JP2003523193A - Compositions useful for regulating Parkin activity - Google Patents

Abstract

  (57) [Summary] The present invention relates to novel compounds and their use, especially as pharmaceutical, diagnostic or pharmacological targets. More specifically, the present invention relates to a novel protein called PAP1, and to novel proteins and compounds that can at least partially modulate Parkin gene activity.

Description

Detailed Description of the Invention

The present invention relates to compositions and methods useful for modulating the activity of parkines. More specifically, the present invention relates to PAP as a binding partner of Parkin.
1 as well as a novel protein designated 1 as well as peptides or polypeptides derived from or homologous to said protein. The present invention also relates to compounds capable of at least partially modulating Parkin activity, in particular Parkin and PAP1.
To compounds that may interfere with the interaction with. INDUSTRIAL APPLICABILITY The present invention is useful in the fields of therapy and diagnosis, and also for constituting a pharmacological target useful for the development of new drugs.

The Parkin gene is mutated in several familial forms of Parkinson's disease (juvenile autosomal recessive disease) (Kitada et al., 1998). Parkinson's disease (Lewy, 1912) is one of the most representative neurodegenerative diseases, affecting more than 1% of the population over 55 years of age. Patients suffering from this disease have various neurological disorders, which are collectively referred to as Parkinson's syndrome. Characteristic symptoms are muscle rigidity, immobility, and tremor at rest. These symptoms result from the degeneration of substantia nigra dopaminergic neurons in the brain.

Most cases of Parkinson's disease are not familial diseases. However, there are some familial cases, some of which are monogenic diseases. At the present time, only three genes that differ in some hereditary forms with few cases have been identified. The first form is the autosomal dominant form, the causative gene of which encodes alpha synuclein (Polymeropoulos et al., 1997). This protein acts as a marker for Parkinson's disease L
It is a major component in the intracytoplasmic inclusion body called the ewy body (Lewy, 1912).
The second form, also an autosomal dominant form, involves mutations in the gene encoding a hydrolase called carboxy-terminal hydrolase L1 of ubiquitin (Leroy et al., 1998). It is speculated that this enzyme hydrolyzes ubiquitin in polymeric or conjugated form to ubiquitin in monomeric form.
The third form is characterized by being autosomal recessive type, often developing before the age of 40, and lacking the Lewy body, as compared with the above two forms. For patients with this form, the dopamine precursor L-dopa, which is used as a therapeutic drug for Parkinson's disease, is extremely effective. The gene involved in this form encodes a new protein called Parkin (Kitad
a et al., 1998).

The Parkin gene is composed of 12 exons containing a genomic region of chromosome 6 (6q25.2-q27) of 500,000 base pairs or more. At present, there are mainly two mutations in this gene early in the disease, namely exons 2-9.
It has been found that there are mutations that cause deletions of various sizes, or point mutations that cause early appearance of a termination codon or amino acid changes (Kitada et al., 1998; Abbas et al., 1999). Lucking et al.,
1998; Hattori et al., 1998). The nature of these mutations and the autosomal recessive transmission mode suggest that reduced Parkin function leads to Parkinson's disease.

This gene is expressed in many tissues, especially the substantia nigra. There are multiple transcripts corresponding to this gene as a result of different alternative splicing (Kitada).
Et al., 1998; Sunada et al., 1998). Two types of messenger R in the brain
NA is present, and in one messenger RNA, the portion corresponding to exon 5 is deleted. Parkin gene messenger RN identified in leukocytes
A does not include the regions encoding exons 3, 4 and 5. The longer messenger RNA of the Parkin gene present in the brain contains 2960 bases,
It encodes a protein consisting of 5 amino acids.

The N-terminal part of this protein has little homology with ubiquitin. The C-terminal half is IBR (In Between Rin) corresponding to a region rich in cysteine.
g) contains two "ring finger" motifs separated by domains,
Can bind metals as "zinc finger" domains (Morett, 199).
9). Localization of parkin to the cytoplasm and Golgi apparatus of substantia nigra neurons containing melamine was demonstrated by immunohistochemistry (Shimura et al., 199).
9). Furthermore, this protein is present in some Lewy bodies of Parkinson's disease patients. Although the cellular function of parkin has not been elucidated yet, it plays a role as a transporter in synaptic vesicles, during protein maturation or degradation, and in controlling cell proliferation, differentiation, or development. Conceivable. Parkin is absent in the juvenile autosomal recessive form. Therefore, one can be sure that this loss of function contributes to the disease.

Therefore, elucidating the exact role of Parkin proteins in the degeneration process of dopaminergic neurons is to understand the whole picture of Parkinson's disease and to develop a treatment method therefor, more generally in central nervous system diseases. Is the most important task to understand the whole picture and to develop its treatment method.

The object of the present invention is to identify binding partners of Parkin that interact with Parkin under physiological conditions. Parkin binding partners are new targets in pharmacology to produce or study compounds that can modulate the activity of Parkin, especially compounds that can modulate the activity of Parkin with respect to degeneration of dopaminergic neurons and / or progression of neurological disease. is there. The proteins, antibodies, corresponding nucleic acids and specific probes or specific primers are also useful for detecting or quantifying proteins in biological specimens, especially neural tissue specimens. These proteins or nucleic acids are also useful in therapeutic methods such as modulating the interaction of Parkin with a polypeptide of the invention in order to modulate the activity of Parkin or the activity of a compound of the invention. .

More specifically, the present invention results from the discovery by the Applicants of a novel human protein that interacts with Parkin. This protein is called PAP1 (P
arkine Associated Protein 1) or LY111
Call. The PAP1 protein (Sequence 1 or 2) has some homology to synaptotagmin and may specifically interact with the central region of Parkin (represented by Sequence 3 or 4). The PAP1 protein is also derived from various tissues of human origin, in particular the lungs (sequences 12, 13) and the brain (sequences 42, 43) and also in the truncated form (sequences 14, 15, 44) corresponding to variants due to splicing. 45), cloned, sequenced and characterized.

The present invention also resulted from the identification and characterization of specific regions of the PAP1 protein involved in modulation of Parkin function. By discovering the existence of this protein and elucidating the region involved in its function, it is possible to produce a novel compound and / or composition useful as a medicine, and to develop an industrial screening method for such a compound. It became possible to do.

Accordingly, a first object of the present invention is to at least partially modulate the interaction of PAP1 proteins (or their homologs) with parkin (particularly human parkin) or the interaction of these proteins. It is to provide compounds that can interfere with steps.

Another object of the invention is to provide PAP1 proteins, fragments, derivatives and homologs thereof.

Another object of the invention is a nucleic acid encoding a PAP1 protein, a fragment, derivative or homologue thereof, a vector containing such a nucleic acid, a recombinant cell containing such a nucleic acid or a vector, and such a A non-human mammal containing the nucleic acid in its cell is to be provided.

The present invention also relates to an antibody capable of binding to PAP1 protein, fragments, derivatives and homologues thereof, in particular a polyclonal antibody or a monoclonal antibody, more preferably PAP1 protein capable of binding the interaction between PAP1 protein and Parkin. Antibodies capable of at least partial inhibition.

Another object of the invention is the pap1 gene or one of the genes in any biological specimen.
To provide a PAP1-specific nucleotide probe or primer useful for detecting or amplifying one region.

The present invention also relates to pharmaceutical compositions, methods of detecting genetic abnormalities, methods of producing a polypeptide as defined above, methods of screening or characterizing active compounds.

As mentioned above, a first object of the present invention is to provide compounds which can at least partially interfere with the steps of the interaction of the PAP1 protein (or its homolog) with Parkin.

