JP2003532388A - Melanin-concentrating hormone receptor chimeras and fusion proteins - Google Patents

Abstract

  (57) [Summary]   The present invention is directed to melanin-concentrating hormone receptor (MCH-R) chimeras and fusion proteins. An MCH-R chimeric protein comprises an MCH-R polypeptide region composed of at least two or more polypeptide regions characteristic of MCH-R found in different species. The MCH-R fusion protein contains an MCH-R polypeptide region and a fluorescent protein region.

Description

Detailed Description of the Invention

BACKGROUND OF THE INVENTION The references cited herein are not admitted to be prior art to the present invention.

[0002] Neuropeptides located in the hypothalamus play a major role in mediating control of body weight (Flier et al., 1998. Cell, 92, 437-440).
Melanin-concentrating hormone (MCH) is a 19-amino acid cyclic neuropeptide synthesized in the hypothalamus as part of the larger preprohormone precursor, which also encodes the neuropeptides NEI and NGE (Nahon et al., 1990
． Mol. Endocrinol. 4,632-637). MCH was initially identified in the salmon pituitary. In fish, MCH affects melanin aggregation and thus skin pigmentation. In trout and eel, M
CH has been shown to be involved in stress-induced or CRF-stimulated ACTH release (Kawauchi et al., 1983. Nature.
305, 321-323).

In humans, two genes expressed in the brain and encoding MCH have been identified (Breton et al., 1993. Mol. Brain Res. 18, 29).
7-310). In mammals, MCH is predominantly found in the zona in
ertia) and the hypothalamic neuronal cell bodies involved in feeding control including the perinuclear cell bodies of the outer hypothalamus (Knigge et al., 1996.P.
eptides 17, 1063-1073).

[0004] Pharmacological and genetic evidence suggest that the major mode of action of MCH is that that promotes feeding (increased appetite). MCH mRNA is expressed in fasted mice and rats and in ob / ob mice (Qu et al., 1996 Nature.
e 380, 243-247), upregulated. Central injection of MCH (ICV) stimulates feeding, and MCH induces α-melanocyte-stimulating hormone (αM
It antagonizes the hypophagic effect observed in SH) (Qu et al., 1996 Nature 380, 243-247). MCH-deficient mice are lean and anorexic and have an increased metabolic rate (Shimada et al., 1998.
Nature 396, 670-673).

The effects of MCH are not limited to the regulation of feeding. Because the hypothalamus-
The effects on the pituitary-axis have been reported (Nahon, 1994.
Critical Rev. in Neurobiol. 8,221-262)
. MCH may regulate the stress-induced release of CRF from the hypothalamus and ACTH from the pituitary, so MCH may be involved in the physical response to stress. Also, the MCH nervous system may be involved in reproductive or maternal function.

[0006] Several references describe receptors that have been shown to bind to MCH (Chambers et al., 1999. Nature 400, 261-26.
5; Saito et al., 1999. Nature 400, 265-269; Bac
hner et al., 1999, FEBS Letters 457: 522-524;
Shimomura et al., 1999. Biochemical and Biop
physical Research Communications 261,
622-626; and Lembo et al., 1999. Nat. Cell. Biol
． 1, 267-271).

SUMMARY OF THE INVENTION The present invention is directed to melanin-concentrating hormone receptor (MCH-R) chimeras and fusion proteins. The MCH-R chimeric protein comprises a MCH-R polypeptide region composed of at least two or more polypeptide regions characteristic of MCH-R found in different species. The MCH-R fusion protein is MCH-R
It includes a polypeptide region and a fluorescent protein region.

The MCH-R polypeptide region provides a functional G protein-coupled receptor region capable of binding MCH and transducing intracellular signals. Specific examples of MCH-R polypeptide regions include naturally occurring MCH-R, chimeric MCH-R containing two or more regions from naturally occurring MCH-R, and functional derivatives thereof. .

References to the terms “characteristic” and “derivative thereof” refer to a reference sequence. In both cases there is at least about 75% sequence similarity to the reference sequence.

Accordingly, a first aspect of the present invention comprises (a) a MCH-R polypeptide region,
(B) A fusion protein comprising a fluorescent polypeptide region is described. The fluorescent polypeptide region is linked to the carboxy side of the MCH-R polypeptide region directly or via a polypeptide linker.

Another aspect of the invention describes MCH-R chimeric proteins. The protein is characterized by (a) an MCH-R binding region characteristic of human MCH-R, (b) a transmembrane domain characteristic of non-human MCH-R, and (c) a characteristic feature of non-human MCH-R. Contains the intracellular domain.

Another aspect of the invention describes nucleic acids encoding the MCH-R fusion proteins or MCH-R chimeric proteins described herein. Such nucleic acids include contiguous nucleotide sequences that encode the protein, or sequences that the host cell has to produce contiguous nucleotide sequences that encode the protein. Processing of nucleic acid sequences to produce a contiguous nucleotide sequence encoding a protein can occur by splicing together exons to cause removal of an intron.

Another aspect of the invention describes an expression vector comprising a nucleic acid encoding an MCH-R fusion protein or MCH-R chimeric protein described herein.

Another aspect of the invention describes a recombinant cell comprising a nucleic acid encoding an MCH-R fusion protein or MCH-R chimeric protein described herein.
The nucleic acid can be part of the host genome and can be independent of the host genome.

Another aspect of the invention describes a non-human transgenic animal comprising a nucleic acid encoding an MCH-R fusion protein or MCH-R chimeric protein described herein.

Another aspect of the invention describes methods for assaying MCH-R active compounds by measuring the effect of a test preparation on one or more MCH-R activities. The method comprises the MCH-R fusion protein or MCH-R described herein.
Perform using chimeric proteins.

Other features and advantages of the invention will be apparent from the further description provided herein including the various examples. The described examples illustrate various components and methods useful in practicing the present invention. The examples do not limit the invention. Based on this disclosure, one of ordinary skill in the art will be able to identify and use other components and methods useful in the practice of the present invention.

BRIEF DESCRIPTION OF THE FIGURES FIG. 1 illustrates mouse MCH-R fusion protein as human wild type MCH-R and CM.
5 shows the results of an aequorin assay comparing V-EGFP control.

