific mutagenesis was then performed as described. M13-W22 phage was transformed into E. coli CJ23
Mutant M13-WW2 was prepared by introducing into 6 strains and using uridine-containing SS-DNA of M13-W22 phage as a template for site-directed mutagenesis. Oligodeoxynucleotide m221rev (5'-GGGGCATGTG
TGACGTCTGTCACAAGATTTG-3 '; SEQ ID NO: 17) was used for site-directed mutagenesis. Oligonucleotide m221rev contains a phosphokinase recognition site RRHT as well as an AatII recognition site. The uridine-containing SS-D of M13-WW22 phage was labeled with oligonucleotide m221rev.
Annealed with NA, followed by in vitro synthesis of complementary strands. Then, Escherichia coli DH5αF having a functional uracil N-glycosylase in the obtained DS-DNA
Strain 'was transformed and the parent strand was removed. The desired mutants were characterized by AatI restriction endonuclease digestion and DNA sequencing. In this way, the construct M13-WW2 was obtained. Subsequently, RF-DN of M13-WW2 phage
A was digested with SacII restriction endonuclease and the resulting 410 bp fragment was inserted into vector pCC49 digested with the same endonuclease to give plasmid pWW2. Vector pWW2 expresses MAb-WW2 with amino acid substitutions K221R and T222R in the heavy chain of MAb-chCC49. d. Construction of MAb-WW3 To construct plasmid pWW3, vector pCC49 was digested with HindIII and SnaBI restriction endonucleases and a 708 bp fragment was isolated. The fragment was isolated by agarose gel electrophoresis and subsequently purified. Replicative form (RF) DNA of M13mp19 phage was first digested with XbaI restriction endonuclease, followed by blunting with Klenow fragment of DNA polymerase. The DNA was then digested with the HindIII restriction endonuclease to isolate the large DNA fragment. Then, M13mp19
The 708 bp fragment was inserted into the blunt-ended XbaI and HindIII sites of DNA to give phage M13-W23. Regiospecific mutagenesis was then performed as described. Mutant M13-WW3 was prepared by introducing M13-W23 phage into E. coli CJ236 strain and using uridine-containing SS-DNA of M13-W23 phage as a template for site-directed mutagenesis.
Oligodeoxynucleotide m18rev (5'-CCTGGGGGCTTCGC
GAAGGATTTTCCTGCAAGG-3 '; SEQ ID NO: 18) was used for site-directed mutagenesis. The oligonucleotide m18rev contains a phosphokinase recognition site RRIS and also a NruI recognition site. Oligonucleotide m18rev was annealed with uridine-containing SS-DNA of M13-WW23 phage, followed by in vitro synthesis of complementary strand. After that, the obtained DS-DN
Escherichia coli DH5αF ′ strain having a functional uracil N-glycosylase was transformed with A and the parent chain was removed. The desired mutants were characterized by NruI restriction endonuclease digestion and DNA sequencing. In this way, the construct M13-
WW3 was obtained. Then, the RF-DNA of M13-WW3 phage was added to XhoI.
And the HindIII restriction endonuclease and the resulting 420 bp fragment was digested with the same endonuclease intermediate vector pdHL7-
First, it was inserted into BB to obtain the plasmid pCC49t-WW3. Then, the pC
C49t-WW3 was digested with XbaI and HindIII restriction nucleases,
The resulting 2983 bp fragment was isolated. The vector pCC49 was digested with the same endonuclease and the 6440 bp large fragment was isolated. 29
The 83 bp fragment was ligated to this 6440 bp vector fragment, resulting in plasmid pWW3. Vector pWW3 expresses MAb-WW3 with amino acid substitutions V18R and K19R in the heavy chain of MAb-chCC49.

E. Construction of MAb-WW4 To construct plasmid pWW4, vector pCC49 was constructed with XbaI and B.
Digested with amHI restriction endonuclease and isolated the 415 bp fragment. The fragment was isolated by agarose gel electrophoresis and subsequently purified. M1
Replicating form (RF) DNA of 3mp18 phage was digested with XbaI and BamHI restriction endonucleases and the large DNA fragment was isolated. continue,
The 415 bp fragment was inserted into the XbaI and BamHI sites of M13mp18 DNA to obtain phage M13-W24. Subsequently, site-directed mutagenesis was performed as described. Mutant M13-WW4 was prepared by introducing M13-W24 phage into Escherichia coli CJ236 strain and using uridine-containing SS-DNA of M13-W24 phage as a template for site-directed mutagenesis. Oligodeoxynucleotide mL17-2 (5'-GTGTCAGTTGGCCG
GAGGGTTACTTTGAGC-3 '; SEQ ID NO: 19) was used for site-directed mutagenesis. Oligonucleotide mL17-2 contains a phosphokinase recognition site RRVT and also an EaeI recognition site. Oligonucleotide mL
17-2 was annealed with the uridine-containing SS-DNA of M13-WW24 phage, followed by in vitro synthesis of complementary strands. Then, Escherichia coli DH5αF ′ strain having a functional uracil N-glycosylase was transformed with the obtained DS-DNA to remove the parent strand. The desired mutants were characterized by EaeI restriction endonuclease digestion and DNA sequencing. Thus, the construct M13-WW
4 was obtained. Subsequently, the RF-DNA of M13-WW4 phage was digested with XbaI and BamHI restriction endonucleases, and the obtained 410 bp fragment was inserted into vector pCC49 digested with the same endonucleases to obtain plasmid pWW4. Vector pWW4 expresses MAb-WW4 with amino acid substitutions E17R and K18R in the light chain of MAb-chCC49.

F. Construction of MAb-WW5 To construct WW5, mutant M13-WW5 was prepared using SS-DNA of M13-W22 phage as a template for site-directed mutagenesis. Oligodeoxynucleotide m221mlrev (5'-CGGTGGGGCATGA
GTGACGTCTGTCACAAGATTTG-3 '; SEQ ID NO: 20) was used for site-directed mutagenesis. Oligonucleotide m221m1re
v contains a phosphokinase recognition site RRHS as well as an AatII recognition site. Oligonucleotide m221m1rev to SS-containing uridine of M13-WW22
Annealed with DNA and subsequently complementary strands were synthesized in vitro. Then, Escherichia coli DH5αF ′ having a functional uracil N-glycosylase in the obtained DS-DNA
The strain was transformed and the parent strand was removed. The desired mutants were characterized by AatII restriction endonuclease digestion and DNA sequencing. In this way, the construct M13-WW5 was obtained. Then, M13-WW5 RF-DNA was added to Sa
The 410 bp fragment obtained by digesting with the cII restriction endonuclease was
Insertion into the vector pdHL7-CC49 digested with the same endonuclease gave the plasmid pWW5. Vector pWW5 has MAb-WW5 with amino acid substitutions K221R, T222R and T224S in the heavy chain of MAb-chCC49.
Express. g. Construction of MAb-WW6 Plasmid pLgpCXIIHuWW5ΔCH expressing the heavy chain of MAb-WW6
In order to prepare 2, the plasmid pLgpCXIIHuCC49ΔCH2 was cloned into Ap
Digested with aI and XhoI restriction endonucleases, a 340 bp fragment was isolated. The fragment was isolated by agarose gel electrophoresis, purified, and cloned into pBluescript digested with the same restriction endonucleases. The resulting plasmid was subsequently digested with EcoRI and KpnI restriction endonucleases. The smaller DNA fragment was isolated. Then, M13
The 370 bp fragment was inserted into the EcoRI and KpnI sites of mp19DNA to obtain phage M13-huHdCH2. Then, D. 3. b. Site-directed mutagenesis was performed as described in section. Mutant M13-huWW5 was prepared by introducing M13-huHdCH2 phage into Escherichia coli CJ236 strain and using SS-DNA containing uridine of M13-huHdCH2 phage as a template for site-directed mutagenesis. Oligodeoxynucleotide m2
21m1rev (5'-CGGTGGGGCATGGTGACGTCTGTCAC
AAGATTTG-3 '; SEQ ID NO: 21) was used for site-directed mutagenesis. Oligonucleotide m221m1rev has phosphokinase recognition site R
RHS also contains an AatII recognition site. Oligonucleotide m221m1
rev is annealed with SS-DNA containing uridine of M13-huHdCH2,
Subsequently, the complementary strand was synthesized in vitro. Then, Escherichia coli DH5αF ′ strain having a functional uracil N-glycosylase was transformed with the obtained DS-DNA to remove the parent strand. The desired mutants were characterized by AatII restriction endonuclease digestion and DNA sequencing. Thus, the construct M13-huWW5
was gotten. Subsequently, the RF-DNA of M13-huWW5 was treated with ApaI and Xh.
digested with oI restriction endonuclease and the resulting 340 bp fragment was digested with the same endonuclease vector pLgpCXIIHuCC49ΔCH
2 into plasmid pLgpCXIIHuWW5ΔCH2. The vector pLgpCXIIHuWW5ΔCH2 expresses MAb-WW6 with amino acid substitutions K221R, T222R and T224S in the heavy chain of MAb-huCC49. h. Construction of MAb-WW7 Two plasmids pLNCXIIHuCC49HuKV5 and pLgpCXIIHuWW5V for expressing the light and heavy chains of MAb-WW7 respectively.
8ΔCH2 was prepared. To create plasmid pLNCXIIHuCC49HuKV5, plasmid pBScHuCC49V5 was first digested with HindIII and ApaI restriction endonucleases followed by blunting with the Klenow fragment of DNA polymerase to give a 1.1 kb fragment. Another plasmid, pLNCXIIHuCC49HuK, was digested with HindIII restriction endonucleases to blunt end and the resulting 6.5 kb large fragment was isolated. Subsequently, the 1.1 kb fragment was ligated to the 6.5 kb fragment to give the plasmid pLNCXIIHuCC49HuKV5. Plasmid pL
NCXIIHuCC49HuKV5 was characterized by NheI restriction endonuclease digestion and DNA sequencing. To create the plasmid pLgpCXIIHuWW5V8ΔCH2, the plasmid pBScHuCC49V8ΔCH2 was first digested with HindIII and ClaI restriction endonucleases and the resulting 1.1 kb fragment was isolated and purified. Plasmid pLgpCXIIHuWW5ΔCH2 was digested with the same restriction endonucleases. A 6.5 kb fragment was isolated from the two resulting fragments. Subsequently, the 1.1 kb fragment was ligated to the 6.5 kb fragment to obtain the plasmid pLgpCXIIHuCC49V8ΔCH2. Then, the pLgpCXIIHuCC49V8ΔCH2 was digested with ApaI and XhoI restriction endonucleases. The large 7269 bp fragment was isolated. PLgpCXIIHuWW5ΔCH2 was subsequently digested with the same restriction endonucleases to isolate a 340 bp fragment. Finally, the 340bp is 7269bp
Ligation into the fragment gave the plasmid pLgpCXIIHuWW5V8ΔCH2. i. Construction of MAb-WW8 To construct an expression vector for MAb-WW8, two Xh of pWW5 were constructed.
The intermediate vector pWW5t-BB was constructed so that one of the oI restriction sites could be removed. To construct pWW5t-BB, pWW5 was digested with BstEI and Bgl.
Digested with II restriction endonuclease. The obtained 7800 bp fragment was isolated, blunt-ended, and then self-ligated to prepare an intermediate vector pWW5t-BB. Subsequently, the 420 bp fragment was transformed into the plasmid pLgpCXIIHuC by PCR using the following 5'primer and 3'primer, respectively.
Amplified from C49ΔCH2 (5 ′ primer: (5′-kashH-7) C
CCCTCAGGCCACATGGAGTGGTCCTGGGTC (SEQ ID NO: 22); and 3'primer: (3'-KASHh-420) CCCAA
GCTTTTTGGCGCGTGGAGACGGTGACCAG (SEQ ID NO: 2
3)). The PCR fragment was subsequently digested with XhoI and HindIII restriction endonucleases, isolated and purified by agarose gel electrophoresis and subcloned into pWW5t-BB digested with the same restriction endonucleases to generate p
WW5t-huVH-BB was obtained. Then, pWW5t-huVH-BB was added to Ba.
Digested with mHI and XbaI restriction endonucleases, the 7400 bp fragment was isolated. Subsequently, the 400 bp fragment was transformed into plasmid pLNCXIIH by PCR using the following 5'primer and 3'primer, respectively.
Amplified from uCC49HuK (5 'primer: (5'-kashL-11
) CCTCTAGACCACATGGATAGCCAGGCCCAG (SEQ ID NO: 24); and 3'primer: (3'kashL-425) GCCGC
GGCCCGTGGATCCCTTCAGTTCCAGCTT (SEQ ID NO: 25
)). This PCR fragment was subsequently digested with BamHI and XbaI restriction endonucleases, purified and ligated into the 7400 bp fragment to give pWW8.
-BB was obtained. Finally, pWW8-BB was digested with HindIII and XbaI restriction endonucleases to give two fragments. The smaller fragment (3000 bp) was isolated and purified. The plasmid pWW5 was subsequently digested with the same restriction endonucleases. The large fragment (6400 bp) was isolated, purified and ligated to the purified 3000 bp fragment described above. The resulting construct pWW8 was characterized by EaeI restriction endonuclease digestion and DNA sequencing. Vector pWW8 expresses humanized MAb-WW5 with amino acid substitutions K221R, T222R and T224S in the heavy chain of MAb-chCC49.

4. Expression of monoclonal antibody a. MAb-chCC49-6P, MAb-WW1, MAb-WW2, MAb
-Expression of WW3, MAb-WW4 and MAb-WW5 Using electroporation, plasmid pMAb-chCC49-6P.
, PMAb-WW1, -WW2, -WW3, -WW4 and -WW5 were introduced into mouse myeloma NS0 cells. First, 2 × 10 ⁷ cells in 450 μL ice-cold PBS were mixed with 12 μg purified plasmid in an electroporation cuvette. The cells were incubated on ice for 10 minutes. The electroporator was adjusted to the following settings: 950 μF at 0.24 KV. After the cells were electroporated for 30 msec (time constant), the cells were allowed to recover on ice for 10 minutes, and then 30 mL of culture medium (DMEM, 10% fetal bovine serum and 1% was added from the cuvette.
% Glutamine), and then 100 μL of each well was added to a 96-well plate. After 48 hours, the culture medium was sorted into a selective culture medium (DMEM, 1
With 0% fetal bovine serum, 1% glutamine and 0.15 μM methotrexate). The culture medium was exchanged with a selective culture medium every 3 to 4 days until stable transformants were obtained. Expression of mutant proteins in cell culture supernatant was determined by ELISA. The clone with the highest expression of the modified MAb was selected for culture expansion. First, put the cells of the 96-well plate into the 24-well plate,
Subsequently, the flask was gradually expanded to a 150 cm ² flask. 5 in a 150 cm ² flask
× 10 ⁶ cells were grown in 50 mL of culture medium until the culture medium became yellow and most cells died, and then the supernatant was collected.

B. Expression of MAb-WW6 To express MAb-WW6, the plasmids pLNCXIIHuCC49Huk and p were transformed into mouse myeloma NS0 cells using electroporation.
LgpCXIIHuWW5ΔCH2 was introduced. The method was carried out according to the method described in D. 4. It was the same as that described in the section a (
Selection medium: DMEM, 10% fetal bovine serum, 1% glutamine, 700 μg / m
L G418, 1 μg / mL mycophenolic acid, 250 μg / mL xanthine and 15 μg / mL hypoxanthine). After expanding the cells to a 150 cm ² flask, 5 × 10 ⁶ cells were grown in 50 mL of protein-free hybridoma culture PFHM-II (Gibco BRL). Subsequently, the supernatant was collected after most of the cells died.

C. Expression of MAb-WW7 To express MAb-WW7, plasmids pLNCXIIHuCC49HukV5 and pLgpCXIIHuWW5V8ΔCH2 were introduced into mouse myeloma NS0 cells using electroporation. The method was carried out according to the method described in D. 4. The same as described in the section a) (selection medium: DMEM, 10% fetal bovine serum, 1% glutamine, 700).
μg / mL G418, 1 μg / mL mycophenolic acid, 250 μg / mL xanthine and 15 μg / mL hypoxanthine). After expanding the cells to a 150 cm ² flask, 5 × 10 ⁶ cells were grown in 50 mL of protein-free hybridoma culture PFHM-II (Gibco BRL). Subsequently, the supernatant was collected after most of the cells died.

5. Purification of monoclonal antibodies a. MAb-chCC49-6P, MAb-WW1, MAb-WW2, MAb
Purification of -WW3, MAb-WW4 and MAb-WW5 MAb-chCC49-6P, MAb-WW1, -WW2, -WW3, -WW.
Before purifying 4 and -WW5, the supernatant of several sheets of 150 cm ² flasks were pooled. The cell culture supernatant containing the modified MAb was then purified as described with some minor modifications. Briefly, a 1 mL Protein A column was equilibrated with 3 column volumes of Buffer A (3M NaCl, 1M glycine, pH 8.8). Solid NaCl was added to the cell culture supernatant to a concentration of 3M. Subsequently, the pH of the cell supernatant was adjusted to 8.0 with 1 M glycine (pH 8.8). Supernatant(
(About 300 mL) was centrifuged at 7268 xg for 10 minutes. Then, after passing through a 0.2 μm filter unit, the supernatant was loaded onto the protein A column at a flow rate of 1 mL / min. The column was washed with 5 column volumes of buffer A. Then, it was eluted with 2 column volumes of buffer solution B (0.2 M glycine.HCl, pH 2.5). Elute the eluate with 1 mL of buffer C (10 mM boric acid, 2.5 mM borax and 7.5 mM NaC.
1, pH 8.5) (the pH of the neutralized solution was 7.0). The purified MAb was dialyzed against 1000 volumes of PBS overnight at 4 ° C. Subsequently, the dialyzed MAb was concentrated using a Centricon concentrator. The protein concentration of purified MAb was determined by ELISA and the purity of IgG was checked by SDS polyacrylamide gel electrophoresis. Subsequently, the purified MAb was dispensed into 0.5 mL tubes and stored frozen at -20 ° C or lower until use.

B. Purification of MAb-WW6 and MAb-WW7 Since CH2 domain deleted MAbs were unable to bind protein A, MAb-WW6 and MAb were used with Protein G Sepharose (Pharmacia).
b-WW7 was purified. Before purifying MAb-WW6 and MAb-WW7,
Supernatants from several 150 cm ² flasks were pooled. Subsequently, the cell culture supernatant containing the modified MAb was purified. Briefly, a 1 mL protein G column was equilibrated with 3 column volumes of buffer A (3M NaCl, 1M glycine, pH 8.8). Solid NaCl was added to the cell culture supernatant to a concentration of 3M. Subsequently, the pH of the cell supernatant was adjusted to pH 8.0 with 1 M glycine (pH 8.8). Supernatant(
(About 300 mL) was centrifuged at 7268 xg for 10 minutes. Then, after passing through a 0.2 μm filter unit, the supernatant was loaded onto the protein G column at a flow rate of 1 mL / min. The column was washed with 5 column volumes of buffer A. Then, it was eluted with 2 column volumes of 0.1 M glycine.NaOH (pH 10). The eluate was neutralized with 80 μL of NaH ₂ PO ₄ (2M) and adjusted to pH 7.0. 10 of the purified MAb
It was dialyzed against 00 volume of PBS overnight at 4 ° C. Subsequently, the dialyzed MAb was concentrated using a Centricon concentrator. The protein concentration of the purified MAb is E
Determined by LISA and IgG purity checked by SDS polyacrylamide gel electrophoresis. Subsequently, the purified MAb was dispensed into 0.5 mL tubes and stored frozen at -20 ° C or lower until use.