The term PAP1 protein as used herein means the protein itself and all homologous forms of the protein. The term homologous is equivalent to the protein under consideration and means all proteins derived from different cells, in particular human cells or cells of non-human organisms, which have the same type of activity. Such homologues also imply natural variants of the PAP1 protein having sequence 2, in particular variants due to polymorphism or due to splicing.
Such homologues are also obtained by hybridization experiments with coding nucleic acids, especially nucleic acids of sequence 1. In the range used in the text,
It is sufficient that this kind of sequence has a significant percentage of concordance to lead to a physiological behavior similar to that of the claimed PAP1 protein. The term significant concordance percentage is at least 60%, preferably 8
It means a percentage of 0%, more preferably 90%, even more preferably 95%. In this respect, sequences 13, 15, 43 and 45 identified from human origin tissue are variants of sequence 2 and / or homologues. Therefore, the name PAP1 also includes these polypeptides.

In the range used herein, the “percentage match” of two nucleotide or amino acid sequences is determined by comparing the two optimally aligned sequences in a comparison window.

Therefore, the portion of the nucleotide or polypeptide sequence that falls within the comparison window is such that the optimal alignment of the two sequences is obtained relative to the reference sequence (without additions or deletions). It may include additions or deletions (eg "gaps").

To calculate the percentage, the number of positions where the same nucleobase or amino acid residue is observed in the two compared sequences (nucleic acid sequence or peptide sequence) is determined and the base or amino acid in both sequences is determined. The sequence match percentage is obtained by dividing the number of positions where there is a residue match by the total number of positions in the comparison window and then multiplying the resulting quotient by 100.

The optimal alignment of the comparative sequences is WISCONSIN GENETICS SO
FTWARE PACKAGE, GENETICS COMPUTER GRO
UP (GCG), 575 Science Doctor, Madison,
It can be performed by computer processing using a known algorithm included in the WISCONSIN package.

For example, BLAST software (BLAST 1.4.9, March 1996)
Version, February 1998 BLAST 2.0.4 version and 1998
BLAST 2.0.6 version, September 2010, and by using the round-down parameter exclusively (Altschul et al., J. Mol. Bio.
l. (1990) 215; 403-410; Altschul et al., Nuclei.
c Acids Res. (1997) 25: 3389-3402) The percentage sequence match can be calculated. Blast uses the algorithm of Altschul et al. (Supra) to search for sequences similar / homologous to the canonical "request" sequence. The request sequences and databases used may be peptide or nucleic acid sequences, or any combination thereof.

Interference with the compounds of the invention manifests itself in various forms. For example, the compound at least partially suppresses, inhibits or stimulates the interaction of PAP1 protein or one of its homologs with Parkin. Preferably, the compound is capable of modulating an interaction as described above in vitro, eg in a two-hybrid system or an acellular system which detects the interaction between two polypeptides. Preferred compounds of the invention are compounds which are capable of at least partially modulating this interaction, more preferred compounds of the invention have this interaction by at least 20%, more preferably by comparison with a control in the absence of the compound. A compound capable of enhancing or inhibiting at least 50%.

In a particular embodiment of the invention, the compound interferes with the step of the interaction between the region of Parkin represented by SEQ ID NO: 4 and the PAP1 protein represented by SEQ ID NO: 2, 13, 15, 43 or 45. obtain.

In a particular embodiment of the invention, the compound may bind to the interaction domain of the PAP1 protein or one of its homologs with Parkin.

The compounds of the present invention can have various types and origins. In particular, peptide type, nucleic acid type (
That is, it may be a nucleic acid containing a chain of bases, particularly a DNA molecule or an RNA molecule), a lipid type compound, a sugar type compound, an antibody and the like, and more generally includes all organic or inorganic molecules.

The first class of compounds of the invention is in the peptide form. The term peptide refers to any molecule containing a chain of amino acids, such as peptides, polypeptides, proteins,
By imposing antibodies (or fragments or derivatives of antibodies), these peptides may optionally be modified or attached to another compound or chemical group. In this respect, the term "peptide" more specifically means a molecule consisting of a chain of 50 amino acids or less, more preferably 40 amino acids or less. The polypeptide (or protein) preferably comprises 50-500 or more amino acids.

According to a first preferred embodiment, the compound of the invention comprises all or part of peptide sequence 2 or any one of its derivatives, in particular peptide sequence 13, 15, 43.
Or a peptide compound comprising all or part of 45 or a derivative thereof, more particularly a PAP1 protein comprising the sequence 2, 13, 15, 43 or 45.

As used herein, the term derivative refers to one or more genetically modified and / or
Or hybridizes to any sequence that differs from the sequence under consideration due to alterations in the genetic code caused by chemical modification, as well as nucleic acid sequence 1 or a fragment thereof, such as nucleic acid sequence 12, 14, 42 or 44 or a fragment thereof. By all sequences is meant any peptide capable of interfering with the steps of interaction of the PAP1 protein or one of its homologs with Parkin. The term genetic modification and / or chemical modification means any mutation, substitution, deletion, addition and / or modification of one or more residues. The term derivative also means a sequence homologous to the sequence under consideration, which is derived from another cell source, in particular a human cell or a cell of a non-human organism and which has the same activity as the sequence under consideration. Such homologous sequences can be obtained by hybridization experiments. Hybridization is carried out under various hybridization conditions using a nucleic acid library as a starting material and a native sequence or a fragment thereof as a probe (Maniatis et al., 1989). Further, the term "fragment" or "portion" refers to a portion of the molecule under consideration that is 5 or more consecutive residues, preferably 9 or more consecutive residues, more preferably 15 or more consecutive residues. Means all parts including the residue. A typical fragment may contain at least 25 contiguous residues.

Such a derivative or fragment may have various pharmacological and / or biological properties for various purposes, in particular, for enhancing the therapeutic effect or suppressing side effects, or for providing these derivatives or fragments with novel pharmacological and / or biological properties. It can be produced for the purpose of giving.

Peptides derived from PAP1 proteins and homologues include in particular peptides which have the ability to interact with parkin but which contain non-functionalized effector regions. Such peptides are obtained by creating deletions, mutations or disruptions in the PAP1 protein and its homologous effector regions. Such modifications are obtained, for example, by in vitro mutagenesis, the introduction of additional elements or synthetic sequences, or the deletion or substitution of early elements. When the derivatives as defined above are produced, it can be demonstrated that these derivatives have the activity of partially inhibiting the binding of the PAP1 protein or its homologues to the binding site of Parkin. It will be clear that for this purpose any technique known to the person skilled in the art may be used.

The invention also provides fragments of the sequences as described above. Such fragments can be made in a variety of ways. In particular, peptide synthesizers known to those skilled in the art can be used to synthesize by chemical methods based on the sequences given in this application. It can also be synthesized by the genetic method in which the nucleotide sequence encoding the desired peptide is expressed in the cell host. In this case, the nucleotide sequence can be chemically synthesized using an oligonucleotide synthesizer based on the peptide sequence and the genetic code provided in this application. Nucleotide sequences may also be prepared by starting from the sequences given in this application by enzymatic cleavage, ligation, cloning, etc. according to techniques known to those skilled in the art, or with probes made from these sequences D
It may be produced by screening an NA library.

Furthermore, the peptides of the invention, ie the peptides capable of at least partially modulating the interaction of the PAP1 protein and homologs with parkin, also have a site at the PAP1 protein and homologues which results in the interaction with parkin. It may be a peptide having the corresponding sequence.

Another peptide of the invention is a peptide that interacts competitively with a peptide as defined above for cellular targets. Such peptides can in particular be synthesized on the basis of the sequences of the peptides under consideration and their ability to compete with the peptides defined above can be determined.

A particular object of the invention is to provide PAP1 proteins. More specifically a PAP1 protein comprising sequence 2 or a fragment or derivative thereof,
For example, to provide a PAP1 protein comprising sequences 13, 15, 43, 45 or fragments thereof.

Another object of the invention is to provide a polyclonal or monoclonal antibody or a fragment or derivative of these antibodies against a polypeptide as defined above. Such an antibody can be produced by a method known to those skilled in the art. In particular, these antibodies immunize animals against the peptide compounds of the invention, especially polypeptides or peptides comprising all or part of sequence 2.
It can be prepared by collecting blood and isolating the antibody. These antibodies also
It can be prepared by preparing hybridomas according to techniques known to those skilled in the art.