FIG. 2 is a diagram of c of a CHO cell clone stably expressing mMCH-1R-EGFP.
1 shows an AMP flashplate assay. Cells from individual clones were dissociated in enzyme-free medium and stimulated with human MCH at the indicated concentrations for 15 minutes at 37 ° C. in the presence of 10 μM forskolin.
The cells were then lysed and assayed for bound [ ¹²⁵ I] cAMP. The mouse MCH-1R-EGFP clone has an EC50 value (0.1111, 0.1255, 0.1291) indistinguishable from the EC50 value (0.1282 nM) of the CHO cell clone expressing the wild-type human short isoform of MCH-1R. Or 0.
2304 nM).

FIG. 3 shows C stably expressing the human short / mouse species chimeric MCH-1R-EGFP.
1 shows a cAMP flashplate assay of HO cell clones. Cells from individual clones were dissociated in enzyme-free medium and stimulated with human MCH at the indicated concentrations for 15 minutes at 37 ° C. in the presence of 10 μM forskolin. The cells were then lysed and assayed for bound [ ¹²⁵ I] cAMP. Human short / mouse species chimeric MCH-1R-EGFP clones have EC50 values (0.1137) for CHO cell clones expressing the wild-type human short isoform of MCH-1R.
EC50 values (0.0366, 0.0462, 0.211) indistinguishable from nM)
7 or 0.2499 nM).

DETAILED DESCRIPTION OF THE INVENTION The present invention is directed to MCH-R chimeras and fusion proteins. Such proteins have a wide variety of uses, including use as research tools to study the function and kinetics of MCH-R and to screen agonists and antagonists of MCH-R.

The MCH-R provides a target for achieving various beneficial effects in patients. Preferably, MCH-R activity is associated with weight loss, weight gain, cancer (eg,
It is adjusted to achieve one or more of treatment of colon cancer or breast cancer), pain relief, diabetes treatment, stress reduction or sexual dysfunction treatment.

Modulation of MCH-R activity can be achieved by eliciting a response at the MCH receptor or by altering the response evoked by an agonist or antagonist of the MCH receptor. Compounds that modulate MCH-R receptor activity include:
Included are agonists, antagonists and allosteric modulators.
Generally, MCH-R antagonists and allosteric modulators that negatively affect activity are used to achieve weight loss, treat cancer (eg, colon or breast cancer), reduce pain, reduce stress or treat sexual dysfunction. MCH-R agonists and allosteric modulators that positively affect activity are used to effect weight gain.

Preferably, MCH-R activity is modulated in a patient to achieve weight loss or to treat diabetes. Diabetes can be treated, for example, by modulating MCH-R activity to achieve one or both of increased glucose tolerance or diminished insulin resistance.

Excess body weight is a contributor to various diseases, including hypertension, diabetes, dyslipidemia, cardiovascular disease, gallstones, osteoarthritis and some forms of cancer. Reducing weight can be used, for example, to reduce the likelihood of such disorders and as part of the treatment of such disorders. Weight loss can be achieved, for example, by modulating MCH-R activity to have one or more of the effects of decreased appetite, increased metabolic rate, decreased fat intake or decreased craving for carbohydrates.

[0026] Weight gain is particularly useful for patients having or undergoing treatment for a disease or disorder associated with weight loss. Specific examples of diseases or disorders associated with weight loss include anorexia, AIDS, weakness, cachexia and weakness in the elderly. Specific examples of treatments involving weight loss include chemotherapy and radiation therapy.

[0027]   MCH-R chimeric protein   The MCH-R chimeric protein is specific for MCH-R found in different species.
MCH-R polypeptide composed of at least two or more characteristic polypeptide regions
It contains a peptide region. The different polypeptide regions present depend on the N-terminal extracellular domain.
In: a membrane composed of a transmembrane region, a cell loop region and an intracellular loop region
A transmembrane domain; and an intracellular carboxy-terminal domain. MCH-R net
Specific examples of the amino acid sequence include SEQ ID NO: 1 (human MCH1R long form), SEQ ID NO: 2 (
j human MCH1R short form) and SEQ ID NO: 3 (mouse MCH1R)
.

Preferably, the MCH-R chimeric protein comprises a transmembrane and intracellular domain characteristic of non-human MCH-R, as well as an MCH-R binding region characteristic of human MCH-R. There are substantial amino acid differences between the N-terminus of MCH-R present in humans and the N-terminus of other species such as mouse. Such differences could, for example, confer a mouse MCH-R with unique properties and responsiveness to agonists and / or antagonists that differ from human MCH-R.
The presence of the human MCH-R binding region provides a "humanized" MCH-R chimeric receptor.

The transmembrane and intracellular domains characteristic of non-human MCH-R can be used with non-human hosts to obtain an environment closer to the naturally occurring environment for these regions. For example, MCH with mouse transmembrane and intracellular domains
The -R chimera is preferably used in mouse cell lines or transgenic mice.

The MCH-R chimeric protein may contain regions other than the extracellular, transmembrane and intracellular domains that do not substantially reduce the activity of the protein. Preferably, the additional region does not cause more than about 25% reduction in MCH-R activity as measured using one or more of the assays described in the Examples below. Examples of additional regions that may be present include fluorescent protein regions and linker regions.

In one embodiment of the invention, the MCH-R chimeric protein comprises (a
) A MCH-binding domain characteristic of the first species, and (b) a transmembrane and intracellular domain domain characteristic of the second species linked directly or via a linker to the carboxy side of the MCH-binding domain. including. Preferably, the protein is at least about 75%, at least 85% or at least 95% relative to SEQ ID NO: 4 (human short form / mouse species chimera MCH1R) or SEQ ID NO: 5 (human long form / mouse species chimera).
Comprising or consisting of an MCH-R polypeptide having% sequence similarity,
Or substantially consists of it. Even more preferably, the protein comprises, consists essentially of, or consists of SEQ ID NO: 4 or SEQ ID NO: 5.

Sequence similarity for polypeptides can be measured by BLAST (
Altschul et al., 1997., incorporated herein by reference. Nuclei
c Acids Res. 25, 3389-3402). In one embodiment of the invention, sequence similarity is measured using the tBLASTn search program with the following parameters: MATRIX: BLOSUM62, PERR.
ESIDUE GAP COST: 11, and Lambda ratio: 1.