6. MAb-chCC49-6P, MAb-WW1, MAb-WW2, MAb
-WW3, MAb-WW4, MAb-WW5, MAb-WW6 and MAb-W
Each variant of the phosphorylated MAb of W7 was labeled with [γ- ³² P] ATP and cAMP-dependent protein kinase as previously described. 0.5 mCi of [γ- ³² P] ATP and 15 units of the catalytic subunit of bovine cardiac muscle-derived cAMP-dependent protein kinase (6
25 μL of 20 mM Tris-HCl (about 10 μg of MAb at mg / ml DTT).
The reaction was stopped by incubation in 100 mM NaCl and 12 mM MgCl ₂ at pH 7.4) at 30 ° C. for 60 minutes, followed by cooling on ice. 300 with 5 mg / mL bovine serum albumin in 10 mM sodium phosphate, pH 6.7
After addition of μL at 4 ° C., 0.325 mL of reaction mixture was dialyzed against 10 mM sodium phosphate, pH 6.7, overnight at 4 ° C. The dialysis buffer was changed twice. Incorporation of radioactivity into a monoclonal antibody results in trichloroacetic acid (
Pestka, 1972) and then measured with a liquid scintillation spectrometer. The final product in 0.325 mL was adjusted to pH 7.4 with 1 M Tris base to remove any labile ³² P, followed by incubation at 37 ° C. overnight.

7. Determination of [ ³² P] MAb immunoreactivity The direct binding assay was performed as follows. 96-well plates were coated overnight at 4 ° C. with 100 μL of TAG-72 positive bovine mandibular mucin (BSM) or TAG negative porcine mandibular mucin (PSM) at a concentration of 10 μg / mL in PBS. The plate was subsequently blocked with 5% BSA in PBS. The [ ³² P] MAb was serially diluted with 1% BSA in PBS starting at 2 × 10 ⁵ cpm in 100 μL. The plates were incubated overnight at 4 ° C, followed by 4 washes with 1% BSA in PBS. Finally, 150 μL of 0.2 N NaOH was added to each well, followed by collection and placing in scintillation vials. This process was repeated once more with 150 μL 0.2 N NaOH and the above was added to the same scintillation vial and measured.

Direct binding assays were also performed by passing [ ³² P] MAbs through beads coated with either BSM or PSM. BSM was as described (Johnson et al., 19) at a ratio of 2 mg BSA to 1 mL water-filled beads.
86; Kashimiri et al., 1995) immobilized on beads. BSM beads (50 μL water filled volume) were placed in duplicate in 1.5 mL Eppendorf tubes. Then, 2 × 10 ⁵ cpm was added to 1 mL of 1% bovine serum albumin (BSA) in PBS.
2 tubes containing [ ³² P] MAb of 2 were added to each tube. Mix while rotating 2
After incubating at room temperature for an hour, the BSM beads are then placed at 1000 for 5 minutes.
Precipitated at xg. The supernatant was removed by aspiration and discarded. 1 more beads in PBS
The supernatant was washed by aspirating the supernatant 3 times with 1 mL of% BSA after centrifugation as described. The radioactivity remaining in the beads in each tube was measured and the total percentage of [ ³² P] MAbs bound to the BSM beads was calculated as (binding counts) / (total counts loaded) × 100 (where total count is 2 ×). 10 ⁵ cpm was calculated as the binding count represents the count on the beads}.

8. Determination of Stability of ³² P-Labeled MAbs in Serum Stability of ³² P-labeled MAbs was determined as previously described with minor modifications. Briefly, each reaction consisted of 0.5 mL human serum, mouse serum, fetal bovine serum or bovine serum albumin solution (5 mg / mL in PBS), 125 μL Tris-HCl (pH 7.4) and 3 μL [ ³² P. ] MAb (2.4 × 10 ⁶ cpm
) In a total volume of 628 μL, which was incubated at 37 ° C. 20 μL aliquots were taken in duplicate at 24 hours, 5 days or 21 days and the stability of [ ³² P] phosphate bound to MAb was determined by TCA precipitation.

II. Results Construction of chimeric monoclonal antibody capable of phosphorylating MAb-chCC49 Model of MAb-chCC49 As described herein (see also FIG. 4), a three-dimensional model of MAb-chCC49 using the crystal structure of MAb231 as a template. Was built. Manufactured MAb-chC
The C49 model showed overall structural similarity to the MAb231 template molecule. Again, an asymmetric T-shape and an extended hinge region were found in the MAb-chCC49 model (which was consistent with the overall sequence similarity with MAb231 in the model).
However, when the MAb-chCC49 is superposed on the MAb 231 (see FIG.
), Differences in local structure were observed, especially in the CDR regions of the two MAbs. this is,
This is consistent with the difference in the primary sequence of the amino acids of the two molecules in this region.

Overview of the Model of MAb-chCC49 Phosphorylating Chimeric Monoclonal Antibodies and Phosphorylated Modified MAbs The model of MAb-chCC49 phosphorylating chimeric monoclonal antibodies and phosphorylated modified MAbs are: It is shown in FIGS. All of the modified MAb models produced exhibited asymmetric T-shapes and extended hinge regions, as noted above for MAb 231 (FIG. 5). A closer look at the site where we introduced the cAMP-dependent phosphorylation site revealed that almost all amino acid residues essential for phosphorylation were exposed on the surface, which indicates that this site Accessible, suggesting that phosphorylation is promoted. Not surprisingly, when the MAb-chCC49 and the modified MAb were superposed, they showed the same structure in most regions except for the part where the phosphorylation site was introduced into the mutant MAb (Fig. 10). , Where the superposition of models of MAb-WW5 and MAb-chCC49 is shown). The striking structural differences in the skeletal geometry are due to the CDR of MAb-chCC49 or modified MAb.
Not found in the area. This suggests that the modified MAb binding capacity will not be significantly altered after introducing the phosphorylation site into MAb-chCC49. The systematic search results for each kinase recognition site are summarized in Table 1. Several constructs (MAb-chCC49K1, MAb-chCC49KI, MAb-C
C49CKII, MAb-CC49Tyr, MAb-chCC49-6P, MA
For b-WW5, -WW6, -WW7 and -WW8) the bound phosphate groups were more permissive than the bound phosphate groups of the other constructs (MAb-WW1, -WW2, -WW3 and -WW4). It is observed to have a conformation.

A. MAb-chCC49K1 and phosphorylated MAb-chCC49K
Model 1 of MAb-chCC49K1 and phosphorylated model of MAb-chCC49K1 are shown in FIGS. 6A and 8A. It can be seen that the phosphorylation site of MAb-chCC49K1 extends longer than the phosphorylation sites of MAbs-WW1, -WW2, -WW3, -WW4 and -WW5, making the enzyme more accessible.
The phosphate group was replaced with a serine residue (Ser449 at the PKA site of MAb-chCC49K1).
And Ser455) and a systematic conformational search (Table 1) was performed as described herein to determine the conformation of the phosphate group. As shown in Table 1, Ser455 and Ser4 of heavy chains 1 and 2
The search corresponding to 49 yielded 43 and 54 conformations, respectively, which were higher than those of the other mutant MAbs in Table 1, indicating the easier accessibility of the PKA recognition sites at these sites in said MAbs. It is suggested. However, searches corresponding to Ser449 and Ser455 in heavy chains 1 and 2 only yielded 18 and 15 conformations, respectively. However, since the PKA recognition site of MAb-chCC49K1 is located on the flexible C-terminus of the MAb, further searches along the MAb's backbone will reveal more concatenation to the bound phosphate group. It was made possible by conducting a search to check whether the formation is possible. Therefore, we have S along Cφ-Cφ of Ser449.
The same search was performed for Cα-Cβ and Cβ-Oγ of er449 (chain 1). The results are shown in Table 1. This search allowed 655 for bound phosphate groups.
The conformation was obtained, reflecting the flexible nature of the site. Similar results were obtained for the search corresponding to Ser455 (chain 2). We are Ala
Along the Cφ-Cφ of 454, Ser455, and Met456, a search similar to Cα-Cβ and Cβ-Oγ of Ser455 (chain 2) was performed for 22 bound phosphate groups.
We have found that 98 conformations are acceptable.

One of the interesting phenomena that we noticed when performing the first systematic search was that at some sites, the phosphate groups differed from surrounding amino acids in some of the allowed conformations. It had the potential to form hydrogen bonds (Table 1). However, at other sites, the phosphate group had no potential to form hydrogen bonds in any of the allowed conformations. M
For Ab-chCC49K1, one of the four phosphate groups attached to MAb-chCC49K1 is stabilized by hydrogen bonding (Figure 11). The above hydrogen bond was formed with the NH group of Ser449 of the same heavy chain. Taken together, these data revealed that the two heavy chains are not symmetrical and show significant differences in their structure.

B. MAb-chCC49CKI and phosphorylated MAb-chCC49
Model of CKI MAb-chCC49CKI and phosphorylated MAb-chCC49CK
The I model is shown in FIGS. 6B and 8B, respectively. MAb-c
Serine residues at the PKA site of hCC49CKI (Ser450 and Ser457
) And a systematic conformational search (Table 1) was performed as described herein to determine the conformation of the phosphate group. As shown in Table 1, a search corresponding to Ser450 of heavy chain 1 yielded 40 conformations, which is more than that of some other mutant MAbs in Table 1. However, the other three searches yielded 28, 6 and 30 conformations. However, the PKA recognition site of MAb-chCC49CKI is also a MAb.
Since it resides on the flexible C-terminus of A., we performed a further search along the backbone of the MAb to see if more conformations were allowed for the bound phosphate group. It was The results are shown in Table 1. For a search corresponding to Ser457 (Chain 1), we follow Ser457 (Chain 1) along the Cφ-Cψ of Ser457.
Cα-Cβ and Cβ-Oγ were searched. This search yielded 618 acceptable conformations. Similar results were obtained for Ser450 and S
The results obtained for the search corresponding to er457 (chain 2) gave the ratings as shown in Table 1. Before performing an additional conformational search, we also performed a search to determine whether the bound phosphate group had the potential to form hydrogen bonds with surrounding amino acids. Three of the four serine phosphate groups on MAb-chCC49CKI showed the ability (Table 1). Here too, the asymmetry of the antibody structure is evident.

C. MAb-chCC49CKII and phosphorylated MAb-chCC4
Model of 9CKII MAb-chCC49CKII and phosphorylated MAb-chCC49C
Models of KII are shown in Figures 6C and 8C, respectively. MAb with phosphate group
Binding to the serine residue (Ser436) at the PKA site of -chCC49CKII, a systematic conformational search (Table 1) was performed as described herein to determine the conformation of the phosphate group. As shown in Table 1, the two searches yielded 56 and 48 conformations, respectively. We also performed a special search to see if the bound phosphate group had the potential to form hydrogen bonds with surrounding amino acids. MAb-ch CC49CK
One of the two serine phosphate groups on II showed the ability to form hydrogen bonds (Table 1
).

D. MAb-chCC49Tyr and phosphorylated MAb-chCC49
Model of Tyr MAb-chCC49Tyr and phosphorylated MAb-chCC49Ty
Models of r are shown in Figures 6D and 8D, respectively. MAb-c
After binding to the PKA site tyrosine residue (Tyr455) of hCC49Tyr, a systematic conformational search was performed as described herein to determine the conformation of the phosphate group. As shown in Table 1, two searches yielded 60 and 213 conformations, respectively. We performed a special search to see if the bound phosphate group had the potential to form hydrogen bonds with surrounding amino acids. One of the two tyrosine phosphate groups on MAb-chCC49Tyr showed the ability to form hydrogen bonds (Table 1).

E. MAb-chCC49-6P and phosphorylated MAb-chCC49
-6P model MAb-chCC49-6P and phosphorylated MAb-chCC49-6
Models of P are shown in Figures 7A and 9A, respectively. The results of a systematic conformational search are shown in Table 1. Ser470 (chain 1), Ser485
The searches corresponding to (strand 1) and Ser449 (strand 2) yielded about 50 conformations, which are much more than other searches for the same MAb. However, since the PKA recognition site of MAb-chCC49-6P is also present on the flexible C-terminus of MAb, we performed a further search along the main chain of this MAb to find other bound phosphates. On the other hand, it was investigated whether more conformations were allowed. As shown in Table 1, all of the additional searches for MAb-chCC49-6P yielded far more conformations than the first search. We performed a special search to see if the bound phosphate group had the potential to form hydrogen bonds with surrounding amino acids. Seven of the 12 serine phosphate groups on MAb-chCC49-6P showed the ability to form hydrogen bonds (Table 1).

F. Models of MAb-WW1 and Phosphorylated MAb-WW1 Models of MAb-WW1 and phosphorylated MAb-WW1 are shown in FIGS. 7B and 9B. The phosphate group was replaced with a serine residue (S) at the PKA site of MAb-WW1.
er21), a systematic conformational search was performed as described herein to determine the phosphate group conformation. According to the search results, regarding MAb-WW1, there are 13 phosphate groups bound to Ser21 of heavy chain 1.
However, heavy chain 2 was shown to allow only one conformation. However, since the PKA recognition site on MAb-WW1 resides in the CH1 region of the MAb rather than on either of the flexible ends, there is an addition for a bound phosphate group along the backbone of this MAb. Was not possible. We performed a special search to see if the bound phosphate group had the potential to form hydrogen bonds with surrounding amino acids. None of the serine phosphate groups on MAb-WW1 showed the ability to form hydrogen bonds (Table 1).

G. Models for MAb-WW2 and Phosphorylated MAb-WW2 Models for MAb-WW2 and phosphorylated MAb-WW2 are shown in Figures 7C and 9C, respectively. After attaching the phosphate group to the threonine residue (Thr224) at the PKA site of MAb-WW2, a systematic conformational search was performed as described herein. Similar results were obtained after two systematic searches. After two searches, 21 and 13 conformations were revealed.
However, like MAb-WW1, the PKA recognition site of MAb-WW2 is
An additional search for the bound phosphate groups along the backbone of this MAb was not possible because it resides in the hinge region of the MAb rather than at either of the flexible ends. We performed a special search to see if the bound phosphate group had the potential to form hydrogen bonds with surrounding amino acids. Several conformations resulting from both searches showed that the phosphate group had the potential to form hydrogen bonds with the NH group of Thr224 (Table 1, Figure 12A).

H. Models of MAb-WW3 and Phosphorylated MAb-WW3 Models of MAb-WW3 and phosphorylated MAb-WW3 are shown in Figures 7D and 9D, respectively. After attaching the phosphate group to the serine residue (Ser21) at the PKA site of MAb-WW3, a systematic conformational search was performed as described herein. For MAb-WW3, Ser21 (chain 1)
After performing the search corresponding to, 9 conformations were obtained. The potential for hydrogen bond formation was observed (Table 1). Of these conformations, we choose the one with the smallest energy (4127 kcal / mol) (
In this case, the phosphate group can form hydrogen bonds with the hydroxyl group on the side chain of Tyr80 (FIG. 12B)), a conformational search corresponding to Ser21 (chain 2) was performed. The results were similar to those obtained in the previous search. MAb
Like -WW1, the PKA recognition site on MAb-WW3 is present in the variable region of the heavy chain of the MAb rather than on either of the flexible ends, so this M
A search for additional bound phosphate groups along the Ab backbone was not possible.

I. Models for MAb-WW4 and Phosphorylated MAb-WW4 Models for MAb-WW4 and phosphorylated MAb-WW4 are shown in Figures 7E and 9E, respectively. Following attachment of the phosphate group to the threonine residue (Thr17) at the PKA site of MAb-WW4, a systematic conformational search was performed as described herein. For MAb-WW4, the results obtained from the two systematic searches were very similar. Only two conformations were obtained from each search. Similar to MAb-WW1, the PKA recognition site on MAb-WW4 is located on the variable region of the light chain of MAb rather than on either of the flexible ends, so that along the main chain of this MAb. No additional search for bound phosphate groups was possible. No hydrogen bond formation was observed between the phosphate group on MAb-WW4 and any surrounding amino acids after two systematic searches (Table 1).

J. Models of MAb-WW5 and Phosphorylated MAb-WW5 MAb-WW5 and Models of phosphorylated MAb-WW5 are shown in FIGS. 7F and 9.
It is shown in F. The phosphate group was replaced with a serine residue (Se) at the PKA site of MAb-WW5.
After binding to r224), a systematic conformational search was performed as described herein. For MAb-WW5, similar results were obtained after two systematic searches. After the search corresponding to Ser224 (heavy chain 1), 61 conformations were shown. A search corresponding to Ser224 (heavy chain 2) yielded results similar to the previous one, allowing 57 conformations. Analysis of these conformations revealed that the phosphate group on Ser224 of chain 1 was Cys2.
It was shown to have the potential to form hydrogen bonds with the NH groups of either 25 or Ser224 (Table 1, Figure 13A). In contrast, the phosphate group of Ser224 of chain 2 was only able to form hydrogen bonds with Ser224 (Table 1, Figure 13B).

K. Models of MAb-WW6 and Phosphorylated MAb-WW6 MAb-WW6 and Phosphorylated MAb-WW6 are shown in FIGS. 7G and 9.
It is shown in G. The phosphate group was replaced with a serine residue (Se) at the PKA site of MAb-WW6.
After binding to r224), a systematic conformational search was performed as described herein. For MAb-WW6, similar results were obtained after two systematic searches. After the search corresponding to Ser224 (heavy chain 1), 65 conformations were shown. By the search corresponding to Ser224 (heavy chain 2), 54
The conformation of was obtained. Analysis of these conformations showed that the phosphate group of Ser224 of chain 1 had the potential to form hydrogen bonds with the NH groups of either Cys225 or Ser224 (Table 1, FIG. 14A).
). In contrast, the phosphate group of Ser224 of chain 2 was only able to form hydrogen bonds with Cys225 (Table 1, Figure 14B).

L. Models of MAb-WW7 and phosphorylated MAb-WW7 MAb-WW7 and models of phosphorylated MAb-WW7 are shown in FIGS. 7H and 9.
Shown in H. The phosphate group was replaced with a serine residue (Se) at the PKA site of MAb-WW7.
After binding to r224), a systematic conformational search was performed as described herein. For MAb-WW7, similar results were obtained after two systematic searches. 64 conformations were revealed after a search corresponding to Ser224 (heavy chain 1). A search corresponding to Ser224 (heavy chain 2) yielded 56 conformations. Analysis of these conformations showed that the phosphate group of Ser224 of chain 1 had the potential to form hydrogen bonds with the NH groups of either Cys225 or Ser224 (Table 1, Figure 15A). In contrast, the phosphate group of Ser224 of chain 2 was only able to form hydrogen bonds with Cys225 (Table 1, Figure 15B).