More preferably, the antibody or antibody fragment of the invention has the ability to at least partially modulate the interaction of the claimed peptides with parkin.

Furthermore, these antibodies can also be used to detect and / or quantify the expression of PAP1 in biological specimens and, consequently, to obtain information about the activation status of the PAP1 protein.

Fragments or derivatives of antibodies are eg fragments Fab, Fab'2,
A single chain antibody (ScFv), etc. In particular, all fragments or derivatives that preserve the antigen specificity of the original antibody are included.

More preferably, the antibody of the invention is capable of binding to a PAP1 protein comprising the sequence 2, 13, 15, 43 or 45, in particular the region of the PAP1 protein involved in the interaction with Parkin. More preferably, these antibodies (or fragments or derivatives) are capable of binding to an epitope present in the sequence from residue 1 to residue 344 of sequence 2.

The present invention also relates to non-peptidic compounds or non-peptidic sole compounds that are useful as pharmaceuticals. That is, it is possible to prepare a non-peptidic PAP1 activity-modulating molecule suitable for pharmaceutical use from the active protein motif described in the present application. In particular, the active motif of the peptide may be replicated with a non-peptidic structure or a non-peptidic single structure.

The object of the invention is also to provide any of the nucleic acids encoding the peptide compounds of the invention. The invention especially provides a nucleic acid comprising all or part of the sequence 1, 12, 14, 42 or 44 or one of its derivatives. The term derivative sequence, as used herein, refers to any sequence that hybridizes to the sequence set forth in SEQ ID NO: 1 or a fragment of said sequence to encode a peptide compound of the invention, and also to the genetic code It means a sequence obtained from the above sequence based on the degeneracy of. Nucleic acids of the invention include, for example, all or part of nucleic acid sequence 12, 14, 42 or 44.

The invention further provides peptide compounds having a significant percentage of concordance to Sequence 1 or to fragments of Sequence 1 and having physiological behavior similar to that of PAP1 protein. For an array that encodes The term significant match percentage means a percentage of at least 60%, preferably 80%, more preferably 90%, even more preferably 95%.

The various nucleotide sequences of the present invention may or may not be artificially produced sequences. The nucleotide sequence is, for example, a genomic sequence, cDNA, RNA, hybrid sequence, synthetic sequence or semi-synthetic sequence. These sequences can be obtained by screening a DNA library (cDNA library, genomic DNA library) or can be obtained by chemical synthesis, and the sequences obtained by screening the library can be obtained chemically or enzymatically. It can also be obtained by a hybrid method including modification, or by searching for homology in a database of nucleic acids or proteins. Hybridization as described above is preferably carried out under the conditions described by Sambrook et al. (1989, pages 9.52-9.55).

The hybridization is advantageously carried out under high stringency hybridization conditions. The term "high stringency hybridization conditions" as used in the present invention refers to the following conditions.

1- Membrane competition and prehybridization : -40 μl salmon sperm DNA (10 mg / ml) and 40 μl human placental DNA (
10 mg / ml). Denaturate at -96 ° C for 5 minutes and then soak the mixture in an ice bath. -Remove SSC 2x buffer and place in hybridization tube containing membrane 4
Inject ml of formamide mix. -Add a mixture of two denatured DNAs. -Incubate at 42 ° C for 5-6 hours with rotation.

2- Competition of labeled probe : -labeled and purified probe with 10 according to non-specific hybridization amount
Add 50 μl of Cot I DNA from. Denaturate at -95 ° C for 7-10 minutes. Incubate at -65 ° C for 2-5 hours.

3- Hybridization : -remove the prehybridization mix. -40 μl salmon sperm DNA (10 mg / ml) and 40 μl human placental DNA (
10 mg / ml). Denaturate at 96 ° C for 5 minutes and then soak the mixture in an ice bath. Add 4 ml of formamide mix, mixture of two DNAs and labeled probe / denatured Cot I DNA to the hybridization tube. Incubate for 15-20 hours at 42 ° C with rotation.

[0050]   4-Washing -Wash with ambient temperature wash 2x SSC. -Wash twice for 5 minutes each with 2x SSC and 0.1% SDS at ambient temperature. Wash twice for 15 minutes each with 0.1X SSC and 0.1% SDS at -65 ° C. The film is wrapped in Saran wrap and exposed.

The above hybridization conditions are suitable for hybridizing nucleic acid molecules of various lengths ranging from 20 nucleotides to several hundred nucleotides under high stringency conditions.

Of course, the hybridization conditions described above can be modified according to techniques known to those skilled in the art to suit the nucleic acid to be hybridized and the type of label selected.

For example, the work of HAMES & HIGGGINS (1985) (Nuclei
c acid Hybridization iapractical App
roach, Hames and Higgins Ed. , IRL Pres
s, Oxford) or F.I. AUSUBEL et al. (1999) work (Curr
ents Protocols in Molecular Biology,
Green Publishing Associates and Wile
y Interscience, N.Y. Y. Suitable hybridization conditions can be adjusted according to the teachings contained in

A particular nucleic acid of the invention encodes a polypeptide comprising sequence 2 or a fragment or derivative thereof, in particular the human PAP1 protein. Advantageous nucleic acids of the invention are nucleic acids comprising the nucleic acid sequence 1, 12, 14, 42 or 44.

Such nucleic acids can be used in the production of the peptide compounds of the present invention. Therefore, the present application relates to a method for producing a peptide compound, which comprises the steps of culturing cells containing the nucleic acid of the present invention under conditions for expressing the nucleic acid, and recovering the produced peptide compound. In this case, the peptide compound-encoding moiety is generally placed under the control of a signal capable of expressing the peptide compound in the cell host. Depending on the cellular host used, these signals (promoter, terminator, secretion "
Selection of "leader" sequences, etc.). In addition, the nucleic acids of the invention may form part of an autonomously replicating or integrating vector. An integrative vector can be made by using sequences homologous to some regions of the host genome into which the vector can be integrated, for example by homologous recombination. There are plasmid vectors, episomal vectors, chromosomal vectors, viral vectors, and the like.

Cellular hosts useful for producing the peptide compounds of the invention by recombinant methods can be either eukaryotic or prokaryotic cells. Suitable eukaryotic hosts include animal cells, yeast or fungi. Especially as yeast, Saccharomyces
, Kluyveromyces, Pichia, Schwanniomyces
Alternatively, yeast of the genus Hansenula may be mentioned. Animal cells include COS cells, CHO cells, C127 cells, PC12 cells, and the like. Fungi include, inter alia, Aspergillus species or Trichoderma species. Prokaryotic cells include E. E. coli, Bacillus or Strept
The use of bacteria such as omyces is preferred.

It is a further object of the present invention to provide mammals other than humans which contain the nucleic acids or vectors of the invention in their cells.

Such mammals (rodents, dogs, rabbits, etc.) are useful for characterizing PAP1 and identifying therapeutic compounds. The modification of the genome of such transgenic animals is the "knock in" or "knock out" of one or more genes.
It is obtained by modifying or modifying by. This modification may be performed by conventional denaturing agents or mutagens, or by regulatory mutagenesis. Genomic modifications may also be obtained by insertion or substitution of wild type or mutant gene (s). Modification of the genome is advantageously performed on germline and pronuclei. To produce a transgenic organism, an expression cassette containing the modified gene is injected into two pronuclei by microinjection. Thus, the animals of the invention are obtained by injection of expression cassettes containing nucleic acids. Preferably the nucleic acid is DNA, which may be genomic DNA (gDNA) or complementary DNA (cDNA).
) Is okay.

The transgenic animals of the invention may be produced according to conventional techniques known to those of skill in the art. The person skilled in the art is especially familiar with US patents US 4,873,191, US 5,464,76
4 and US 5,789,215 may be referred to, in particular the method for producing transgenic animals, in particular the method for producing transgenic mice. The contents of these documents are included in the present invention by reference.