Differences in naturally occurring amino acids are due to different R groups. The R group provides different amino acid properties such as physical size, charge and hydrophobicity. Amino acids can be classified into different groups as follows: neutral and hydrophobic (alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine and methionine); neutral and polar (glycine, serine, threonine, tyrosine, Cysteine, asparagine and glutamine); basic (lysine, arginine and histidine); and acidic (aspartic acid and glutamic acid).

In general, when substituting different amino acids, it is preferable to replace amino acids with similar properties. Substitution of different amino acids within a particular group, eg
Substitutions of leucine to valine, lysine to arginine, and glutamine to asparagine are good candidates for causing no alteration in polypeptide function.

Changes other than different amino acid groups can also be made. Preferably, such changes are made taking into account the position of the amino acid to be replaced within the polypeptide. For example,
Arginine may be a freer alternative to glutamic acid and may be a substitute for non-polar amino acids inside the polypeptide. Because it has a long aliphatic side chain (A
usubel, Current Protocols in Molecular
r Biology, John Wiley, 1987-1998, Suppl.
element 33 Appendix 1C).

[0036]   MCH-R fusion protein   The MCH-R fusion protein may be attached directly or via a linker.
And a fluorescent protein region and an MCH-R polypeptide region. these
The region provides MCH-R activity and markers for assessing MCH-R kinetics.
Get

The MCH-R polypeptide region confers functional MCH-R activity and includes naturally occurring MCH-R, chimeric MCH-R and derivatives thereof. Those preferred derivatives have at least about 75%, at least about 85% or at least about 95% sequence similarity to the naturally occurring MCH-R or chimeric MCH-R (as described herein). .

The fluorescent protein region contains a fluorescent chromophore. Preferably, the fluorescent protein region is a luminescent Aequorea victoria.
Jellyfish green fluorescent protein or a derivative thereof. Preferred derivatives are
It has at least about 75%, at least about 85% or at least about 95% sequence similarity to the luminescent Aequorea victoria green fluorescent protein (GFP). Luminous orange jellyfish (Aequorea v
ICTORIA) Specific examples of green fluorescent protein and its derivative are Cor.
mack et al., 1996. Gene 17, 33-38; Yang et al., 1996.
Nucleic Acids Research 24, 4592-4593;
Tsien et al., US Pat. No. 5,625,048; Tsien et al., US Pat.
, 777,079; and Cormack et al., US Pat. No. 5,804,387.
No. 5,697,096, each of which is hereby incorporated by reference.

In another embodiment, the MCH-R polypeptide region comprises or is substantially a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5. Or consists of it. The fluorescent polypeptide region includes SEQ ID NO: 6 (GFP), SEQ ID NO: 7 (EGFP), SEQ ID NO: 8 (E
merald), SEQ ID NO: 9 (Topaz) and SEQ ID NO: 10 (W1b), or substantially consists of or consists of the sequence. EGFP, Emerald, Topaz and W1b are derivatives of GFP.

The optionally present linker is a polypeptide region, preferably 1 to about 100 amino acids in length. In another embodiment, the linker is 75,
Up to 50 or 25 amino acids long.

Preferably, said MCH-R fusion protein comprises, consists essentially of, or consists of, said MCH-R polypeptide region and said fluorescent polypeptide region. More preferably, the protein is SEQ ID NO: 11 (mouse MCH1
R-linker-EGFP), SEQ ID NO: 12 (mouse MCH1R / EGFP direct fusion), SEQ ID NO: 13 (human short form / mouse species chimeric MCH1R-linker-E)
GFP) or SEQ ID NO: 14 (human long form / mouse species chimeric MCH1R-linker-EGFP), or consists essentially of or consists of an amino acid sequence selected from the group consisting of:

[0042]   MCH-R chimera and fusion protein nucleic acids and expression   MCH-R chimeras and fusion proteins are well known in the art.
Can be manufactured using. Preferably, such a protein is an expression vector.
Recombination in the host cell via a target or via a nucleic acid integrated in the host genome
Manufacture by expression. MCH-R polypeptide region, fluorescent protein region, MC
Nucleic acid sequences encoding HR chimeric protein and MCH-R fusion protein
Specific examples of are provided by SEQ ID NOs: 15-29 (see Example 1 below).
I).

Starting with a particular amino acid sequence and the known degeneracy of the genetic code, a large number of different encoding nucleic acid sequences can be obtained. Almost all amino acids are encoded by different combinations of nucleotide triplets or codons, resulting in the degeneracy of the genetic code (eg, Lewin GENES IV, p. 119, Oxf.
ord University Press, 1990). Amino acids are encoded by codons as follows:

A = Ala = alanine: codons GCA, GCC, GCG, GCU. C = Cys = Cysteine: codons UGC, UGU. D = Asp = aspartic acid: codons GAC, GAU. E = Glu = glutamic acid: codons GAA, GAG. F = Phe = phenylalanine: codons UUC, UUU. G = Gly = glycine: codons GGA, GGC, GGG, GGU. H = His = histidine: codon CAC, CAU. I = Ile = isoleucine: codons AUA, AUC, AUU. K = Lys = lysine: codons AAA, AAG. L = Leu = leucine: codons UUA, UUG, CUA, CUC, CUG, CU
U. M = Met = methionine: codon AUG. N = Asn = asparagine: codons AAC, AAU. P = Pro = proline: codons CCA, CCC, CCG, CCU. Q = Gln = glutamine: codons CAA, CAG. R = Arg = arginine: codons AGA, AGG, CGA, CGC, CGG, C
GU. S = Ser = serine: codons AGC, AGU, UCA, UCC, UCG, UCU
. T = Thr = threonine: codons ACA, ACC, ACG, ACU. V = Val = valine: codons GUA, GUC, GUG, GUU. W = Trp = tryptophan: codon UGG. Y = Tyr = tyrosine: codons UAC, UAU.

Specific examples of the technique for introducing a nucleic acid into a cell and expressing the nucleic acid to obtain a protein include Ausubel, Current Protocols in Mole.
molecular Biology, John Wiley, 1987-1998, and Sambrook et al., Molecular Cloning, A Labo.
rally Manual, 2nd edition, Cold Spring Harbor
It is described in a reference book such as Laboratory Press, 1989.