M. Models of MAb-WW8 and phosphorylated MAb-WW8 MAb-WW8 and phosphorylated MAb-WW8 are shown in FIGS.
I. The phosphate group was replaced with a serine residue (Se) at the PKA site of MAb-WW8.
After binding to r224), a systematic conformational search was performed as described herein. For MAb-WW8, 62 conformations were revealed after a search corresponding to Ser224 (heavy chain 1). A search corresponding to Ser224 (heavy chain 2) yielded 39 conformations. Analysis of these conformations revealed that the phosphate group on Ser224 of chain 1 was Cys.
It was shown to have the potential to form hydrogen bonds with the NH groups of either 225 or Ser224 (Table 1, Figure 16A). In contrast, the phosphate group of Ser224 of chain 2 was able to form hydrogen bonds with the NH groups of both Arg221 and His223 (Table 1, Figure 16B).

3. Hypothesis Based on the systematic search shown in Table 1, several constructs (MAb-chCC49
K1, MAb-CC49CKI, MAb-CC49CKII, MAb-CC49
In Tyr, MAb-chCC49-6P, MAb-WW5, -WW6, -WW7 and -WW8), the bound phosphate group is the other construct (MAb-WW1, -WW).
2, -WW3 and -WW4) were observed to have much more permissive conformations. We allow more conformations, suggesting that the enzyme can more easily access the recognition site, and therefore we can say that the greater the number of allowed conformations, the more likely the enzyme to recognize the recognition site. It was hypothesized that the accessibility of the is high. According to this hypothesis, we
MAb-chCC49-6P, MAb-WW5, -WW6, -WW7 and -W
W8 is another mutant MAb (MAb-WW1, -WW2, -WW3 and -WW.
Expected to be radiolabeled by PKA with much higher specific activity than 4).

Another phenomenon that we noticed from Table 1 was that the phosphate groups on the modified MAbs have various potentials to form hydrogen bonds with neighboring amino acids. In some constructs (MAbs-WW2, -WW3, -WW5, -WW6, -WW7 and -WW8), all of the bound phosphate groups were able to form hydrogen bonds with surrounding amino acid residues. However, in other constructs, any of the bound phosphate groups
Or, only a small amount of hydrogen bonds could be formed (MAb-chCC49K1).
, MAb-CC49CKI, MAb-CC49CKII, MAb-CC49Ty
r, MAb-chCC49-6P, MAb-WW1 and MAb-WW4). Since the formation of hydrogen bonds physically stabilizes the phosphate moiety, we hypothesized that the greater the potential for hydrogen bonding, the more resistant the phosphate group to hydrolysis. That is, the stronger the potential to form hydrogen bonds, the more stable the bound ³² P. In other words, if the bound phosphate group is unable to form hydrogen bonds with nearby amino acids, the stability of the bound phosphate group is compromised. According to this hypothesis, MAb-WW2, -WW3, -WW5, -WW6, -WW7.
And stability of the phosphate group of -WW8 is shown by MAb-chCC49K1, MAb-C
C49CKI, MAb-CC49CKII, MAb-CC49Tyr, MAb-
It will be higher than that of chCC49-6P, MAb-WW1 and MAb-WW4.

4. MAb-chCC49-6P, MAb-WW1, MAb-WW2, MAb
-WW3, MAb-WW4, MAb-WW5, MAb-WW6, MAb-WW7
And construction of MAb-WW8 a. Construction of MAb-chCC49-6P Plasmid pdHL7-CC49-6 expressing MAb-chCC49-6P.
P (FIG. 17) was constructed by cloning two synthetic fragments K2 (FIG. 3) at the XmaI site of the expression vector pdHL7-CC49K1. Construction details are described herein. b. Construction of MAb-WW1 The plasmid pWW1 expressing MAb-WW1 was constructed as shown in FIGS. 18A and B. Construction details are described herein. c. Construction of MAb-WW2 The plasmid pWW2 expressing MAb-WW2 was constructed as shown in Figures 19A and B. Construction details are described herein.

D. Construction of MAb-WW3 Plasmid pWW3 expressing MAb-WW3 was constructed as shown in Figures 20A, B and C. Construction details are described herein. e. Construction of MAb-WW4 Plasmid pWW4 expressing MAb-WW4 was constructed as shown in Figures 21A and B. Construction details are described herein. f. Construction of MAb-WW5 Plasmid pWW5 expressing MAb-WW5 was constructed as shown in Figures 22A and B. Construction details are described herein.

G. Construction of MAb-WW6 Plasmid pLgpCXIIHuWW5 expressing the heavy chain of MAb-WW6 was constructed as shown in Figures 23A and B. Construction details are described herein. h. Construction of MAb-WW7 Plasmid pLNCXIIHuCC49Hu expressing the light chain of MAb-WW7.
KV5 was constructed as shown in FIG. 24, and a plasmid pLgpCXIIHuWW5V8ΔCH2 expressing the heavy chain of MAb-WW7 was constructed as shown in FIG. Construction details are described herein. i. Construction of MAb-WW8 Plasmid pWW8 expressing humanized MAb-WW5 was constructed as shown in Figures 26A, B, C and D. Construction details are described herein.

5. Expression and purification of monoclonal antibodies a. Expression and Purification of MAb-chCC49-6P Stable transfection of mouse myeloma NS0 cells with the expression vector pMAb-chCC49-6P was performed as described herein. The concentration of IgG produced by the highest expressing clone was sandwich EL
It was about 2 μg / mL when measured by ISA. The mutant MAb secreted in 90 mL of supernatant was purified and concentrated as described herein. The final concentration of purified MAb was 0.9 mg / mL as measured by ELISA.

B. MAb-WW1 Expression and Purification Stable transfection of mouse myeloma NS0 cells with the expression vector pMAb-WW1 was performed as described herein. The concentration of IgG produced by the clone with the highest expression was approximately 40 μg / mL as measured by sandwich ELISA. Mutant M secreted in 500 mL of supernatant
Ab was purified and concentrated as described herein. The final concentration of purified MAb was 5.3 mg / mL as measured by ELISA. c. MAb-WW2 Expression and Purification Stable transfection of mouse myeloma NS0 cells with the expression vector pMAb-WW2 was performed as described herein. The concentration of IgG produced by the clone with the highest expression was approximately 18 μg / mL as measured by sandwich ELISA. Mutant M secreted in 150 mL of supernatant
Ab was purified and concentrated as described herein. The final concentration of purified MAb was 4.5 mg / mL as measured by ELISA.

D. Expression of MAb-WW3 and purification Stable transfection of mouse myeloma NS0 cells with the expression vector pMAb-WW3 was performed as described herein. The concentration of IgG produced by the clone with the highest expression was approximately 22 μg / mL as measured by sandwich ELISA. Mutant M secreted in 430 mL of supernatant
Ab was purified and concentrated as described herein. The final concentration of purified MAb was 0.9 mg / mL as measured by ELISA. e. MAb-WW4 Expression and Purification Stable transfection of mouse myeloma NS0 cells with the expression vector pMAb-WW4 was performed as described herein. The concentration of IgG produced by the clone with the highest expression was approximately 7 μg / mL as measured by sandwich ELISA. Mutant MA secreted in 290 mL of supernatant
b was purified and concentrated as described herein. The final concentration of purified MAb is
It was 35.2 mg / mL when measured by ELISA.

F. Expression of MAb-WW5 and purification Stable transfection of mouse myeloma NS0 cells with the expression vector pMAb-WW5 was performed as described herein. Clone # 24 (which has the highest concentration of IgG (as determined by sandwich ELISA
10 μg / mL) was selected for culture expansion and collection of supernatant. MA
Prior to purification of b-WW5, supernatants from 6 150 cm ² flasks were pooled. Purification of MAb-WW5 was performed as described herein. Purified MAb-
The concentration of WW5 was 3.3 mg / mL as measured by ELISA. Subsequently, a 10 μL aliquot of the purified MAb-WW5 was dispensed into a 0.5 mL tube and stored frozen at −20 ° C. until use.

G. Expression and purification of MAb-WW6 Expression vectors pLNCXIIHuCC49HuK and pLgpCXIIHuW
Stable transfection of mouse myeloma NS0 cells with W5ΔCH2 was performed as described herein. Clone # 24, which expressed the highest concentration of IgG (2 μg / mL) as measured by sandwich ELISA, was selected for culture expansion and supernatant collection. Prior to purification of MAb-WW6, supernatants from three 150 cm ² flasks were pooled. MAb-WW6
Purification was carried out as described herein. The concentration of purified MAb-WW6 was E
It was 3.0 mg / mL when measured by LISA. Then, purified MAb-WW
A 10 μL aliquot of 6 was dispensed into 0.5 mL tubes and stored frozen at −20 ° C. until use.

H. Expression and purification of MAb-WW7 Expression vectors pLNCXIIHuCC49HuKV5 and pLgpCXIIH
Stable transfection of mouse myeloma NS0 cells with uWW5V8ΔCH2 was performed as described herein. Clone # 14 (this has the highest concentration of IgG (8 μg /
mL) was selected for culture expansion and supernatant collection. MAb-WW7
Prior to purification, the supernatants from three 150 cm ² flasks were pooled. MAb
-Purification of WW7 was performed as described herein. The concentration of purified MAb-WW7 was 2.0 mg / mL as measured by ELISA. Then, refined MA
Dispense a 10 μL aliquot of b-WW7 into a 0.5 mL tube and store at -20 ° C until use.
It was frozen and stored in.

6. MAb-chCC49-6P, MAb-WW1, MAb-WW2, MAb
-WW3, MAb-WW4, MAb-WW5, MAb-WW6 and MAb-W
Characterization of W7 and ³² P-labeled MAbs Purified modified MAbs were subjected to SDS polyacrylamide gel electrophoresis (SDS-PA).
GE). Two bands, 1 in the presence of mercaptoethanol
50kDa (MAb-chCC49-6P, MAb-WW1, -WW2,-)
WW3, -WW4 and -WW5), or 40 kDa (MAb-WW6)
And MAb-WW7) and the other, 25 kDa was observed on Coomassie Brilliant Blue stained gels (Fig. 27A-H). These bands are modified MAbs
Of heavy chain and light chain, respectively. These modified MAbs, MAb-chCC4
9-6P, MAb-WW1, -WW2, -WW3, -WW4, -WW5, -WW
6 and -WW7 by [γ- ³² P] ATP by cAMP-dependent protein kinase
Respectively phosphorylated to the following radioactivity specific activities: 11126 Ci / mmol,
49 Ci / mmol, 35 Ci / mmol, 30 Ci / mmol, 7 Ci / mm
ol, 2895 Ci / mmol, 2380 Ci / mmol and 2837 Ci /
mmol. After reduction with 2-mercaptoethanol and subsequent SDS-PAGE, [ ³² P] MAb-chCC49-6P, [ ³² P] MAb-WW5, [ ³² P] MAb-WW6 and [ ³² P] MAb-. WW7 was found to migrate as a strong single band (corresponding to the position of the heavy chain of the MAb on gels stained with Coomassie blue) at either the 50 kDa or 25 kDa position as shown by autoradiography. . However, MAb-WW1, -WW2, -W
W3 and -WW4 were barely labeled when compared to MAb-chCC49-6P, -WW5, -WW6 and -WW7. This means that P
The radioactivity specific activities of KA-phosphorylated MAbs-chCC49-6P, -WW5, -WW6 and -WW7 are higher than those of other mutant MAbs by the serine or threonine at the protein kinase recognition site. It will be much higher due to the smaller number of potential conformations available to A. We substantiated our predictions in section 3 (results page 96). Furthermore, MAb-WW1,
Autoradiographs oversensitized for -WW2, -WW3 and -WW4 showed that the major labeled band was PKA, not the MAb.

7. [ ³² P] MAb-ch CC49-6P, [ ³² P] MAb-WW5, [ ³² P
] MAb-WW6 and [ ³² P] MAb-WW7 immunoreactivity measurements a. [ ³² P] MAb-chCC49-6P immunoreactivity determination [ ³² P] MAb-chCC49-6P immunoreactivity was determined by direct binding assay (Table 2). The binding results with BSM coated plates for [ ³² P] MAb-chCC49-6P were 66%. Nonspecific binding measured on PSM coated plates was less than 1%. The binding results with BSM coated beads for [ ³² P] MAb-chCC49-6P were 95%. Nonspecific binding measured with PSM coated beads was 4%. b. [ ³² P] MAb-WW5 immunoreactivity determination [ ³² P] MAb-WW5 had a binding result of 68 using BSM coated plates.
% (Table 2). Nonspecific binding measured on PSM coated plates was less than 1%. The binding result with BSM coated beads for [ ³² P] MAb-WW5 was 94%. Nonspecific binding measured with PSM coated beads was 4%.

C. [ ³² P] MAb-WW6 immunoreactivity determination [ ³² P] MAb-WW6 immunoreactivity was determined by direct binding assay (
Table 2). The binding result using BSM coated plates for [ ³² P] MAb-WW6 was 68%. Nonspecific binding measured on PSM coated plates was less than 1%. The binding results using BSM coated beads for [ ³² P] MAb-WW6 are 9
It was 5%. Nonspecific binding measured with PSM coated beads was 3%. d. [ ³² P] MAb-WW7 immunoreactivity determination [ ³² P] MAb-WW7 immunoreactivity was determined by direct binding assay (
Table 2). The binding result with BSM coated plates for [ ³² P] MAb-WW7 was 68%. Nonspecific binding measured on PSM coated plates was less than 1%. The binding result with BSM coated beads for [ ³² P] MAb-WW7 was 95%. Non-specific binding measured with PSM coated beads was 2%.

8. [ ³² P] MAb-ch CC49-6P, [ ³² P] MAb-WW5, [ ³² P]
MAb-WW6 and ^[32 P] measured in the stability in serum of ^{MAb-WW7 [32 P] MAb} -chCC49-6P, [32 P] MAb-WW5, [32 P] MA
The stability of b-WW6 and [ ³² P] MAb-WW7 in serum was measured. The stability of the other mutants (MAbs-WW1, -WW2, -WW3 and -WW4) was unmeasurable as none of these MAbs could be phosphorylated with high specific activity. The result of the poor phosphorylation of the MAb is the P
The KA was substantially radiolabeled (FIGS. 27B-E), so that the stability assays of these reactions were largely reflective of the stability of the labeled PKA.

A. Determination of stability of [ ³² P] MAb-chCC49-6P in serum The percentage of [ ³² P] phosphate groups remaining on [ ³² P] MAb-chCC49-6P indicates the radioactivity at various time points. Determined by comparison to initial radioactivity values in buffer and various sera (Table 3 and Figure 28). It is observed that after incubation for 24 hours in buffer, fetal bovine serum, human and mouse serum, approximately 91-93% of the phosphate groups remain stably bound to the MAb. b. Determination of the stability of [ ³² P] MAb-WW5 in serum The percentage of [ ³² P] phosphate groups remaining on [ ³² P] MAb-WW5 was determined by measuring the radioactivity at the beginning of [ ³² P] MAb. It was determined by comparing with the radioactivity value of. It was shown that after incubation for 24 hours in buffer, fetal bovine serum, human and mouse serum, at least 99% of the phosphate groups remained stably bound to the MAb (Table 4, Figure 29). More than 95% of the radioactivity remained bound to the MAb even after 5 days incubation in the above buffer and serum (Table 4, Figure 30). We also measured when [ ³² P] MAb-WW5 was incubated in buffer for 21 days. After 21 days at 37 ° C more than 93% of the radioactivity remained bound to the MAb (Table 5, Figure 31). This means that the stability of the phosphate group on MAb-WW5 is determined by MAb-chCC49K
1, MAb-chCC49CKI, MAb-chCC49CKII, MAb-c
The term A. hCC49Tyr and that which would be higher than that on MAb-chCC49-6P. Consistent with our prediction of 3 (results page 96).

C. ^[32 P] of MAb-WW6 remaining on MAb measurement various points stability in serum ^[32 P] The percentage of radioactivity, it ^[32 P] of the first radioactivity MAb Determined by comparison with the value. It was shown that after incubation for 24 hours in buffer, fetal bovine serum, human and mouse serum, at least 99% of the phosphate groups remained stably bound to the MAb (Table 6, Figure 32). More than 95% of the radioactivity remained bound to the MAb even after 5 days incubation in the above buffer and serum (Table 6, Figure 33). We also measured when [ ³² P] MAb-WW6 was incubated in buffer for 21 days. After 21 days at 37 ° C, 94% or more of the radioactivity was MAb
Remained bound to (Table 5, Figure 34).

D. ^[32 P] of MAb-WW7 remaining on MAb measurement various points stability in serum ^[32 P] The percentage of radioactivity, it ^[32 P] of the first radioactivity MAb Determined by comparison with the value. After incubation in buffer, fetal calf serum, human and mouse serum for 24 hours, it was shown that at least 99% of the phosphate groups remained stably bound to the MAb (Table 7, Figure 35). More than 95% of the radioactivity remained bound to the MAb even after 5 days incubation in the above buffer and serum (Table 7, Figure 36). We also measured when [ ³² P] MAb-WW7 was incubated in buffer for 21 days. After 21 days at 37 ° C, 93% or more of the radioactivity was MAb
Remained bound to (Table 5, Figure 37).

III. Design and construction ³² P monoclonal antibody which can be phosphorylated in a highly stable phosphoric acid groups supported by the discussion molecule models produced Useful radioactive for radioactivity immunotherapy with ideal several properties Though considered an isotope, its utility for labeling MAbs was limited due to the lack of simple labeling methods available. However, this problem has already been overcome and labeling methods have been developed that have proven simple, efficient and applicable to virtually any protein. MA that can be phosphorylated
b (MAb-chB72.3-P, MAb-chCC49K1, MAb-chC
C49CKI, MAb-chCC49CKII and MAb-chCC49Ty
r) by inserting the predicted consensus sequence for phosphorylation by cAMP-dependent protein kinases and other protein kinases at the carboxyl terminus of the heavy chain constant region of MAb-chB72.3-P or MAb-chCC49. did. These MAbs could be purified and phosphorylated with [γ- ³² P] ATP at high specific activity by the appropriate protein kinase. these[
The γ- ³² P] MAb bound with high specificity to cells expressing the TAG-72 antigen.

However, for first generation phosphorylatable antibodies, the bound ³² P was not sufficiently stable in buffers or serum useful for in vivo applications in animals and humans. Several methods have been proposed to improve the stability of MAbs that can be phosphorylated. Since RRX (S / T) is a PKA recognition site, by changing amino acid residue X or an amino acid residue downstream from this site,
It was thought that the stability of MAbs capable of phosphorylation could be altered. Furthermore, it was believed that the use of threonine instead of serine at the PKA recognition site could enhance the stability of MAbs that can be phosphorylated (although this method dramatically compromises the efficiency of phosphorylation. Will). Alternatively, a MAb that can be phosphorylated using other phosphatases
The stability of may also be variable. With this in mind, molecular modeling was used to determine the location of the phosphorylation site of MAb-chCC49 that is resistant to hydrolysis. Since molecular modeling is a powerful tool for predicting the three-dimensional structure of proteins, it can be used to accurately predict the selection of optimal positions for protein kinase recognition sites and to improve the stability of bound phosphate groups. Improved.

1. Design of monoclonal antibodies capable of phosphorylation at highly stable phosphate groups assisted by molecular modeling a. Site Selection for Introduction into MAb-chCC49 Sites were selected using the following criteria to introduce a cAMP-dependent protein kinase recognition site. (1) Since the consensus sequence for cAMP-dependent protein kinase is Arg-Arg-X-Ser / Thr, the site with the maximum number of these four residues was examined to minimize the structural alteration of the original MAb. Selected to be. (2) A site in the complementarity determining region (CDR) was avoided. MAb-ch CC49
CDR regions of E. coli have been elucidated. This region is the variable region of the MAb that binds antigen, and therefore any modification of these sites may alter the binding affinity or specificity of the MAb. (3) The site selected will be one accessible to protein kinases. The selection is made according to MAb-chCC49
Was achieved by visual analysis of the three-dimensional molecular structure of.