Briefly, a polynucleotide construct containing a nucleic acid of the invention is inserted into an ES type cell line system. Insertion of the polynucleotide construct is described by Thomas et al. (198
7, Cell, Vol. 51: 503-512), preferably by electroporation.

The cells treated with the electroporation step are then screened for the presence of the polynucleotide construct (eg, selected with a label or using PCR or Southern-type DNA electrophoretic gel analysis). , Optionally after generating a homologous recombination event, selecting for positive cells that have integrated the exogenous polynucleotide construct into their genome. Such a technique is described in, for example, MANSOUR et al. (Natur
re (1988) 336: 348-352).

Next, BRADLEY (1987, Production and Anal)
ysis of Chimaeric mice. : E. J. ROBERTSO
N Ed. teratocarcinomas and embryonic
Stem cells: A practical approach. IRL
Selected positive cells are isolated, cloned and injected into 3.5 day old mouse blastocysts by a procedure as described by press, Oxford, page 113). The blastocyst is then introduced into a female host animal and embryo development is followed until birth.

An alternative method is WOOD et al. (1993, Proc. Natl. Acad. Sc.
i. USA, vol. 90: 4582-4585) or NAGY et al. (1993).
, Proc. Natl. Acad. Sci. USA, vol. 90: 8424-
8428) and contacting selected positive ES type cells with 2.5 day old 8-16 cell stage embryos (morula) to produce ES cell internalization. Then, ES cell colonies are formed in a wide range of blastocysts including cells that become germ cells.

The progeny are then tested to determine if they have integrated the polynucleotide construct (transgene).

The nucleic acids of the invention also serve to make antisense oligonucleotides or antisense strands of genes that are useful as pharmaceuticals. Antisense sequences are short oligonucleotides that are complementary to the coding strand of a given gene and are the transcribed mRNA.
Since it can specifically hybridize with A, it can prevent the mRNA from being translated into a protein. Accordingly, it is an object of the present invention to provide antisense sequences that can at least partially inhibit the interaction of PAP1 protein with parkin. Such a sequence may consist of all or part of the nucleic acid sequence defined above. Such sequences are generally sequences complementary to sequences encoding peptides that interact with Parkin or are sequence fragments. Such an oligonucleotide may be produced by division or the like, or may be produced by chemical synthesis.

The claimed sequences are in the field of gene therapy with antisense sequences or peptides capable of modulating the interaction of PAP1 protein with parkin.
It can be used to introduce and express in vivo. To do this, in
o Viable or non-viral vectors that can be administered (Kahn et al., 1991)
) Into the array. Viral vectors suitable for the present invention include in particular vectors such as adenovirus, retrovirus, adeno-associated virus (AAV) or herpesvirus. The object of the present application is also the nucleic acid encoding a polypeptide of the invention, in particular a nucleic acid encoding a polypeptide or peptide comprising all or part of sequence 2 or a derivative thereof, eg sequence 12, 14, 42 or 44 or It is to provide a recombinant defective virus comprising a nucleic acid encoding a polypeptide or a peptide containing all or part of their derivatives.

The present invention also provides a synthetic or non-synthetic nucleotide probe capable of hybridizing with the nucleotide sequences defined above or their complementary strands. Such probes are used in vitro as diagnostic tools to detect PAP1 expression or superexpression, or to demonstrate genetic abnormalities (mis-splicing, polymorphisms, point mutations, etc.). obtain. These probes can also be used to discover and isolate homologous nucleic acid sequences encoding a peptide as defined above from another cell source, preferably cells of human origin. The probes of the invention generally contain at least 10 bases and may, for example, contain one of the above sequences or their entire complement. These probes are preferably labeled prior to use. Various techniques known to those skilled in the art may be used for this (radioactive labels, fluorescent labels, enzyme labels, chemical labels, etc.).

The present invention also relates to a primer or primer pair capable of amplifying all or part of a nucleic acid encoding PAP1, eg a primer having a sequence selected from sequences 16-41.

The object of the present invention is furthermore to provide all pharmaceutical compositions comprising as active ingredient at least one compound as defined above, in particular a peptide compound.

The object of the present invention is in particular all pharmaceutical compositions comprising as active principle at least one antibody and / or antibody fragment as defined above, and at least one nucleic acid or vector as defined above as active principle. To provide all pharmaceutical compositions comprising.

The object of the present invention is also to provide all pharmaceutical compositions containing as an active ingredient a chemical molecule capable of enhancing or suppressing the interaction between PAP1 protein and parkin.

The object of the present invention is further to provide a pharmaceutical composition in which the peptide, antibody, chemical molecule and nucleotide sequences as defined above are associated with each other or another active ingredient.

The pharmaceutical compositions of the invention may be used to modulate the activity of parkin proteins and consequently maintain the survival of dopaminergic neurons. More specifically, the intended purpose of these pharmaceutical compositions is to modulate the interaction of PAP1 protein with parkin. Preferred are pharmaceutical compositions intended for the treatment of central nervous system disorders such as Parkinson's disease.

The object of the present invention is also the use of a molecule as described above for modulating the activity of parkin or for typing central nervous system diseases. The present invention specifically uses these molecules to at least partially modulate the activity of parkin.

The present invention also relates to a method of screening or characterizing molecules active against the function of Parkin, which comprises the selection of molecules capable of binding to Sequence 2 or Sequence 4 or fragments (or derivatives) thereof. The method preferably comprises contacting one or more test molecules with a polypeptide comprising sequence 2 or sequence 4 or a fragment (or derivative) thereof in vitro, and sequence 2 (especially residues 1-residues). 344) or a molecule capable of binding sequence 4. The test molecule can be various types of molecules (peptides, nucleic acids, lipids, sugars, etc., or a mixture of these molecules, eg, combinatorial libraries, etc.). As mentioned above, the molecules identified by the above methods as active against Parkin function can be used to modulate the activity of Parkin proteins, and as a powerful therapeutic agent for treating neurodegenerative pathologies. Become.

Other advantages of the invention will be apparent from the following examples and figures, which represent non-limiting representative examples.

BRIEF DESCRIPTION OF THE FIGURES FIG. 1: Schematic diagram of the vector pLex9-Parkine (135-290) FIG. 2: Results of the primary 5′-RACE experiment. Eight clones were obtained. The initial electron arrangement is shown at the bottom of the figure. Figure 3: Results of the secondary 5'-RACE experiment. Only 2 out of 8 clones obtained in the primary experiment (clones A12 and D5) were effective. The initial electronic sequence is shown at the bottom of the figure. The complete DNA and protein sequences are shown in sequences 12-15. Figure 4: Detailed view of the organization of clones C5 and D4 in the secondary 5'-RACE experiment. The revealed consensus sequence is shown at the top of the figure. Figure 5: Structure of transcripts isolated from human brain Figure 6: Human brain LY111 (full length) nucleic acid and protein sequences. Double underline:
Conserved cysteine zinc finger domains; Bold: _{C 2} 1 domain; italics: _{C 2} 2 domain Figure 7: nucleic acid and protein sequences of the human brain LY111 (abbreviation). Double underline: conserved cysteine of the zinc finger domain; Bold: _{C 2} 1 domain; italics: _{C 2} 2 domain Figure 8: COS-7 abbreviation after expression in a cell LY111 protein (8b) or full-length LY111 protein (8a Figure 9: Human lung LY111 (non-truncated) nucleic acid and protein sequences.

[0078]   Figure 10: Human brain LY111 (truncated) nucleic acid and protein sequences.

Materials Used and Technologies (1) Yeast Strain: S. cerevisiae L40 strain (Mata, his3D200, tr
p1-901, leu2-3, 112, ade2, LYS2: :( lexAop
) _4- HIS3, URA3: :( lexAop) _8- LacZ, GAL4, GA
L80) was used to verify protein-protein interactions when one binding protein was fused to the LexA protein. LexA protein is
It may recognize LexA response elements that control the expression of the reporter genes LacZ and His3.

The above yeast strain was cultured in the following culture medium. Complete YPD medium : -Yeast extract (10 g / l) (Difco) -Bactopeptone (20 g / l) (Difco) -Glucose (20 g / l) (Merck) Add 20 g / l agar (Difco) to this medium. A solid medium was used. Minimum YNB medium : -Yeast nitrogen group (no amino acid) (6.7 g / l) (Difco) -Glucose (20 g / l) (Merck) 20 g / l agar (Difco) was added to this medium to give a solid medium. To do.
In addition, CSM medium [CSM-Leu, -Trp, -His (620 mg / liter), CSM-Trp (740 mg / liter) or CSM-Leu, -Tr
p (640 mg / liter) (Bio101)] and / or 2.5 mM 3-
Amino-1,2,4-triazole is added to the amino acid and / or 3-amino-
Supplement with 1,2,4-triazole.

(2) Bacterial strain: genotype supE, hsdΔ5, thi, Δ (lac-proAB), F ′ [
A plasmid was constructed by using the Escherichia coli TG1 strain having tra D36 pro A ⁺ B ⁺ lacI ^q lacZΔM15], and used as a means for amplifying and isolating the recombinant plasmid used.

This E. coli strain was cultured in the following medium. LB medium : -NaCl (5 g / l) (Prolabo) -Bactotryptone (10 g / l) (Difco) -Yeast extract (5 g / l) (Difco) 15 g / l agar (Difco) was added to this medium. Use solid medium.

Ampicillin was used at a concentration of 100 μg / ml. This antibiotic is useful for selection of bacteria that have received a plasmid containing a gene resistant to this antibiotic as a marker.

Genotypes supE44, ara14, galK2, lacY1, Δ (gpt-
proA) 62, rpsL20 (Str ^r ), xyl-5, mtl-1, rec
Escherichia coli HB1 having A13, Δ (mcrC-mrr), HsdS ⁻ (r ⁻ m ⁻ ).
Strain 01 was used as a means for amplification and isolation of plasmids obtained from a human lymphocyte cDNA library.

This E. coli strain was cultured in the following medium. M9 medium : -Na2HPO4 (7 g / l) (Prolabo) -KH2PO4 (3 g / l) (Prolabo) -NH4Cl (1 g / l) (Prolabo) -NaCl (0.5 g / l) (Prolabo) -Glucose (20 g / l) L) (Sigma) -MgSO4 (1 mM) (Prolabo) -thiamine (0.001%) (Sigma) To this medium, 15 g / l agar (Difco) is added to make a solid medium.
Leucine (50 mg / liter) is required to enable the HB101 strain to grow.
(Sigma) and proline (50 mg / l) (Sigma) need to be added to M9 medium.

When selecting a plasmid from a two-hybrid library of lymphocyte cDNA, leucine was not added to the medium because the plasmid carries the Leu2 selectable marker.

(3) Plasmid: Vector pLex9 (pBTM116) (Bartel et al., 1993): A 5 kb vector homologous to pGBT10 containing a multiple cloning site downstream of the sequence encoding the bacterial repressor LexA and upstream of the terminator. This vector was used to form the fusion protein.

PLex-HaRasVal12: described in International Patent Application WO98 / 21327, which includes a sequence encoding a HaRas protein with a mutation at position Val12 (Vojtek et al.) Known to interact with mammalian Raf proteins. Plasmid pLex9 as described. This plasmid is P
It was used to test the interaction specificity of the AP1 protein.

PLex9-cAPP: a plasmid pL containing sequences encoding the cytoplasmic domain of the APP protein, which is known to interact with the PTB2 domain of FE65.
ex9. This plasmid was used to test the interaction specificity of the PAP1 protein in the L40 strain.

(4) Synthetic oligonucleotide: TTAAGAATTC GGAAGTCCAG CAGGTAG (sequence 5) ATTAGGATCC CTACACACAAAGGCAGGGAG (sequence 6) P corresponding to the central region of the parkin sandwiched between the EcoRI site and the BamHI site.
The oligonucleotide used to obtain the CR fragment. GCGTTTGGAA TCACTACAG (Sequence 7) GGTCTCGGGTG TGGCATC (Sequence 8) CCGCTTTGCTT GGAGGAAC (Sequence 9) CGTTATTTCTC CGCCTGGG (Sequence 10) AATAGCTCGA GTCAGGAGGAGGAGAG
Oligonucleotides used to sequence the insert corresponding to the PAP1 gene. Oligonucleotides are Applied System ABI 394-0.
Synthesize with 8 devices. The synthesized oligonucleotide is stripped from the synthetic matrix with aqueous ammonia, precipitated twice with 10 volumes of n-butanol and then placed in water. Quantify by measuring optical density (1 OD ₂₆₀ corresponds to 30 μg / ml).

(5) Preparation of plasmid DNA Small and large scale production of plasmid DNA was performed using the DNA purification kit according to the protocol instructed by the manufacturer Quiagen: -Quiaprep Spin Miniprep Kit, ref: 27106.
-Quiaprep Plasmid Maxiprep Kit, ref: 12
163.

(6) Enzymatic amplification of DNA by PCR (polymerase chain reaction): DNA matrix, dNTP (0.2 mM), PCR buffer (10 mM Tris-HCl, pH 8.5, 1 mM MgCl 2, 5 mM KCl, 0) .01
% Gelatin), 10-20 picomoles of each oligonucleotide and 2.5 IU of Ampli Taq DNA polymerase (Perkin Elmer) in a final volume of 100 μl. The mixture is covered with 2 drops of paraffin oil to prevent the specimen from evaporating. Appligene's "Crocodile II"
The equipment was used.

The matrix denaturation temperature was 94 ° C., the hybridization temperature was 52 ° C., and the enzyme extension temperature was 72 ° C.

(7) Ligation: All ligation reactions were performed with 100-200 ng vector, 0.1-0.5 μg insert, 40 IU T4 DNA ligase enzyme (Biolabs) and ligation buffer (50 mM Tris-HCl, pH 7). .8; 10 mM MgCl ₂ ; 1
In the presence of 0 mM DTT; 1 mM ATP), a final volume of 20 μl was performed at 37 ° C. for 1 hour. Negative controls were made by ligating the vector in the absence of insert.

(8) Transformation of Bacteria: Transformation of bacteria with a plasmid is performed according to the following protocol. TG1 bacteria are transformed according to the method of Chung (Chung et al., 1989) using a binding volume of 10 μl. The transformed bacteria are plated on LB medium supplemented with ampicillin and incubated at 37 ° C. for 16 hours.

(9) Separation and extraction of DNA: DNA is separated based on size by agarose gel electrophoresis from Maniatis (Maniatis et al., 1989). 1% agarose gel (90 mM Tris base; 90 mM borate; 2 mM EDTA) in TBE buffer (
Gibco BRL).

(10) Fluorescent Sequencing of Plasmid DNA: The sequencing technique is based on the Sanger method (Sanger et al., 1977) so that this method can be applied to the sequencing by fluorescence developed by Applied Biosystems. The modified method was used. The protocol used is the protocol described by the inventor of the system (Perkin Elmer, 1997).

(11) Yeast Transformation: Conventional yeast transformation technology developed by Gietz (Gietz et al., 19
92) is introduced into yeast by a method modified as follows: Especially when yeast is transformed with a lymphocyte cDNA library,
The yeast used contains the plasmid pLex9-Parkine (135-290) which encodes the central part of Parkin fused to the LexA protein. This yeast is cultivated in 200 ml of YNB minimal medium supplemented with the amino acid CSM-Trp at 30 ° C. under agitation to a density of 10 ⁷ cells / ml. 5 μg of library was added to each to transform yeast according to the above protocol.
The cell suspension was poured into 10 μl tubes. Heat shock for 20 minutes, then collect cells by centrifugation, resuspend in 100 ml YPD medium and 30 ° C.
Was maintained for 1 hour, resuspended in 100 ml of YNB medium supplemented with CSM-Leu, -Trp, and maintained at 30 ° C. for 3 hours and 30 minutes. Transformation efficiency was measured by plating transformed cells at various dilutions in solid YNB medium supplemented with CSM-Trp, -Leu. After maintaining the culture at 30 ° C. for 3 days, the obtained colonies were counted and the transformation rate per 1 μg of DNA in the lymphocyte library was calculated.

(12) Isolation of plasmids extracted from yeast: 5 ml of yeast culture incubated for 16 hours at 30 ° C. was centrifuged and 200 μm
l lysis buffer (1M sorbitol, 0.1M KH2PO4 / K2HPO
4, pH 7.4, 12.5 mg / ml zymolyase) and incubated at 37 ° C. for 1 hour. Next, DNA purification kit, Quiaprep Spin
Miniprep kit, ref27106, manufacturer Quiagen
Process the lysate using according to the protocol instructed by.

(13) β-Galactosidase Activity Test: A nitrocellulose sheet is placed in advance on a petri dish containing disassembled yeast clones. The sheet is then immersed in liquid nitrogen for 30 seconds to burst the yeast and release the β-galactosidase activity. After thawing, the nitrocellulose sheet is placed on another Petri dish with the colony-adhering surface facing up. In this dish, N,
15 μl X-Gal (at a concentration of 40 mg / ml in N-dimethylformamide.
5-bromo-4-chloro-3-indoyl-β-D-galactoside).
5 ml PBS solution (60 mM Na ₂ HPO ₄ , 40 mM NaH ₂ PO ₄ ,
Whatm pre-impregnated with 10 mM KCl, 1 mM MgSO ₄ , pH 7)
An paper is spread. Next, the dish is placed in an oven at 37 ° C. The test result is determined to be positive if the colonies on the membrane turn blue after 12 hours.

Example 1: Construction of a vector capable of expressing a fusion protein of the central part of parkin and the bacterial repressor LexA In a library screening using a two-hybrid system, the central region of the parkin is similar to that of the bacterial repressor LexA. It must be fused to a DNA binding protein. Sequence 3 was used to express this fusion protein.
Alternatively, the sequence encoding the central region of Parkin present in the sequence represented by 4 is L
Vector pLex9 introduced in the same reading frame as the sequence corresponding to exA protein
(See Materials and Methods section).

A 468 bp DNA fragment corresponding to 156 amino acids in the central region of Parkin starting at amino acid 135 was obtained from the oligonucleotides (sequences 5 and 6) by PCR. These oligonucleotides also have an E at the 5'end.
A coRI site was introduced, and a termination codon and a BamHI site were introduced at the 3'end.
A PCR fragment was introduced downstream of the LexA protein coding sequence between the EcoRI site and the BamHI site of the multiple cloning site of plasmid pLex9 to create the vector pLex9-Parkine (135-290) (FIG. 1).

The construct was verified by DNA sequencing. This validation revealed that this fragment had no mutations that occurred during the PCR reaction and was fused to the same open reading frame of the fragment corresponding to LexA.

Example 2 Screening of a Lymphocyte Fusion Library In this example, the two-hybrid method (Fields & Song, 1989) is used.
)It was used. Screening of the fusion library can identify clones that produce a fusion protein in the transactivator domain of GAL4 and can interact with the beneficial protein described in Example 1 (central region of Parkin). This interaction restores the transactivator and can induce expression of the reporter genes His3 and LacZ in the L40 strain.

To perform this screening, Richard Benarous (Pe
cDNA derived from human peripheral lymphocytes provided by ytavi et al., 1999).
A fusion library made from A was selected. Yeast was transformed with the lymphocyte library, and positive clones were selected by the procedure described below.

During screening, each of the independent plasmids of the fusion library and the plasmid pLex9-Parkine (135-290) was transformed into at least one yeast.
And must coexist with a sufficient probability. In order to maintain this probability sufficiently, it is important that the yeast has a high transformation efficiency. For this,
A yeast transformation protocol was selected that gave a transformation efficiency of transforming 2.6 × 10 ⁵ cells per μg of DNA. Furthermore, since the transformation efficiency is reduced when yeast is co-transformed with two different plasmids, yeast pre-transformed with plasmid pLex9-Parkine (135-290) was used as a preferred method. Phenotype His-, Lys-, Leu-, Ad
This e-carrying strain L40 pLex9-Parkine (135-290) was transformed with 50 μg of the plasmid DNA of the fusion library. Approximately 1.3 × 10 ⁷ transformed cells could be obtained from this amount of DNA,
This number corresponds to a number slightly above the number of independent plasmids that make up the library. From this result, it can be considered that almost all of the plasmids in the library were useful for transforming yeast. Selection of transformants capable of restoring functional transactivator was performed without histidine, leucine and tryptophan supplemented with 2.5 mM 3-amino-1,2,4-triazole and 620 mg / liter CSM (Bio101). Of YNB medium.

This selection resulted in a large number of clones with the phenotype His +.
To test the effectiveness of the resulting clones by the expression of another reporter gene LacZ, these transformants were subjected to a β-galactosidase activity test. 1
A dual phenotype H in which 15 clones can respond to protein-protein interactions
It had is +, β-Gal +.

Example 3: Isolation of the plasmid of the library in selected clones The plasmid of the fusion library contained in the yeast selected by the two-hybrid screen to identify proteins capable of interacting with the central region of Parkin. Was extracted. In order to obtain a large amount of such a plasmid, it is necessary to transform E. coli with a DNA extract of a positive yeast strain prior to this isolation. The library plasmid contained in this extract is yeast /
Since it is an E. coli shuttle plasmid, it can easily replicate in the bacterial body. Library plasmids were selected by complementation of the leucine auxotrophic HB101 strain in leucine deficient medium.

Plasmid D of bacterial colonies obtained after transformation of yeast with DNA extract
NA was analyzed by restriction enzyme digestion and agarose gel separation of DNA fragments. Of the 115 clones analyzed, the clone containing one plasmid of the library had a different profile than the rest of the clones. This plasmid was named pGAD-Ly111b and examined in more detail.

Example 4: Sequencing of inserts contained in the identified plasmids To sequence the inserts contained in the identified plasmids, first in a first step, a lymphocyte cDNA library insert EcoRI was prepared. GAL near the site
The oligonucleotide of sequence 7 complementary to the 4TA sequence was used. Then, in a second step, sequences 8 to 11 corresponding to the sequences of the inserts obtained during the sequencing process.
Was used. The sequence obtained is shown in Sequence 1. The protein thus identified was named PAP1 (Perkin binding protein 1).

The sequence of this insert and the data banks GENBank and EMBL (Euro
Comparison with the sequence contained in the pean Molecular Biology Lab) showed 25% homology at the protein level to various members of the synaptotagmin family. Synaptotagmin is a member of the membrane protein family that is encoded by at least 11 different genes expressed in brain and other tissues. They contain a unique transmembrane domain and two calcium regulatory domains called C ₂ . Homology between synaptotagmin and PAP1 protein is found in this domain. No other significant homology was observed.

Example 5: Analysis of the interaction specificity of the central region of Parkin with the PAP1 protein. To determine the interaction specificity of the fragment corresponding to the PAP1 protein with the central region of Parkin, another unrelated protein was determined. In addition, a specific two-hybrid interaction test was conducted. To carry out this test, the plasmid pLex9-
Instead of Parkin (135-290), control plasmids plex9-cAPP or pLex9-H each encoding HaRasVal12 protein fused to the cytoplasmic domain of APP or the DNA binding domain of LexA.
The L40 strain was transformed with aRasVal12 and the plasmid isolated during the screening of the two-hybrid library. To determine protein-protein interactions, β-Gal activity tests were performed on cells transformed with various plasmids. According to the results of this test, only the plasmid isolated during the screening of the two-hybrid library and the yeast transformed with the plasmid pLex9-Parkine (135-290) have β-Gal + activity, So the central area of Parkine and P
It showed an interaction with the AP1 protein. This PAP1 fragment is cAPP
This interaction proves to be specific as it is believed that it does not interact with the protein or the HaRasVal12 protein.