The expression vector contains a recombinant nucleic acid encoding a polypeptide, with regulatory elements for proper transcription and processing. The recombinant nucleic acid contains two or more nucleic acid regions that are not naturally associated with each other. Extrinsic regulatory elements, such as exogenous promoters, may be useful for expressing recombinant nucleic acids in a particular host.
Specific examples of expression vectors include cloning vectors, modified cloning vectors, specially designed plasmids and viruses.

Generally, regulatory elements present in expression vectors include transcription promoters, ribosome binding sites, terminators, and optionally present operators. Another preferred element is the polyadenylation signal, which effects processing in eukaryotic cells. Preferably, the expression vector also contains an origin of replication for autonomous replication in the host cell, a selectable marker, a number of useful restriction enzyme sites, and high copy number potential.

Expression vectors that provide suitable levels of polypeptide expression in a variety of hosts are well known in the art. Mammalian expression vectors well known in the art include pcDNA3 (Invitrogen), pMC1neo (Str
atagene), pXT1 (Stratagene), pSG5 (Strat)
agene), EBO-pSV2-neo (ATCC 37593), pBPV
-1 (8-2) (ATCC 37110), pdBPV-MMTneo (342)
-12) (ATCC 37224), pRSVgpt (ATCC 37199)
, PRSVneo (ATCC 37198), pSV2-dhfr (ATCC
37146), pUCTag (ATCC 37460), pCI-neo (Pr.
OMEGA) and lambda ZD35 (ATCC 37565). Bacterial expression vectors well known in the art include pET11a (Novege).
n), lambda gt11 (Invitrogen), pcDNAII (Invit
rogen) and pKK223-3 (Pharmacia). Fungal cell expression vectors well known in the art include pYES2 (Invit
rogen), Pichia expression vector (Invitrogen)
Is included. Insect cell expression vectors well known in the art include Blu
e Bac III (Invitrogen).

Recombinant host cells can be prokaryotic or eukaryotic. Specific examples of recombinant host cells include bacteria such as E. coli; fungal cells such as yeast; mammalian cells such as humans, cows, pigs, monkeys, hamsters and rodents; and Drosophila and Insect cells such as cell lines derived from silkworms are included. Commercially available mammalian cell lines include L cell LM (TK.sup.
-) (ATCC CCL 1.3), L cell LM (ATCC CCL 1.2)
), 293 (ATCC CRL 1573), Raji (ATCC CCL 8)
6), CV-1 (ATCC CCL 70), COS-1 (ATCC CRL)
1650), COS-7 (ATCC CRL 1651), CHO-K1 (AT
CC CCL 61), 3T3 (ATCC CCL 92), NIH / 3T3 (
ATCC CRL 1658), HeLa (ATCC CCL 2), C127
I (ATCC CRL 1616), BS-C-1 (ATCC CCL 26)
And MRC-5 (ATCC CCL 171).

It may be useful to modify the sequence taking into account the codon usage of the host in order to enhance expression in a particular cell. Codon usage of various organisms is known in the art (Ausubel, Current Protocols i.
n Molecular Biology, John Wiley, 1987-
1998, Supplement 33 Appendix 1C).

Expression vectors can be introduced into host cells using standard techniques.
Specific examples of such techniques include transformation, transfection, lipofection, protoplast fusion and electroporation.

Nucleic acid encoding a polypeptide can be expressed intracellularly without the use of an expression vector, eg, using synthetic or natural mRNA. In addition, mRNA can be expressed in various cell-free systems such as wheat embryo extract, reticulocyte extract, or in cell-based systems (eg, frog oocytes). Introduction of mRNA into a cell-based system can be performed by, for example, microinjection.

Techniques for producing transgenic animals are well known in the art. Specific examples of such techniques are found in Teratocarcinomas and
embryonic stem cells: a practical app
roach. E. J. Robertson, IRL Press Limit
ed, Oxford, England (1987); and Gene Targ.
eting: a practical approach. A. L. Joyne
r., Oxford University Press Inc. New Y
ork, NY (1993).

[0054]   G-protein coupled receptor assay   MCH-R is a G protein coupled receptor. Gi / o, Gs and Gq
Techniques for measuring various G protein activities are well known in the art.
ing. MCH-R activity is preferably in measuring Gi / o or Gq
More assayed.

Gi / o and Gs activity can be measured using techniques such as the melanophore assay, cAMP
It can be measured by measuring production, measuring inhibition of cAMP accumulation, and measuring ³⁵ S-GTP binding. cAMP can be measured indirectly using various techniques such as radioimmunoassay and by the cAMP responsive gene reporter protein.

Gq activity can be measured using techniques such as measuring intracellular Ca ²⁺ . Specific examples of techniques well known in the art that can be used to measure Ca ²⁺ include the use of dyes such as Fura-2, and the use of Ca ²⁺ bioluminescence sensitive reporter proteins such as aequorin. Be done. As an example of a cell line that uses aequorin to measure G protein activity, HEK293 / a
eq17 (Button et al., 1993. Cell Calcium.
14, 663-671, and Feighner et al., 1999. Science
e 284: 2184-2188; both of which are incorporated herein by reference).

Functional assays can be performed with individual compounds or with preparations containing different compounds. Preparations containing various compounds in which one or more compounds affect the activity of the MCH-R chimera or fusion protein are MCH-R
To identify compounds that affect the activity of chimeric or fusion proteins, one can subdivide into smaller groups of compounds. In an embodiment of the invention, test preparations containing at least 10 compounds are used in the functional assay.

A functional assay is the recombinantly produced MCH-R present in various environments.
It can be done using chimeric or fusion proteins. Such environments include, for example, cell extracts containing purified MCH-R chimeric or fusion proteins expressed from recombinant nucleic acids and purified cell extracts and suitable membranes for the polypeptides, Also included is the use of purified MCH-R chimeric or fusion proteins produced by recombinant means introduced into a variety of environments suitable for measuring G protein activity.

[0059]   Fluorescent protein assay   Using a fluorescent protein bound to the MCH receptor, receptor sequestration (sequence)
station), receptor desensitization and receptor
Various aspects of receptor kinetics can be studied, including receptor localization. The firefly
The photoprotein can be used in in vitro or in vivo systems.