By following the first criterion, the complete MAb-c for the introduction of the PKA site
Twelve sites were found within the hCC49 molecule. Evaluation of the three-dimensional model of these hypothetical mutant Abs suggested that not all of these sites were good for site-directed mutagenesis (Table 8). First, MAb-chCC4
Analysis of 9 models revealed 4 out of 12 possible sites (sites 5, 6, 8 and 9).
) Was buried. Furthermore, the introduction of arginine residues at these sites is
It was shown by molecular modeling that it would bring significant steric problems to the structure of the Ab-chCC49 molecule (Table 8). Therefore, these sites were excluded from further study. The remaining sites were examined and the site mutations were detected as described above in the MAb.
It was observed whether it would not change the CDR region of chCC49. Part 1
1 shows that all four amino acid residues in the PKA recognition site have MAb-chCC49
It was excluded because it exists in the CDR2 region of the light chain of. Mutations in some amino acid residues (eg Cys320 at site 6 and Pro117 at site 12) were also avoided as these residues may play an essential role in maintaining the proper structure of the MAb. . Promising mutants that did not show obvious problems as described above were finally selected for further work.

B. Selection of Template for Modeling MAb-chCC49 Prior to creating the model of MAb-chCC49, there was a question as to which structure could be used as template. While the structure of the intact MAb has been a subject of great interest for many years, it has been extremely difficult to obtain the crystalline structure of the intact antibody due to the intrinsic mobility and segmental flexibility of the antibody. Have difficulty. So far, the crystal structures of only two complete MAbs have been solved. One is MAb2
31 (mouse IgG2a MAb against canine lymphoma). On the other hand, the other
MAb 61.1.3 (murine IgG1 MAb against phenobarbital). Since one site chosen for introducing the mutation was within the hinge region of the MAb, it was decided to use the crystal structure of the complete MAb as a template. Evaluation of the crystal structures of these two complete MAbs revealed the relative positions of the Fab, hinge and Fc regions. In addition, both exhibit global asymmetry, which may indicate that the degree of intrinsic mobility and segmental flexibility of the antibody is significant.

Nevertheless, the other structural features of the two MAbs were very different. I
gG1 has a distorted but compact Y-shape, while IgG2a has a more elongated T-shape. This difference may strongly reflect the difference in amino acid residues in their hinge region. The IgG2a hinge, which has 23 amino acids, is 6 amino acids longer (3 in the upper hinge region and 3 in the lower hinge region) than the IgG1 hinge. GCG Package (Wisconsin Package Version 10, Ge
Overall sequence comparisons performed with the Bestfit program of the netics Computer Group (GCG), Madison, Wisc) show that IgG1 is more stable than IgG2a in MAb-c.
It was shown to have a little higher sequence identity with hCC49. These results show that: MAb 61.1.3 (IgG1) and MAb-chCC49 light chain sequences share 65% identity and 72% similarity, while MAb 231.
(IgG2a) and that of MAb-chCC49 have 63% identity and 70%
They share similarities and, in addition, the heavy chain sequences of IgG1 and MAb-chCC49 are 6
It shows 4% identity and 74% similarity, while IgG2a and MAb-c.
hCC49 shows 60% identity and 68% similarity.

However, when the comparison was performed using the hinge region sequence, MAb-chC
The hinge of C49 was found to be more similar to that of MAb231 in both length and amino acid sequence than that of MAb 61.1.3 (FIG. 38).
). Like MAb231, MAb-chCC49 also has a long hinge (M
It has one less amino acid than that of Ab231), which means that
It suggests that it may exhibit an elongated structure similar to b231. MA
b231 and MAb-chCC49 also share substantial sequence identity (about 90%) in both the core and lower hinge regions. On the other hand, MAb-chCC49 and MAb 61.1.3 do not resemble each other in the above region. MAb-chC
MAb 61.1.3 has a much shorter hinge compared to C49. Sequence alignments also showed that they have very low homology in the region. Since two of the mutant MAbs are likely to have a phosphorylation site in the hinge region, in order to model the complete MAb-chCC49 molecule,
It was decided to continue using MAb 231 as a template.

C. Molecular Modeling Protocol We developed a protocol to construct a model of modified MAbs. Since the phosphate group is a large group, structural distortions can result from the binding of MAbs to serine or threonine residues. In order to confirm this possibility, after constructing a model of the mutant MAb, the serine or threonine residue at the PKA recognition site of the MAb was bound to the phosphate group. In addition, after coupling the phosphate group, a systematic conformational search was performed to analyze all possible conformations of the MAb. The results showed that the introduction of the phosphate group would not significantly change the structure of the mutant MAb.

2. Construction of monoclonal antibodies capable of phosphorylation at highly stable phosphate groups a. In vitro experiments Since the goal was to make stable radiolabeled MAbs for use in vivo, the stability properties of phosphorylated MAbs were investigated. Some of the modified MAbs (MAb-WW5, MAb-WW6 and MAb-WW7) showed excellent stability in the investigated serum and buffer. Compared to [ ³² P] MAb-chCC49K1 and [ ³² P] MAb-chCC49-6P (the former, after incubation for 24 hours in buffer and various sera, about 93 to 96% of the phosphate groups were M.
Remained stable bound to Ab), [ ³² P] MAb-WW5, [ ³² P] MA
The stability of the phosphate groups of b-WW6 and [ ³² P] MAb-WW7 showed a marked improvement (Figure 39). [ ³² P] MAb-ch CC49K1 and [ ³² P] MAb-c
Over 99% of the phosphate groups MAb-WW5, MAb-WW6 and MAb-WW7 after 24 h incubation in the same buffer or serum as hCC49-6P.
Remained stable, while the phosphate group was significantly hydrolyzed from [ ³² P] MAb-chCC49K1 (in the latter case, the protein kinase recognition site was fused to the C-terminus). Even after 21 days of incubation in buffer or serum, MAb-bound radioactivity was still present at> 93%. Therefore, these new constructs, phosphoserine (Ser224), are highly resistant to hydrolysis.

B. In vivo experiments Both [ ³² P] MAb-WW5 and [ ³² P] MAb-chCC49K1 MAbs.
In vivo experiments (clearance in blood (FIG. 40) and biodistribution (Table 9)) were performed. As shown in FIG. 38, 9 of [ ³² P] MAb-chCC49K1
Over 0% was removed from blood in 6 hours, but at the same time [ ³² P] MAb-WW5
Only 70% was removed from the blood. The above data is [ ³² P] MAb-WW
5 demonstrated significantly improved stability in the blood clearance assay over [ ³² P] MAb-chCC49K1. [ ³² P] MAb-WW5 also showed improved tumor localization compared to [ ³² P] MAb-chCC49K1. At all time points, [ ³² P] MAb-WW5
It was accumulated in the tumor in significantly higher amounts than in all other organs. The amount of [ ³² P] MAb-chCC49K1 accumulated in the tumor was not significantly higher than that in other organs. [ ³² P] MAb-WW5 is [ ¹²⁵ I] MAb-c
It even showed comparable, if not better, tumor localization than hCC49 and [ ¹³¹ I] MAb-chCC49 (the latter already entering Phase II clinical trials in breast cancer patients). In Table 8, at 24 hours, about but twice the ^{[12 5} I] MAb-chCC49 and ^[131 I] MAb-chCC49 has accumulated in the spleen from the tumor, ^[32 P] and the ratio for MAb-WW5 Has been shown to be the opposite. These in vivo experiments showed that MAb-WW5 has high potential for use in the diagnosis and treatment of adenocarcinoma.

3. Hypothesis regarding the relationship between model, stability of phosphate group on MAb, and phosphorylation efficiency of phosphorylation site MAb capable of phosphorylating with bound phosphate group and phosphorylation without it Two interesting phenomena were observed after making a model of MAb capable of First, several constructs (MAb-chCC49K1, MAb-CC
49CKI, MAb-CC49CKII, MAb-CC49Tyr, MAb-c
The bound phosphate groups of hCC49-6P, MAb-WW5, MAb-WW6 and MAb-WW7) are associated with several other mutant MAbs (MAb-WW1, -WW2,-).
It had much more acceptable conformations than WW3 and -WW4). Therefore, it was hypothesized that the higher the number of allowed conformations, the easier the enzyme would access the recognition site and the higher the phosphorylation efficiency of MAb. According to this hypothesis, MAb-chCC49-6P, MAb-
WW5, MAb-WW6 and MAb-WW7 are other mutant MAbs (MAb-MAb-
PK with much higher specific activity than WW1, -WW2, -WW3 and -WW4)
Expected to be radiolabeled by A. This prediction was confirmed by the phosphorylation assay of modified MAbs. MAb-chCC49-6P, MAb-W
Radioactivity specific activity 1112 of W5, MAb-WW6 and MAb-WW7, respectively.
6 Ci / mmol, 2895 Ci / mmol, 2380 Ci / mmol and 2
837 Ci / mmol was phosphorylated by PKA with [γ- ³² P] ATP. However, the mutants MAb, MAb-WW1, -WW2, -WW3 and -WW4.
Are radioactivity specific activities of 49 Ci / mmol and 35 Ci / mm depending on PKA, respectively.
It was only phosphorylated below ol, 30 Ci / mmol and 7 Ci / mmol.

Second, the phosphate groups on the engineered modified MAbs had varying potential to form hydrogen bonds with neighboring amino acid residues. Some constructs (MAb-W
In W2, -WW3, -WW5, -WW6 and -WW7) (Table 1), all of the bound phosphate groups were able to form hydrogen bonds with neighboring amino acid residues. However, other constructs (MAb-WW1, MAb-WW4, MAb-chCC49K
1, MAb-CC49CKI, MAb-CC49CKII, MAb-CC49T
yr and MAb-chCC49-6P) were able to form hydrogen bonds with either or only few of the bound phosphate groups. The formation of hydrogen bonds is
It was hypothesized that hydrogen bonds could serve as a surrogate marker for the region where the phosphate group is hydrolyzed, as it limits the extent to which the phosphate moieties can interact with surrounding residues. I was Like the other factors, the hydrogen bond itself should make the phosphate residue more susceptible to hydrolysis.

However, as a surrogate marker for the protected region, the higher the potential for hydrogen bond formation, the stronger the resistance of the phosphate group to hydrolysis. That is, the stability of the bound phosphate group is enhanced if the phosphate group is protected from attack by the hydroxyl group by surrounding residues, for example by charge interactions or a hydrophobic environment. According to this hypothesis, MAb-WW2, -WW3, -WW5, -W
The stability of the phosphate groups on W6 and -WW7 was determined by MAb-WW1, MAb-WW4.
, MAb-chCC49K1, MAb-CC49CKI, MAb-CC49CK
II, higher than that on MAb-CC49Tyr and MAb-chCC49-6P. This prediction suggests that the stability of phosphorylated MAbs-WW5, -WW6 and -WW7 is shown by MAb-chCC49K1, MAb-CC49CKI, Mb.
Ab-CC49CKII, MAb-CC49Tyr and MAb-chCC49
Confirmed by comparison with that of -6P. [ ³² P] MAb-WW5, [ ³² P] MAb-WW6 and [ ³² P] MAb-WW7 were very stable in all sera and buffers examined. The above hypothesis is based on other mutant MAbs (MAb-WW1, MAb-WW2, MAb-
WW3 and MAb-WW4) could not be investigated because neither of these MAbs could strongly phosphorylate. In these cases, the phosphorylation of MAb was low and PKA was substantially radiolabeled.

Another lineage evidence supporting the above hypothesis was a study on the structure of PKA. PKA attaches an endogenous phosphate group to the enzymes Thr197 and Ser338 (Figure 41). The phosphate groups on Thr197 and Ser338 form 6 and 4 hydrogen bonds, respectively (FIGS. 42 and 43). Recognition motif RTW
Both Thr197 and Ser338, which contain T and RVS respectively, are not readily phosphorylated. They are highly stable as the phosphate groups remain attached after extensive purification of the protein and during the complete crystallization process. Such phosphate group recognition sites present inside the protein would not be convenient for efficient labeling of MAbs. Therefore, to label the MAbs, we carefully searched for sites that were easily accessible by the enzyme but still had sufficient opportunity for hydrogen bonds to be present within the protected region. Another option is to spread the protein,
This could be a useful strategy if it could be subsequently phosphorylated and then refolded. However, this would not be practical for MAbs or other proteins. MAb-WW5, -WW6 and -WW
Together with our data describing the stability of the phosphate group on 7, Thr197
The above data, which describes the stability of the phosphate group of Ser338 and Ser338, defines the range of protected regions where the hydrogen-bonding interactions of the phosphate groups with surrounding amino acids contribute to the stability of the phosphate group bound to the protein. Support the hypothesis. 4. Summary These results indicate that molecular modeling can be used efficiently to design phosphorylation sites with optimal properties, enable superior phosphorylation, and minimize phosphate group hydrolysis. Is shown. Such monoclonal antibodies should prove very useful in the diagnosis and treatment of cancer.

IV. Summary of Conclusions Radiolabeled monoclonal antibodies against tumor associated antigen (TAA) are used clinically for cancer detection, staging and treatment. In order to develop a more efficient radiolabeled monoclonal antibody, the recognition site for the cAMP-dependent protein kinase was modified by MAb-chCC by position-directed mutation to the coding sequence.
49. Positioning of regions suitable for the introduction of cAMP-dependent phosphorylation sites using molecular modeling to construct variants of MAb-chCC49 without altering their immunoreactivity or biological properties, The range of the site where the bound phosphate group is particularly stable and the enzyme can easily access the phosphorylation site was specified. Four sites on the heavy chain and one site on the light chain were selected. A vector expressing the mutant MAb was constructed and transfected into mouse myeloma NS0 cells expressing high levels of the production mutant MAb. Some of the mutant MAbs (MAb-WW
5, MAb-WW6 and MAb-WW7; these are cAM in the hinge region of the heavy chain.
P-dependent phosphorylation site) was able to be phosphorylated with high specific activity by [γ- ³² P] ATP by the catalytic subunit of the cAMP-dependent protein kinase, and the phosphate group was stabilized. Hold. MAb compared to MAb-chCC49K1 (another variant of MAb-chCC49 capable of phosphorylation)
Phosphate groups attached to -WW5, -WW6 and -WW7 showed much improved stability (about 10-fold increase in resistance to hydrolysis). This means that in vitro
And proved in both in vivo experiments. MAb-WW5, -WW6 and -W
W7 showed high binding specificity for the TAG-72 antigen.

Models of mutant monoclonal antibodies with or without a bound phosphate group show that phosphate group resistance to hydrolysis correlates with the potential for hydrogen-bonding interactions at phosphorylated serine or threonine sites. It was shown to have sex. The higher the potential for hydrogen bond formation, the higher the stability of the phosphate groups on the phosphorylated monoclonal antibody due to the environment surrounding said phosphate groups. Furthermore, the more conformation allowed for the bound phosphate group on the MAb, the easier it is for the enzyme to access the PKA recognition site, increasing the efficiency of radiolabeling the MAb with PKA. These general theories establish that phosphorylation sites on MAbs and proteins that can radiolabel monoclonal antibodies and other proteins with high specific activity, and that the bound phosphate groups are resistant to hydrolysis. Provide the basis for doing. Monoclonal antibodies labeled at such sites with [ ³² P] phosphate groups would be excellent candidates for the treatment of various malignant diseases.

Example 2 Example 2 aims at comparing the stability of genetically engineered phosphorylated monoclonal antibodies with phosphorylation sites. I. Materials and Methods In this experiment, SYBYL molecular modeling package (version 6.5; Tripos Association, St. Louis, MO, 1999) for structural analysis and geometric refinement.
It was used. Most of the homologous model generation and the mutant model generation were performed using the LOOK3.5 program (Molecular Application Group, Palo Alto, CA). For geometrical optimization, Kolman united charges, molecular mechanics force fields and SYBYL's MAXIMIN2 minimizer were used. All of these visualization analyzes and simulations were performed on a Silicon Graphics Octane workstation.

1. Template The complete MAb 231 crystal structure was used as a template for the modeling of MAb-chCC49. These coordinates are now available as ID1IGT from the Polypeptide Data Bank (PDB). M
Since the crystal structure of Ab231 was previously the only one available as a complete antibody, MAb231 was used as a template for model building in this experiment. further,
After the crystal structure of MAb 61.1.3 was reported, the length and sequence of the hinge region of MAb 231 was found to be more similar to that of MAb-chCC49 than that of MAb 61.1.3. . Then, the obtained MAb-chC
A model of the MAb-chCC49 mutant was prepared using the model of C49 as a template.

2. Mab-chCC49 Modeling General Method: The MAb-chCC49 model was constructed using the homology modeling module of the LOOK3.5 program. After obtaining the IgG2a MAb231 coordination, the MAb231 structure was used as a template to generate MAb-chCC49.
Has developed a molecular model of. First, the four strands of MAb 231 are individually separated,
They have been designated L1, L2, H1, and H2 (L for light chain and H for heavy chain). The coordination of each chain was extracted and stored separately. The procedure used for model building of MAb-chCC49 was to perform homologous model building separately for each chain of MAb-chCC49. First, the three-dimensional structure of the chain L1 of MAb231 is displayed, and subsequently the sequence of the light chain of MAb-chCC49 is introduced into the program,
An automatic alignment mode was activated and alignment of the MAb-chCC49 light chain sequence was performed using the alignment of the MAb 231 light chain sequence. The model was constructed and completely refined under an automated method using the program module SEGMOD. The coordination of chain L1 of MAb-chCC49 was then created and saved as a PDB file. The model and coordination of chains L2, H1 and H2 of MAb-chCC49 were made in the same way as described above.

Geometrical refinement and energy minimization: Using SYBYL molecular modeling software,
Further geometric refinement and optimization was performed. The three-dimensional structure of chain L1 of MAb-chCC49, whose coordination was made as above, was displayed. Essential hydrogen atoms (hydrogen atoms bonded to nitrogen, oxygen and / or sulfur atoms potentially required for hydrogen bonding with surrounding atoms / residues) were added. In the first step, the side chains were scanned to minimize conformational constraints within the side chain groups and surrounding residues, if any. Proline is the only residue that contains a ring in its backbone and has a phi angle close to 70 °. Therefore, SYBYL
The "fix proline" command was used to maintain the geometry of proline. As
The orientation of the amide groups of n and Gln was scanned for favoring hydrogen bonding with surrounding residues. Finally, Coleman's coalescing charge was loaded on chain L1 so that the energy calculations could include the electrostatic contribution. The three-dimensional structure of chains L2, H1, H2 was geometrically refined and further optimized by the same method used for chain L1. Subsequently, refined models of chains L1, L2, H1 and H2 of MAb-chCC49 were combined into a single molecule. After that, the side chains are changed to Asn and G
It was fixed in the same manner as the amide group of In to relax the tension in the synthetic molecule. Since MAb-chCC49 is a large polypeptide, the energy minimization process was divided into two parts. Side chain minimization was first performed prior to energy minimization of the complete molecule. The scaffold was used by making it one aggregate set.
Then, the energy minimization of the side chain is performed by Coleman's coalescence force field option
n united force field option) was repeated 100 times. In the next step, the aggregates were removed and the energy minimization of the complete molecule was performed by the Powell method in the SYBYL program.