Therefore, these results indicate the presence of a novel protein named PAP1 that can interact specifically with Parkin. This protein, which is closely related to synaptotagmin, has no significant homology to any known protein, so it may be used in therapeutic or diagnostic applications to produce antibodies, probes or peptides, or
It can be used to screen active molecules.

Example 6: Cloning of the PAP1 gene from a human lung DNA library In order to identify the complete sequence of the human PAP1 gene and characterize the presence of mutant forms, Sequence 1 was treated with two electron extension methods. This treatment yielded two electronic sequences of 1644 bp and 1646 bp, respectively, with an extension of 330 bp compared to sequence 1. However, analysis of these sequences revealed distinct differences in the post-translational consensus region. That is, one array has an O of 420 aa.
RF, the other sequence gave an ORF of 230aa. When the obtained protein sequence is compared with the known sequence, human synaptogammin I (p65) (p21579)
24% homology was found with 293 amino acids that overlap with). The function of synaptogammin I is the regulatory function of membrane interactions during the transport of synaptic vesicles to the synaptic zone. Synaptogammin I binds to acidic phospholipids to some extent specifically. Furthermore, calcium-dependent interactions between synaptogamine and activated protein kinase C receptors have been reported. Synaptogamin can also bind to three other proteins, namely neurexin, syntaxin and ap2. Considering that the homology between the identified sequence and the synaptogammin family is rapidly abolished in the early stage, the identified sequence may have a deletion compared to the native sequence. Is big. To test this hypothesis and confirm the validity of the sequence, RT-PCR and sequencing experiments were performed using the 1644 bp sequence. The resulting sequence contains a 420 aa ORF and has similar synaptogammin homologies.

To generate longer sequences, and to verify whether the resulting sequences corresponded to the spliced form, oligo L1 was prepared against a human lung cDNA preparation.
And L2 were used to perform an extension experiment by 5'-RACE from the 3'region of the sequence confirmed to be effective.

The obtained results are shown in FIG. These results indicate that 8 clones were identified, corresponding to 6 different 5'ends. Three clones (clone A12,
F2, F12) contains a STOP codon that blocks the ORF, and clone A3
Contains no ORF. The presence of various transcripts was confirmed by RT-PCR and nested RT-PCT (Table 1).

[0117]

[Table 1]

The primer pair U3-L3 and CB are specific for a common fragment of sequence, oligos A and U1 are specific for the initial sequence and clone C11, oligo L4.
Is specific for the initial sequence and primer U2 is specific for clone A3. Secondary 5 by oligos L3 and L7 (Fig. 2) located in the common region of different clones.
'-RACE was performed. The obtained results are shown in FIGS. 3 and 4. The presence of various transcripts was confirmed by RT-PCR and nested RT-PCT (Table 2).

[0119]

[Table 2]

The sequences of the primers and oligonucleotides are shown in Tables 3 and 4 (sequences 16-37).

[0121]

[Table 3]

[0122]

[Table 4]

Taken together, these results show the long and short isoforms (FIG. 9, sequences 12 and 13) and short isoforms of the PAP1 protein identified from human lung (FIG. 10, FIG.
The consensus sequences corresponding to sequences 14 and 15) are valid. In the examples below, this protein is called LY111. The long isoform is residue 2 of sequence 12
Encoded by the 1833 bp ORF located at 37-2069, 6
It contains 10 amino acids. The polyadenylation signal is nucleotide 231.
It is localized after 5. The short isoform is residues 429-1370 of sequence 14.
It is encoded by the 942 bp ORF located at 313 and contains 313 amino acids. The polyadenylation signal is located after nucleotide 1616.

Next, Northern blot experiments were performed on various human tissues with the probes (amplimerCD and EF), showing 6 kb transcript in muscle and 3 k in heart.
The transcript of b and the transcript of 6 kb were detected in fetal liver. Furthermore, the cloning of human fetal brain transcripts is described in Example 7. Different homology tests were performed on different protein databases. The results are shown in Table 5 below.

[0125]

[Table 5]

[0126]   Example 7: Two full-length transcripts of PAP1 using human fetal brain complementary DNA
Cloning of (Ly111B)   Confirm the presence of full-length (“complete”) Ly111b transcripts in the human brain
To this end, PCR was performed from complementary DNA from human fetal brain (Marath.
on Ready cDNA, Clontech). Oligonu as a primer
Cleotide LyF1 (AAT GGA AGG GCG TGA CGC, FIG. 5
, Sequence 38) and HA71 (CCT CAC GCC TGC TGC AAC
  CTG, Sequence 39) was used. Increase short DNA fragments of about 2 kilobases
Widened The product of this primary PCR was used as a matrix for nested PCR.
I used it. The oligonucleotide LyEcoF (GCACGAATT was used for this PCR.
CATG GCC CAA GAA ATA GAT CTG, sequence 40) and
And HA72 (CTG TCT TCG TAT TTC TCC GCC TT
G, sequence 4) was used. The amplified product is converted to the restriction enzyme EcoRI (oligonucleotide
Digested with LyEcoF) and BstEII (FIG. 2), expression vector p
Inserted into cDNA3 and then their sequence was determined. Sequence of the obtained clone
Analysis revealed that two full-length transcripts Ly11b could be present in the human fetal brain.
It turned out (Fig. 5). First transcript (Ly111b_fullA) Is the same in human lungs
Corresponding to the defined mRNA (Example 6), a 609 amino acid protein (pLy
111b_fullAEncodes sequences 42 and 43) of Figures 5 and 6. second
Transcript (Ly111b_fullB) Is alternative splicing of common primary mRNA
It is likely to represent a sing product. This transcript is Ly11b_fullAbe equivalent to
Is the sequence between nucleotides 752 and 956 of the sequence confirmed to be effective in human lung.
No row exists (sequence 42). Therefore, Ly111b_fullBIs amino acid 1
PLy111 deleted in the domain of 72-240 (Figs. 5, 7, sequences 44-45) _fullA A protein consisting of 541 amino acids equal to (pLy111b_{f ullB} ) Is coded. Two proteins pLy111b_fullA/_{f ullB} Is a Perkin flag containing amino acids 135-290 identified in yeast
And a domain that interacts with menthol (initial sequence Ly111b, FIG. 5).
, And thus could theoretically maintain this interaction. pLy111b_{fullA / fullB}Protein is RIM / Rabphili
Belong to ne family.

PLy111b _{fullA / fullB} has homology to RIM / rabphiline family proteins (Wang Y, Sugita S.
& Sudof TG, The RIM / NIM family of ne
uronal C2 domain proteins. J Biol Che
m (2000) 275, 20032-20044), especially granulophi.
has homology to lines (Wang Jie, Takeuchi T,
Yokota H & Izumi T. Novel Rabphilin-3
-Like protein associates with insuli
n-containing granules in pancreatic
beta calls. J Biol Chem (1999) 274, 2854
2-28548). The protein is characterized by the presence of a zinc finger domain in the N-terminal part and two C ₂ domains in the C-terminal part (FIGS. 6 and 7). The zinc finger domain of the RIM / rabphiline family of proteins was involved in the interaction with the Rab protein. Since the Rab protein is a protein that binds to GTP, it is an essential component of the membrane transport mechanism of eukaryotic cells. It has already been described in the literature that the C ₂ domain of the RIM / rabophiline family of proteins can bind to the membrane through interaction with phospholipids. Expression of pLy111b _{fullA / fullB} protein in cells of COS-7 system: co-localization with parkin gene The coding sequence of the transcript Ly111b _{fullA / B was phased} to the eukaryotic expression vector pcDNA3 and to the sequence encoding the N-terminal myc epitope. They were inserted together (pcDNA3-mycLy111b _{fullA / B} ). Cells of the COS-7 line transfected with these vectors had a protein (pcDNA3-mycLy111b _fullA ) having an apparent molecular weight of about 67 kDa and 60 kDa.
And a protein having an apparent molecular weight of pcDNA3-mycLy111b _{full B.} These molecular weights are in agreement with the expected molecular weights. Detection of this protein by immunolabeling with an antibody against the N-terminal myc epitope revealed that:
This protein is unevenly distributed in dots in the cytoplasm, cell processes and sometimes the nucleus of COS-7 cells (Fig. 8a, b, column A). When these proteins were overexpressed by parkin detected with anti-parkin Asp5 antibody in cells of COS-7 line (Fig. 8a, b, column B), homologous distribution and co-localization of these proteins. Are observed (Fig. 8a, b, column C).