In vitro application of fluorescent proteins can be done using techniques well known in the art. Specific examples of such techniques are described in Barak et al., 1997.
Mol Pharm. 5, 177-184; Tarasova et al., 1997. J
． Biol. Chem. 272, 14817-14824; Lin et al., 1998.
． Mol. Cell. Endo. 146, 27-37; Tarasova et al., 1
998. J. Biol. Chem. 273, 15883-15886; Kall
al et al., 1998. J. Biol. Chem. 273, 322-328; Gro
ake et al., 1999. J. Biol. Chem. 274, 23263-2326
9; Doherty et al., 1999. Biochem. J. 341, 415-42
2; Block et al., 1999. Proc. Natl. Acad. Sci. USA
96, 10123-10128; Cornea et al., 1999. Endocri
nolgy 140, 4272-4280; and Lembo et al., 1999.
Nat. Cell Biol. 1, 267-271 (these references are not admitted to be prior art to the present invention).

In vivo application of fluorescent proteins can be done using techniques well known in the art. Specific examples of such techniques are described by Mombaerts et al., 19
96. Cell 87, 675-686; Rodriquez et al., 1999. C
Ill 97, 199-208; Spergel et al., 1999. J. Neuro
sci. 1,2037-2050; and Zuo et al., 1999. Proc. Na
tl. Acad. Sci. USA 96,14100-14105 (these references are not admitted to be prior art to the present invention).

EXAMPLES Examples are provided below to further illustrate various features and advantages of the present invention. The examples also illustrate useful methods for practicing the invention. These examples do not limit the invention.

[0063]   Example 1:   Information on the amino acid and nucleic acid sequences of SEQ ID NOs: 1-29 is shown below. Sequence number 1
To 29 are MCH-R polypeptide region, fluorescent polypeptide region, fusion protein
Of quality and chimeric protein polypeptides and encoding nucleic acid sequences
Including examples. In some cases, the encoding nucleic acid is an open reading
It is shown with additional nucleic acid upstream or downstream from the frame.

[0064]

[Chemical 1]

[0065]

[Chemical 2]

[0066]

[Chemical 3]

[0067]

[Chemical 4]

[0068]

[Chemical 5]

[0069]

[Chemical 6]

[0070]

[Chemical 7]

[0071]

[Chemical 8]

[0072]

[Chemical 9]

[0073]

[Chemical 10]

[0074]

[Chemical 11]

[0075]

[Chemical 12]

[0076]

[Chemical 13]

[0077]

[Chemical 14]

[0078]

[Chemical 15]

[0079]

[Chemical 16]

[0080]

[Chemical 17]

[0081]

[Chemical 18]

[0082]

[Chemical 19]

[0083]

[Chemical 20]

[0084]

[Chemical 21]

[0085]

[Chemical formula 22]

[0086]

[Chemical formula 23]

[0087]

[Chemical formula 24]

[0088]

[Chemical 25]

[0089]

[Chemical formula 26]

[0090]

[Chemical 27]

[0091]

[Chemical 28]

[0092]

[Chemical 29]

[0093]   Example 2: Preparation of chimeras and fusion proteins   How many of MCH-R receptor (MCH1R) and green fluorescent protein (GFP)
Different fusion proteins with different superbright mutants
DNA vector was prepared. GFP mutant with a 12 amino acid linker
: TCGACGGTACCGCCGGGCCCGGGATCCCATCGCCACC
(SEQ ID NO: 30), amino acid sequence: VDGTAGPGSIAT (SEQ ID NO: 31)
Via (linker fusion) or directly to the end of MCH1R (direct fusion)
) Fused.

[0094]   Mouse MCH1R-linker-GFP mutant fusion construct   First, mouse MCH1R is ligated to the enhanced green fluorescent protein via the linker.
In-frame fused to quality (EGFP). High-accuracy polymerase mixture (E
xpand High Fidelity PCR System from
Boehringer Mannheim) and N-terminal and C-terminal respectively
PCR primers [MCH1R (
EcoRI) 5 ': GCGAATTCACCATGGATCTGCAAGCCT
CG (SEQ ID NO: 32), MCH1R (SalI) 3 ': GCGTCGAGCGGT
GCCTTTGCTTTCTGTCC (SEQ ID NO: 33)] and MCH
PCR amplification of 1R from full-length mouse MCH1R genomic DNA lambda clone (9
5 ° C for 5 minutes; 95 ° C for 30 seconds, 60 ° C for 45 seconds, 68 ° C for 3.5 minutes 1
5 cycles; 68 ° C. for 7 minutes). In addition, the MCH1R N-terminal PCR primer
The mer contains a Kozak consensus sequence for translation (5 'containing an NcoI site.
-ACCATGG-3 '), the MCH1R C-terminal PC
R primer removes the endogenous stop codon present in the mouse MCH1R gene
Designed to do. The resulting PCR product is phenol / chloroform extracted,
Restriction digested with EcoRI and SalI, gel purified, EcoRI site and Sal
Multicloning of Clontech's pEGFP-N3 vector between I sites
In-frame subcloning within the cloning site. Got this construct
A few clones were sequenced to obtain clones with completely correct nucleotide sequences.
Have been identified. This clone was named after mouse MCH1R-linker-EGFP.
Therefore, it was designated as mMCH1R-1-EGFP.

An approximately 760 bp SalI-NotI fragment of mMCH1R-1-EGFP was excised, gel purified and pBluescript between the Sal1 and NotI sites.
It was subcloned into the multiple cloning site of pt (SK +) (Stratagene). The approximately 710 bp NcoI-BsrG1 fragment of EGFP was excised from the resulting pBluescript-EGFP vector to obtain the vector pRS.
ET-Emerald, pRSET-Topaz and pRSET-W1B were replaced with the corresponding NcoI-BsrG1 fragments of Emerald, Topaz or W1B (other super bright GP mutants), respectively. pRSET-Eme
rald, pRSET-Topaz and pRSET-W1B are Aurora
Biosciences Co. Obtained from. Emerald, Topaz
Alternatively, the SalI-NotI fragment containing W1B was obtained with pBl
It was excised from the uescript-Emerald, pBluescript-Topaz and pBluescript-W1B vectors. The appropriate fragment was gel purified and subcloned into mMCH1R-1-EGFP digested with SalI and NotI to obtain the SalI-NotI EGFP fragment in Emerald.
, Topaz or the corresponding SalI-NotI fragment from W1B. Some of the clones in each construct were sequenced to confirm the presence of the appropriate GFP variant. The obtained vector was used as mouse MCH1R-linker-Emerald, mouse MCH1R-linker-Topaz and mouse MCH1R-linker-W1.
After B, mMCH1R-l-Emerald, mMCH1R-l, respectively
-Topaz and mMCH1R-l-W1B.