3. Selection of site for introduction into MAb-chCC49 The site for introduction of the cAMP-dependent polypeptide kinase recognition site was selected so as to have some properties. It should not be within the CDR regions of the MAb; the introduction of a kinase recognition site should not require changes greater than 3 amino acids; said site would be accessible to the polypeptide kinase. This was accomplished by the above program as detailed in the "Results" section.

4. Modeling of Mutant MAb and Mutant [ ³² P] MAb This method was similar to modeling of MAb-chCC49. Briefly, a homology model was created by using each strand of the mutant MAb as the template with the corresponding strand of MAb-chCC49. Geometric refinement and optimization of the modeled MAbs and energy minimization were performed in the same way to obtain MAb-chC
I got a refined model of C49. After obtaining the model of the mutant MAb, a phosphate group was prepared, and by using the "builder" module of the SYBYL model preparation package, the Ser /
It was attached to the hydroxyl group of Thr. In the case of WW1, the phosphate group is Ser123
In the case of WW2 to Thr224; in the case of WW3 to Ser21;
In the case of WW4, it was bound to Thr20. In order to obtain an optimal position and also to make a favorable interaction with the surrounding residues of the phosphate moiety, Ser of the PKA recognition site
A systematic conformational search was performed along CC and CC of / Thr. The conformation of the Ser / Thr side chain in which the phosphate group component is stabilized through hydrogen bonds was chosen. The minimized subset (only 4 amino acid residues in the PKA recognition site, RRXS / T were selected) was then performed 100 times by the method of Powell.

5. Construction of mutant polypeptide expression vector Expression vector pdHL7 for phosphorylating monoclonal antibody (MAb-chCC49K1) having two cAMP kinase recognition sites in each heavy chain
-CC49K1 was modified as follows to construct a site-specific mutation, and MAb-
Phosphorylation sites were introduced at various sites on CC49. To construct an expression vector for MAb-chCC49 without a phosphokinase recognition site, first of all,
The intermediate vector pdHL7-BH was created so that one of the two XhoI restriction sites of pdHL7-CC49K1 could be removed. To construct pdHL7-BH, the vector pdHL7-CC49K1 was constructed with BamHI and Hind.
Digested with III restriction endonuclease. The resulting 685 bp fragment was isolated by agarose gel electrophoresis and subsequently purified to create blunt ends and self-ligate to produce the intermediate vector pdHL7-BH. To construct pdHL7-CC49, the pdHL7-CC49K1 to 358 bp fragment was transformed into
Amplified by PCR using'and 3'primers: 5'primer, G
TGACCGCTGTACCAACCTCTGTCC (SEQ ID NO: 26); and 3'primer, CCCTCGAGTCA-CTTGCCCGGGGACA
GGGAGAGG (SEQ ID NO: 27). Subsequently, this PCR fragment was added to B
Digested with srGI and XhoI restriction endonucleases and purified. The vector pdHL7-BH was digested with the same restriction endonucleases to release the 6463 bp fragment, purified and ligated with the digested and purified 358 bp PCR fragment described above. The resulting plasmid, pdHL-CC49BH, was subsequently digested with XmaI and EcoRI restriction endonucleases to give two bands. The smaller band (which was 2726 bp) was isolated and purified and subsequently further ligated to the 6667 fragment. The 6667 fragment is pdHL7-CC
49K1 was isolated and purified after digestion with the same restriction endonuclease. The resulting construct pdHL7-CC49 was characterized by BsrGI and XhoI restriction endonuclease digestion and DNA sequencing.

To construct the plasmid pWW1, the vector pdHL7-CC49 was cloned into Hi.
Digested with ndIII and PstI restriction endonucleases, the 890 bp fragment was isolated. The fragment was isolated by agarose gel electrophoresis and subsequently purified. The replication type (RF) DNA of the phage M13mp18 was HindII
The large DNA fragment was isolated by digestion with I and PstI restriction endonucleases. Subsequently, the 890 bp fragment was Hind of M13mp18 DNA.
Insertion at the III and PstI sites gave the plasmid pM13-W21. Regiospecific mutagenesis was then performed as described. Simply put, pM13-
It was introduced into the W21 E. coli CJ236 strain (the E. coli strain is a dut , ung strain and normally lacks the enzyme uracil N-glycosylase that removes uracil from DNA). This results in the incorporation of uridine into the DNA. Then, M
Mutant M13-WW1 was prepared using the uridine-containing single-stranded (SS) -DNA of 13-W21 phage as a template for site-directed mutagenesis. Oligodeoxynucleotide m120 (5'-GCAGCCTCCCACCAGGGCGCC
CA-TCGGTC-3 '; SEQ ID NO: 28) was used for site-directed mutagenesis. Oligonucleotide m120 contains a phosphokinase recognition site RRPS as well as a NarI recognition site. Oligonucleotide m120 to M13-WW
21 uridine-containing SS-DNA was annealed, followed by in vitro synthesis of complementary strand. Then, Escherichia coli DH5F ′ strain having a functional uracil N-glycosylase was transformed with the obtained double-stranded (DS) -DNA to remove the parent strand. The desired mutants were characterized by NarI restriction endonuclease digestion and DNA sequencing. In this way, the construct M13-WW1 was obtained. continue,
The RF-DNA of M13-WW1 was digested with HindIII and BstEII restriction endonucleases and the resulting 410 bp fragment was inserted into vector pCC49 digested with the same endonucleases to give plasmid pWW1. Vector pWW1 expresses MAb-WW1 with amino acid substitutions K120R and G121R in the heavy chain of MAb-chCC49.

To construct the plasmid pWW2, the vector pCC49 was added to HindIII.
And digested with NaeI restriction endonuclease to isolate the 1424 bp fragment. The fragment was isolated by agarose gel electrophoresis and subsequently purified. Replicative form (RF) DNA of M13mp19 phage was first digested with XbaI restriction endonuclease, followed by blunting with Klenow fragment of DNA polymerase. The DNA was then further digested with HindIII restriction endonuclease to isolate the large DNA fragment. Then, M13
The blunt-ended XbaI site and HindIII site of mp19DNA were
The 24 bp fragment was inserted to obtain phage M13-W22. Regiospecific mutagenesis was then performed as described. Simply put, M13-W22
The phage was introduced into the Escherichia coli CJ236 strain (the E. coli strain is a dut , ung strain, and normally lacks the enzyme uracil N-glycosylase that removes uracil from DNA). This results in the incorporation of uridine into the DNA. Subsequently, mutant M13-WW2 was prepared using the uridine-containing single-stranded (SS) -DNA of M13-W22 phage as a template for site-directed mutagenesis. Oligodeoxynucleotide m221rev (5'-GGGGCATGTTGGACG
TCTGTCACAAGATTTG-3 '; SEQ ID NO: 29) was used for site-directed mutagenesis. Oligonucleotide m221rev contains a phosphokinase recognition site RRHT as well as an AatII recognition site. The oligonucleotide m221rev was annealed with the uridine-containing SS-DNA of M13-WW22, followed by in vitro synthesis of the complementary strand. Then, the obtained double-stranded (DS)-
E. coli strain DH5F ', which has a functional uracil N-glycosylase, was transformed with DNA to remove the parent strand. The desired mutant was characterized by AatI restriction endonuclease digestion and DNA sequencing. In this way, the construct M13-WW2 was obtained. Subsequently, SacI was added to the RF-DNA of M13-WW2.
The 410 bp fragment obtained by digestion with the I restriction endonuclease was inserted into the vector pCC49 digested with the same endonuclease to obtain the plasmid pWW.
Got 2. The vector pWW2 contains the amino acid substitution K in the heavy chain of MAb-chCC49.
It expresses MAb-WW2 with 221R and T222R.

To construct the plasmid pWW3, the vector pCC49 was added to HindIII.
And a SnaBI restriction endonuclease to digest the 708 bp fragment. The fragment was isolated by agarose gel electrophoresis and subsequently purified. Replicative form (RF) DNA of M13mp19 phage was first digested with XbaI restriction endonuclease, followed by blunting with Klenow fragment of DNA polymerase. The DNA was then further digested with HindIII restriction endonuclease to isolate the large DNA fragment. Then, M13
708b at the blunt-ended XbaI and HindIII sites of mp19 DNA
The p fragment was inserted to obtain phage M13-W23. Regiospecific mutagenesis was then performed as described. Briefly, M13-W23 was introduced into E. coli CJ236 strain (the E. coli strain is a dut , ung strain and normally lacks the enzyme uracil N-glycosylase, which removes uracil from DNA). This results in the incorporation of uridine into the DNA. Mutant M13-WW3 was prepared using the uridine-containing single-stranded (SS) -DNA of M13-W23 phage as a template for site-directed mutagenesis. Oligodeoxynucleotide m18rev (5'-CCTGGGGGCTTCGCGAAGGATTTTCCTG
CAAGG-3 '; SEQ ID NO: 30) was used for site-directed mutagenesis. The oligonucleotide m18rev contains a phosphokinase recognition site RRIS as well as a NruI recognition site. Oligonucleotide m18rev to M13-WW
23 phage was annealed with uridine-containing SS-DNA, followed by in v
Itro synthesis was performed. Then, Escherichia coli DH5F ′ strain having a functional uracil N-glycosylase was transformed with the obtained double-stranded (DS) -DNA to remove the parent strand. Characterization of the desired mutants by NruI restriction endonuclease digestion and DNA
Checked by sequencing. In this way, the construct M13-WW3 was obtained.
Subsequently, the M13-WW3 RF-DNA was digested with XhoI and HindIII restriction endonucleases and the resulting 420 bp fragment was digested with the same endonucleases as the intermediate vector pCC49t-BglII-BstEII.
First, the plasmid pCC49t-WW3 was obtained. Then, the pCC4
9t-WW3 was digested with XbaI and HindIII restriction nucleases and the resulting 2983 bp fragment was isolated. The vector pCC49 was digested with the same endonuclease and the 6440 bp large fragment was isolated. 2983
The bp fragment was ligated to this 6440 bp vector fragment resulting in plasmid pWW3. Vector pWW3 expresses MAb-WW3 with amino acid substitutions V18R and K19R in the heavy chain of MAb-chCC49.

To construct plasmid pWW4, vector pCC49 was digested with XbaI and BamHI restriction endonucleases and a 415 bp fragment was isolated. The fragment was isolated by agarose gel electrophoresis and subsequently purified. M
The replicative form (RF) DNA of 13mp18 phage was digested with XbaI and BamHI restriction endonucleases and the large DNA fragment was isolated. Then, the 415 bp fragment was inserted into the XbaI and BamHI sites of M13mp18 DNA to obtain phage M13-W24. Subsequently, site-directed mutagenesis was performed as described. Briefly, M13-W24 was transformed into E. coli CJ23
6 strains are introduced (the E. coli strains are dut and ung strains, and normally lack the enzyme uracil N-glycosylase, which removes uracil from DNA). This results in the incorporation of uridine into the DNA. Subsequently, mutant M13-WW4 was prepared using the uridine-containing single-stranded (SS) -DNA of M13-W24 phage as a template for site-directed mutagenesis. Oligodeoxynucleotide m
L17-2 (5'-GTGTCAGTTGGCCGGAGGGGTTACTTTG
AGC-3 '; SEQ ID NO: 31) was used for site-directed mutagenesis.
Oligonucleotide mL17-2 contains a phosphokinase recognition site RRVT and also an EaeI recognition site. Oligonucleotide mL17-2 to M13-WW24
Of SS-DNA containing uridine, followed by in vitro synthesis of complementary strand. Then, Escherichia coli DH5F ′ strain having a functional uracil N-glycosylase was transformed with the obtained double-stranded (DS) -DNA to remove the parent strand. The desired mutants were characterized by EaeI restriction endonuclease digestion and DNA sequencing. In this way, the construct M13-WW4 was obtained. Then, M1
The RF-DNA of 3-WW4 was digested with XbaI and BamHI restriction endonucleases and the resulting 410 bp fragment was inserted into vector pCC49 digested with the same endonucleases to give plasmid pWW4. Vector pWW
4 expresses MAb-WW4 with amino acid substitutions E17R and K18R in the light chain of MAb-chCC49.

6. Plasmid pWW1-pWW4 was introduced into mouse myeloma NS0 cells using expression electroporation of mutant Mabs. First, 2 × 10 ⁷ in 450 μL ice-cold PBS.
Cells were mixed with 12 μg of purified plasmid in an electroporation cuvette. The cells were incubated on ice for 10 minutes. The electroporator was adjusted to the following settings: 950 μF at 0.24 KV. After the cells were electroporated for 30 msec (time constant), the cells were allowed to recover on ice for 10 minutes, followed by 30 mL of culture medium (DMEM, 10% fetal bovine serum and 1%) from the cuvette.
(Containing glutamine), then 1 in each well in a 96-well plate
It was distributed by 00 μL. After 48 hours, the culture solution was added to the selection culture solution (DMEM, 10
% Fetal bovine serum, containing 1% glutamine and 0.15 μM methotrexate). The culture medium was exchanged with a selective culture medium every 3 to 4 days until stable transformants were obtained. Expression of mutant polypeptides in cell culture supernatant was determined by ELISA. Clones showing the highest expression of the mutant polypeptide were selected and grown in flasks, and the supernatants were collected from these clones.

7. Purification of Mutant MAbs Cell culture supernatant containing mutant MAbs was purified as described with some minor modifications. Briefly, a 1 mL Polypeptide A column was equilibrated with 3 column volumes of Buffer A (3M NaCl, 1M Glycine, pH 8.8). Solid NaCl was added to the cell culture supernatant to a concentration of 3M. Subsequently, the pH of the cell supernatant was adjusted to 8.0 with 1 M glycine (pH 8.8). Supernatant(
(About 300 mL) was centrifuged at 7268 xg for 10 minutes. Then, after passing through a 0.2 μm filter unit, the supernatant was loaded onto the polypeptide A column at a flow rate of 1 mL / min. The column was washed with 5 column volumes of buffer A. Then the column was eluted with 2 column volumes of buffer B (0.2 M glycine.HCl, pH 2.5). The eluate was neutralized with 1 mL of buffer C (10 mM boric acid, 25 mM borax and 75 mM NaCl, pH 8.5). The purified MAb was dialyzed against 1000 volumes of PBS overnight at 4 ° C. IgG polypeptide concentration was determined by ELISA,
The purity of IgG was checked by SDS polyacrylamide gel electrophoresis. Purified MAb was stored in a liquid nitrogen freezer until use.

8. Phosphorylation of mutant MAbs Mutant MAbs were labeled with [γ- ³² P] ATP and cAMP-dependent polypeptide kinase as previously described. Approximately 10 μg of MAb with 0.5 mCi of [γ- ³² P] ATP and 15 units of catalytic subunit of bovine cardiac muscle-derived cAMP-dependent polypeptide kinase (6 mg / ml DTT) in 25 μL of 20 mM Tris-
3 in hydrochloric acid (pH 7.4), 100 mM NaCl and 12 mM MgCl _2.
The reaction was stopped by incubating at 0 ° C. for 60 minutes, followed by cooling on ice. 10m
After adding 300 μL containing 5 mg / mL bovine serum albumin in M sodium phosphate, pH 6.7 at 4 ° C., 0.325 mL reaction mixture was added overnight to 10 mM sodium pyrophosphate, pH 6.7. It was dialyzed at 4 ° C. 2 for dialysis buffer
Exchanged twice. Incorporation of radioactivity into monoclonal antibodies was measured by liquid scintillation spectroscopy after precipitating the polypeptide with trichloroacetic acid (Pestka, 1972). The final product in 0.325 mL was adjusted to pH 7.4 with 1 M Tris base to remove any labile ³² P, followed by incubation at 37 ° C. overnight.

9. Determination of Stability of Mutant [ ³² P] MAb in Serum The stability of ³² P-labeled mutant MAb was determined as previously described with minor changes. Briefly, each reaction contained 0.25 mL of bovine serum albumin (
PBS contained 5 mg / mL), 62.5 μL of 1 M Tris-HCl (pH 7.4) and 10 μL of [ ³² P] MAb (2.4 × 10 ⁶ cpm) in a total volume of 322.5 μL at 37 ° C. Incubated. 2 sets of 20 over 24 hours
A μL portion was collected and the stability of [ ³² P] phosphate bound to MAb was measured by TCA precipitation.

II. Result 1. Model of MAb-chCC49 As described in the section "Materials and Methods", a three-dimensional model of MAb-chCC49 was constructed using the crystal structure of MAb231 as a template. MAb-chC produced
The C49 model showed overall structural similarity with the MAb231 template molecule. Again, asymmetric T-shaped and extended hinge regions were found in the MAb-chCC49 model (which was consistent with the model's overall sequence similarity to MAb231). However, when either MAb-chCC49 was overlaid on MAb231, structural differences in the overall molecule could be seen, especially in the CDR regions of the two MAbs. This results from the sequence difference of the two molecules in this region.

2. Site Selection After creating a model of MAb-chCC49, the next step was to select a site on MAb-chCC49 that could create an optimal phosphorylation site. The criteria used were as follows. Since the consensus sequence for cAMP-dependent polypeptide kinase is Arg-Arg-X-Ser / Thr, the site with the greatest number of these four residues was examined to minimize structural alterations of the native MAb. Selected to. Second, sites within the complementarity determining regions (CDRs) were avoided. The CDR regions are the variable regions of the MAbs that bind antigen, and therefore any modification of these sites can alter the binding affinity or specificity of the MAbs. By following these criteria, the positions of 12 sites were determined, 9 on the heavy chain and 3 on the light chain. Further evaluation of these sites resulted in four sites (3
One on the heavy chain and one on the light chain).

The first site chosen to incorporate the phosphorylation site began at amino acid residue 120 in the heavy chain CH1 region. The mutations to be introduced here were K120R and G121R. Together with P122 and S123, these four amino acid residues are the type RR recognized by the cAMP-dependent polypeptide kinase.
XS was formed. This variant is designated WW1. The second site begins at amino acid residue 221 in the hinge region of the heavy chain. Required mutations are K221R and T2
Together with H223 and T225, which were 22R, these four amino acid residues would also be phosphorylation sites. This variant is designated WW2. The third site was V18R, K18R, I20 and S21, which was located on the variable region of the heavy chain. The fourth site was on the variable region of the light chain. The site is
It will have the patterns E17R, K18R, V19 and T20.

3. Variant MAb Models The generated variant MAb models all showed asymmetric T-shapes and extended hinge regions as noted above for MAb 231. A close examination of the site where the cAMP-dependent phosphorylation site was introduced reveals that almost all amino acid residues essential for phosphorylation are exposed on the surface, and this site is easy for phosphorylation. It is suggested that it will have accessibility. Not surprisingly, when MAb-chCC49 and mutant MAb were superposed, they showed the same structure in most of the regions except for the region where the phosphorylation site was introduced into the mutant MAb. Both CDRs of MAb-chCC49 and mutant MAb
There were no significant structural differences in the area. This suggested that the binding ability of the mutant MAb would not be significantly changed after introducing the phosphorylation site in the hinge region.