[0128]     (References)

[0129]

[Table 6]

[Brief description of drawings]

[Figure 1]   1 is a schematic diagram of the vector pLex9-Parkine (135-290).

[Fig. 2]   The result of a primary 5'-RACE experiment is shown.

[Figure 3]   The result of a secondary 5'-RACE experiment is shown.

[Figure 4]   A detailed view of the organization of clones C5 and D4 in the secondary 5'-RACE experiment is shown.

[Figure 5]   3 depicts the structure of transcripts isolated from human brain.

FIG. 6 shows the nucleic acid and protein sequences of human brain LY111 (full length). Double underline:
Conserved cysteine zinc finger domains; Bold: _{C 2} 1 domain; italics: _{C 2} 2 domain.

FIG. 7 shows the human brain LY111 (truncated) nucleic acid and protein sequences. Double underline: zinc finger domains conserved cysteines; Bold: _{C 2} 1 domain; italics: _{C 2} 2 domain.

Figure 8a: Short LY111 protein (8b) or long L after expression in COS-7 cells.
The localization of Y111 protein (8a) is shown.

FIG. 8b: Short LY111 protein (8b) or long L after expression in COS-7 cells.
The localization of Y111 protein (8a) is shown.

[Figure 9]   3 shows the nucleic acid and protein sequences of human lung LY111 (non-truncated form).

[Figure 10]   1 shows the nucleic acid and protein sequences of LY111 (truncated form) of human brain.

[Sequence list]

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61K 45/00 A61P 25/00 4C085 48/00 C07K 14/47 4C087 A61P 25/00 16/18 4H045 C07K 14 / 47 C12N 7/00 16/18 C12P 21/02 C12N 5/10 C12Q 1/68 A 7/00 C12N 15/00 ZNAA C12P 21/02 5/00 B C12Q 1/68 A61K 37/02 (81) designation Country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR), OA (BF, BJ, CF) , CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, D, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU. , ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MG, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA , ZW (72) Inventor Bliss, Alexi F-75006 Paris, France, Riu Saint Tandre des Arts, 51 (72) Inventor Fournier, Alain France, F-92290 Syatoney Malabri, Abunyu Rosie Salengro, 28 (72) Inventor Pradeie, Laurent France, F-91370 Belleaire , Abunyu Carmassere, 23 (72) Inventor Prade, Catherine France, F-94320 Teyer, Abunyu Dou General Dou Gaul, 30 (72) Inventor Arneuu-Leguigne, Isabelle Fev, France 94430-Cyenne Vielle Cour-Marne, Liu-de-Bourie, 112 (72) Inventor Rosier-Montouux, Marie-Francoise France, F-92160 Antony, Riu de Baconnet, 21 (72) Invention Person Cortey, Olga France, F-75013 Paris, Lieu d'Ou cyyubarle, 151 F term (reference) 4B024 AA01 AA11 BA44 BA80 CA 04 DA02 EA04 GA11 HA12 HA17 4B063 QA18 QQ42 QQ52 QR56 QR62 QS25 QS34 4B064 AG01 CA10 CA19 CC24 DA01 DA13 4B065 AA87X AA93Y AB01 AC14 BA02 CA24 CA44 CA46 4C084 AA02 AA03 AA06 AA07 AA13 AA17 BA44 MA02 NA13 NA14 ZA02 4C085 AA13 AA14 BB11 DD61 DD62 DD63 EE01 4C087 AA01 AA02 BC83 MA02 NA13 NA14 ZA02 4H045 AA10 AA11 AA20 AA30 BA10 CA45 DA76 DA86 EA20 EA30 EA50 FA74

Claims (31)

[Claims] 1. A compound capable of at least partially modulating the interaction between PAP1 protein or a homologue thereof and Parkin. 2. A compound according to claim 1, characterized in that it suppresses, inhibits or stimulates said interaction, at least in part. 3. The compound according to claim 1, which is capable of binding to an interaction domain between PAP1 protein or a homologue thereof and Parkin. 4. The compound according to any one of claims 1 to 3, which is a peptide type, nucleic acid type, lipid type, sugar type compound or an antibody. 5. A compound according to claim 4, characterized in that it comprises wholly or partly the peptide sequence 2 or one of its derivatives. 6. The compound according to claim 4, which is a peptide compound containing a region having a sequence corresponding to all or a functional portion of a PAP1 protein site that interacts with parkin. 7. A PAP1 protein containing a non-functionalized effector region (
And / or a homologous form), the compound according to claim 4, which is a peptide compound. 8. A polypeptide comprising Sequence 2 or a derivative or fragment thereof. 9. A polypeptide according to claim 8 comprising at least 5, preferably at least 9 and more preferably at least 15 contiguous residues of sequence 2. 10. All or part of sequence 13, 15, 43 or 45 or variants thereof, in particular at least 5 of sequence 13, 15, 43 or 45,
9. The polypeptide according to claim 8 comprising preferably at least 9, more preferably at least 15 contiguous residues. 11. A nucleic acid encoding the peptide compound according to any one of claims 4 to 10. 12. Nucleic acid according to claim 11, characterized in that it comprises all or part of sequence 1, 12, 14, 42 or 44 or a sequence derived from these sequences. 13. A nucleic acid encoding the polypeptide according to claim 8 or 11. 14. A nucleic acid capable of hybridizing with the nucleic acid according to any one of claims 11 to 13 or a complementary strand thereof, particularly a nucleotide probe. 15. A vector comprising the nucleic acid according to any one of claims 11 to 14. 16. A recombinant defective virus comprising the nucleic acid according to any one of claims 11 to 14. 17. A nucleic acid selected from the nucleic acids of sequences 16-41 and 46. 18. An antibody or an antibody fragment or derivative, which is an antibody against the peptide compound according to any one of claims 4 to 10. 19. The antibody according to claim 18, which recognizes the polypeptide according to claim 9 or 10. 20. A pharmaceutical composition comprising at least the compound according to any one of claims 1 to 10 or the antibody according to claim 18 or 19. 21. A non-peptidic compound or a non-peptidic sole compound capable of at least partially modulating the interaction between PAP1 protein or its homologue and Parkin. 22. A compound according to claim 21, characterized in that the active motif of the peptide according to any one of claims 5 to 7 is replicated together with a non-peptidic structure or a non-peptidyl structure. . 23. A pharmaceutical composition comprising at least the nucleic acid according to any one of claims 11 to 14 or the vector according to claim 15 or 16. 24. A pharmaceutical composition comprising the peptide compound according to any one of claims 4 to 10. 25. The composition according to any one of claims 22 to 24, which is used for treating a neurodegenerative disease. 26. A method for screening or characterizing active molecules comprising the step of selecting molecules capable of binding to Sequence 2 or Sequence 4 or fragments thereof. 27. A method for screening or characterizing active molecules comprising the step of selecting molecules capable of binding to sequences selected from sequences 13, 15, 43 and 45 or fragments thereof. 28. A step of culturing cells containing the nucleic acid according to any one of claims 11 to 14 or the vector according to claim 15 or 16 under expression conditions of the nucleic acid, and the produced peptide compound. And recovering the
0. The method for producing the peptide compound according to any one of 0. 29. The human PAP1 protein in isolated form. 30. A cell comprising the nucleic acid according to any one of claims 11 to 14 or the vector according to claim 15 or 16. 31. A mammal other than human comprising the nucleic acid according to any one of claims 11 to 14 in its cell.