[0096]   Mouse MCH1R / GFP mutant direct fusion construct   A two-step PCR method was used to generate the direct fusion construct. First, the mouse
MCH1R, EGFP and Emerald, respectively, in full-length mouse MCH1
R genomic DNA lambda clone, Clontech pEGFP-N3 vector
And PCR amplified from the Aurora pRSET-Emerald vector
. Mouse MCH1R was cloned into the same N-terminal PCR plasmid according to the conditions previously described.
Immers [MCH1R (EcoRI) 5 ': GCGAATTCACCATGGAT
CTGCAAGCCCTCG (SEQ ID NO: 32)] was used for PCR amplification. Only
However, in this case different C-terminal PCR primers were used. The C-terminal PCR
Reimer [MCH1R (EGFP / Emerald) 3 ': CCTTCGCTCA
CCATGGTGCCTTTGCTTTCTGTCC (SEQ ID NO: 34)] is
In the same manner as described above, the endogenous termination codon of mouse MCH1R was removed and the N-terminal of EGFP was deleted.
A region of nucleotide sequence complementary to the nucleotide sequence was introduced.

A common N-terminal PCR primer [EGFP / Emerald (MCH1R) 5 ′: CA which gives a region of nucleotide sequence complementary to the C-terminus of mouse MCH1R.
GAAAGCAAAGGCACCCATGTGTAGCAAGGGCGAGGGAG
C (SEQ ID NO: 35)] and a C-terminal PCR primer [EGFP3 ′: GGCGGATCCCTCTAGAGTCCGCGGGCC ′ (SEQ ID NO: 36) or Emerald (EGFP) 3 ′: GCTCTAGAGTC, which provides a NotI site at the C-terminus.
GCGGCCGCTTTACTTGTACAGCTCGTC (SEQ ID NO: 37)]
And a high fidelity polymerase mixture (Advan from Clontech
PCR amplification (95 ° C. for 5 minutes; 95 ° C. for 30 seconds, 60 ° C. for 45 minutes) of EGFP and Emerald separately from each template using target HF-2).
For 15 seconds at 68 ° C for 1.5 minutes; 68 ° C for 7 minutes). Obtained P
The CR product was electrophoresed on an agarose gel and the appropriate fragment was gel purified.

In the second PCR step, the previously prepared mouse MCH1R and EGFP were prepared.
, Or a PCR reaction between mouse MCH1R and Emerald PCR products was prepared. After a denaturation step of 5 minutes at 95 ° C, two rounds of thermal cycling (95 ° C for 30 seconds, 60 ° C for 45 seconds, 68 ° C for 4 minutes) were performed in the absence of PCR primers. This is because the mouse MCH1R and GFP mutants anneal in their complementary regions to a high fidelity polymerase mixture (Boehringer).
Expand High Fidelity PCR from Mannheim
System) and provided double-stranded template DNA.

Then, the common N-terminal mouse MCH1R [MCH1R (EcoRI) 5 ′: G
CGAATTCACCATGGATCTGCAAGGCCTG (SEQ ID NO: 32)
] And a suitable C-terminal PCR primer [EGFP3 ′: GGCGGATCCT]
CTAGAGTCCGGGCC (SEQ ID NO: 36) or Emerald (EGF
P) 3 ': GCTCTAGAGTCCGCGCCGCTTACTTGTACAG
CTCGTCC (SEQ ID NO: 37)] was added to the reaction and the thermal cycling was continued for another 15 cycles followed by a final extension at 68 ° C. for 7 minutes. The resulting PCR product was phenol / chloroform extracted, restriction digested with EcoRI and NotI, electrophoresed on an agarose gel, and the appropriate fragment was gel purified.

These EcoRI-NotI fragments correspond to a direct fusion between mouse MCH1R and EGFP, or mouse MCH1R and Emerald. Clo
The ntech pEGFP-N3 vector was restriction digested with EcoRI and NotI to release an approximately 780 bp EcoRI-NotI EGFP fragment. This restriction digest was electrophoresed on an agarose gel to give approximately 3.9 Kb pEGFP-N3.
The vector backbone was gel purified. EcoRI-NotI mouse MCH1R
/ EGFP or mouse MCH1R / Emerald direct fusion fragment to the pEG
It was subcloned between the EcoRI and NotI sites in the FP-N3 vector backbone. The resulting several clones of each of these two constructs were sequenced in order to identify clones with the correct nucleotide sequence. However, no clone was identified with a perfectly correct nucleotide sequence. Fortunately, some of the clones of each of these two constructs only have a nucleotide mismatch within the intron region of mouse MCH1R, thus affecting the functionality of the resulting fusion protein. Was not expected. These clones were named after the mouse MCH1R / EGFP direct fusion and mouse MCH1R / Emerald direct fusion, respectively, in mMCH1.
They were named R / EGFP and mMCH1R / Emerald.

[0101]   Human short and long form / mouse species chimeric MCH1R-linker-GFP mutant fusion Combined structure   Human short form and human long form / mouse species chimeric MCH1R-linker-GFP
To generate both mutant fusion constructs, an initial mouse MCH1R-linker
-A GFP variant fusion construct was modified. Exon 1, the intron and 127
Approximately 1.7 kb Hi of the mouse MCH1R gene containing the amino acid exon 2
ndIII-BspEI fragment with various mouse MCH1R-linker-GFP mutations
Excised from the somatic fusion construct of approximately 470 bp from the wild type human MCH1R short form
About 6 from the HindIII-BspEI fragment or the wild type human MCH1R long form.
It was replaced by a 70 bp HindIII-BspEI fragment.