According to the modeling data obtained to date, the low energy and hydrogen bond-forming potential of phosphorylated polypeptides may contribute to the stability of the phosphate group bound to the polypeptide in a limited region. I hypothesized that there is sex. Thus, the lower the energy, the greater the potential to form hydrogen bonds with surrounding amino acid residues and the phosphate groups are more stably bound by the polypeptide.
According to this hypothesis, the stability of the mutant MAb Phosphorylated expected as ^{follows: [32 P] MAb-WW2} = [32 P] MAb-WW3> [32 P] MAb
^{-WW4> [32 P] MAb-} WW1.

4. Systematic Search and Model of Mutant [ ³² P] MAbs After attaching a phosphate group to the Ser or Thr residue at the PKA site of each mutant MAb, an initial systematic conformational search (Table 1) was performed. , The conformation of the phosphate group was determined. The search result is Ser2 for MAb-WW1.
The phosphate group attached to 1 has been shown to have an allowed conformation of about 13.
However, the energy of these conformations is about 1.1 × 10 ⁵ kc
al / mol, the other mutant MAb (its energy is about 3400 kcal / m
It is much higher than the energy of ol) (Table 1). The conformation with the lowest energy was selected and a second systematic search for other phosphate groups attached to the MAb was performed. This gives only one conformation, though the energy is lower than that obtained from the initial search (
7.7 × 10 4 kcal / mol), yet much higher than the energies of the other mutant MAbs. This conformation of MAb-WW1 was selected for further energy minimization.

For MAb-WW2, similar results were obtained after two systematic searches. A much higher number of 61 conformations than the same index for the other mutant MAbs in Table 1 were shown, suggesting the accessibility of the PKA recognition site for this MAb. The energy range was 3904-3906 kcal / mol. Interestingly, some conformations from both searches show that the phosphate group is
It has been shown to have the potential to form hydrogen bonds with the SH group of Cys225 or the NH group of Thr224. Therefore, after the first systematic search, the conformation with the lowest energy (its phosphate group capable of forming hydrogen bonds with the SH group of Cys225) was selected and a second systematic search was performed. . The results were similar to those obtained in the first search. The conformation with the lowest energy obtained from the second search was selected and further energy minimization was performed.

For MAb-WW3, 9 conformations were obtained after the first systematic search with an energy range of 4127-4129 kcal / mol. Furthermore, the potential for hydrogen bond formation was observed (Table 1). The one with the lowest energy (4127 kcal / mol) from these conformations (
The phosphate group was selected to be capable of forming hydrogen bonds with the hydroxyl group on the side chain of Tyr80) and a second conformational search was performed. The results were similar to those obtained on the first search. The conformation with the lowest energy obtained from the second systematic search was selected and further energy minimization was performed.

For MAb-WW4, the results obtained from the two systematic searches were very similar. Only two conformations were obtained from each search. However, unlike MAb-WW1 (which only allowed a few high energy conformations after phosphate binding), the energy of phosphorylated MAb-WW4 was extremely low at 3778 kcal / mol. No hydrogen bond formation was observed between MAb-WW4 and any surrounding amino acid residues. Again, the conformation with the lowest energy was selected from this second systematic search to perform further energy minimization.

According to the modeling data we have obtained so far, the low energy and hydrogen bond-forming potential of phosphorylated polypeptides may contribute to the stability of the phosphate groups attached to the polypeptide. I made a hypothesis. The lower the energy, and the stronger the potential to form hydrogen bonds with surrounding amino acid residues, the more stable the phosphate group attached to the polypeptide is considered. According to this hypothesis, the stability of the mutant MAb Phosphorylated is expected that it would be as ^{follows: [32 P] MAb-WW2} = [32 P] MAb-WW3> [32 P] MA
b-WW4> [ ³² P] MAb-WW1.

5. Expression and Purification of Mutant MAbs Expression vectors pMAb-WW1-pM as described in the "Materials and Methods" section.
Stable transfection of mouse myeloma NS0 cells was performed with Ab-WW4. The concentration of IgG produced by the clone with the highest expression was
Approximately 30 μg / mL as measured by sandwich ELISA. The mutant MAb secreted in the supernatant was purified and concentrated as described in the "Materials and Methods" section. The final concentration of purified MAb was measured by ELISA.

6. Characterization of mutant MAb and mutant [ ³² P] MAb Purified MAbs were analyzed by SDS polyacrylamide gel electrophoresis. In the presence of mercaptoethanol, two bands (one with 50 kDa and the other with 25 kDa)
Da) was observed in the gel stained with Coomassie Brilliant Blue. They are,
Matched to the heavy and light chains of the MAb, respectively. The mutant MAb is [γ- ³² P] A.
Radioactivity specific activity 500Ci by cAMP-dependent polypeptide kinase using TP
Phosphorylated at / mmol. After reduction with 2-mercaptoethanol, the phosphorylated mutant MAb migrated as a single band at 50 kDa shown by autoradiography, which is consistent with the position of the heavy chain on Coomassie Brilliant Blue stained gel. This result was consistent with the fact that there is a phosphorylation site on the heavy chain of the mutant MAb.

7. Stability Assays Stability assays of these mutant MAbs were performed in buffer (5 mg / mL B in PBS).
SA). The percentage of ³² P radioactivity remaining in the MAb at various time points was determined by comparison with the initial value of [ ³² P] MAb. After incubation for 24 hours in buffer, approximately 93%, 99%, 98% and 97% of the phosphate groups were MAb-WW1, MAb-WW2, MAb-WW3 and MAb-W.
It remained stably bound to W4. This is because the stability of the phosphate group against hydrolysis is [ ³² P] MAb-WW2 = [ ³² P] MAb-WW3> [ ³² P] MAb-W.
We confirmed our expectation that W4> [ ³² P] MAb-WW1. That is, the lower the energy, and the stronger the potential to form hydrogen bonds, the more stable the binding ³² P was on the MAb due to the protective environment around the phosphate groups.

III. Discussion ³² P has long been considered to be the ideal radioisotope in radioimmunotherapy, but its use was limited for two reasons. First, there was no easy labeling method available for all polypeptides. This problem was solved when a labeling method was developed that proved to be simple, efficient and even applicable to virtually all polypeptides. The second problem is that bound ³² P was not stable when the labeled polypeptide was incubated in buffer. Mabs that can be phosphorylated
Several methods have been proposed to improve the stability of. However, these attempts have not reported satisfactory results. This report addresses this issue from a different perspective. First, instead of randomly selecting sites, molecular modeling was used to determine the sites into which PKA recognition sites could be introduced. "result"
Three sites on the heavy chain and one site on the light chain were selected by following the criteria set out in the section. Subsequently, a protocol was developed to build a model for the mutant MAb. Since the phosphate group is a very large group, attaching a phosphate group to the Ser / Thr residue of the MAb may cause structural distortion. To establish this possibility, after constructing a model of the mutant MAb, the PK of this MAb
A phosphate group was introduced into the Ser / Thr residue at the A recognition site. Furthermore, a conformational search was carried out to investigate which conformation the MAb adopts after binding the phosphate group. The above results showed that the phosphate group would not change significantly the structure of the mutant MAb in this case.

There were two interesting phenomena. First, after the addition of the phosphate group, the complete intramolecular energy becomes very high for some of the constructs (MAb-WW1),
On the other hand, for the other constructs, the energy was very low (MAb-WW2,
MAb-WW3, MAb-WW4). Second, the phosphate groups on some constructs have the potential to form hydrogen bonds with adjacent amino acid residues (MAb-WW2
, MAb-WW3), while the phosphate groups on the other constructs did not have said potency (MAb-WW1, MAb-WW4). Since both of these two factors (energy and hydrogen bond formation potential) can influence the interaction of molecules, the energy and hydrogen bond formation potential is reflected in the stability of [ ³² P] MAbs. I made the hypothesis that That is, the lower the energy,
The stronger the potential to form hydrogen bonds, the more stable the bond ³² P is on the MAb. According to this hypothesis, the stability of the mutant MAb is expected as ^{follows: [32 P] MAb-WW2} = [32 P] MAb-WW3> [32 P] MAb-
WW4> [ ³² P] MAb-WW1. This expectation is that the mutant [ ³² P] M in BSA is
Confirmed by Ab stability assay. Although the correctness of this hypothesis requires further testing, this study has presented a novel method to analyze the biochemical properties of polypeptides by using molecular modeling.

It is noteworthy that before we modeled the MAb-chCC49, the question arose which structure could be used as template. Although the structure of intact MAbs has been a very serious problem until now due to the inherent mobility and segmental flexibility of antibodies, obtaining a complete antibody crystal structure is extremely difficult. So far, only two crystal structures of the complete MAb have been solved. 1
One is MAb 231 (mouse IgG2a MAb against canine lymphoma cells), the other MAb 61.1.3 (murine IgG1M against phenobarbital).
Ab). Since one site where the mutation was introduced is in the hinge region of the MAb, it was decided to use the complete MAb crystal structure as a template. Evaluation of the crystal structures of these two complete MAbs revealed the relative positions of the Fab, hinge and Fc regions. Moreover, both showed gross asymmetry, which may indicate that the degree of intrinsic mobility and segmental flexibility of the antibody is significant.

The other structural features of the two MAbs were quite different. IgG1 has a distorted but compact Y-shape, while IgG2a has a more elongated T-shape.
This difference may well reflect the difference in their hinge regions. The IgG2a hinge, which has 23 amino acids, is 6 amino acids longer than the IgG1 hinge, three of which are in the upper hinge region and three more in the lower hinge region. GCG Package (Wisconsin Package Version 10, Genetics Computer Grou
By comparison of global sequences performed using the Bestfit program of p (GCG), Madison, Wisconsin), IgG1 showed Ig to MAb-chCC49.
It was shown to share a little higher sequence homology than G2a. This result is MA
The sequences of the b61.1.3 (IgG1) and MAb-chCC49 light chains share 65% identity and 72% similarity, while MAb231 (IgG2a) and MAb231 (IgG2a).
The sequence of the light chain of b-chCC49 shares 63% identity and 70% similarity; in addition, the sequence of the heavy chain of IgG1 and MAb-chCC49 has 64% identity and 7%.
It shows 4% similarity, while IgG2a and MAb-chCC49 show 60% identity and 68% similarity.

However, when the comparison was performed using the sequences of the hinge region, the MAb-ch
The CC49 hinge was found to be more similar to that of MAb 231 than that of MAb 61.1.3 in both length and amino acid sequence. MAb2
Similar to 31, MAb-chCC49 also has a long hinge and is one less amino acid than that of MAb231. This suggests that MAb-chCC49 may have an elongated structure similar to MAb231. MAb 231
And MAb-chCC49 also share substantial sequence identity (about 90%) in both the core and lower hinge regions. On the other hand, in this region MAb-ch CC49 and M
Ab 61.1.3 are not similar to each other. Compared to MAb-chCC49, MA
b61.1.3 has a much shorter hinge. Sequence alignments also showed that they have very low homology in this region. Since our mutant MAb will have a phosphorylation site in the hinge region, MAb-chC
It was decided to continue to use MAb231 as a template to create a complete molecular model of C49.

The present study also showed that molecular modeling saves time and also allows the structure of a desired polypeptide to be accurately predicted. For example, according to the two criteria we set out in the "Results" section, 1 in the complete Ab of MAb-chCC49
Zero or more sites were found. Evaluation of these hypothetical mutant Ab models suggested that not all of these sites were suitable for site-directed mutagenesis. Some models of hypothetical mutant Abs show that after mutation, the side chains of the mutated amino acids are critical for the side chains of nearby residues (especially those of the CDR regions), as in the case of mutations in the variable regions of MAbs. It was shown to give interference. Some other models suggest that after mutation the phosphorylation site is M, as may occur if the mutation was introduced in the Fc part.
It was shown to be buried deep inside the Ab. This would cause problems since it was proposed that it would be desirable to have an exposed phosphorylation site in order to obtain good phosphorylation. Variants whose model did not exhibit the above problems were finally selected for further work.

US Pat. No. 5,986,061 is incorporated herein by reference. Polypeptides modified according to the present invention by the presence of one or more phosphorylated groups (or analogs thereof, ie sulfur) are biological, medical, medical (including therapeutic and diagnostic). ) And other scientific fields. It is anticipated that the polypeptides modified by the methods disclosed in the present invention may have additional specific uses. Some examples of such applications are described below. However, it is understood that these specifically described uses are not intended to limit the scope of the invention.

Pharmacokinetics of Polypeptides Following follow-up of polypeptides injected into animals and patients is often useful. Phosphorus bound to some of these polypeptides is shown below to be relatively stable in mouse serum. Thus, the fate of a polypeptide can be conveniently studied. The present invention provides a method for producing more stable bound phosphate groups using computer modeling. Therefore,
Polypeptides so phosphorylated are particularly suitable for the above applications. When using phosphorylated polypeptides or analogs of the invention that are expected to come into contact with human or animal serum, the polypeptide derivative needs to be stable in human or animal serum. The derived polypeptide is equivalent to (ie from a biological point of view) the serum of the species in which the pharmacokinetic study (or pharmacokinetic application) is performed, or equivalent to the serum of the species in which the work is performed. Must be stable in serum.

For example, in the above use, the phosphate group linked to MAb-WW5 is converted to MAb-c
It is much more stable in mouse serum at 37 ° C than that of hCC49K1. 37
After 24 hours at 0 ° C., about 99% and 92% of the phosphate groups in MAb-WW5, respectively.
And still bound to MAb-chCC49K1. Therefore, for applications in which stability of the phosphorylated derivative is essential, serum-stable derivatives made using the present invention are used. The applications described here are not limited to polypeptides phosphorylated at serine residues. It was mentioned above how the kinase phosphorylates other amino acids, eg threonine or tyrosine. Thus, polypeptides modified at these amino acids are included within the scope of this invention. Due to the structure of such an inducing labeled polypeptide, the stability of said inducing labeled polypeptide in serum is improved, even if the corresponding serine-phosphorylated derivative is not adequately stable in serum. It may not be excluded.

General Diagnostic Reagents Yet another specific use of the modified polypeptides of the present invention is notable. As mentioned herein, virtually all polypeptides can be engineered to introduce one or multiple phosphorylation (or analog) sites. Such polypeptides may be used for a variety of scientific purposes, ie for studying the fate of these polypeptides in animals or humans, for studying their stability, or for any experiment in which radioactive polypeptides are useful. It can be used for use as a laboratory reagent. For example, molecular weight standards are commonly used for polyacrylamide gel electrophoresis. A polypeptide having a phosphorylation site could be a convenient autoradiographic marker, such as a molecular weight marker, an isoelectric focusing marker or other marker. For such applications, stability is generally not important and retention of biological activity of the polypeptide, eg, antigen binding, is not important. Thus, for certain uses or applications, it is not essential that the phosphorylatable polypeptides of the invention have biological activity.

Anti-cancer Therapeutic “Bombs” A particularly notable and interesting application made possible by the present invention was in general terms termed therapeutic agents, more specifically anti-tumor “therapeutic irradiation bombs”. It is a thing.
Such a biologically active composition may include a tumor-specific monoclonal antibody (MAb
) (Or Fab fragment or Fab 'fragment if appropriate) and multiple "modified" streptavidins attached to each of the MAb-conjugated biotins. Each of the above streptavidins has been modified to have multiple phosphorylated groups. Since streptavidin is itself a tetramer, a large number of radioactive groups are thus provided. These large numbers of radioactive groups are strongly amplified and are therefore more easily detectable, exposing the tumor to radiation which results in even stronger tumor destruction. If it can be highly phosphorylated, it can be detected more easily. Thus, each of the biotins attached to each of the tumor-specific MAbs binds tightly to multiple streptavidin molecules, which in turn contain multiple labeled phosphorus atoms (or their equivalent isotopes). Depending on the therapeutic or diagnostic purpose, all streptavidin is labeled with radioactive phosphorus, or partially or wholly with radioactive thiophosphorus, or various phosphorus or sulfur isotopes (the isotopes are various decays). Embodiment or having an irradiation energy level). Such isotopes are discussed below. Since an antibody molecule is itself a molecule with multiple chains, many sites can be introduced directly into the antibody or Fab fragment by the methods of the invention.

Hormones, Cytokines, Lymphokines, Growth Factors Radioactive phosphorus or sulfur labeled hormones are another type of biological material within the scope of the present invention. For example, phosphorylated (eg, ³³ P, ³² P) hormones can differentially bind to particular cell types in preference to other tissues.
Cancerous tissues that have an increased number of receptors for such hormones can be treated with appropriately phosphorylated hormones, which in turn bind these hormones to the cells. Therefore, the treatment will be significantly improved. In addition, labeled hormones are commonly used in receptor studies to examine the binding of cell surface receptors, soluble receptors or other reagents and substances to those hormones.

Typical labeled ( ³³ P, ³² P) hormones included in the present invention are growth hormone, insulin, FSH; LH and others. It is clear that such hormones constructed by genetic engineering serve to introduce one or more hypothetical phosphorylatable or thiophosphorylated groups. As noted above for hormones, the same ideas apply to cytokines, lymphokines, growth factors (ie IL-1, IL-2, IL-3, TNF-alpha,
It is applicable to TNF-beta, various CSF molecules, erythropoietin EGF, NGF and others), and any polypeptide having varying degrees of cell and / or tissue specificity.

Antibodies Avidin labeled by means of phosphorylation can be used directly to enhance immunoassays as a surrogate for unlabeled or enzyme linked unlabeled streptavidin. The invention also includes introducing a phosphorus or analog label into a genetically engineered antibody (more specifically a MAb) or Fab or Fab 'fragment. Such Mabs are useful for diagnostic and therapeutic purposes. Phosphorylated MAbs can be targeted to specific tumor associated antigens or various tumors such as breast and rectal cancer cells, malignant melanoma cells, ovarian cancer cells and other malignancies.

Further Therapeutic Uses Other uses contemplated in accordance with the invention are as follows: monoclonal antibody or suitable antibody cocktail and / or antibody fragment (eg Fa.
b or Fab 'fragment) cocktails are effective molecules that can introduce phosphorylation sites or other labelable sites according to the present invention. The use of ³² P in therapy has been demonstrated in polycythemia vera and other malignancies. Therefore, it is clear that high-energy beta particles are effective as anti-cell drugs. The binding of ³² P by the introduction of phosphorylation sites on MAbs or their appropriate fragments (Fab and Fab ') may also be useful in the treatment of tumors for which the monoclonal antibody has specificity. A number of monoclonal antibodies have been raised against tumor associated antigens from breast, rectal, ovarian and other adenocarcinomas, malignant melanoma, and many other tumors. Therefore, it is expected that MAbs against the tumor associated antigens of these tumors would be very effective when labeled with ³² P. Labeling can be increased by using a phosphorylation site cassette, or by directly introducing multiple phosphorylation sites into the complete polypeptide or appropriate fragments by genetic engineering. By "cassette" is meant a multi-functional component. The obvious advantage of the present invention is that a large number of labeled phosphorylation sites, when introduced into a MAb according to the present invention, results in the binding specificity and / or affinity of said modified MAb for its specific targeting epitope. Is not to lower.

The present invention also contemplates the preparation of therapeutic antigens in which the patient may develop side-effecting antigenic reactions. Therefore, monoclonal antibodies with different phosphorylation sites can be conveniently produced by genetic engineering according to the present invention. When introduced into a patient who is hypersensitive to an injected antibody due to its phosphorylation site or who is producing an antibody to said antibody, the antigenic properties of said polypeptide are different. It can be modified by changing to the phosphorylation site. Thus, it is possible to use such antibodies in many convenient treatment regimens in patients who are responsive to previous types of antibodies. To this end, antibody series with different phosphorylation sites can be generated. Each series will be designed to have a different epitope structure and will be used sequentially. Alternatively, a cocktail made up of such various antibodies can be used first so that any antibody can be present as part of a whole. This will minimize antibody formation to any of the new sites. Due to the relative ease of designing potential phosphorylation sites using the present invention, such efforts can be greatly simplified within a short period of time.

Various Isotopes According to the present invention, as discussed above, phosphorylated derivatives must be stable in serum for certain applications. Various isotopes that are more effective than others for a particular therapeutic purpose can be used. For example, in a phosphorylation reaction, ³³ P can be substituted for ³² P. ³⁵ S, which has a half-life of about 89 days, would not normally be useful as an anti-cellular reagent. Because ³⁵ S is a low energy beta emitter. Nevertheless, ³⁵ S-labeled MAbs may likely have particular use in therapy and / or diagnosis.

Table I below shows various isotopes (and other related items) that are particularly useful for incorporation into polypeptides in accordance with the present invention. Table I: Isotopes for Labelable Groups Isotopes Half-life Decay type Radiant energy ³² P 14.2 days beta 1.707 Mev ³³ P 24.4 days beta 0.25 MeV ³⁵ S 87.0 days alpha 0.167 Mev ³⁸ S 2.87 hours Alpha 1.1 MeV

Accordingly, the invention provides polypeptides designed for a particular biological purpose. An important implication of the present invention is the higher safety of labeled MAbs due to their low energy emission levels and their radioactive release properties. In particular, ³² P and ³³ P labeled MAbs have much lower energy emission levels than conventional radiolabels for peptides (eg ¹²⁵ I). Furthermore, compared to ¹²⁵ I gamma radiation, which is common in currently used labeling protocols, phosphorus and sulfur isotopes ( ³²
P, ³³ P, ³⁵ S and ³⁸ S) decay releases are beta or alpha particles.

Beta-Tagged Polypeptides of the Invention (eg MAb or Streptavidin)
The safe nature of is very important for the diagnostic and therapeutic uses of the invention. Beta-emitters penetrate tumors, but unlike gamma-emitters they are not as readily released from patients into medical staff and non-medical personnel. By selecting ³⁵ S-phosphate ATP analogs for ³⁵ S (which has a half-life of 87 days) and ³² P, the effective radioactive lifetime of therapeutic agents can be significantly increased. Thus, the polypeptides labeled according to the present invention have a wide range of properties with significant advantages not previously readily available. The present invention is not limited to the use of unstable isotopes. In the future, it may be advantageous to label the polypeptide with a stable isotope suitable for NMR, detection by nuclear activation, or methods developed in the future. Furthermore, the label need not be a "radioactive" label, provided it is a identifiable label.

Radioimmunoassay with Labeled Antigens According to the present invention, phosphorylated polypeptides can generally be used as radiolabeled components. Polyclonal antibodies as well as monoclonal antibodies can be used in these radioimmunoassays. When a change in the antigenic structure of the polypeptide occurs in the phosphorylation site region or the distal linear portion of the polypeptide by introducing a novel phosphorylation site into the peptide, and when the reaction mode as an antigen changes, The polypeptide of the invention can be modified by introducing a phosphorylation site at a different position so that the reaction mode as an antigen is stably retained and the polypeptide can bind to the polyclonal or monoclonal antibody in question. .. Moreover, in the present invention using computer modeling, the whole process will be greatly speeded up. Furthermore, due to its high energy, ³² P secondary bremsstrahlung can be used for imaging. Thus, the present invention provides significant flexibility as to where the label can be introduced. Generally introduced phosphorus (and other radiolabels) will not disrupt the antigen-antibody binding of the present invention.

Radiosandwich Immunoassay In a radiosandwich immunoassay using a monoclonal antibody, the introduction of phosphorylation sites into the antibody according to the invention is a sensitive method involving the binding of a secondary antibody. Therefore, the sensitivity of such radioactive sandwich immunoassays can be substantially increased. In particular, when a number of phosphorylation sites are introduced into a polypeptide according to the present invention either directly or by the addition of a fusion phosphorylation cassette, the sensitivity of the assay will be increased many-fold. Furthermore, the present invention is unique in that it creates models in which several phosphate groups are co-introduced and further predicts their overall effect on the overall stability and conformation of phosphorylated polypeptides. Have advantages.

Another advantage of the present invention should be noted. Unlike other chemical modifications required for radiolabeled polypeptides using iodination or iodine or other reagents, the phosphorylation reaction is a mild reaction, so a monoclonal that is inactivated by chemical methods or iodination. It is unlikely that the antibody will be inactivated by phosphorylation. Thus, the process of the invention allows phosphorylation of polypeptides that are usually too sensitive to labeling with iodine. Introduction of phosphate analogs with ³⁵ S provides radiolabeled polypeptide derivatives with long half-lives (1.5 times ¹²⁵ I and 6 times longer than ³² P). Therefore, when labeling MAbs with ³⁵ S, they will have a substantially longer shelf life compared to ³² P or ¹²⁵ I radiolabeled derivatives. As discussed above, the present invention allows for the selection of the most appropriate labeled isotope as compared to, for example, ¹²⁵ I.

Imaging In order to image a tumor or tissue in an animal or patient, typically a high energy gamma emitter is absorbed by a relatively low energy beta emitter, which is mostly absorbed by the scooping. Is preferred). However, for certain imaging experiments in animals or patients, MAbs conjugated with ³² P, ³³ P or ³⁵ S via a phosphorylation site introduced according to the invention may be useful. For example, ³² P, ³³ P or ³⁵ P in in vivo experiments attempting to examine biopsy specimens.
It will be appreciated that MAbs labeled with S will be useful. Tumor spread during surgery could utilize radioisotope detection probes to track the local spread of the tumor and indicate the extent of surgery. In addition, these polypeptides (
That is, fixed or frozen tissue specimens can be taken in which binding of tumor-associated antigens or antibodies to other ligands) is maintained. Therefore, autoradiographs of tissue sections can provide information on the extent of tumor spread and further fully assess the extent of binding of specific monoclonal antibodies to tumor associated antigens. Furthermore, as an in vitro reagent using cells or tissue sections,
Such labeled antibodies would be highly sensitive reagents for detecting tumor associated antigens or other antigens by commonly used types of assays.

Anti-Antibodies Many uses are known for anti-antibodies such as anti-mouse, anti-human, anti-sheep, and anti-goat antibodies or for monoclonal antibodies as a single substance or as a cocktail. Such antibodies can be genetically engineered according to the invention to introduce single or multiple phosphorylation sites and be accordingly labeled with various isotopes as described above. These provide general reagents in which anti-antibodies are required, especially in radioimmunoassays, autoradiography, or any other reaction in which anti-antibodies are useful.

Rapid Purification of Phosphorylated Polypeptides The present invention also has application in the separation and purification of polypeptides. Phosphorylated polypeptides can be separated from unphosphorylated polypeptides and can be separated from polypeptides that are more phosphorylated than others. For example, if a polypeptide can be phosphorylated, it is common for only a small percentage of the molecules to be phosphorylated. Of course, the total phosphorylation can be increased by introducing multiple phosphorylation sites according to the invention so that most molecules do not escape phosphorylation. Allowing the phosphorylated polypeptide to be separated from the non-phosphorylated polypeptide is important for molecules with a single phosphorylation site where the phosphorylated and non-phosphorylated molecules may be present in the population. Especially useful. In this aspect, the efficacy of any phosphorylated analog is increased. Separation of phosphorylated molecules from non-phosphorylated
This can be accomplished by making polyclonal or monoclonal antibodies to phosphorylation sites with and / or without induced phosphate groups. Such polyclonal and monoclonal antibodies are expected to have significant value in the purification of polypeptides and have been previously reported.

Dephosphorylation of Polypeptides Phosphorylation is emphasized herein. Dephosphorylation, which tends to result in less disruption of the polypeptide molecule, is also a milder step than was previously used to remove ¹²⁵ I from the polypeptide, thus facilitating removal of the label. What is the result of this phosphorylation reaction (due to the phosphate or thiophosphate groups). Therefore, when it is useful to remove radioisotopes, this is
It can be achieved relatively easily and gently by enzymatic reaction. Various phosphatases can be used for this purpose. Most phosphatases have relatively low specificity, but some have very strong specificity. The latter are, for example, those that act on sugar phosphate groups and enzymes that dephosphorylate glycogen synthase b and phosphorylase b. Furthermore, specific dephosphorylation of phosphorylated polypeptides can be achieved by reversing the reaction of the polypeptide-serine and -tyrosine kinases. In fact, if it is necessary to determine whether addition of a phosphate group causes a change in the activity of the polypeptide other than aging, denaturation or other tampering, the phosphate group is removed and the activity of the polypeptide is removed. Can be determined again. In such a manner, the effect of phosphorylation on the activity of the polypeptide can be fully understood. This may be useful in determining the activity of various phosphorylated interferons. The concept of "dephosphorylation" has an interesting use, which is essentially "reverse" to the concept disclosed herein. Whenever a site in a polypeptide in its native state can be phosphorylated under normal conditions, it has been found that the polypeptide capable of phosphorylation under normal conditions produces some undesirable consequences. If so, removal of that site may be particularly desirable. Illustrative would be polypeptides associated with oncogenic viruses (eg Rous sarcoma virus (RSV)) and cellular oncogenes.

Phosphorylation Cassette The present invention also provides for the labeling of a polypeptide which does not insert the coding sequence for the phosphorylation site (or cassette) into the nucleotide coding sequence of the polypeptide, but which still uses the invention. Including another method. This method will be particularly useful for large polypeptides such as immunoglobulins for use in various assays. Such an alternative requires that the phosphorylated polypeptide be chemically linked to a large polypeptide. The linkage may be by any bifunctional reagent or activated derivative known in the art (such as N-hydroxy-succinimide). This technique could use polypeptides with multiple phosphorylation sites in tandem or in a "cassette". The cassette can be introduced within the polypeptide or at either end thereof. The DNA encoding the tandem phosphorylation sites is for easy excision and insertion into DNA containing the coding sequence of the polypeptide linked to a larger polypeptide,
It will include a restriction site flanked by its flanks. Such a phosphorylation cassette could be expressed as a small polypeptide, subsequently phosphorylated and then chemically linked to a larger polypeptide.

It is also possible to provide a human or animal donor gene capable of phosphorylation, and also to provide a DNA sequence which is genetically engineered into the animal body by a suitable vector or cell line or transgenic technology. Included within the scope of the invention. Thus, the cell or animal is capable of producing a polypeptide (eg, an immunoglobulin) that can be phosphorylated (and / or phosphorylated) after the phosphorylation site has been introduced by the method of the invention. You can It would be possible to generate chimeric antibodies with murine variable regions and human constant regions that can be phosphorylated. Human antibodies used as donor molecules will be engineered to contain single or multiple phosphorylation sites. Similarly, it can be applied to polypeptides other than immunoglobulins.

Other Uses There are other uses for the labeled polypeptides of the present invention. In general, virtually any polypeptide containing a label (radioactive label, fluorescent label, chemical substance label, enzyme label, etc.) can be labeled with a phosphate group separately by introducing the phosphorylation site of the present invention. You can Purification of such polypeptides can be followed in a sensitive assay by simply measuring the ability to accept a phosphate group, rather than following enzymatic activity. Thus, a polypeptide engineered according to the present invention can be readily purified, and can itself be used as a tracer to follow the purification of other similar polypeptides. For example, a polypeptide with a single engineered phosphorylation site that has very few modifications to its own polypeptide structure will be purified in the same manner as its unmodified polypeptide. Is extremely likely. In fact, by having a stock of polypeptides or marker series that can be phosphorylated, labeled derivatives can be conveniently prepared when desired by a simple phosphorylation reaction. Thus, the polypeptides of the invention that can be phosphorylated provide a useful inventory of corresponding labeled polypeptides.

Pharmaceutical and Biologically Active Compositions The modified polypeptides of the present invention can be formulated according to known methods for preparing pharmaceutically useful compositions. For example, the MAbs of this invention are mixed with a mixture with pharmaceutically acceptable excipients. Suitable excipients and their formulation are described in: Remington's Pharmaceutical Sciences by EW M
artin: This document is included herein by reference). The compositions described above will contain an effective amount of MAbs and other polypeptides together with suitable amounts of excipients to prepare pharmaceutically acceptable compositions suitable for effective administration to a host. . The host may or may not be a mammal. The carrier may be a liquid, a solid or a gas. Of course, therapeutic and veterinary uses for humans are contemplated for the biologically active compositions of this invention. The biologically active composition of the present invention can be administered in a biologically or therapeutically effective amount. The above amounts are easily determined by those skilled in the art. It is generally in excess of the minimum amount that gives the desired reaction, for actual or other purposes. The biologically active composition of the present invention can also include any other biologically active agent. The substance does not adversely affect the desired activity, especially the activity or use of the modified polypeptide of the invention. It will be appreciated that the modified polypeptides of the present invention may be obtained by chemical and / or enzymatic synthesis rather than by recombinant DNA technology. Although particularly preferred embodiments and some uses, and applications made possible by the present invention have been described, the present invention is not limited to the foregoing, but rather the appended statutory claims and the specification. It will be appreciated that the book is bound by the subject matter covered.

[0183]

[Table 1]

A systematic conformational search could be performed along Ser / Thr Cα-Cβ and Cβ-Cγ of the PKA recognition site to obtain an acceptable conformation for each phosphorylated mutant MAb. The "searched binding" column shows the amino acid residues that were systematically searched. Corresponding to the drawings, the column labeled "chain number" refers to the left model as chain 1 and the right model in each figure as chain 2. The "Hydrogen Bonding with Surrounding Amino Acids" column indicates whether the phosphate group attached to each mutant MAb has the potential to form one or more hydrogen bonds with surrounding amino acids. . In the energy column, the first number represents the lowest energy conformation and the second number represents the highest energy conformation, all calculated without energy minimization. A more detailed description is presented in the "Materials and Methods" section.

[0185]

[Table 2]

[ ³² P] MAb immunoreactivity was measured by a direct binding assay. Assays were performed by plate assay with BSM or PSM coated on plates or bead assay with BSM or PSM bound to beads. The percentage of [ ³² P] MAb bound to the plates or beads was measured as detailed in the “Materials and Methods” section. Excess antigen B bound to beads
The assay performed by SM is more reliable than the plate assay in which the BSM is not in sufficient excess.

[0187]

[Table 3]

[ ³² P] MAb-chCC49K at various times in serum or buffer at 37 ° C.
The percentage of ³² P retained on 1 was determined by TCA precipitation (Pestka, 1972). For stability measurements, 1.3 x 10 ⁶ cpm was added to each reaction mixture as described in the "Materials and Methods" section. 20μ in duplicate for TCA precipitation
L minutes were collected at the times indicated. The values in the table are the average of two sets of measurements. A more detailed description is given in the "Materials and Methods" section.

[0189]

[Table 4]

The percentage of ³² P retained on [ ³² P] MAb-WW5 was measured as described in the legend to Table 3.

[0191]

[Table 5]

The percentage of ³² P retained on the [ ³² P] MAb was measured as described in the legend to Table 3.

[0193]

[Table 6]

The percentage of ³² P retained on [ ³² P] MAb-WW6 was measured as described in the legend to Table 3.

[0195]

[Table 7]

The percentage of ³² P retained on [ ³² P] MAb-WW7 was measured as described in the legend to Table 3.

[0197]

[Table 8]

[0198]

[Table 9]

[ ³² P] MAb-WW5, [ ³² P] MAb-CC49K1, [ ¹³¹ I] MAb
-CC49 and [ ¹²⁵ I] MAb-CC49 were added to human colon cancer xenografts (LS
-174T) to athymic mice. Kill the mouse at the time of display (5
Animals / group), tumors and percentage of injected dose per gram of various normal tissues (% ID / g) was determined.

[Brief description of drawings]

FIG. 1 shows a model of MAb-chCC49 antibody. Light chains are shown in yellow and heavy chains in green. The purple region represents the site where a polypeptide kinase recognition site can be introduced. A total of 9 sites in the heavy chain and 3 potential sites in the light chain are shown.

FIG. 2 shows a comparison of production models of MAb-chCC49 and MAb231 antibodies. The light chain of MAb-chCC49 is shown in yellow and the heavy chain in green. MAb2
31 is shown in white.

FIG. 3 shows the nucleotide and amino acid sequence of synthetic fragment K2. cA
The two phosphorylation sites recognized by the MP-dependent protein kinase are underlined. The cloning site (XmaI) is italicized.

FIG. 4 shows a model of MAb-chCC49 antibody. This figure shows MAb-chCC4
9 shows a complete 3D model. The light chains are shown in yellow, while the heavy chains on the left are turquoise and the heavy chains on the right are magenta. The reddish orange region shown in the gap filling model is
Protein kinase recognition sites (ie 9 sites on the heavy chain and 3 sites on the light chain)
Represents the part that is considered to be.

FIG. 5 shows a comparison of the structures of MAb-chCC49 and MAb231 antibodies. MAb
-ChCC49 is shown in crimson and MAb 231 is shown in green.

FIG. 6 shows a model of mutant MAb. The light chain of the MAb is shown in yellow, while the heavy chain on the left is turquoise and the heavy chain on the right is magenta. The red-orange region shown in the void filling model represents the region where the protein kinase recognition site is introduced. A: M
Ab-ch CC49K1 model; B: MAb-CC49CKI model; C: MA
Model of b-CC49CKII; D: Model of MAb-CC49Tyr.

FIG. 7 also shows a model for the mutant MAb. The light chain of the MAb is shown in yellow while the
The heavy chain on the left is turquoise, and the heavy chain on the right is magenta. The red-orange region shown in the gap filling model represents the region into which the protein kinase recognition site was introduced. A: MAb-chCC49-6P model; B: MAb-WW1 model; C:
MAb-WW2 model; D: MAb-WW3 model; E: MAb-WW4 model; F: MAb-WW5 model; G: MAb-WW6 model; H: MAb-WW7
Model: I: MAb-WW8 model.

FIG. 8 shows a model of mutant [ ³² P] MAb. The light chain of the MAb is shown in yellow, while the heavy chain is shown in magenta. The white region shown in the void-filling model represents the region where the protein kinase recognition site is introduced. The green region, which represents a phosphate group bound to a serine or tyrosine residue, is barely visible. The oxygen bound to the phosphate group is red. ^{A: [32 P] MAb-} chCC49K1
Model: B: [ ³² P] MAb-CC49CKI model; C: [ ³² P] MAb-C
Model of C49CKII; D: Model of [ ³² P] MAb-CC49Tyr.

FIG. 9 shows a model of mutant [ ³² P] MAb. The light chain of the MAb is shown in yellow while the heavy chain is magenta. The white region shown in the gap filling model represents the region into which the protein kinase recognition site was introduced. The green region, which represents a phosphate group bound to a serine or tyrosine residue, is barely visible. The oxygen bound to the phosphate group is red. A: [ ³² P] MAb-ch CC49-6P model; B: [ ³² P] MAb-WW1 model; C: [ ³² P] MAb-WW2 model; D
: Model of [ ³² P] MAb-WW3; E: model of [ ³² P] MAb-WW4; F: model of [ ³² P] MAb-WW5; G: model of [ ³² P] MAb-WW6; H: [ ³² P
] Model of ^{MAb-WW7; I: [32} P] Model of MAb-WW8.

FIG. 10 is a comparison of the structures of MAb-chCC49 and MAb-WW5. MAb
-WW5 is shown in turquoise, while MAb-chCC49 is shown in crimson. No crimson color is visible because the two structures are substantially identical. The inset (bottom left) shows an expansion of the hinge region containing the side chain between the CH1 and CH2 domains, where the protein kinase recognition site was inserted (boxed).

FIG. 11 shows hydrogen bonding between a phosphate group of serine of MAb-chCC49K1 and a nearby amino acid. The carbon of serine is as follows: C, carbonyl carbon;
CA, alpha carbon; CB, beta carbon to which a phosphate group (P) is bound via the oxygen (OG) of serine. The other symbols are as follows: OXT, first oxygen of hydrogen-bonded phosphate group on the right side; O1P, second oxygen of phosphate group; O2P, third oxygen of phosphate group; H, amino acid Hydrogen in the range from the nitrogen (N) to the oxygen OXT of the phosphate group. All four serine residues shown in this figure are modified with a phosphate group. Only one of those phosphate groups forms a hydrogen bond.

FIG. 12 shows hydrogen bonds between a phosphate group and a nearby amino acid. A is MAb-WW
Hydrogen bond between the phosphate group of Thr of 2 and a nearby amino acid. B is a hydrogen bond between the phosphate group of Ser of MAb-WW3 and a nearby amino acid. The carbon atoms of Ser / Thr are as follows: C, carboxyl carbon; CA, alpha carbon; CB, beta carbon to which the phosphate group (P) is attached via the oxygen (OG) of serine. The other symbols are: OXT, one oxygen of the phosphate group; O1P, the second oxygen of the phosphate group; O2P, the third oxygen of the phosphate group. This figure is a model of a ball and club as described herein.

FIG. 13 shows stabilization of the phosphate group component on serine 224 of MAb-WW5. A
: Ser22 via a hydrogen bond between the phosphate group and the backbone nitrogen on cysteine 225 (left side) or between the phosphate group and the backbone nitrogen on serine 224 (right side).
The side chain of 4 stabilizes the phosphate group component. B: The side chain of Ser224 stabilizes the phosphate group component via a hydrogen bond between the phosphate group and the backbone nitrogen. The carbons of serine are as follows: C, backbone carbonyl carbon; CA, alpha carbon;
CB, beta carbon to which a phosphate group (P) is bound via the oxygen (OG) of serine. The other symbols are as follows: OXT, the first oxygen of the phosphate group; O1P, the second oxygen of the phosphate group that forms a hydrogen bond; O2P, the third oxygen of the phosphate group; H, Hydrogen in a hydrogen bond ranging from nitrogen (N) of an amino acid to oxygen of a phosphate group.

FIG. 14 shows stabilization of the phosphate group component on serine 224 of MAb-WW6. A
: Via a hydrogen bond between the phosphate group and the backbone nitrogen on cysteine 225, Se
The side chain of r224 stabilizes the phosphate group component. B: The side of Ser 224 via a hydrogen bond between the phosphate group and the nitrogen of the main chain of cysteine 225 on the left side, and a hydrogen bond between the phosphate group and the nitrogen of the main chain of cysteine 225 on the right side. The chain stabilizes the phosphate group component. Serine 224 is shown in crimson and cysteine is shown in green. The carbon of serine is as follows: C, carbonyl carbon of the main chain; C
A, alpha carbon; CB, beta carbon to which a phosphate group (P) is bound via the oxygen (OG) of serine. The other symbols are as follows: OXT, the first oxygen of the phosphate group; O1P, the second oxygen of the phosphate group; O2P, the third oxygen of the phosphate group;
H, hydrogen of hydrogen bond ranging from nitrogen (N) of amino acid to oxygen of phosphate group.

FIG. 15 shows stabilization of the phosphate group component of serine 224 of MAb-WW7. A:
Via a hydrogen bond between the phosphate group and the main chain nitrogen of cysteine 225, Ser2
The side chain of 24 stabilizes the phosphate group. B: Phosphate group and cysteine 225 on the left side
The side chain of Ser 224 stabilizes the phosphate group component through hydrogen bonding between the main chain nitrogen and the hydrogen bond between the phosphate group and the main chain nitrogen of cysteine 225 on the right side. Serine 224 is shown in crimson and cysteine 225 is shown in green. The carbon of serine is as follows: C, backbone carbonyl carbon; CA,
Alpha carbon; CB, beta carbon to which a phosphate group (P) is bound via the oxygen (OG) of serine. Other symbols are as follows: OXT, first oxygen of phosphate group; O1P, second oxygen of phosphate group; O2P, third oxygen of phosphate group; H,
Hydrogen in a hydrogen bond ranging from nitrogen (N) of an amino acid to oxygen of a phosphate group.

FIG. 16 shows stabilization of the phosphate group component on serine 224 of MAb-WW8. A
: Hydrogen bond between phosphate group and main chain nitrogen on cysteine 225 (left side), or hydrogen bond between phosphate group and main chain nitrogen on both histidine 223 and arginine 221 (right side) amino acids Via, the side chain of Ser224 stabilizes the phosphate group component. B: Hydrogen bond between the phosphate group and the nitrogen of the main chain of serine 224 (left side), or hydrogen between the phosphate group and the nitrogen of the main chain on both amino acids of histidine 223 and arginine 221 (right side). Through binding, the side chain of Ser224 stabilizes the phosphate group component. The carbons of serine are as follows: C, carbonyl carbon of the main chain; CA, alpha carbon; CB, beta carbon to which a phosphate group (P) is bound via oxygen (OG) of serine. Other symbols are as follows: OXT, first oxygen of phosphate group; O1P, second oxygen of phosphate group; O2P, third oxygen of phosphate group; H, nitrogen of amino acid (N) To hydrogen of hydrogen bonds ranging from to oxygen of the phosphate group.

FIG. 17: Expression vector constructed for expression of MAb-CC49-6P, p
3 shows dHL7-CC49-6P.

FIG. 18 shows the construction of pWW1. Due to the large amount of this construction, details are presented in the figure divided into contiguous parts (FIGS. 18A and 18B).

FIG. 19 shows the construction of pWW2. Due to the large amount of this construction, details are presented in the figure divided into contiguous parts (FIGS. 19A and 19B).

FIG. 20 shows the construction of pWW3. Due to the large amount of this construction, the figures are presented in detail in consecutive parts (FIGS. 20A, 20B and 20C).

FIG. 21 shows the construction of pWW4. Due to the large amount of this construction, details are presented in the figure divided into consecutive parts (FIGS. 21A and 21B).

FIG. 22 shows the construction of pWW5. Due to the large amount of this construction, the figures are presented in detail in consecutive parts (FIGS. 22A and 22B).

FIG. 23 shows the construction of pLgpCXIIHuWW5. Due to the large amount of this construction, details are presented in the figure divided into contiguous parts (FIGS. 23A and 23).
B).

FIG. 24 shows the construction of pLNCXIIHuCC49HuKV5. Construct pLN
CXIIHuCC49HuKV5 expresses the light chain of MAb-WW7.

FIG. 25 shows the construction of pLgpCXIIHuWW5V8ΔCH2. Final construct p
LgpCXIIHuWW5V8ΔCH2 is deleted in the CH2 domain and contains the amino acid substitutions K221R, T222R and T224S in the humanized MAb-CC49.

FIG. 26 shows the construction of pWW8. Due to the large amount of this construction, the figures are presented in more detail in consecutive parts (FIGS. 26A, 26B, 20C and 26D).
).

FIG. 27 shows SDS polyacrylamide gel electrophoresis of modified MAbs. A: M
Ab-chCC49-6P represents a gel of unlabeled MAb-chCC49-6P.
[ ³² P] MAb-chCC49-6P is a phosphorylated MAb-chCC49
-6P shows an autoradiograph. STDS is a molecular weight marker (SDS-PA
GE standard substance (wide area), Bio-Rad, Cat. No. 161-0317). The marker kDa is shown on the left of panels A and G. Arrows indicate where the phosphorylated variant MAb migrated as observed on the autoradiograph (right lane of each panel). SDS polyacrylamide gel electrophoresis of other mutant MAbs using similar labels is shown in BH.

FIG. 28 shows the stability of [ ³² P] MAb-chCC49-6P in various sera during 24 hours. [ ³² P in serum and buffer at 37 ° C for 24 hours
] Percentage of ³² P remaining in MAb-chCC49-6P is shown.

FIG. 29 shows the stability of [ ³² P] MAb-WW5 in various sera during 24 hours. [ ³² P] MAb-W in serum and buffer at 37 ° C. for 24 hours
The percentage of ³² P remaining in W5 is shown.

FIG. 30 shows the stability of [ ³² P] MAb-WW5 in various sera for 5 days. [ ³² P] MAb-WW5 in serum and buffer at 37 ° C. for 5 days
Shows the percentage of ³² P remaining.

FIG. 31 shows the stability of [ ³² P] MAb-WW5 in buffer for 21 days.
³² P remaining in ^[32 P] MAb-WW5 for 21 days at 37 ° C. in buffer
Indicates the percentage of.

FIG. 32 shows the stability of [ ³² P] MAb-WW6 in various sera during 24 hours. [ ³² P] MAb-W in serum and buffer at 37 ° C. for 24 hours
The percentage of ³² P remaining in W6 is shown.

FIG. 33 shows the stability of [ ³² P] MAb-WW6 in various sera for 5 days. Shown is the percentage of ³² P remaining in [ ³² P] MAb-WW6 in serum and buffer at 37 ° C. for 5 days.

FIG. 34 shows the stability of [ ³² P] MAb-WW6 in buffer for 21 days.
³² P remaining in ^[32 P] MAb-WW6 for 21 days at 37 ° C. in buffer
Indicates the percentage of.

FIG. 35 shows the stability of [ ³² P] MAb-WW7 in various sera for 24 hours. [ ³² P] MAb-W in serum and buffer at 37 ° C. for 24 hours
The percentage of ³² P remaining in W7 is shown.

FIG. 36 shows the stability of [ ³² P] MAb-WW7 in various sera for 5 days. The percentage of ³² P remaining in [ ³² P] MAb-WW7 in serum and buffer at 37 ° C. for 5 days is shown.

FIG. 37 shows the stability of [ ³² P] MAb-WW7 in buffer for 21 days.
³² P remaining in ^[32 P] MAb-WW7 for 21 days at 37 ° C. in buffer
Indicates the percentage of.

FIG. 38 is a comparison of the primary sequences in the hinge region of MAb-chCC49, MAb231 and MAb61.1.3. A: MAb-chCC49, MAb
231 and alignment of the primary sequence in the hinge region of MAb 61.1.3. B: Bestfit in the hinge region between the primary sequence of MAb-chCC49 and the primary sequence of MAb231. C: Bestfit in the hinge region of the primary sequence of MAb-chCC49 and MAb 61.1.3.

FIG. 39 shows [ ³² P] MAb-WW5, [ ³² P] MAb-WW6, [ ³² P] MA.
FIG. 6 shows a comparison of the stability of b-WW7 and [ ³² P] MAb-chCC49K1 in mouse serum. [ ³² P] MAb-W in mouse serum at 37 ° C. for 24 hours
The percentage of ³² P remaining in W5, -WW6, -WW7 and [ ³² P] MAb-chCC49K1 is shown. Figure, the blue symbols ^[32 P] represents MAb-WW5; green symbols represent the ^[32 P] MAb-WW6; peach symbols ^[32 P] MA
b-WW7; the black line represents [ ³² P] MAb-chCC49K1.

FIG. 40 shows [ ³² P] MAb-WW5 and [ ³² P] MAb-chCC49K1.
Is a comparison of blood clearance in mice. Blood clearance was performed by collecting 10 μL of blood (from the tail vein) at various time points. Values range from about 2 post injection
Normalized to blood drawn at 5 minutes.

FIG. 41 shows the crystal structure of the catalytic subunit of the cAMP-dependent protein kinase from Bos Taurus, along with its inhibitor. The catalytic subunit of PKA is shown in turquoise, while its inhibitor is shown in crimson. Thr
197 and Ser338 are shown in white. Also shown is the green region representing the phosphate group attached to a serine or threonine residue. The oxygen bound to the phosphate group is red.

FIG. 42 shows stabilization of the phosphate group component on threonine 197 of the catalytic subunit of the cAMP-dependent protein kinase from Bos Taurus. The threonine carbons are: C, backbone carbonyl carbon; CA, alpha carbon; CB,
Beta carbon to which a phosphate group (P) is bound via the oxygen (OG) of serine. The other symbols are as follows: O1P, the first oxygen of the phosphate group; O2P, the second oxygen of the phosphate group; O3P, the third oxygen of the phosphate group; NZ3, of the side chain of Lys189. Nitrogen; HZ3, hydrogen of hydrogen bond in side chain of Lys189 (NZ3) to O1P of Thr197; NH1, first hydrogen on side chain of Arg165; nitrogen of side chain of HH12, Arg165 (NH1 ) To Thr197 O
Hydrogen in a hydrogen bond ranging up to 2P; NH2, the second nitrogen on the side chain of Arg165; HH22, the side chain nitrogen (NH2) of Arg165 to O1 of Thr197.
Hydrogen with hydrogen bonds ranging up to both P and O2P oxygen.

FIG. 43 shows stabilization of the phosphate group component on serine 338 of the catalytic subunit of the cAMP-dependent protein kinase from Bos Taurus. Hydrogen bonds between O1P and side chain nitrogens on both Asn189 and Lys342 amino acids, and also O3
Through the hydrogen bond between P and the backbone nitrogen on Ile339, the side chain of Ser338 stabilizes the phosphate moiety. In addition, the side chain OG of Ser338 is also A
Due to both the main chain nitrogen and the first side chain nitrogen of sn340, Lys342
A hydrogen bond could be formed by the nitrogen of the third side chain of. The other labels are the same as those in the description of FIG. 42.

[Sequence list]

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) // C12P 21/08 C12N 15/00 ZNAA (81) Designated country EP (AT, BE, CH, CY, DE) , DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW , ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, C , CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD , SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW F terms (reference) 4B024 AA01 AA12 BA45 CA04 HA15 4B064 AG27 CC24 DA05 DA14 4H045 AA11 AA20 BA10 DA76 FA74 5B046 AA00

Claims (20)

[Claims] 1. A method of producing a polypeptide capable of phosphorylation comprising the steps of: (i) identifying the mutations required within the internal sequence of the polypeptide to produce the recognition sequence for the kinase. (Ii) producing a mutant polypeptide whose sequence is identified in step (i); and (iii) exposing the mutant polypeptide to the kinase to determine the phosphorylation level of the mutant polypeptide. 2. The method according to claim 1, wherein the mutant polypeptide is produced by gene recombination. 3. A method for producing a polypeptide capable of phosphorylation comprising the steps of: (i) providing a computer model of the polypeptide in question; (ii) with respect to the internal sequence of said polypeptide, Identifying the mutations required to generate the recognition sequence for the kinase; (iii) using the computer model, the mutant polypeptide that is phosphorylated at the putative phosphorylation site or unphosphorylated. Determines whether the three-dimensional structure and / or biological activity of the mutant polypeptide is likely to be retained, and if so, the putative phosphorylation site is accessible to the kinase. And if accessible, the phosphate group attached to the hypothetical phosphorylation site is stabilized by intramolecular interactions. And (iv) if all the conditions of step (iii) are met, the mutant polypeptide is produced by genetic recombination. 4. The method of claim 3, wherein the computer model of the polypeptide in question is generated using a method selected from any one of the following: (i) X-ray crystallography; (ii) NMR; Or (iii) coordination of a template polypeptide that shares at least 75%, preferably 85%, most preferably 95% sequence homology with the polypeptide in question over its entire length, or at least in the region where mutagenesis is performed. Computer software using. 5. The method of claim 4, wherein the putative phosphorylation site is recognized by either a serine / threonine kinase or a tyrosine kinase. 6. The phosphate groups attached to the phosphorylated polypeptide are substantially stable, and after incubation in animal serum or buffer for at least 5 days, at least 80% of the total phosphate groups, and more The method of claim 5 wherein preferably 95% and most preferably 99% remains. 7. The method of claim 6, wherein less than 3 amino acid sequence changes are required to create only one hypothetical phosphorylation site for the kinase of interest. 8. The method of claim 6, wherein said polypeptide of interest is an antibody. 9. The method of claim 8, wherein the antibody is a monoclonal antibody. 10. The method of claim 9, wherein the monoclonal antibody is selected from the group consisting of a modified monoclonal antibody, a chimeric antibody, a hybrid antibody, a Fab fragment, a Fab ′ fragment, and an Fc fragment. 11. The method of claim 8, wherein the antibody is labeled with a radioisotope. 12. The method of claim 11, wherein the radioisotope is selected from the group consisting of [ ³² P], [ ³³ P], [ ³⁵ S] and [ ³⁸ S]. 13. A polypeptide capable of phosphorylation comprising at least one internal sequence as a genetically engineered protein kinase phosphorylation site, which is capable of stable phosphorylation, whereby said phosphorus The phosphate groups attached to the oxidized polypeptide are substantially stable, and after incubation in animal serum or buffer for at least 5 days, at least 80%, more preferably 95%, most preferably 99% of the total phosphate groups. % Of said polypeptide capable of phosphorylation remaining. 14. The phosphorylatable polypeptide of claim 13, wherein said polypeptide is produced using the method of claim 1. 15. A phosphorylated polypeptide comprising at least one internal sequence as a genetically engineered protein kinase phosphorylation site, which is stably phosphorylated at said phosphorylation site, whereby The phosphate groups attached to said phosphorylated polypeptide are substantially stable, and after incubation in animal serum or buffer for at least 5 days, at least 80% of the total phosphate groups,
More preferably 95%, most preferably 99% of said phosphorylated polypeptide remains. 16. A polynucleotide sequence encoding the polypeptide of claim 13. 17. A polynucleotide sequence encoding the polypeptide of claim 14. 18. A polypeptide according to claim 13 or 14 which is capable of phosphorylating at least one or a polynucleotide sequence according to claim 16 or 17; wherein said polypeptide is engineered at its phosphorylation site. At least one protein kinase capable of phosphorylating, or a polynucleotide sequence encoding said protein kinase; and at least usable as a substrate by said protein kinase to label said polypeptide capable of phosphorylating A kit containing one nucleic acid or a derivative thereof. 19. A method of producing a computer model of a polypeptide of interest comprising the steps of: (i) its three-dimensional structure, and at least the polypeptide of interest in the area of the molecule for which computer modeling is performed. And at least 75%, preferably 85%
And most preferably provides coordination of template molecules sharing 95% sequence homology; Separate modeling of individual subunits of proteins composed of multiple subunits; (iii) Perform geometric refining and energy minimization steps using molecular modeling software. 20. A method of analyzing the biochemical properties of a polypeptide by using a molecular modeling tool comprising the steps of: (i) the sequence of the polypeptide of interest, and the polypeptide of interest, or the problem of interest. (Ii) providing a three-dimensional structure of a model polypeptide having significant sequence homology with the polypeptide of (1) by (ii) computer-aided molecular modeling using the coordination of the model peptide as a template, Predict three-dimensional structure; and (iii) determine the energy and stability of the predicted structure of the polypeptide in question.