Several clones of each construct were sequenced to confirm the presence of the human MCH1R short or long form N-terminal region. These clones were named after the human short form / mouse species chimeric MCH1R-linker-GFP variant and human long form / mouse species chimeric MCH1R-linker-GFP variant, respectively.
/ MMCH1R-1-GFP variant or hlong / mMCH1R-1-GF
It was named P mutant.

[0103]   Example 3: Functional evaluation of MCH1R / GFP mutant fusion protein   HEK293 Aequorin (National Institutes)
  of Health) and CHO mammalian cell lines to various MCH1R / GFP
Mutant fusion constructs and appropriate control constructs were transiently transfected. L
ipofectamine 2000 (Gibco BRL) is recommended by the manufacturer.
Transfections were performed using the recommended protocol. Transfer
Approximately 48 hours post-operation, cells were harvested, stimulated with various concentrations of human MCH, and
Quorin bioluminescence (HEK293 Aequorin cells) or cAMP production
(CHO cells). Aequorin bioluminescence is intracellular Ca²⁺ It is a typical measure of mobilization. Production of cAMP by Adenylyl Cyclas
e Activation FlashPlate Assay (NEN Li
fe Science Products, Inc. ).

MMCH1R-linker-EGF into HEK293 Aequorin cells
After transient transfection of the P construct (MCH-R-I-EGFP), the resulting fusion protein showed functional activity comparable to the wild type human MCH1R short form (MCH-R wt). In this functional assay, mMCH1R-1-
The EC ₅₀ value of EGFP was almost the same as that of the wild type human short form receptor (FIG. 1).

MMCH1R-1-EGFP and mMCH1R / EGFP into CHO cells
After transient transfection of the fusion construct, the resulting fusion protein showed functional activity comparable to the wild type human MCH1R short form. In this functional assay, the EC ₅₀ values of mMCH1R-1-EGFP and mMCH1R / EGFP were similar to the wild type human short form receptor (Table 1). Corresponding Emera
Transient transfection with the Id construct gave similar results (data not shown).

[0106]

[Table 1]

Human Short Form / Mouse Species Chimeric MCH1R-l-EGF into HEK293 Cells
P (HuShort / mMCH1R-1-EGFP) and human long form / mouse species chimera MCH1R-1-EGFP (HuLong / mMCH1R-1-EGF)
After transient transfection of the P) construct, the resulting fusion proteins showed comparable functional activity to the wild type human MCH1R short and long forms, respectively. In this functional assay, the EC ₅₀ value of each fusion protein was similar to the corresponding wild type human receptor (FIG. 2).

[0108]

[Table 2]

Human Short Form / Mouse Species Chimeric MCH1R-l-EGFP (H into CHO Cells
After transient transfection of the uShort / mMCH1R-1-EGFP) and human long form / mouse species chimeric MCH1R-1-EGFP (HuLong / mMCH1R-1-EGFP) constructs, the fusion proteins obtained were respectively wild type It showed a comparable or lower functional activity to the human MCH1R short and long forms (Table 3). In this functional assay, human _{The EC 50} values of the short form / mouse species chimera MCH1R-l-EGFP fusion protein will be compared to the corresponding wild-type human receptor, human length forms / mouse species chimera MCH1R- l-
EGFP fusion proteins had the about 7.5-fold than the corresponding wild-type control high _{The EC 50} values.

[0110]

[Table 3]

Transient expression of all MCH1R / GFP mutant fusion proteins that underwent functional evaluation gave fluorescence primarily associated with the plasma membrane of both HEK293 and CHO cells (data not shown). This fluorescence pattern matched the predominant membrane-bound localization.

[0112]   Example 4: Generation of stable cell lines   SuperFect (Qiagen) and mouse MCH-1R-EGFP or
Using the human short / mouse species chimeric MCH-1R-EGFP, wild type CHO cells were used.
Cells were transfected. 48 hours after transfection, G418 was included.
Transfected cells were subjected to positive selection in culture medium for about 10 days
. After selection, to increase the population of cells expressing EGFP, MCH-1R-
CHO cells expressing EGFP were transformed into Fluroscience Assisted
  Cell sorting (FACS) gives 1 or 2 lines based on fluorescence intensity
Bulk sort over the wound. Various after bulk sorting
Individual clones with fluorescence intensity of were isolated by FACS and expanded.

To identify clones with a good specific binding window, fluorescently labeled M
Fluorome for screening large numbers of stable clones by whole cell binding with a CH derivative (SymJz-MCH, PE Biosystems).
tric Microvolume Assay Technology (FM
AT) was used first. Some clones showing a specific binding window greater than 3-fold were further evaluated for MCH binding by a SPA-based binding assay. Cells from individual clones were dissociated in enzyme-free dissociation medium to prepare cell membranes, which were then [ ¹²⁵ I] Phe ¹³ Ty in the presence of human MCH.
They were tested for their ability to bind to r ¹⁹ -MCH. Mouse MCH-1R-EGF
P or C expressing human short / mouse species chimeric MCH-1R-EGFP (FIG. 4)
The HO cell line showed IC50 values for MCH indistinguishable from the corresponding IC50 values obtained with the CHO cell line expressing the wild-type human short isoform of MCH-1R.

The functional activity of these clones was confirmed by cAMP Flashplate Assay.
It was evaluated by y (FIGS. 2 and 3). The CHO cell line expressing mouse MCH-1R-EGFP (FIG. 2) or human short / mouse species chimeric MCH-1R-EGFP (FIG. 3) is a CHO cell line expressing the wild-type human short isoform of MCH-1R. The EC50 value for human MCH that is indistinguishable from the EC50 value obtained in 1. was shown.

Subcellular localization of MCH-1R-EGFP fusion protein was determined by confocal microscopy using EGFP fluorescence as a marker for MCH-1R expression. Mouse MCH-1R-EGFP or human short / mouse species chimeric MCH-1R-
CHO cell lines stably expressing EGFP exhibit EGFP fluorescence predominantly associated with the cell membrane, indicating that these MCH-1R-EGFP fusion proteins are predominantly associated with the cell membrane.

The claims include other embodiments. While some embodiments have been shown and described, various modifications can be made without departing from the spirit and scope of the invention.

[Brief description of drawings]

FIG. 1 shows mouse MCH-R fusion proteins derived from human wild type MCH-R and CM.
5 shows the results of an aequorin assay comparing V-EGFP control.

FIG. 2 c of CHO cell clones stably expressing mMCH-1R-EGFP.
1 shows an AMP flashplate assay. Cells from individual clones were dissociated in enzyme-free medium and stimulated with human MCH at the indicated concentrations for 15 minutes at 37 ° C. in the presence of 10 μM forskolin.
The cells were then lysed and assayed for bound [ ¹²⁵ I] cAMP. The mouse MCH-1R-EGFP clone has an EC50 value (0.1111, 0.1255, 0.1291) indistinguishable from the EC50 value (0.1282 nM) of the CHO cell clone expressing the wild-type human short isoform of MCH-1R. Or 0.
2304 nM).

FIG. 3 shows C stably expressing human short / mouse species chimeric MCH-1R-EGFP.
1 shows a cAMP flashplate assay of HO cell clones. Cells from individual clones were dissociated in enzyme-free medium and stimulated with human MCH at the indicated concentrations for 15 minutes at 37 ° C. in the presence of 10 μM forskolin. The cells were then lysed and assayed for bound [ ¹²⁵ I] cAMP. Human short / mouse species chimeric MCH-1R-EGFP clones have EC50 values (0.1137) for CHO cell clones expressing the wild-type human short isoform of MCH-1R.
EC50 values (0.0366, 0.0462, 0.211) indistinguishable from nM)
7 or 0.2499 nM).

[Sequence list]

─────────────────────────────────────────────────── ─── Continued Front Page (51) Int.Cl. ⁷ Identification Code FI Theme Coat (Reference) C07K 19/00 C12N 1/15 C12N 1/15 1/19 1/19 1/21 1/21 C12Q 1 / 02 5/10 C12N 15/00 ZNAA C12Q 1/02 5/00 AF Term (reference) 4B024 AA11 BA63 CA04 CA07 DA02 EA04 GA11 HA12 4B063 QA18 QR60 QR77 QR80 QS24 QS28 QS36 QX02 4B065 AA91X AA91Y AA93CA14X AA93Y AB 4H045 AA10 AA30 BA10 BA41 CA40 CA50 DA50 EA50 FA74

Claims (30)

[Claims] 1. A) melanin-concentrating hormone receptor polypeptide region comprising a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, and b) the melanin-aggregate. A fusion protein comprising a fluorescent polypeptide region linked to the carboxy side of a hormone receptor polypeptide region directly or via a linker. 2. The protein according to claim 1, wherein the fluorescent polypeptide region comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10. 3. The melanin-concentrating hormone polypeptide region comprises SEQ ID NO: 1,
The protein according to claim 2, comprising a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5. 4. The protein according to claim 3, wherein the protein consists essentially of the melanin-concentrating hormone receptor polypeptide region and the fluorescent polypeptide region. 5. The protein according to claim 4, wherein the protein consists of the amino acid sequence of SEQ ID NO: 11 or SEQ ID NO: 12. 6. The first melanin-concentrating hormone polypeptide region bound to (a) the MCH binding region from the first species and (b) directly to the carboxy side of the MCH binding region or via a linker. The protein of claim 1, which is a chimeric polypeptide comprising a transmembrane and intracellular domain region from two species. 7. The protein according to claim 6, wherein the fluorescent polypeptide region comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10. 8. The protein according to claim 7, wherein the protein consists of the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 14. 9. A) a melanin-concentrating hormone-binding region characteristic of human melanin-concentrating hormone receptor, b) a transmembrane domain characteristic of a non-human melanin-concentrating hormone receptor, and c) a non-human melanin-concentrating hormone receptor. A chimeric melanin-concentrating hormone protein comprising an intracellular domain characteristic of. 10. The protein of claim 9, wherein the protein comprises a melanin-concentrating hormone receptor polypeptide having at least 75% sequence similarity to SEQ ID NO: 4 or SEQ ID NO: 5. 11. The protein of claim 10, wherein the protein comprises the sequence of SEQ ID NO: 4 or SEQ ID NO: 5. 12. The protein according to claim 11, wherein the protein consists of the sequence of SEQ ID NO: 4 or SEQ ID NO: 5. 13. A nucleic acid comprising a nucleotide sequence encoding the protein of claim 1. 14. The nucleic acid of claim 13, wherein the nucleotide sequence is a continuous sequence. 15. The nucleic acid of claim 13, wherein said nucleotide sequence is selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 and SEQ ID NO: 29. 16. A nucleic acid comprising a nucleotide sequence encoding the protein of claim 9. 17. The nucleic acid of claim 16, wherein the nucleotide sequence is a continuous sequence. 18. The nucleotide sequence of SEQ ID NO: 19 and SEQ ID NO: 20.
The nucleic acid according to claim 16, which is selected from the group consisting of: 19. An expression vector comprising the nucleic acid according to claim 13. 20. An expression vector comprising the nucleic acid according to claim 16. 21. A recombinant cell comprising the nucleic acid of claim 13. 22. The recombinant cell of claim 21, wherein the nucleic acid is in an expression vector. 23. The recombinant cell of claim 21, wherein the nucleic acid is in the genome of the cell. 24. A recombinant cell comprising the nucleic acid of claim 16. 25. The recombinant cell of claim 24, wherein the nucleic acid is in an expression vector. 26. The recombinant cell of claim 24, wherein the nucleic acid is in the genome of the cell. 27. A non-human transgenic animal comprising the nucleic acid of claim 13. 28. A non-human transgenic animal comprising the nucleic acid of claim 16. 29) a) contacting the cells of claim 21 with a test preparation containing one or more test compounds, and b) determining the effect of the test preparation on one or more melanin-concentrating hormone receptor activity. An assay method for melanin-concentrating hormone receptor active compounds, comprising the steps of: 30. a) Contacting the cells of claim 24 with a test preparation containing one or more test compounds, and b) determining the effect of the test preparation on one or more melanin-concentrating hormone receptor activity. An assay method for melanin-concentrating hormone receptor active compounds, comprising the steps of: