JP2003520590A - Chondromodulin I-related peptide - Google Patents

Abstract

(57) Abstract The present invention relates to a novel polynucleotide encoding a polypeptide structurally related to chondromodulin I, and the purified protein itself. The invention also relates to vectors, host cells, antibodies and recombinant methods for producing the polypeptide. One aspect of the present invention is a process for producing a chondromodulin I-related peptide, comprising culturing the above host cell under conditions suitable for expressing the polypeptide, and optionally, A process comprising isolating the polypeptide from the culture. In addition, the present invention discloses therapeutic, diagnostic and research utilities for these and related products.

Description

Detailed Description of the Invention

RELATED APPLICATION This application is related to US patent application Ser. No. 09/724, filed Nov. 28, 2000.
, 310 and U.S. Patent Provisional Application No. 60/1 filed January 19, 2000
Claim priority by 76,898.

FIELD OF THE INVENTION The present invention relates to novel polypeptides related to chondromodulin-I (called ChMIrp), and nucleic acid molecules encoding the peptides. The invention also includes vectors, host cells, selective binding agents (eg, antibodies), and ChMI.
A method for producing an rp polypeptide. Also provided are methods for use of ChMIrp, including methods for diagnosing and for disorders associated with ChMIrp.

BACKGROUND OF THE INVENTION Advances in technology in the identification, cloning, expression and manipulation of nucleic acid molecules have greatly accelerated the discovery of novel therapies based on decoding the human genome. Rapid nucleic acid sequencing techniques are now capable of generating sequence information at unprecedented rates, and coupled with computational analysis, allow the assembly of overlapping sequences throughout the genome and identification of polypeptide coding regions. Comparison of the deduced amino acid sequence to a database compilation of known amino acid sequences makes it possible to determine the degree of homology to previously identified sequence and / or salient features of the structure. Cloning and expression of the polypeptide coding region of a nucleic acid molecule provides the polypeptide product for structural and functional analysis. For producing variants and derivatives thereof,
Manipulation of nucleic acid molecules and encoded polypeptides may confer advantageous properties on the product for use as a therapeutic agent.

Despite the significant technological advances in genomics research over the last decade, the ability to develop new therapeutic agents based on the human genome is still largely unrealized. A large number of genes encoding potentially beneficial protein therapeutic agents, or genes encoding polypeptides that can act as "targets" for therapeutic molecules, are recombinant D
Although identified using NA technology, the structure and function of many genes in the mammalian genome are still unknown.

Accordingly, it is an object of the present invention to identify novel polypeptides and nucleic acid molecules encoding novel polypeptides that have diagnostic or therapeutic advantages.

Chondromodulin-I (ChM-I) is present in the presence of fibroblast growth factor-2 (FGF-2), which stimulates DNA synthesis of cultured rabbit growth plate chondrocytes. Was first identified as a protein component in fetal bovine cartilage extract. The growth stimulator was subsequently isolated and the amino acid sequence determined. Based on this amino acid sequence, degenerate primers were used in PCR to clone a fragment of the bovine gene. This DNA fragment was used to identify the 1.7 kb band in bovine epiphyseal cartilage mRNA, which was then used to identify bovine epiphyseal cartilage c
The bovine chondromodulin-I gene was isolated from a DNA library. Hir
aki et al., Biochem. Biophys. Res. Com. , 175: 97
1-974, 1999). ChM-I orthologs from human, mouse, rat, rabbit, and chicken were then isolated; for isolation of human and rabbit orthologs, Hiraki et al.
． J. Biochemistry, 260: 869-878, 1999) and Shukunami and Hiraki (Biochem. Biophys. R).
es. Com. , 249: 885-890, 1998). ChM-
I was found to be expressed by chondrocytes (Hiraki et al., Eur.
J. Biochemistry, 260: 869-878, 1999).

Expression of the human ChM-I gene in CHO cells revealed that the secretory mature protein was greater than the polypeptide isolated from cartilage extract (Hir).
aki et al., Eur. J. Biochemistry, 260: 869-878,
1999). This proteolytic processing was also demonstrated when ChM-I rabbit orthologs were expressed in monkey COS cells (Shukunami and Hiraki, Biochem. Biophys.
． Res. Com. , 249: 885-890, 1998). Alignment of the amino acid sequences of the mature and precursor proteins revealed that the mature protein sequence begins immediately after the RERR amino acid sequence present in the precursor form. The ChM-I precursor contains a single hydrophobic region near its amino terminus that is thought to be involved in membrane insertion. The RERR sequence acts as a processing signal that mediates proteolytic cleavage that results in the secretion of the mature form. This processing leaves most of the amino-terminal portion of the protein inserted within the cell membrane of chondrocytes. Therefore, these results indicate that ChM-I is expressed as a larger transmembrane precursor protein, which is cleaved to the carboxy-terminal mature form and deposited on cartilage (Suzuki, B.
iochem. Biophys. Res. Comm. 259: 1-7, 1999
Outline).

Expression of ChM-I mRNA has been detected only in human and bovine cartilage developing embryos. In particular, high levels of expression were detected in chondrocytes present in proliferating chondrocytes and lower levels were detected in chondrocytes present in the adjacent resting zone and upper hyperplastic zone. No discernible expression was detected in chondrocytes present in the joint zone and the lower calcified hyperplastic zone. ChM-I polypeptides have been localized in the inter-territorial regions of the proliferative, resting and upper hyperplastic zones (Hirak).
i et al., Eur. J. Biochemistry, 260: 869-878, 19
99).

ChM-I polypeptides can stimulate DNA and proteoglycan synthesis in chondrocytes of rabbit culture growth plates in the presence or absence of FGF-2. ChM-I inhibits proliferation and tube morphogenesis in bovine carotid artery endothelial cells (in vitro) and inhibits capillary formation in the chicken chorioallantoic membrane assay (in vivo) (Hiraki et al., Eur. J. Biochemistry).
, 260: 869-878, 1999). ChM-I polypeptide is FGF-
Synergize with 2 to induce soft agar colony formation of cultured growth plate chondrocytes (Inoue et al., Biochem. Biophys. Res. Com., 24.
1: 395-400, 1999). Primary osteoblasts and MC3T3-e1 osteoblast-like cells proliferate when stimulated with ChM-I (Mori et al., FEBS.
Lett. , 406: 310-314, 1999).

Thus, the identification of chondromodulin-I has led to a good understanding of the processes involved in mediating the development of skeletal components, including inhibition of bone growth, chondrogenesis and cartilage angiogenesis. The identification of chondromodulin-I-related genes and polypeptides as described herein and other chondromodulin-related polypeptides further clarified understanding of these processes, and degraded and increased skeletal components. Promote the development of treatments for the pathological conditions involved in angiogenesis.

SUMMARY OF THE INVENTION The present invention relates to a novel serine / threonine kinase family and uses thereof. More specifically, the present invention relates to novel ChMIrp nucleic acid molecules and encoded polypeptides, and uses thereof.

The present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: (a) the nucleotide sequence shown in SEQ ID NO: 1; (b) shown in SEQ ID NO: 2. A nucleotide sequence encoding a polypeptide; (c) a nucleotide sequence that hybridizes to the complement of (a) or (b) under moderate or high stringency conditions, wherein the encoded polypeptide is Is a nucleotide sequence having the activity of the polypeptide shown in SEQ ID NO: 2; and (d) a nucleotide sequence complementary to any of (a) to (c).

The present invention also provides an isolated nucleic acid molecule comprising a nucleotide sequence selected from the following group: (a) at least about 70%, about 70%, to the polypeptide shown in SEQ ID NO: 2. 7
5%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98
%, Or about 99% identical, is a nucleotide sequence that encodes a polypeptide, wherein the polypeptide is GAP, BLASTP, BLASTN, FA.
STA, BLASTA, BLASTX, BestFit, and Smith-W
having the activity of the encoded polypeptide set forth in SEQ ID NO: 2, as determined using a computer program selected from the group consisting of the aterman algorithm; (b) an allele of the nucleotide sequence set forth in SEQ ID NO: 1. A nucleotide sequence encoding a variant or splice variant, wherein the encoded polypeptide has the activity of the encoded polypeptide set forth in SEQ ID NO: 2; (c) a poly of at least about 25 amino acid residues. A nucleotide sequence of SEQ ID NO: 1, (a), or (b), which encodes a peptide fragment, wherein the polypeptide has the activity of the encoded polypeptide set forth in SEQ ID NO: 2; (d) ) Substitution of 1-250 amino acid residues shown in any of SEQ ID NOs: 1-2 A nucleotide sequence encoding a polypeptide having pre / or defect,
Wherein the encoded polypeptide has the activity of the encoded polypeptide shown in SEQ ID NO: 2; (e) the nucleotide sequence of SEQ ID NO: 1, or a fragment of at least about 16 nucleotides (a)-( d); (f) Under mild or highly stringent conditions (a)-(e)
), Wherein the encoded polypeptide has the activity of the encoded polypeptide set forth in SEQ ID NO: 2; and (g) (a) To a nucleotide sequence complementary to any of (e).

The invention further provides an isolated nucleic acid molecule comprising a nucleotide sequence selected from the following group: (a) a poly as set forth in SEQ ID NO: 2 having at least one conservatively substituted amino acid. A nucleotide sequence encoding a peptide, wherein the encoded polypeptide has the activity of the polypeptide set forth in SEQ ID NO: 2; (b) SEQ ID NO: 2 having at least one conservative insertion amino acid. A nucleotide sequence encoding the polypeptide set forth in, wherein the encoded polypeptide has the activity of the polypeptide set forth in SEQ ID NO: 2; (c) has at least one conservatively deleted amino acid. , A nucleotide sequence encoding the polypeptide shown in SEQ ID NO: 2, wherein the encoded polypeptide A peptide having the activity of the polypeptide set forth in SEQ ID NO: 2; (d) a nucleotide sequence encoding the polypeptide set forth in SEQ ID NO: 2 having a C-terminal and / or N-terminal deletion, wherein: The encoded polypeptide has the activity of the encoded polypeptide shown in SEQ ID NO: 2; (e) selected from the group consisting of amino acid substitution, amino acid insertion, amino acid deletion, C-terminal deletion, and N-terminal deletion. , With at least one modification, SEQ ID NO: 2
A nucleotide sequence encoding the polypeptide set forth in, wherein the polypeptide has the activity of the encoded polypeptide set forth in SEQ ID NO: 2; (f) comprising a fragment of at least about 16 nucleotides, (A)-(e)
(G) under mild or highly stringent conditions (a)-(f)
), Wherein the encoded polypeptide has the activity of the encoded polypeptide set forth in SEQ ID NO: 2; and (h) (a) To a nucleotide sequence complementary to any of (e).

The present invention also provides an isolated polypeptide comprising an amino acid sequence selected from the following group: (a) includes a mature amino acid terminus at residue 1 and further optionally a methionine amino terminus. (B) an amino acid sequence for the ortholog of SEQ ID NO: 2, wherein the polypeptide has the activity of the polypeptide shown in SEQ ID NO: 2; ) At least about 70%, about 7 relative to the amino acid sequence shown in SEQ ID NO: 2
5%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98
%, Or about 99% identical, is a nucleotide sequence that encodes a polypeptide, wherein the polypeptide is GAP, BLASTP, BLASTN, FA.
STA, BLASTA, BLASTX, BestFit, and Smith-W
having the activity of the encoded polypeptide set forth in SEQ ID NO: 2 as determined using a computer program selected from the group consisting of the aterman algorithm; (d) SEQ ID NO: comprising at least about 25 amino acid residues. 2 is an amino acid sequence fragment shown in FIG. 2, wherein the polypeptide has the activity of the polypeptide shown in SEQ ID NO: 2; (e) the amino acid sequence shown in SEQ ID NO: 2, or (a) to (e) A) an amino acid sequence that is either an allelic variant or a splice variant of the amino acid sequence set forth in at least one of (1), wherein the polypeptide has the activity of the polypeptide set forth in SEQ ID NO: 2; The invention further provides an isolated polypeptide comprising an amino acid sequence selected from the group Provided: (a) an amino acid sequence set forth in SEQ ID NO: 2 having at least one conservative substitution amino acid, wherein the polypeptide has the activity of the polypeptide set forth in SEQ ID NO: 2; b) an amino acid sequence shown in SEQ ID NO: 2 having at least one inserted amino acid, wherein the polypeptide has the activity of the polypeptide shown in SEQ ID NO: 2; (c) at least one deletion An amino acid sequence shown in SEQ ID NO: 2 having amino acids, wherein the polypeptide has the activity of the polypeptide shown in SEQ ID NO: 2; (d) has a C-terminal and / or N-terminal deletion , The amino acid sequence of SEQ ID NO: 2, wherein the encoded polypeptide is the activity of the polypeptide of SEQ ID NO: 2. The a; (e) amino acid substitutions, amino acid insertions, amino acid deficiency, C-terminal, defects, and are selected from the group consisting of N-terminal-deficient, with at least one modification, SEQ ID NO: 2
The amino acid sequence of SEQ ID NO: 2 wherein the polypeptide has the activity of the polypeptide of SEQ ID NO: 2; also a fusion polypeptide comprising the polypeptide sequence of paragraphs (a)-(e) above. Also provided.

The present invention also includes an expression vector comprising the isolated nucleic acid molecule set forth herein, a recombinant host cell comprising the recombinant nucleic acid molecule set forth herein, and the step of culturing the host cell. And optionally a method of producing a ChMIrp polypeptide comprising the step of isolating the polypeptide so produced.

Transgenic non-human animals containing a nucleic acid molecule encoding a ChMIrp polypeptide are also encompassed by the invention. The ChMIrp nucleic acid molecule is introduced into an animal in a manner that allows expression and increased levels of ChMIrp polypeptide, which may include increased circulating levels. The transgenic non-human animal is preferably a mammal.

[0018]   Derivatives of the ChMIrp polypeptides of the invention are also provided.

Provided within the invention are analogs of ChMIrp resulting from conservative or non-conservative amino acid substitutions of the ChMIrp polypeptide of SEQ ID NO: 2. Such analogs include ChMIrp polypeptides in which the amino acid at position 276 is selected from the group consisting of cysteine, serine, or alanine, and the amino acid at position 280 is selected from the group consisting of cysteine, serine, or alanine. ChMIrp polypeptide comprising a ChMIrp polypeptide, wherein the amino acid at position 281 is a ChMIrp polypeptide selected from the group consisting of glutamic acid or aspartic acid, and the amino acid at position 285 is a ChMIrp selected from the group consisting of glycine, proline, or alanine. A polypeptide, wherein the amino acid at position 297 comprises a ChMIrp polypeptide selected from the group consisting of arginine, lysine, glutamine, or asparagine, and the amino acid at position 300 comprises cysteine. ChMIrp selected from the group consisting of serine or alanine,
A polypeptide, wherein the amino acid at position 306 comprises a ChMIrp polypeptide selected from the group consisting of cysteine, serine, or alanine, and the amino acid at position 310 comprises valine, isoleucine, methionine, leucine,
C selected from the group consisting of phenylalanine, alanine, or norleucine
Includes hMIrp polypeptide.

Further provided are selective binding agents, such as antibodies and peptides capable of specifically binding the ChMIrp polypeptides of the invention. Such antibodies and peptides can be repulsive or antagonistic.

Pharmaceutical compositions containing the nucleotides, polypeptides or selective binding agents of the invention, and one or more pharmaceutically acceptable formulation agents are also included by the invention. This pharmaceutical composition is used to provide a therapeutically effective amount of nucleotides or polypeptides of the invention. The invention also relates to methods of using the polypeptides, nucleic acid molecules and selective binding agents. The invention also provides a device for administering a ChMIrp polypeptide encapsulated within a membrane.

ChMIrp polypeptides of the invention and biologically active variants thereof,
Analogs, homologues and fragments may be used for therapeutic and / or diagnostic purposes to treat, prevent and / or detect susceptibility to conditions or pathological conditions resulting from abnormal levels of ChMIrp polypeptides, which conditions are associated with chondr.
Overreaction or skeletal state of the host to omodulin family members (
For example, pathological conditions including cancer, inflammatory diseases (e.g., cancer, inflammatory disease (eg, Psoriasis and cirrhosis) and related diseases (including atherosclerosis, including coronary heart disease and hypertension).

The present invention comprises a biologically active ChMIrp polypeptide and / or one or more biologically active variants, fragments, homologues or variants thereof, other pharmaceutical agents alone. Either in combination or in combination, is provided for the treatment, prevention or amelioration of diseases resulting from abnormal levels of ChMIrp polypeptides in mammals. The present invention also provides a method of diagnosing such disorders / diseases, or ChMIrp polypeptides and / or antibodies and / or C in body fluids.
It provides susceptibility to such disorders / diseases for mammals, including using the amount and / or tissue of the hMIrp gene. The invention also provides methods of diagnosing disorders / diseases resulting from mutations in the ChMIrp gene, using the nucleic acid molecules of the invention as probes. The animal is preferably a mammal, more preferably a human.

The invention also provides a method of testing molecular collisions during expression of ChMIrp polypeptides. Expression and modulating (ie, increasing or decreasing) levels of ChMIrp polypeptides are also included by the invention. One method involves administering a nucleic acid molecule to an animal in vivo. In another method, ChMI
Nucleic acid molecules containing elements that regulate the expression of rp polypeptides can be administered to animals.
Examples of these methods include gene therapy and antisense therapy.

Methods of modulating expression and modulating (ie, increasing or decreasing) the levels of ChMIrp polypeptides are also included by the invention. One method involves administering to the animal a nucleic acid molecule encoding a ChMIrp polypeptide. In another method, nucleic acid molecules containing elements that regulate or modulate the expression of ChMIrp polypeptides can be administered. Examples of these methods include gene therapy, cell therapy and antisense therapy, as described further herein.

ChMIrp polypeptides were highly expressed in a wide range of primary human tumors. Thus, the polypeptides present and their useful nucleic acid intermediates have shown utility in differentiating transformed cells from the background.

In another aspect of the invention, a ChMIrp polypeptide can be used to identify its receptor or binding partner (“ChMIrp receptor” or “ChMIrp binding partner”). Various forms of "expression cloning" are widely used to clone receptors for proteins or cofactors. For example, Simonsen and Lodish, Tre
nds in Pharmaceutical Sciences, 15: 4.
37-441, 1994 and Tartaglia et al., Cell, 83:12.
63-1271, 1995. ChMIrp receptor or ChM
Isolation of Irp binding partners is useful for identifying or developing novel agonists and antagonists of ChMIrp polypeptide signaling pathway.

In another aspect of the invention, a ChMIrp polypeptide has a binding partner (such as a “ChMrp receptor” or a “ChMrp receptor” or other ChMIrp cofactor).
Irp binding partner ") (Chien et al., Pr.
oc. Natl. Acad. Sci. USA, 88: 9578-9583, 19
91). Isolation of ChMIrp binding partners is useful for identifying or developing new agonists and antagonists of ChMIrp activation.

Such agonists and antagonists include soluble ChMIrp ligands, anti-h2520-109 selective binding agents (eg ChMIrp antibodies and derivatives thereof), small molecules, peptides or derivatives thereof capable of binding ChMIrp polypeptides. , Or antisense oligonucleotides,
Any of these may be useful in treating one or more diseases or disorders, including those disclosed herein.

In certain embodiments, a ChMIrp polynucleotide agonist or antagonist can be a protein, peptide, carbohydrate, lipid, or low molecular weight molecule that interacts with a ChMIrp polypeptide to modulate its activation.

DETAILED DESCRIPTION OF THE INVENTION The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. . All references listed in this application are expressly incorporated herein by reference.

Definitions The term “nucleic acid molecule encoding ChMIrp” refers to a nucleic acid molecule or polynucleotide, which comprises or consists essentially of the nucleotide sequence set forth in SEQ ID NO: 1, and / or It comprises or consists essentially of a nucleotide sequence encoding the polynucleotide set forth in SEQ ID NO: 2. Related nucleic acid molecules have about 7 nucleotides relative to the nucleotide sequence as shown in SEQ ID NO: 1.
Comprising or consisting essentially of a nucleotide sequence that is 0 percent identical, or comprising a nucleotide sequence that encodes a polypeptide that is about 75 percent identical to the polypeptide as set forth in SEQ ID NO: 2. It will consist of this. In a preferred embodiment, the nucleotide sequence is about 75 percent, or about 80 percent, relative to the nucleotide sequence as set forth in SEQ ID NO: 1.
%, Or about 90 percent, or about 95, 96, 97, 98,
Or 99% identical, or the nucleotide sequence is SEQ ID NO: 2.
About 75 percent, or about 8 percent, of the polypeptide sequence as shown in.
Encode a polypeptide that is 0 percent, or about 85 percent, or about 90 percent, or about 95, 96, 97, 98, or 99 percent identical. A related nucleic acid molecule encodes a polypeptide that retains at least one activity of the polypeptide set forth in SEQ ID NO: 2.

Related nucleic acid molecules also include fragments of the above ChMIrp nucleic acid molecules, which fragments are at least about 10 contiguous nucleotides, or about 15, or about 20, or about 25, or about 50, or about 50. 75, or about 100, or more than about 100 contiguous nucleotides. Related nucleic acid molecules also include fragments of the above ChMIrp nucleic acid molecules, which fragments contain at least about 25 amino acid residues, or about 50, or about 75, or about 100, or more than about 100 amino acid residues. It encodes a polypeptide. A related nucleic acid molecule also comprises a nucleotide sequence that encodes a polypeptide that comprises, or consists essentially of, substitutions and / or deletions of 1-317 amino acid residues as compared to the polypeptide of SEQ ID NO: 2. including. Related Fhm ligand nucleic acid molecules include those molecules that comprise a nucleotide sequence that hybridizes to any of the above nucleic acid molecules under the moderately or highly stringent conditions defined herein. In a preferred embodiment, the relevant nucleic acid molecule is under moderately or highly stringent conditions, with the sequence set forth in SEQ ID NO: 1 or a polypeptide (wherein the polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 2). Including), or a nucleic acid fragment described above, or a nucleic acid fragment that encodes a polypeptide as defined above. It is also understood that related nucleic acid molecules include allelic or splice variants of any of the above nucleic acids and include sequences complementary to any of the above nucleotide sequences.

The term “isolated nucleic acid molecule” refers to (1) among the proteins, lipids, carbohydrates, or other substances with which total DNA is naturally found when isolated from a source cell. A nucleic acid molecule of the invention isolated from at least about 50 percent,
(2) a nucleic acid molecule of the present invention that is not linked to all or part of a polynucleotide to which the "isolated nucleic acid molecule" is naturally linked, (3) operably linked to a polynucleotide that is not naturally linked. The nucleic acid molecule of the present invention as described above, or (4) refers to a nucleic acid molecule of the present invention that does not occur in nature as part of a larger polynucleotide sequence. Preferably, the isolated nucleic acid molecule of the invention is any other contaminating nucleic acid molecule, or other contaminant found in its natural environment, which may be used in polypeptide production, or for therapeutic use, diagnostics. (Prevents preventive, preventive, or research use)).

The term “nucleic acid” sequence or nucleic acid molecule, as used herein, refers to a DNA or RNA sequence. The term includes molecules formed from any of the known base analogs of DNA and RNA, including, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridini. Lucitocin, pseudoisocytosine (pseudoisocytosine)
e), 5- (carboxyhydroxylmethyl) uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxy-methylamino-methyluracil, dihydrouracil, inosine, N6-iso. -Pentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethyl-guanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5 −
Methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyamino-methyl-2-thiouracil, β-D-
Mannosyl cuocosine (β-D-mannosylqueosine), 5 '
-Methoxycarbonyl-methyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, oxybutoxosine (oxybutoxosin)
e), pseudouracil, queocin, 2-thiocytosine, 5-methyl-2-
Thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N
-Uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, pseudouracil, queocin, 2-thiocytosine, and 2,6-diaminopurine.

The term “operably linked” is used herein to refer to a method of placing flanking sequences. Here, the flanking sequences thus described are constructed or assembled to perform their useful functions. Thus, flanking sequences operably linked to a coding sequence may result in replication, transcription and / or translation of the coding sequence. For example, a coding sequence is operably linked to a promoter if the promoter is capable of directing the transcription of the coding sequence. The flanking sequences need not be contiguous with the coding sequence as long as it functions correctly. Thus, for example, an untranslated but transcribed intervening sequence may be present between the promoter sequence and the coding sequence, and the promoter sequence is still considered to be "operably linked" to the coding sequence. obtain.

The term “ChMIrp polypeptide allelic variant” refers to several possible naturally occurring alternative forms of a gene that occupy a defined locus on the chromosome of an organism or population of organisms. One of the.

The term “ChMIrp polypeptide splice variant” refers to a nucleic acid molecule (usually R
NA). This nucleic acid molecule is produced by the selective processing of intron sequences in RNA transcripts.

The term “expression vector” refers to a vector that is suitable for transformation of a host cell and contains nucleic acid sequences that direct and / or control the expression of inserted heterologous nucleic acid sequences. Expression includes, but is not limited to, processes such as transcription, translation, and RNA splicing (if an intron is present).

The term “vector” is used to refer to any molecule (eg, nucleic acid, plasmid, or virus) used to transfer coding information into a host cell.

As used herein, the term “transformation” refers to a change in the genetic characteristics of a cell, and a cell that has been transformed when it has been modified to contain new DNA. It For example, a cell is transformed when it is genetically modified from its native state. Subsequent to transfection or transduction, transformation of DNA involves the incorporation of D into the cell by physically integrating it into the chromosome of the cell.
It may recombine with NA, be transiently maintained as an episomal element without being replicated, or may independently replicate as a plasmid. A cell is considered to be stably transformed if the DNA is replicated with cell division.

The term “transfection” is used to refer to the uptake of heterologous or exogenous DNA by a cell, and the cell is “transfected” if the exogenous DNA has been introduced inside the cell membrane. . Many transfection techniques are well known in the art and disclosed herein. For example, Grah
am et al., Virology 52: 456, 1973; Sambrook et al., M.
olecular Cloning, A Laboratory Manual
, Cold Spring Harbor Laboratories (Col
d Spring Harbor Laboratories, New Yor
K., 1989); Davis et al., Basic Methods in Mole.
polar Biology, Elsevier, 1986; and Chu et al.
See Gene 13: 197, 1981. Using technology like this
One or more exogenous DNA moieties may be introduced into a suitable host cell.

The term “transduction” is commonly used to refer to the transfer of a gene from one bacterium to another by phage. "Transduction" also refers to the acquisition and transfer of eukaryotic cell sequences by a retrovirus.

The term “host cell” refers to a cell in which a nucleic acid sequence has been or can be transformed with a vector containing a selected gene of interest, which vector is then expressed by this cell. Used for. The term includes the progeny of the parent cell, whether the progeny is identical in morphology or genetic structure to the original parent, so long as the selected gene is present.

The term “vector” is used to refer to any molecule (eg, nucleic acid, plasmid, or virus) used to transfer coding information into a host cell.

The term “highly stringent conditions” refers to DNs where the sequences are highly complementary.
Refers to conditions designed to allow hybridization of the A strands and exclude hybridization of DNA that is significantly inconsistent. Hybridization stringency is primarily determined by temperature, ionic strength, and the concentration of denaturing agents (eg, formamide). An example of "highly stringent conditions" for hybridization and washing is 0.015 at 65-68 ° C.
M sodium chloride, 0.0015 M sodium citrate, or 0.
015M sodium chloride, 0.0015M sodium citrate and 50% formamide. Sambrook et al., Molecular Cloning:
A Laboratory Manual, 2nd Edition, Cold Spring
Harbor Laboratory, (Cold Spring Harbo
r Laboratory, N .; Y. 1989); Anderson et al., Nuc.
leic Acid Hybridization: A Practical
Approach Chapter 4, IRL Press Limited (Oxfor
d, England).

More stringent conditions (eg higher temperature, lower ionic strength,
Higher formamide or other denaturants) can also be used, but the rate of hybridization is affected. Other agents may be included in the hybridization and wash buffers for the purpose of reducing non-specific and / or background hybridization. Examples are 0.1% bovine serum albumin, 0.1% polyvinyl-pyrrolidone, 0.1% sodium pyrophosphate, 0.1
% Sodium dodecyl sulfate, NaDodSO ₄ , (SDS), Ficoll (fi
Coll), Denhardt's solution, sonicated salmon sperm DNA (or another non-complementary DNA) and dextran sulphate, but other suitable agents may also be used. The concentration and type of these additives can be varied without substantially affecting the stringency of the hybridization conditions. Hybridization experiments are usually performed at pH 6.8-7.4. However, at typical ionic strength conditions, the rate of hybridization is almost independent of pH. Anderson et al., Nucleic Acid Hybridisatio.
n: A Practical Approach, Chapter 4, IRL Press
See Limited (Oxford, England).

Factors affecting the stability of the DNA duplex include base composition, length, and degree of base pair mismatch. Hybridization conditions can be adjusted by those of skill in the art to accommodate these variables and allow DNAs of different sequence relatedness to form hybrids. The melting temperature of a perfectly matched DNA duplex can be estimated by the following equation: T _m (° C.) = 81.5 + 16.6 (log [Na +]) + 0.41 (G + C%).
) -600 / N-0.72 (% formamide) where N is the length of the duplex formed and [Na +] is the molar concentration of sodium ion in the hybridization or wash solution. And G + C
% Is the percentage of (guanine + cytosine) bases in the hybrid. For imperfectly matched hybrids, the melting temperature is reduced by about 1 ° C. for every 1% mismatch.

The term “moderately stringent conditions” refers to conditions under which a DNA duplex having a higher degree of base pair mismatch than can occur under “highly stringent conditions” can be formed. An example of a typical “moderately stringent condition” is 5
0.015M sodium chloride at 0-65 ° C, 0.0015M sodium citrate or 0.015M sodium chloride at 37-50 ° C, 0.0015M sodium citrate and 20% formamide. By way of example, a "moderately stringent condition" of 50 ° C in 0.015M sodium ion is about 2
Allows 1% discrepancy.

It will be appreciated by those skilled in the art that there is no absolute distinction between “highly” and “moderate” stringent conditions. For example, 0
． With 015M sodium ion (without formamide), the melting temperature of perfectly matched length DNA is about 71 ° C. With a wash at 65 ° C. (at the same ionic strength), this allows a discrepancy of about 6%. To capture more distantly related sequences, one of ordinary skill in the art can simply lower the temperature or increase the ionic strength.

1M Na for oligonucleotide probes up to about 20 nucleotides
A good estimate of melting temperature in Cl ^* is given by: Tm = 2 ° C. per AT base pair + 4 ° C. per GC base pair ^* 6 × in sodium citrate salt (SSC). The sodium ion concentration is 1M. Suggs et al., Developmental Biology Usin.
g Purified Genes pp. 683, Brown and Fox (ed.)
(1981).

High stringency wash conditions for oligonucleotides are typically 6 ×.
SSC, 0 ° C to 5 than Tm of the oligonucleotide in 0.1% SDS
It is at a temperature lower by ℃.

The term “ChMIrp polypeptide” refers to a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, and related polypeptides described herein. Related polypeptides include: ChMIrp polypeptide allelic variants, ChMIrp polypeptide analogs, ChMIrp polypeptide splice variants, ChMIrp polypeptide variants, ChMIrp polypeptide fragments, ChMIrp polypeptide derivatives, substitution variants. , Deletion variants and / or insertion variants, ChMIrp fusion polypeptides, and ChMIrp polypeptide orthologs.

The term “ChMIrp polypeptide analog” refers to related polypeptides having an amino acid sequence similar to the ChMIrp amino acid sequence set forth in SEQ ID NO: 2 with conservative and non-conservative amino acid substitutions.

The term “ChMIrp polypeptide ortholog” refers to a polypeptide from another species that corresponds to the ChMIrp polypeptide amino acid sequence shown in SEQ ID NO: 2. For example, mouse and human ChMIrp polypeptides are considered to be orthologs of each other.

The ChMIrp polypeptide may be a mature polypeptide, as defined herein, and may have an amino-terminal methionine residue, depending on the method of preparing these polypeptides. However, it is not necessary to have it. The term "ChMIrp
“Polypeptide fragment” refers to a peptide or polypeptide that comprises less than the full length amino acid sequence of a ChMIrp polypeptide as shown in SEQ ID NO: 2. Such fragments are, for example, truncated at the amino terminus.
cation), truncation at the carboxy terminus, and / or internal deletions of the amino acid sequence. ChMIrp fragments can be generated by alternative RNA splicing or by in vivo protease activity.

The term “ChMIrp polypeptide fragment” refers to a polypeptide that comprises less than the full length amino acid sequence of a ChMIrp polypeptide as shown in SEQ ID NO: 2. Such ChMIrp fragments can be 6 or more amino acids in length, and are, for example, amino-terminal (with or without a leader sequence).
At the carboxy terminus, and / or from the amino acid sequence.
It can occur by internal deletion of one or more residues. ChMIrp fragments can be generated by alternative RNA splicing or by in vivo protease activity. Membrane-bound forms of ChMIrp polypeptides are also contemplated by the present invention. In preferred embodiments, the truncation and / or deletion comprises about 10 amino acids, or about 20 amino acids, or about 50 amino acids, or about 75 amino acids, or about 100 amino acids, or more than about 100 amino acids. The polypeptide fragment thus produced comprises about 25 consecutive amino acids, or about 50 amino acids, or about 75 amino acids, or about 100 amino acids, or about 150 amino acids, or about 200 amino acids. Such ChMIrp polypeptide fragments may optionally include an amino terminal methionine residue. It is understood that such fragments can be used, for example, to generate antibodies to ChMIrp polypeptides.

The term “ChMIrp polypeptide variant” refers to a ChMIrp polypeptide that comprises an amino acid sequence that has one or more amino acid sequence substitutions, deletions, and / or additions as compared to the ChMIrp polypeptide amino acid sequence. . Variants can be naturally occurring or artificially constructed using recombinant DNA technology. Such ChMIrp polypeptide variants can be prepared from the corresponding nucleic acid molecule encoding the variants. Therefore, this variant is a DNA modified from the DNA sequence for the wild-type ChMIrp polypeptide as shown in SEQ ID NO: 1.
Has an array.

One of skill in the art can determine the appropriate variant of the native polypeptide using well known techniques. For example, one of skill in the art can predict the appropriate region of the molecule that can be altered without destroying the biological activity. Those skilled in the art will also appreciate that conservative amino acid substitutions in which regions that may be important for activity or for structure do not destroy biological activity or adversely affect the structure of the polypeptide. Even recognize that it can be assumed.

To predict suitable regions of the molecule that can be altered without destroying activity, one of skill in the art can target regions that are not considered important for activity. For example, if a similar polypeptide with similar activity is known, from the same species or from another species, one of skill in the art would include the amino acid sequence of a ChMIrp polypeptide as:
One can compare such similar polypeptides. Such comparisons can be used to determine the residues and portions of a molecule that are conserved between similar polypeptides. For those skilled in the art,
It is known that changes in regions of the non-conserved ChMIrp molecule do not appear to adversely affect the biological activity and / or structure of ChMIrp polypeptides. Those skilled in the art will also find that even in relatively conserved areas,
It is known that chemically similar amino acids can be substituted for naturally occurring residues while maintaining activity (conservative amino acid residue substitutions).

In addition, one of skill in the art can review structure-function studies identifying residues in similar polypeptides that are important for activity or structure. In view of such comparisons, one may predict the importance of amino acid residues in a ChMIrp polypeptide that correspond to amino acid residues that are important for activity or structure in similar polypeptides. One of skill in the art can select chemically similar amino acid substitutions for such predicted important amino acid residues in the ChMIrp polypeptide.

Where possible, one of ordinary skill in the art can also analyze the three-dimensional structure in similar polypeptides and the amino acid sequences associated with that structure. In terms of such information,
One of ordinary skill in the art can predict the alignment of amino acid residues of a ChMIrp polypeptide with respect to its three-dimensional structure. One of skill in the art can choose not to make abrupt changes to amino acid residues predicted to be present on the surface of the protein.
Because such residues may be involved in important interactions with other molecules.

ChMIrp polypeptide analogs of the invention can be determined by comparing the amino acid sequence of a ChMIrp polypeptide with a member of a related family. Specific ChMIrp polypeptide-related family members include, but are not limited to: human chondromodulin (chondro).
modulin) I, mouse ChMIrp, mouse chondromodulin I, rat chondromodulin I, bovine chondromodulin I, rabbit chondromodulin I. This comparison is based on Pileup alignment (Wisconsin GCG
Program Package) or equivalent (overlapping) comparisons with multiple family members within conserved and non-conserved regions.

As shown in FIG. 4, the deduced amino acid sequence of human ChMIrp polypeptide (SEQ ID NO: 2) is mouse ChMIrp, mouse chondromodulin I, rat chondromodulin I, bovine chondromodulin I, human chondromodulin I, human chondromodulin I. It is aligned with phosphorus I, rabbit chondromodulin I (SEQ ID NOs: 4-9). Other C
hMIrp polypeptide analogs can be determined using these or other methods well known to those of skill in the art. These overlapping sequences provide guidance for conservative and non-conservative amino acid substitutions that result in additional ChMIrp analogs.
It is understood that these amino acid substitutions consist of naturally occurring or unnatural amino acids. For example, as shown in FIG. 4, an alignment of these related polypeptides results in the potential ChMIrp analog remaining at Ser or Ala at position 276 (SEQ ID NO: 296 in FIG. 4) in SEQ ID NO: 2. Cy substituted with a group
s residue, which may have a Cys residue substituted with a Ser or Ala residue at position 280 (position 300 in FIG. 4) in SEQ ID NO: 2, or
The glutamic acid residue at the 281st position in SEQ ID NO: 2 (in FIG.
Position 1) can be replaced with an Asp residue. Further, the glycine residue at the 285th position in SEQ ID NO: 2 (the 305th position in FIG. 4) can be replaced with Pro and Ala, and the Arg residue at the 297th position in SEQ ID NO: 2 can be substituted. The base (the 317th position in FIG. 4) is Lys, Gl.
n or Asn residue, and the Cys residue at position 300 in SEQ ID NO: 2 (at position 320 in FIG. 4) may be replaced by Ser or Ala residue, SEQ ID NO: Cys residue at position 306 in FIG.
At position 326) can be replaced with a Ser or Ala residue, and the Val residue at position 310 in SEQ ID NO: 2 (in FIG. 4, position 33).
The 0th) can be replaced with Ile, Met, Leu, Phe, Ala, norleucine.

Furthermore, the person skilled in the art can generate test variants containing a single amino acid substitution at each amino acid residue. Variants can be screened using the activity assay described herein. Such variants can be used to gather information about suitable variants. For example, if a change to a particular amino acid that occurs in a disrupted mutant, an unwanted reduction mutant, or an inappropriately active mutant is found,
Mutants with such changes are avoided. In other words, based on the information gathered by such routine experimentation, one of skill in the art can readily determine amino acids whose substitutions should be avoided, either alone or in combination with other mutations.

In an equivalent manner, the hydropathic index of amino acids (hydrophobicity index) can be taken into account in making such changes. Each amino acid has been assigned a hydropathic index based on its hydrophobicity and charge characteristics. The hydropathic indices are: isoleucine (+4.5); valine (+4.2); leucine (+).
3.8); Phenylalanine (+2.8); Cysteine / cystine (+2.5)
Methionine (+1.9); Alanine (+1.8); Glycine (-0.4); Threonine (-0.7); Serine (-0.8); Tryptophan (-0.9); Tyrosine (- 1.3); Proline (-1.6); Histidine (-3.2); Glutamic acid (-3.5); Glutamine (-3.5); Aspartic acid (-3.5);
Asparagine (-3.5); Lysine (-3.9); and Arginine (-4.5).
).

The importance of the hydropathic amino acid index in identifying interactive biological functions for proteins is generally understood in the art (Kyte.
Et al., 1982, J. Am. Mol. Biol. 157: 105-31). It is known that certain amino acids can be used in place of other amino acids with similar hydropathic indices or scores, and still maintain similar biological activity. When making changes based on the hydrophobicity index, the substitution of amino acids whose hydrophobicity index is within ± 2 is preferred, those within ± 1 are particularly preferred, and those within ± 0.5. Are even more particularly preferred.

Substitution of similar amino acids can be made effectively on the basis of hydrophilicity (especially as in the case of the present invention, the biologically functional equivalent proteins or peptides produced by them are immunologically (As envisioned for use in particular embodiments) is also understood in the art.

In US Pat. No. 4,554,101, the greatest local average hydrophilicity of a protein is its immunogenicity and antigenicity, ie, its if it is dominated by the hydrophilicity of its contiguous amino acids. It has been described to correlate with the biological properties of proteins. The following hydrophilicity values have been assigned to these amino acid residues, as detailed in US Pat. No. 4,554,101: Arginine (+3.
0); lysine (+3.0); aspartic acid (+ 3.0 ± 1); glutamic acid (
+ 3.0 ± 1); Serine (+0.3); Asparagine (+0.2); Glutamine (+0.2); Glycine (0); Threonine (-0.4); Proline (-0.5)
± 1); alanine (-0.5); histidine (-0.5); cysteine (-1.
0); methionine (-1.3); valine (-1.5); leucine (-1.8);
Isoleucine (-1.8); Tyrosine (-2.3); Phenylalanine (-2.
5); and tryptophan (-3.4).

In making changes based on similar hydrophilicity values, substitution of amino acids whose hydrophilicity values are within ± 2 is preferred, those within ± l are particularly preferred, and within ± 0.5. Some are even more particularly preferred. US Pat. No. 4,554,101 also teaches the identification and preparation of epitopes from hydrophilic-based primary amino acid sequences. Through the methods described in US Pat. No. 4,554,101, one of skill in the art can identify epitopes within a given amino acid sequence. These regions are also called "epitope regions".

Numerous scientific publications have been devoted to secondary structure deduction and epitope identification from amino acid analyses. Chou et al., 1974, Biochemistry.
13: 222-45; Chou et al., 1974, Biochemistry 11
3: 211-2; Chou et al., 1978, Adv. Enzymol. Rela
t. Areas Mol. Biol. 47: 45-48; Chou et al., 1978.
, Ann. Rev. Biochem. 47: 251-276; and Chou et al., 1979, Biophys. J. 26: 367-84. further,
Computer programs are available to assist with predicting antigenic and epitopic core regions in proteins. As an example, Jameso
n-Wolf analysis (Jameson et al. Compt. Appl. Biosci.
4 (1): 181-186, 1998 and Wolf et al., Comput. Bi
osci. 4 (1): 187-191, 1988); PepPlot program (Brutlag et al., CABS, 6: 237-245, 1990, and We.
Inberger et al., Science, 228: 740-742, 1985) and a novel program for protein tertiary structure prediction (Fetrow et al., Bio).
technology, 11: 479-483, 1993).

Computer programs are currently available to assist with predicting secondary structure. One method of estimating secondary structure is based on homology modeling. For example, two polypeptides or proteins with greater than 30% sequence identity or greater than 40% similarity often have similar structural topologies. The recent growth of the protein structural database (PDB) has provided enhanced predictability of secondary structure, including the number of possible folds in the structure of a polypeptide or protein. Holm et al., 1999, Nucleic Acids Re.
s. 27: 244-47. It has been suggested that there is a limited number of folds in a given polypeptide or protein, and that once the critical number of structures has been elucidated, structure estimation becomes dramatically more accurate (Bre.
nner et al., 1997, Curr. Opin. Struct. Biol. 7: 3
69-376).

A further method of inferring secondary structure is “threading”.
) ”(Jones, 1997, Curr. Opin. Struct. Biol.
7 (3): 377-87; Sippl et al., 1996, Structure 4 (
1): 15-19), "Profile Analysis" (Bowie et al., 1991, Sci.
ence, 253: 164-170; Gribskov et al., 1990, Meth.
ods Enzymol. 183: 146-59; Gribskov et al., 198.
7, Proc. Nat. Acad. Sci. U. S. A. 84 (3): 4355.
~ 4358), and "evolutionary linka.
ge) "(see Holm et al., supra, and Brenner et al., supra).

In preferred embodiments, the variants are 1-3, or 1-5, or 1-10.
Or 1 to 15, or 1 to 20, or 1 to 25, or 1 to 50, or 1 to 75, or 1 to 100, or 100 or more amino acid substitutions, amino acid insertions, amino acid additions and / or amino acid deletions , Where the substitution is conservative or non-conservative, as indicated herein, or any combination thereof. In addition, these variants may have additions of amino acid residues at the carboxyl or amino termini (with or without a leader sequence).

Preferred ChMIrp polypeptide variants include glycosylation variants in which the number and / or type of glycosylation sites are altered compared to the native amino acid sequence. In one embodiment, the ChMIrp polypeptide variant comprises a greater or lesser number of N-linked glycosylation sites than the amino acid sequence set forth in SEQ ID NO: 2. The N-linked glycosylation site has the sequence Asn-X-S
An amino acid residue characterized by er or Asn-X-Thr, where the amino acid residue marked X, can be any amino acid residue other than proline. Substitution of amino acid residues to create this sequence provides a potential new site for the addition of N-linked sugar chains. Alternatively, substitutions that eliminate this sequence remove the existing N-linked sugar chain. N-linked glycosylation rearrangements are also possible in which one or more N-linked glycosylation sites (typically naturally occurring glycosylation sites) are eliminated and one or more new N-linked sites are created. Also provided. Further preferred ChMIrp polypeptide variants have one or more cysteine residues deleted or substituted with another amino acid (eg, serine) as compared to the amino acid sequence set forth in SEQ ID NO: 2. Cysteine variants. The cysteine variant is
It is useful if the ChMIrp polypeptide has to be refolded into a biologically active conformation, eg after isolation of insoluble inclusion bodies. Cysteine variants generally have fewer cysteine residues than the native protein, and typically even numbers of cysteine residues, minimizing interactions that result from unpaired cysteines.

The term “ChMIrp fusion polynucleotide” refers to a fusion of a heterologous peptide or polynucleotide with a ChMIrp polypeptide, fragment and / or variants thereof. Heterologous peptides and polypeptides include, but are not limited to: an epitope that allows detection and / or isolation of a ChMIrp fusion polypeptide; a transmembrane receptor protein or portion thereof (eg, extracellular domain or membrane). Transmembrane domain and intracellular domain);
A ligand or portion thereof that binds to a transmembrane receptor protein; an enzyme or portion thereof that is catalytically active; a polypeptide or peptide that promotes oligomerization (eg, leucine zipper domain); a polypeptide that increases stability or A peptide (eg, an immunoglobulin constant region); as well as a polypeptide comprising the amino acid sequence as set forth in SEQ ID NO: 2 or a polypeptide having a different therapeutic activity than a ChMIrp polypeptide variant.

Furthermore, the ChMIrp polypeptide may be fused to itself or fragments, variants, or derivatives thereof. Fusions can be made to the ChMIrp polypeptide at either the amino or carboxyl termini. The fusion may be direct without a linker or adapter molecule, or via a linker or adapter molecule (eg, one or more amino acid residues up to about 20 amino acids to amino acid residues up to about 50 amino acids). May be Linker or adapter molecules may also be designed with cleavage sites for DNA restriction endonucleases or proteases to allow separation of fused moieties. It is understood that, once constructed, the fusion polypeptide can be derivatized according to the methods described herein.

In a further embodiment of the invention, a ChMIrp polypeptide comprising fragments, variants and / or derivatives is fused to the Fc region of human IgG.
An antibody comprises two functionally independent parts: This independent portion is a variable domain known as "Fab" that binds antigen, and a constant domain known as "Fc" that is involved in effector functions such as complement activation and attack by phagocytes. Fc has a long serum half-life, while Fab has a short life span (Capon et al., Nature 337: 525-31, 1989). The Fc domain, when assembled with a therapeutic protein, may provide a longer half-life, or may incorporate functions such as Fc receptor binding, protein binding, complement fixation, and perhaps even placenta transfer. obtain. Ibid. Table I summarizes the use of certain Fc fusions known in the art, including materials and methods applicable to the production of fused ChMIrp polypeptides.

[0079]

[Table 1] In one example, the human IgG hinge region, CH2 and CH3 regions can be fused to either the N-terminus or C-terminus of the ChMIrp polypeptide using methods known to those of skill in the art. As another example, the partial regions of the hinge and the CH2 and CH3 regions can be fused. The resulting ChMIrpFc-fusion polypeptide can be purified by use of a Protein A affinity column. Fc
Peptides and proteins fused to the region were found to exhibit a substantially longer half-life in vivo than their unfused counterparts. Also, fusion to the Fc region allows for dimerization / multimerization of the fusion polypeptide. The Fc region can be a naturally occurring Fc region or can be modified to improve certain qualities (eg, therapeutic quality, circulation time, reduced aggregation, etc.).

The term “ChMIrp polypeptide derivative” refers to a ChMIrp polypeptide,
Variants, or fragments thereof, which are, for example, by the covalent attachment of one or more water-soluble polymers, N-linked carbohydrates, O-linked carbohydrates, sugars, phosphates, and / or other such molecules. , Chemically modified. Such modifications can be introduced into the molecule by reacting the target amino acid residues of the purified or crude protein with an organic derivatizing agent, which can react with selected side chains or terminal residues. The resulting covalent derivative is also useful in programs directed to identifying residues important for biological activity. This derivative is
It is modified in a manner different from naturally occurring ChMIrp polypeptides, either in the type or position of the molecule attached to the ChMIrp polypeptide. Derivatives further include deletion of one or more chemical groups naturally attached to the ChMIrp polypeptide.

For example, a polypeptide can include, but is not limited to, one or more polymers (water soluble polymers, N-linked carbohydrates, O-linked carbohydrates, sugars, phosphates, and / or other such molecules. Can be modified). For example, the polymer selected is typically water soluble so that the protein linked to the polymer does not precipitate in an aqueous environment (eg, physiological environment). The polymer can be of any molecular weight and can be branched or unbranched. Included within the scope of ChMIrp polypeptide polymers is a mixture of polymers. Preferably, for therapeutic use in the final product preparation, the polymer is pharmaceutically acceptable.

Suitable water-soluble polymers or mixtures thereof include, but are not limited to: polyethylene, glycol (PEG), monomethoxy-polyethylene glycol, dextran (eg low molecular weight (eg about 6 kD. Dextran)), cellulose, or other carbohydrate-based polymers, poly- (
N-vinylpyrrolidine) polyethylene glycol, propylene glycol homopolymers, polypropylene oxide / ethylene oxide copolymers, polyoxyethylated polyols (eg glycerol), and vinyl alcohols. Also included in the invention are bifunctional PEG cross-linking molecules that can be used to prepare covalently linked ChMIrp polypeptide multimers.

For the acylation reaction, the polymer selected has a single reactive ester group. For reductive alkylation, the polymer selected has a single reactive aldehyde group. For example, a reactive aldehyde, polyethylene glycol propionaldehyde, which is water soluble, or a mono C ₁ -C ₁₀ alkoxy or aryloxy derivative thereof (see US Pat. No. 5,252,714).

Pegylation of ChMIrp polypeptides can be specifically performed using any pegylation reaction known in the art. Such reactions are described, for example, in the following references: Francis et al., 1992,
Focus on Growth Factors 3: 4-10; European Patents 0154316 and 0401384; and U.S. Pat. No. 4,179,3.
No. 37. For example, pegylation can be carried out via an acylation or alkylation reaction with a reactive polyethylene glycol molecule (or similar reactive water-soluble polymer), as described herein. Polyethylene glycol (PEG
) Is a water-soluble polymer suitable for use herein. As used herein, the terms "polyethylene glycol" and "PEG" refer to proteins (
It is meant to include any form of PEG used to derivatize mono (C ₁ -C ₁₀ ) alkoxy polyethylene glycol or aryloxy polyethylene glycol.

In general, chemical derivatization can be performed under any suitable conditions used to react a biologically active substrate with an activated polymer molecule. Methods for preparing chemical derivatives of pegylated polypeptides generally include the following steps: (a
) Reacting the polypeptide with an activated polymer molecule (eg, a reactive ester or aldehyde derivative of the polymer molecule) under conditions such that the ChMIrp polypeptide variant is attached to one or more polymer molecules. , And (b)
Obtaining a reaction product. In general, the optimal reaction conditions will be determined based on known parameters and the desired result. For example, the higher the polymer molecule: protein ratio, the greater the proportion of polymer molecules attached. In one embodiment, a ChMIrp polypeptide derivative can have a single polymer molecular moiety at its amino terminus (see, eg, US Pat. No. 5,234,784).

Generally, conditions that can be alleviated or modulated by administration of a ChMIrp polypeptide derivative of the invention include those described herein. However, the ChMIrp polypeptide derivatives disclosed herein may exhibit additional activity, enhanced or decreased biological activity, or other properties (eg, increased or decreased half-life) when compared to an underivatized molecule. ).

The term “biologically active ChMIrp polypeptide”, “biologically active C
"hMIrp polypeptide fragment,""biologically active ChMIrp polypeptide variant," and "biologically active ChMIrp polypeptide derivative" refer to a ChM having at least one activity characteristic of a ChMIrp polypeptide.
Refers to an Irp polypeptide. An immunogenic fragment of a ChMIrp polypeptide is a fragment capable of inducing a host animal with antibodies raised against this ChMIrp fragment.

“Naturally occurring” or “native” is found in nature when used in connection with biological materials such as nucleic acid molecules, polypeptides, host cells, etc., and by humans A substance that has not been manipulated. Similarly, "non-naturally occurring" or "non-native" as used herein refers to substances that are not found in nature or have been structurally modified or synthesized by humans.

The term “isolated polypeptide” refers to (1) at least about 50% of a polynucleotide, lipid, carbohydrate, or other substance found together in nature when isolated from a source cell. (2) not linked (by covalent or non-covalent interactions) to all or part of the polypeptide to which the "isolated polypeptide" naturally links, A polypeptide of the invention, (3) a polypeptide of the invention operably linked (by covalent or non-covalent interactions) to a polypeptide that is not naturally linked, or (4
) Refers to a non-naturally occurring polypeptide of the invention. Preferably, the isolated polypeptide is any other contaminating polypeptide or other contaminant found in its natural environment, which has therapeutic, diagnostic, prophylactic, or research uses. (Which hinders the intended use) is substantially excluded.

The term “mature ChMIrp polypeptide” refers to a polypeptide that lacks a leader sequence, and a mature ChMIrp polypeptide also refers to other modifications of the polypeptide, such as the amino terminus (having a leader sequence or And / or carboxy-terminal proteolytic processing, cleavage of smaller polypeptides from larger precursors, N-linked and / or O-linked glycosylation, etc.).

The term “mutein” refers to variant proteins, polypeptides, variants, analogs or fragments of ChMIrp polypeptides. ChMIrp muteins can be prepared by deletion, insertion, substitution, point mutation, truncation, addition, transposition, PCR amplification, site-directed mutagenesis, or other methods known in the art.

The terms “effective amount” and “therapeutically effective amount” refer to one or more of the ChMIrp polypeptides described above in order to provide a meaningful patient benefit (ie, treatment, cure, prevention, or alleviation of the condition). Refers to the amount of ChMIrp polypeptide (or ChMIrp antagonist) required to support an observable change in the level of biological activity. When applied to an individual active ingredient, the term administered alone means
It means that the component is alone. When applied to a combination, the term refers to the combined amount of active ingredients that, when administered in combination, either sequentially or simultaneously, produce a therapeutic effect. ChMIrp polypeptides that have use in practicing the present invention can be naturally occurring full-length polypeptides, or truncated polypeptides or modified homologs or analogs or derivatives or peptide fragments. Exemplary analogs include those in which one or more different amino acids between two species are replaced with different amino acids from another species. Amino acids that differ from each other can also be substituted with any other amino acid, whether conservative or non-conservative.

The term “pharmaceutically acceptable carrier” or “physiologically acceptable carrier” as used herein refers to a ChMIrp polypeptide, ChMIrp nucleic acid molecule, or a pharmaceutical composition as a pharmaceutical composition. Refers to one or more formulated substances suitable for achieving or enhancing delivery of ChMIrp selective binding agents.

The term “selective binding agent” refers to a molecule that has specificity for a ChMIrp molecule.
Examples of the selective binding agent include an antibody (for example, a polyclonal antibody, a monoclonal antibody (mAb), a chimeric antibody, a CDR-grafted antibody, an anti-idiotype (anti-Id) antibody against an antibody that can be labeled in a soluble form or a bound form), and And fragments, regions, or derivatives thereof provided by known techniques including, but not limited to, enzymatic cleavage, peptide synthesis, or recombinant techniques. The anti-ChMIrp selective binding agent of the present invention is, for example, ChMIrp.
It may bind a portion of the molecule, which inhibits binding of the ChMIrp molecule to the ChMIrp receptor.

As used herein, the terms “specific” and “specificity” refer to the fact that a selective binding agent binds to a human ChMIrp polypeptide and a human non-ChMIrp.
Refers to the ability to bind a polypeptide. However, the selective binding agent is also ChMI
It is understood that it can bind to orthologs of the rp polypeptide, ie, interspecies forms of the ChMIrp polypeptide (eg, mouse ChMIrp polypeptide and rat ChMIrp polypeptide). A preferred embodiment is ChMIrp
Antibodies that are highly specific for polypeptides do not specifically cross-react with non-ChMIrp polypeptides (ie, they do not bind).

The term “antigen” is a molecule or part of a molecule that can be bound by a selective binding agent (eg, an antibody), and further allows an animal to produce an antibody capable of binding an epitope of that antigen. , Molecule or part of a molecule. An antigen can have one or more epitopes. The specific binding reactions referred to above show that the antigen reacts with its corresponding antibody in a highly selective manner and not with many other antibodies that can be elicited by other antigens. means.

ChMIrp polypeptides, fragments, variants and derivatives can be used to modulate ChMIrp selective binding agents using methods known in the art. Thus, antibodies and antibody fragments that bind to ChMIrp polypeptides are within the scope of the invention. Antibody fragments include a portion of an antibody that binds to an epitope of ChMIrp polypeptide. Examples of such fragments include Fab and F (ab ') 2 fragments produced by enzymatic cleavage of full length antibodies. Other binding fragments include fragments produced by recombinant DNA technology (eg, expression of recombinant plasmids containing nucleic acid sequences encoding antibody variable regions). These antibodies can be, for example, polyclonal antibodies, polyclonal monospecific polyclonal antibodies, monoclonal antibodies, recombinant antibodies, chimeric antibodies, humanized antibodies, human antibodies, single chain antibodies, and bispecific antibodies.

Relatedness of Nucleic Acid Molecules and / or Polypeptides The term “identity” refers to two or more polypeptide molecules or two or more polypeptide molecules, as determined by comparing the sequences, as is known in the art. Refers to the relationship between the sequences of nucleic acid molecules. In the art, "identity" also refers to the degree of sequence relatedness between polypeptide sequences or nucleic acid molecule sequences, as is probably determined by the match between strings of nucleotide or amino acid sequences. Means "identity"
Measures the percent identity match between two or more sequences with a gap alignment, as positioned by a particular arithmetic model computer program (ie, "algorithm").

The term “similarity” refers to a concept, but in contrast to “identity,” refers to a measure of similarity that includes both matches by identity and conservative substitution matches. Identity and similarity of related nucleic acid molecules and polypeptides can be readily calculated by known methods. As such a method, Computational Molecular
lar Biology, Lesk, A .; M. Hen, Oxford Universal
city Press, New York, 1988; Biocomputin.
g: Informations and Genome Projects, Sm
ith, D.I. W. Hen, Academic Press, New York, 19
93; Computer Analysis of Sequence Dat
a, Part 1, Griffin, A .; M. And Griffin, H .; G.
Hen, Humana Press, New Jersey, 1994; Seque
nce Analysis in Molecular Biology, vo
n Heinje, G .; , Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M .;
And Devereux, J .; Edited by M. Stockton Press, New
York, 1991); and Carlo and Lipman, SIA.
MJ. Applied Math. , 48: 1073, 1998, but are not limited thereto. If conservative substitutions apply to peptides and not nucleic acid molecules, similarity refers only to the comparison of peptide sequences. Then, if the two polypeptide sequences have, for example, 10/20 identical amino acids and the rest are all non-conservative substitutions, the percent identity and similarity are both 50%. In the same example, if there are 5 more positions that are conservative substitutions, the percent identity remains 50%, but the percent similarity is 75% (15/20). Thus, if there are conservative substitutions, the degree of similarity between two polypeptide sequences will be greater than the percent identity between these two sequences.

Identity and similarity of related nucleic acid molecules and polypeptides can be readily calculated by known methods. One such method is Computation
al Molecular Biology (AM Lesk ed., Oxford)
d University Press 1988); Biocomputin
g: Informations and Genome Projects (D.
W. Smith, Academic Press 1993); Comput
er Analysis of Sequence Data (Part 1,
A. M. Griffin and H.C. G. Griffin, Humana Pr
ess 1994); von Heinle, Sequence Anal
ysis in Molecular Biology (Academic P
ress 1987); Sequence Analysis Primer (
M. Gribskov and J.M. Devereux, M .; Stockton
Press 1991); and Carillo et al., 1988, SIAM J.
． Applied Math. , 48: 1073, but are not limited thereto.

Differences in this nucleic acid sequence may result in conservative and / or non-conservative modifications of the amino acid sequence related to that of SEQ ID NO: 2.

The term “conservative amino acid substitution” refers to the replacement of a naturally occurring amino acid residue with a non-naturally occurring residue such that it has little or no effect on the polarity or charge of the amino acid residue at that position. Say. For example, a conservative substitution results from the replacement of a nonpolar residue in a polypeptide with any other nonpolar residue. In addition, any of the natural residues in the polypeptide, as described above as "alanine scanning mutagenesis"
It can be replaced by alanine. The general rules for amino acid substitutions are shown in Table II below.

[0103]   (Table II)

[0104]

[Table 2] Conservative modifications to this amino acid sequence (and modifications corresponding to the encoding nucleotides) are expected to produce ChMIrp with functional and chemical characteristics similar to those of naturally occurring ChMIrp. In contrast, ChMI
Substantial modifications in the functional and / or chemical characteristics of rp may be due to (a) the structure of the backbone of the molecule in the region of this substitution (eg sheet structure or helix structure), (b) at this target site. It can be achieved by choosing substitutions that are significantly different in the charge or hydrophobicity of the molecule, or (c) its effect of retaining the bulk of this side chain. Naturally occurring residues are based on common side chain attributes,
It can be divided into the following categories: 1) Hydrophobicity: norleucine, Met, Ala, Val, Leu, Ile; 2) Neutral hydrophilicity: Cys, Ser, Thr, Asn, Gln; 3) Acidic: Asp, Glu; 4) Basicity: His, Lys, Arg; 5) Residues affecting chain orientation: Gly, Pro; and 6) Aromatic: Trp, Tyr, Phe.

Non-conservative substitutions may involve the exchange of a member of one of these classes for a member from another class. Such substituted residues may be introduced in the region of the human ChMIrp molecule that is homologous to the non-human ChMIrp, or in the heterologous region of this molecule.

Conservative amino acid substitutions also include non-naturally occurring amino chain residues that are typically incorporated by chemical peptide synthesis rather than synthesis in biological systems. These include peptidomimetics as well as other forms of the opposite or opposite of the amino acid component.

Preferred methods to determine identity and / or similarity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. A preferred computer program for determining identity and similarity between two sequences is GAP (Devereux et al., Nucleic Acids Res.
search12 (1): 387, 1984); Genetics Comput.
er Group, University of Wisconsin, Med
ison, WI), BLASTP, BLASTN, and FASTA (Atsc
hul et al. Molec. Biol. 215: 403-410.1990), but is not limited thereto. This B
The LAST X program is a National Center for Bio
technology Information (NCBI) and other sources (BLAST Manual, Altschul et al., NCB NLM NIH).
Bethesda, MD 20894; Altschul et al., J. Am. Molec.
Biol. 215: 403-410.1990). The well-known Smith Waterman algorithm can also be used to determine identity.

Certain alignment schemes for aligning two amino acid sequences can result in the fit of only the short regions of the two sequences, and the aligned subregions have significant associations between the two full length sequences. Even in the absence of sex, it may have very high sequence identity. Thus, in a preferred embodiment, this selected alignment method (GAP program) results in an alignment of the claimed polypeptides over at least 50 consecutive amino acids.

For example, the computer algorithm GAP (Genetics Compu
ter Group, University of Wisconsin, Me
(Dison, WI), two polypeptides whose sequence identity percentages are to be determined for optimal fit of each amino acid (the "fit range" as determined by this algorithm). Line up. Gap start penalty (
Disadvantage) (Calculate as the average diagonal x 3;
The "mean diagonal" is the mean of the diagonals of the comparison matrix used; this "diagonal" is the score or number assigned to each match of the complete amino acid by the particular comparison matrix) and the gap expansion penalty (usually 1/10 times the gap opening penalty), and PAM 25
A comparison matrix such as 0 or BLOSUM 62 is used with this algorithm. Standard comparison matrix (for the PAM250 comparison matrix, see Dayhoff et al., Atlas of Protein Sequence).
e and Structure, vol. BLO in 5, Addendum 3, 1978
For the SUM 62 comparison matrix, see Henikoff et al., Proc. Na
lt. Acad. Sci USA, 89: 10915-10919, 1992. ) Is also used by this algorithm.

Preferred parameters for comparing polypeptide sequences include the following: Algorithm: Needleman and Wunsch, J. Mol. Mol. Bio
l. 48: 443-453, 1970, comparison matrix: Henikoff and Henikoff, Proc. N
alt. Acad. Sci USA, 89: 10109-10919, 1992.
To BLOSUM 62; Gap penalty: 12 Gap length penalty: 4 Similarity threshold: 0.

This GAP program is useful with these above parameters. These aforementioned parameters are the default parameters (without penalty for end gaps) for polypeptide comparisons using this GAP algorithm.

Preferred parameters for comparison of nucleic acid molecule sequences include the following: Algorithm: Needleman and Wunsch, J. Mol. Mol. Bio
l. 48: 443-453, 1970; comparison matrix: conformity = + 10, nonconformity = 0, gap penalty: 50, gap length penalty: 3.

The GAP program is also useful with these above parameters.
These above parameters are the default parameters for comparison of nucleic acid molecules.

Program Manual, Wisconsin Package, Ve
Other exemplary algorithms, including those shown in region 9 (September 1997), gap opening penalties, gap expansion penalties, comparison matrices, similarity thresholds, etc., can be used by those skilled in the art. The particular selection to be made depends on the particular comparison to be made (eg DNA to DNA, protein to protein, protein to DNA); and, in addition, this comparison is between sets of sequences (in this case GAP Or BestFit is generally preferred) or between one sequence and a database of large sequences (in which case FASTA or BLASTA is preferred).

(Synthesis) It will be appreciated by those of skill in the art that the nucleic acid and polypeptide molecules described herein can be produced by recombinant and other means.

Nucleic Acid Molecules Nucleic acid molecules encoding polypeptides comprising the amino acid sequence of ChMIrp polypeptides can be expressed in various ways (chemical synthesis, cDNA or genomic library screening, expression library screening, and / or P
(But not limited to, CR amplification).

Recombinant DNA methods used herein generally refer to Sambrook.
Et al. (Molecular Cloning: A Laboratory Man
ual (Cold Spring Harbor Laboratory Pr
ess, Cold Spring Harbor, NY, 1989) and / or Ausubel et al., Ed. (Current Protocols in Mol)
ecology Biology, Green Publishers Inc.
And Wiley and Sons 1994), but is not limited thereto.

The present invention provides nucleic acid molecules as described herein and methods for obtaining the molecules. The gene or cDNA encoding the "CHMIrp polypeptide" or fragment thereof can be obtained by hybridization screening of genomic or cDNA libraries or by PCR amplification. Probes or primers useful for screening libraries by hybridization provide sequence information for other known genes or gene fragments from the same or related family of genes, such as conserved sites. It can be made based on.

When a gene encoding a ChMIrp polypeptide is identified from one species, all or part of that gene may have a corresponding gene from another species (ortholog) or a related gene from the same species (homolog). It can be used as a probe to identify. This probe or primer can be used to screen a cDNA library from a variety of tissue sources suspected of expressing the ChMIrp gene.

In addition, some or all of the nucleic acid molecules having a sequence as set forth in SEQ ID NO: 1 can be used to screen a genomic library to identify and isolate the gene encoding ChMIrp. Typically, moderate or high stringency conditions are used for the screen to minimize the number of false positives obtained from this screen. The availability of cDNA encoding ChMIrp or its function is a prerequisite for obtaining genomic DNA. Under stringent conditions, the DNA library is screened, and the resulting clones are examined to determine whether they contain the coding regions, as well as the regulatory sequence elements required for gene expression ( Check promoter function, eg, by fusion with the coding region of the appropriate reporter gene). Methods for screening DNA libraries under stringent conditions are taught, for example, in published European Patent Application No. EPA 0 174 143. Obtaining a genomic sequence can be performed by ChM for any possible interaction with known agents that regulate gene expression (eg, transcription factors or steroids).
Allows the investigation of regulatory sequences located in regions not encoding Irp (especially in the 5'flanking region) or perhaps discovers new agents that may have a particular effect on the expression of this gene To do. The result of such an investigation is ChMIr.
regulates p expression and, therefore, chondromodulin
n) provide the basis for the targeted use of such substances to directly affect the ability of cells to interact with the receptor. As a result, the specific reaction with this receptor and the effect obtained can be suppressed.

The scope of the present invention also includes DNAs encoding ChMIrp saptypes, which may have properties different from those of the ChMIrp of the present invention. These are the expression products formed by alternative splicing, and are modified structures in specific regions, such as altered affinity and specificity for the receptor or altered in terms of the nature and efficiency of signal transduction. The structure which can bring about.

With the help of the cDNA encoding ChMIrp, under low stringency, moderate stringency or high stringency conditions, the cD
It is possible to obtain a nucleic acid which hybridizes to NA or a fragment thereof and which encodes a polypeptide capable of binding the receptor or which comprises a sequence encoding such a polypeptide.

Nucleic acid molecules encoding ChMIrp polypeptides may also be expressed by expression cloning using detection of positive clones based on the characteristics of the expressed protein,
Can be identified. Typically, nucleic acid libraries are screened by binding an antibody or other binding partner (eg, receptor or ligand) to the cloned protein expressed and displayed on the host cell surface. The antibody or binding partner is modified with a detectable label to identify cells that express the desired clone.

These polynucleotides can be produced and the encoded polypeptides expressed according to recombinant expression techniques performed according to the instructions set forth below.
For example, one of skill in the art can readily generate large amounts of the desired nucleotide sequence by inserting the nucleic acid sequence encoding the amino acid sequence of ChMIrp polypeptide into a suitable vector. These sequences can then be used to generate detection probes or amplification primers. Alternatively, a polynucleotide encoding the amino acid sequence of ChMIrp polypeptide can be inserted into an expression vector. By introducing the expression vector into a suitable host, the encoded ChMIrp polypeptide can be produced in quantity.

Another method for obtaining the appropriate nucleic acid sequence is the polymerase chain reaction (PCR). In this method, the cDNA is converted into poly (
A) + RNA or total RNA. The two primers, which are typically complementary to two distinct regions of the cDNA (oligonucleotide) encoding the amino acid sequence of ChMIrp polypeptide, are then labeled with a polymerase such as Taq polymerase. Added to the cDNA, and the polymerase amplifies the region of the cDNA between these two primers.

Another means of preparing nucleic acid molecules encoding the amino acid sequence of ChMIrp polypeptides is by Engels et al. (Angew. Chem. Intl. Ed. 28: 7).
16-34, 1989), using chemical methods well known to those skilled in the art. These methods include phosphotriester, phosphoramidite, and H-phosphonate methods for nucleic acid synthesis, among others. The preferred method for such chemical synthesis is polymer-supported synthesis using standard phosphoramidite chemistry. Typically C
The DNA encoding the amino acid sequence of hMIrp polypeptide is several hundred nucleotides long. Nucleic acids longer than about 100 nucleotides, using these methods,
It can be synthesized as several fragments. These fragments can then be ligated together to form the full-length nucleotide sequence of the ChMIrp polynucleotide. Usually, the DNA fragment encoding the amino terminus of this polypeptide has ATG, which encodes a methionine residue. The methionine may or may not be present in the mature form of the ChMIrp polypeptide, depending on whether the polypeptide produced in the host cell is designed to be secreted by that cell.

In some cases, it may be desirable to prepare a nucleic acid molecule that encodes a ChMIrp polypeptide variant or mutein. D modified in this manner
A nucleic acid molecule encoding a variant is provided with a site-directed mutagenesis, transfer of a primer having a desired point mutation, provided that NA encodes a polypeptide capable of binding one or more members of the chondromodulin family. , Deletion, addition, shortening, PC
It may be generated using R amplification, or other suitable method (see Sambrook et al., Supra, and Ausubel et al., Supra for a description of mutagenesis techniques). Chemical synthesis using the methods described by Engels et al., Supra, can also be used to prepare such variants. Other methods known to those of skill in the art may be used as well.

In a specific embodiment, the nucleic acid variant is a ChMIr in a given host cell.
Contains codons modified for optimal expression of p-polypeptide. The particular codon change depends on the host cell selected for expression and the ChMIrp polypeptide. Such "codon optimization" can be performed by a variety of methods, such as by selecting preferred codons for use in the highly expressed gene in a given host cell. Computer algorithms that incorporate codon frequency tables such as "Eco_high. Cod" for codon preference of highly expressed bacterial genes can be used, and University of Wisc
onsin Package Version 9.0 (Genetics C
computer group, Madison, WI). Other useful codon frequency tables include "Celegans_high.cod", "
Celegans_low. cod ”,“ Drosophila_high.c
od "," Human_high.cod "," Maize_high.cod "
, ”And“ Yeast_high.cod. ”.

In another embodiment, the nucleic acid molecule has a ChMIrp variant with conservative amino acid substitutions as defined above, addition and / or deletion of one or more N-linked or O-linked glycosylation sites. ChMIrp variants, including, or ChMIrp polypeptide fragments as described above. In addition, nucleic acid molecules can be modified with ChMIrp variants, fragments, and fragments, provided that the DNA modified in this manner can encode a polypeptide that can find one or more members of the chondromodulin family of ligands and receptors. Any combination of fusion polypeptides described herein may be encoded.

Vectors and Host Cells Nucleic acid molecules encoding the amino acid sequences of ChMIrp polypeptides can be inserted into suitable expression vectors using standard ligation techniques. Vectors are typically
Selected to be functional in the particular host cell used (ie,
The vector is compatible with the host cell machinery so that gene amplification and / or gene expression occurs. Nucleic acid molecules encoding the amino acid sequence of ChMIrp polypeptides are prokaryotic host cells, yeast host cells, insects (baculovirus system)
It can be amplified / expressed in host cells and / or eukaryotic host cells. The choice of host cell depends in part on whether the ChMIrp polypeptide is post-translationally modified (eg, glycosylated and / or phosphorylated). If so, yeast host cells, insect host cells, or mammalian host cells are preferred. For a review of expression vectors, see Meth. Enz. , Vol. 185 (D.V. Goeddel,
ed. , Academic Press 1990).

[0131] Typically, expression vectors used in any host cell will contain sequences for plasmid maintenance and for cloning and expression of foreign nucleotide sequences. Such sequences (collectively referred to as "flanking sequences"), in certain embodiments, typically include one or more of the following nucleotide sequences: promoter, one or more enhancer sequences, origin of replication. Insert transcription termination sequence, complete intron sequence including donor and acceptor splice sites, sequence encoding leader sequence for polypeptide secretion, ribosome binding site, polyadenylation sequence, nucleic acid encoding expressed polypeptide And a selectable marker element. Each of these sequences is discussed below.

Optionally, the vector may include a "tag" coding sequence (ie, an oligonucleotide molecule located at the 5'or 3'ends of the ChMIrp polypeptide coding sequence); the oligonucleotide sequence may be polyHis. (For example, he
xaHis), another “tag” (eg FLAG, HA (hemagglutinin influenza virus) or (these are commercially available antibodies)) myc. This tag is typically fused to the polypeptide upon expression of the polypeptide and can serve as a means for affinity purification of ChMIrp polypeptides from host cells. Affinity purification can be performed, for example, by column chromatography (6his) using an antibody against the tag as an affinity matrix.
(Such as a nickel column having an affinity for the tag).
If desired, the tag can be subsequently removed from the purified ChMIrp polypeptide by various means, such as by using a particular peptidase for cleavage.

The flanking sequences can be homologous (ie, from the same species and / or lineage as the host cell), heterologous (ie, from a species other than the host cell type or host cell lineage), or a hybrid ( That is, a combination of flanking sequences from more than one source) or can be synthetic, or flanking sequences can be C
It may be a native sequence that functions normally to regulate hMIrp polypeptide expression. Thus, the source of flanking sequences can be any prokaryotic or eukaryotic, any vertebrate or invertebrate, or any plant, provided the flanking sequences are functional in the host cell machinery. And can be activated by the host cell machinery.

The flanking sequences useful in the vectors of this invention may be obtained by any of several methods well known in the art. Typically, flanking sequences useful herein, other than the ChMIrp gene flanking sequences, have been previously identified by mapping and / or restriction endonuclease digestion, and thus, using appropriate restriction endonucleases. , May be isolated from a suitable tissue source. In some cases, the full length nucleotide sequence of one or more flanking sequences may be known. here,
The flanking sequences can be synthesized using the methods described herein for nucleic acid synthesis or cloning.

If all or only part of the flanking sequence is known, PCR is used and / or a genomic library is constructed using appropriate oligonucleotides and / or flanking sequence fragments from the same or another species. By screening, flanking sequences can be obtained.

If the flanking sequences are not known, then a fragment of DNA containing the flanking sequences can be isolated from a large DNA fragment, which may contain, for example, the coding sequence or another gene.
Isolation may be by restriction endonuclease digestion to generate the appropriate DNA fragment, followed by isolation using agarose gel purification, Qiagen® column chromatography (Chatsworth, CA), or other known to those of skill in the art. Can be achieved by a method. The selection of the appropriate enzyme to achieve this goal is
It will be readily apparent to one of ordinary skill in the art.

The origin of replication is typically part of a commercially available prokaryotic expression vector, which origin serves to amplify the vector in a host cell. Amplification of the vector to a particular copy number may, in some cases, be important for optimal expression of the ChMIrp polypeptide. If the vector of choice does not contain an origin of replication site, it can be chemically synthesized based on known sequences and ligated into the vector. For example,
Plasmid pBR322 (New England Biolabs, Beve)
The origin of replication from rly, MA) is suitable for most Gram-negative bacteria, and various origins such as SV40, polyoma, adenovirus, vesicular stomatitis virus (VSV), or HPV or BPV. Papillomavirus) is useful for cloning vectors in mammalian cells. Generally, the origin of replication component is not needed for mammalian expression vectors (eg, SV
The 40 origin is often used only because it contains the early promoter)
Does not need

Transcription termination sequences are typically located 3'to the end of the polypeptide coding region and serve to terminate transcription. Usually, the transcription termination sequence in prokaryotic cells is a GC rich fragment followed by a poly-T sequence. This sequence can be easily cloned from a library or is commercially available as part of a vector, which can also be readily synthesized using methods for nucleic acid synthesis as described herein above. Can be done.

Selectable marker genetic elements encode proteins necessary for the survival and growth of host cells grown in a selective culture medium. Representative selectable marker genes confer (a) resistance to prokaryotic host cells to antibiotics or other toxins (eg, ampicillin, tetracycline, or kanamycin); (b) auxotrophy of the cells. Complement the deficiency; or (c) or encode a protein that supplies important nutrients not available from complex media. Preferred selectable markers are the kanamycin resistance gene, ampicillin resistance gene, and tetracycline resistance gene. The neomycin resistance gene can also be used for selection in prokaryotic and eukaryotic host cells.

Other selection genes can be used to amplify the expressed gene. Amplification is a process in which genes, which are more required for the production of proteins important for growth, are tandemly repeated within the continuous production of chromosomes in recombinant cells. Examples of suitable selectable markers for mammalian cells include dihydrofolate reductase (D
HFR) and thymidine kinase. Mammalian cell transformants are placed under selection pressure, where only the transformants are uniquely adapted to survive by the selection gene present in the vector. Selection pressure is the culturing of transformed cells under conditions in which the concentration of the selection factor in the medium is continuously changed, thereby leading to the amplification of both the selection gene and the DNA encoding the ChMIrp polypeptide. Imposed by. As a result, increased amounts of ChMIrp polypeptide are synthesized from the amplified DNA.

Ribosome binding sites are usually required for translation initiation of mRNA and are characterized by Shine-Dalgarno sequences (prokaryotes) or Kozak sequences (eukaryotes). This element is typically located 3'to the promoter of the expressed ChMIrp polypeptide and 5'to the coding sequence. The Shine-Dalgarno sequences are variable, but are typically polypurines (ie, high AG content). Many Shine-Dalgarno sequences have been identified,
Each can be readily synthesized using the methods described herein and used in prokaryotic vectors.

A leader sequence, or signal sequence, can be used to direct the ChMIrp polypeptide from the host cell in which the ChMIrp polypeptide is synthesized. Typically, the signal sequence is located in the coding region of the ChMIrp nucleic acid molecule, or
Alternatively, it is located directly 5'to the ChMIrp polypeptide coding region. Many signal sequences have been identified and any signal sequence that is functional in the host cell of choice may be used in combination with the ChMIrp gene or cDNA. Thus, the signal sequence can be homologous (natural) or heterologous to the ChMIrp gene or cDNA. Additionally, the signal sequence can be chemically synthesized using the methods described herein. For the most part, secretion of ChMIrp polypeptides from host cells by the presence of the signal peptide is
This results in the removal of the signal peptide from the rp polypeptide.

The signal sequence may be a component of the vector, or it may be part of the ChMIrp DNA inserted into the vector. The native ChMIrp DNA encodes a signal sequence at the amino terminus of the protein that is cleaved during post-translational processing of the molecule to form the mature ChMIrp polypeptide product. Included within the scope of the invention are ChMIrp nucleotides having a native signal sequence as well as ChMIrp nucleotides in which the native signal sequence has been deleted and replaced with a heterologous signal sequence. The heterologous signal sequence selected should be one that is recognized and processed by the host cell (ie, cleaved by a signal peptidase). For prokaryotic host cells that do not recognize and process the native ChMIrp signal sequence, the signal sequence is replaced by a prokaryotic signal sequence selected, for example, from the group of alkaline phosphatase, penicillinase, or thermostable enterotoxin II leaders. For yeast secretion, the native ChMIrp signal sequence is yeast invertase,
It may be replaced by the alpha factor, or acid phosphatase signal sequence. For mammalian cell expression, the native signal sequence of ChMIrp polypeptides is sufficient, although other mammalian signal sequences may be suitable.

In some cases, where glycosylation is desired in eukaryotic host cell expression systems, various nucleic acid or polypeptide sequences may be engineered to improve glycosylation or yield. For example, the peptidase cleavage site of a particular signal peptide may be altered or a pro-sequence may be added,
It can also affect glycosylation. The final protein product may have one or more additional amino acids at position 1 (relative to the first amino acid of the mature protein) associated with expression, which may not be completely removed. For example, the final protein product may have one or two amino acid residues found at the peptidase cleavage site, attached to the N-terminus. Alternatively, the use of some enzyme cleavage sites may result in a slightly truncated form of the desired ChMIrp polypeptide if the enzyme cuts such regions within the mature polypeptide.

In many cases, transcription of the nucleic acid molecule is increased by the presence of one or more introns within the vector; which results in the polypeptide being produced in a eukaryotic host cell, particularly a mammalian host cell. This is especially true when The intron used may be naturally present in the ChMIrp gene, especially if the gene used is the full-length genomic sequence or a fragment thereof. If the intron is not naturally present in the gene (for most cDNAs), the intron may be obtained from another source. The position of the intron with respect to the 5'-flanking sequence and the ChMIrp gene is generally important as the intron must be transcribed effectively. Thus, when the ChMIrp cDNA molecule is transcribed, the preferred position of the intron is 3'to the transcription start site and 5'to the poly-A transcription termination sequence. Preferably, introns are placed on one or the other side of the cDNA (ie 5'or 3 ') so as not to interfere with the coding sequence. The invention can be practiced with any intron from any source, including viruses, prokaryotes and eukaryotes (plants or animals), provided that the intron is present in the host cell into which it is inserted. It is compatible. Synthetic introns are also included herein.
If desired, more than one intron can be used in the vector.

Expression and cloning vectors of the invention will typically contain a promoter that is recognized by the host organism and operably linked to the molecule encoding the ChMIrp polypeptide.

A promoter is a structural gene (typically about 10 genes) that controls transcription of the structural gene.
It is a non-transcribed sequence located upstream (ie, 5 ′ side) from the start codon of 0 to 1000 bp. Promoters are usually grouped into one of two classes: inducible promoters and constitutive promoters. Inducible promoters initiate increased levels of transcription from DNA under their control in response to some changes in culture conditions (eg, the presence or absence of nutrients, or changes in temperature). A constitutive promoter, on the other hand, initiates continuous gene product production; that is, it controls little or no regulation of gene expression. Multiple promoters (recognized by various potential host cells)
Is well known. A suitable promoter is operably linked to the DNA encoding the ChMIrp polypeptide by removing the promoter from the source DNA by restriction enzyme digestion and inserting the desired promoter sequence into the vector. The native ChMIrp promoter sequence can be used to direct amplification and / or expression of ChMIrp nucleic acid molecules. However, a heterologous promoter is preferred if it allows for greater transcription and higher production of expressed proteins as compared to the native promoter, and is compatible with the host cell line chosen for use.

Suitable promoters for use with prokaryotic hosts include the β-lactamase and lactose promoter systems; alkaline phosphatase; tryptophan (tr).
p) promoter system; and hybrid promoters (eg tac promoter). Other known bacterial promoters are also suitable. These sequences are publicly available, so that one of skill in the art will ligate them to the desired DNA using linkers or adapters required to supply any useful restriction sites. obtain.

Suitable promoters for use with yeast hosts are also well known in the art. Yeast enhancers are advantageously used with yeast promoters. Suitable promoters for use with mammalian host cells are well known and include, but are not limited to, polyoma virus, fowlpox virus, adenovirus (eg, Adenovirus 2).
, Bovine papilloma virus, avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus, herpes virus, and most preferably Simian virus 40 (SV40). Other suitable mammalian promoters include heterologous mammalian promoters such as heat shock promoters and actin promoters.

Additional promoters that may be of interest in controlling ChMIrp gene transcription include, but are not limited to: SV40 early promoter region (B
ernoist and Chamber, Nature 290: 304-1.
0, 1980); CMV promoter; promoter contained in the 3'long terminal repeat of Rous sarcoma virus (Yamamoto, et al., Cell 2).
2: 787-97, 1980); herpes thymidine kinase promoter (W
agner et al. , Proc. Natl. Acad. Sci. U. S.
A. 78: 1444-45, 1981); the regulatory sequence of the metallothionein gene (
Brinster et al. , Nature 296: 39-42, 198.
2); a prokaryotic expression vector such as β-lactamase promoter (Vill)
a-Kamaroff et al. , Proc. Natl. Acad. Sci
． U. S. A. , 75: 3727-31, 1978); or the tac promoter (DeBoer et al., Proc. Natl. Acad. Sci. U.
． S. A. 80: 21-25, 1983). Also of interest are the following animal transcriptional regulatory regions that exhibit tissue specificity and have been utilized in transgenic animals: Elastase I gene regulatory region active in pancreatic acinar cells (Swift).
et al. , Cell 38: 639-46, 1984; Ornitz e.
t al. , Cold Spring Harbor Symp. Quant.
Biol. 50: 399-409, 1986; MacDonald, Hepat.
7: 425-515, 1987); an insulin gene regulatory region active in pancreatic β cells (Hanahan, Nature 315: 115-2).
2, 1985); immunoglobulin gene regulatory region (Gr active in lymphocytes)
osscheldl et al. , Cell 38: 647-58, 1984;
Adames et al. , Nature 318: 533-38, 1985.
Alexander et al. , Mol. Cell. Biol. , 7: 1
436-44, 1987); mouse mammary adenocarcinoma virus regulatory region active in testis, breast, lymphocytes, and mast cells (Leder et al., Cell 4).
5: 485-95, 1986); the albumin gene regulatory region active in liver (Pinkert et al., Genes and Devel. 1:26.
8-76, 1987); α-fetoprotein gene regulatory region active in liver (Krumlauf et al., Mol. Cell. Biol., 5: 1.
639-48, 1985; Hammer et al. , Science 23
5: 53-58, 1987); α1-antitrypsin gene regulatory region active in the liver (Kelsey et al., Genes and Devel. 1 :).
161-71, 1987); β-globin gene regulatory region active in myeloid cells (Mogram et al., Nature 315: 338-40, 1).
985; Kollias et al. , Cell 46: 89-94, 198.
6); Myelin basic protein gene regulatory region active in oligodendrocytes of the brain (Readhead et al., Cell 48: 703-12, 1).
987); myosin light chain-2 gene regulatory region active in skeletal muscle (Sani,
Nature 314: 283-86, 1985); and the gonadotropin-releasing hormone gene regulatory region active in the hypothalamus (Mason et al.
, Science 234: 1372-78, 1986).

Enhancer sequences can be inserted into the vector to increase transcription of the DNA encoding the ChMIrp polypeptides of the invention by higher eukaryotes. Enhancers act on promoters to increase transcription, usually about 1
It is a cis-acting element of DNA with a length of 0 to 300 bp. The enhancer is
Relative direction and position are independent. These were found 5'and 3'to the transcription unit. Several enhancer sequences available from mammalian genes are known (eg, globin, elastase, albumin, α-fetoprotein and insulin). However, typically viral-derived enhancers are used. The SV40 enhancer, cytomegalovirus early promoter enhancer, polyoma enhancer, and adenovirus enhancer are exemplary enhancing elements for activation of eukaryotic promoters. Enhancers can be spliced into the vector at the 5'or 3'positions with respect to the ChMIrp nucleic acid molecule, but are typically located 5'to the promoter.

The expression vector of the present invention may be constructed from a starting vector such as a commercially available vector. Such a vector may or may not contain all desired flanking sequences. If one or more of the desired flanking sequences are not already in the vector to be used, these can be obtained individually and linked to the vector. The methods used to obtain each of the flanking sequences are well known to those of skill in the art.

Preferred vectors for carrying out the present invention include bacterial host cells, insect host cells,
And a vector compatible with mammalian host cells. Such vectors include, among others, pCRII, pCR3, and pcDNA3.1 (Invitrog
en, Company, Carsbad, CA), pBSII (Stratag)
ene Company, La Jolla, CA), pET15 (Novag
en, Madison, WI), pGEX (Pharmacia Biotec)
h, Piscataway, NJ), pEGFP-N2 (Clontech, P
alo Alto, CA), pETL (BlueBacII, Invitrog
en), pDSR-alpha (PCT Publication No. WO 90/14363) and pFastBac1, pFastBacHT, and pFastBacDu.
al (Gibco / BRL, Grand Island, NY).

[0154]   Further suitable vectors include, but are not limited to, cosmids, plasmids, or
Or modified viruses, these vector systems can be used with selected host cells.
It is understood that and must be compatible. Such vectors include:
Without limitation, a Bluescript® plasmid derivative (high copy
Number ColEl-based phagemid, Stratagene Cloning
  Systems, La Jolla CA), Taq amplification PCR product
PCR cloning plasmids designed to ^TM   TA Cloning (registered trademark) Kit, PCR2.1 (registered trademark)
Rasmid derivatives, Invitrogen, Carlsbad, CA)
Rasmid and mammalian, yeast or baculovirus
Viral vector like current system (pBacPAK plasmid derivative, Clont
ech, Palo Alto, CA).

After the vector is constructed and the nucleic acid molecule encoding the ChMIrp polypeptide is inserted at the appropriate site in the vector, the complete vector can be inserted into a host cell suitable for amplification and / or polypeptide expression. Transformation of expression vectors for ChMIrp polypeptides into selected host cells can be accomplished by methods such as transfection, infection, calcium chloride, electroporation, microinjection, lipofectin, the DEAE-dextran method, or other known techniques. Can be achieved by known methods including. Some of the methods selected are
It depends on the type of host cell used. These and other suitable methods are well known to those of skill in the art and are described, for example, in Sambrook et al., Supra.

The host cell can be a prokaryotic host cell (eg, E. coli) or a eukaryotic host cell (eg, yeast cell, insect cell, or vertebrate cell). The host cell will synthesize a ChMIrp polypeptide when cultured under suitable conditions, and this polypeptide can subsequently be harvested from the culture medium (if the host cell secretes the polypeptide into the medium). , Directly from the host cell producing the polypeptide (if the polypeptide is not secreted). Selection of the appropriate host cell will depend on various factors such as the level of expression desired, the polypeptide modification desired or required for activity (eg, glycosylation or phosphorylation), and the ease with which the biologically active molecule will fold. Depends on factors.

Yeast cells and mammalian cells are the preferred hosts of the present invention. The use of such hosts provides the substantial advantage that they may also undergo post-translational peptide modifications including glycosylation. Many recombinant DNA strategies exist, which utilize strong promoter sequences and high copy number plasmids used to produce the desired protein in these hosts.

The yeast recognition leader sequence on the cloned mammalian gene product produces and secretes a peptide-bearing leader sequence (ie, pre-peptide). Mammalian cells provide post-translational modifications to protein molecules that include proper folding or glycosylation at the correct site.

Mammalian cells that can be useful as hosts include cells of fibroblast origin (eg, VERO or CHO-K1) and their derivatives. For mammalian hosts, several possible vector systems are available for expression of desired ChMIrp polypeptides. A wide variety of transcriptional and translational regulatory sequences are available depending on the nature of the host. Transcriptional and translational regulatory signals may be derived from viral sources such as adenovirus, bovine papilloma virus, simian virus, etc., in which the regulatory signal is associated with a particular gene having high levels of expression. Alternatively, promoters derived from mammalian expression products (eg, actin, collagen, myosin, etc.) can be used. A transcription initiation regulatory signal that allows repression or activation can be selected so that expression of the gene can be regulated.
Useful signals are regulatory signals that are temperature sensitive (so that expression can be suppressed or inhibited by changing temperature) or chemical regulation (
(Eg, metabolites).

As is widely known, translation of eukaryotic mRNA is initiated at the codon which encodes the initiation methionine. For this reason, a eukaryotic promoter,
It is preferred to ensure a link between the DNA sequence encoding the desired receptor molecule that does not contain any intervening codons that may encode methionine (ie, AUG). The presence of such codons results in the formation of a fusion protein (AU
The G codon is in the same reading frame as the desired receptor molecule encoding the DNA sequence) or a frameshift mutation (the AUG codon is
(If not in the same reading frame) as the desired ChMIrp polypeptide coding sequence).

Expression of ChMIrp polypeptides can also be achieved in prokaryotic cells. Preferred prokaryotic hosts include bacteria (eg, E. coli, Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, etc.). The most preferred eukaryotic host is E. E. coli. Special purpose bacterial hosts include E. coli. coli K12 strain 294 (ATCC 31446), E. coli. coli
X1776 (ATCC 31537), E.I. coli W3110 (F, Λ)
, Prototrophic strains (ATCC 27325), and other enterobacteria (eg Sa
lmonella typhimurium or Serratia marc
escens) as well as various Pseudomonas species. The prokaryotic host must be compatible with the replicon and control sequences in the expression plasmid.

[0162]   Prokaryotic cells (eg E. coli, Bacillus subtilis, Pseudomonas sp., Strepto
In order to express the desired ChMIrp polypeptide in E. coli.
Operably link the sequence encoding the receptor molecule to a functional prokaryotic promoter
It is necessary to Such promoters are either constitutive or more preferred.
Preferably, it can be either regulatable (ie, inducible or derepressive)
. Examples of constitutive promoters include the bacteriophage lambda int promoter
, And the bla promoter of the β-lactamase gene of pBR322.
You can Examples of inducible prokaryotic promoters include bacteriophage λ (P _L And P_R) Major right and left promoters, and E. c
oli trp, recA, lacZ, lacI, gal and tac promotions
.Alpha.-amylase (Ulmane et al., J. Bacteriol. 162: 1.
76-182, 1985), a Bacillus subtilis σ28-specific promoter (Gilma).
Et al., Gene 32: 11-20, 1984), Bacillus bacteriophage.
Promoter (Gryczan, TJ, The Molecular B.
Iology of the Bacilli, Academic Press
, Inc. , New York, 1982), and Streptomyces promoters.
(Ward et al., Mol. Gen. Genet. 203: 468-478.
1986). Prokaryotic promoters are described in Glick (J. Ind.
Microbiol. 1: 277-282, 1987); Cenatempo.
, Biochimie 68: 505-516, 1986); and Gotte.
sman, Ann. Rev. Genet. 18: 415-442 1984).
More outlined.

Proper expression in prokaryotic cells also requires the presence of a ribosome binding site upstream from the gene coding sequence. Such ribosome binding sites are, for example,
Gold et al. (Ann. Rev. Microbiol. 35: 365-404, 1).
981).

The desired ChMIrp polypeptide coding sequence and the operably linked promoter may be a non-replicating DNA (or RNA) molecule, which may be linear or more preferably a closed covalent bond. It may be a cyclic molecule) and introduced into the recipient prokaryotic or eukaryotic cell. Since such molecules are incapable of autonomous replication, expression of the desired receptor molecule can occur via transient expression of the introduced sequences. Alternatively, persistent expression may occur via integration of the introduced sequences into the host chromosome.

In one embodiment, a vector is used that is capable of integrating the desired gene sequences into the host cell chromosome. Cells that have stably integrated the introduced DNA into their chromosomes can also be selected by introducing one or more markers that allow for selection of host cells containing the expression vector. The marker may be auxotrophic in the host (eg, common yeast auxotrophic markers leu21 or ura3), biocide.
e) It may supplement resistance (eg antibiotics) or heavy metals (eg copper) etc. This selectable marker gene may be directly linked to the DNA gene sequence to be expressed or may be introduced into the same cell by co-transfection.

In a preferred embodiment, the introduced sequences are incorporated into a plasmid or viral vector capable of autonomous replication in the recipient host. Any of a wide variety of vectors can be used for this purpose. Important factors in selecting a particular plasmid or viral vector (eg, convenience in recipient cells containing the vector) (the number of copies of the vector desired in a particular host; and host cells of different species) Whether it is desirable to be able to "shuttle" vectors between, can be recognized and selected from recipient cells that do not contain these vectors.

Any of a range of yeast gene expression systems can also be used. Examples of such expression vectors include yeast 2 micron circle, expression plasmids (YEP13, YV
P and YRP) or their derivatives. Such plasmids are well known in the art (Botstein et al., Miami Wntr. Sy.
mp. 19: 265-274 (1982); Broach, The Molec.
ulular Biology of the Yeast Saccharomy
ces: Life Cycle and Inheritance, Cold
Spring Harbor Laboratory, Cold Spring
Harbor, N.M. Y. , 445-470 (1981); Broach, C.
ELL 28: 203-204 1982).

For mammalian hosts, several possible vector systems are available for expression. One class of vectors that use DNA elements that provide autonomous replication of extrachromosomal plasmids is animal viruses (eg, bovine papilloma virus,
Polyoma virus, adenovirus, or SV40 virus).
The second class of vectors relies on the integration of the desired gene sequence into the host chromosome. Cells in which the introduced DNA has been stably integrated into their chromosomes can also be selected by incorporating one or more markers which allow for selection of host cells which contain the expression vector. The marker may provide prototropy to the auxotrophic host, such as biocide resistance (eg, antibiotics), or heavy metals (eg, copper).
The selectable marker gene may be operably linked to the expressed DNA sequence or may be introduced into the same cell by cotransformation. Additional elements may also be required for optimal synthesis of mRNA. These elements are
Splice signals, as well as transcription promoters, enhancers, and termination signals can be included. CDNA expression vectors incorporating such elements are described in Okayama, H .; (Mol. Cell. Biol. 3: 280 19
83). Preferred eukaryotic vectors include
PWLNEO, PSV2CAT, POG44, PXTI, pSG, pSVK3,
Examples include pBPV, pMSG, pSVL (Pharmacia).

Preferred prokaryotic vectors include E. coli. A plasmid such as a plasmid that can be replicated in E. coli (eg pBR322, ColEl, pSC101, p
ACYC 184, πVX, pQE70, pQE60, pQE9, pBG, pD
10, Phase script, psixl74, pbmescript S
K, pbsks, pNH8A, pNHIBa, pNH18A, pNH46A (S
L rare gone), ptrc99a, pKK223-3, pKK233.
-3, pDR540, pRIT5). For example, such a plasmid is described in Maniatis, T .; Et al. (Molecular Cloning, A
Laboratory Manual, Cold Spring Harbor
Press, Cold Spring Harbor, N.M. Y. (1982)
) Is disclosed. As the Bacillus plasmid, pC194, pC
221 and pT127. Such a plasmid is called Grycza.
n, T. (The Molecular Biology of the Ba
Cilli, Academic Press, New York (1982)
307-329). Suitable Streptomyces plasmids include pISJ101 (Kendall et al., J. Bacteriol. 169).
: 4177-4183 1987) and .PHI.C31 bacteriophages (Chater et al., Sixth Internationala).
l Symposium on Actinomycetales Biolo
gy, Akademiai Kaido, Budapaste, Hungary,
1986, 45-541). Streptomyces plasmids are
John et al. (Rev. Infect. Dis. 8: 693-704, 1986.
And Izaki, K .; (Jpn. J. Bacterio L33: 729-74.
2 1978). However, any other plasmid or vector may be used as long as they are replicable and viable in the host cell.

Once the DNA sequence containing the vector or construct has been prepared for expression,
The DAN construct can be introduced into a suitable host. Various techniques can be used, such as protoplast fusion, calcium phosphate precipitation, electroporation or other conventional techniques. After fusion, cells are grown in culture and screened for the appropriate activity. Expression of the sequence results in production of the ChMIrp polypeptide.

Suitable host cells or cell lines are mammalian cells (eg Chinese hamster ovary cells (CHO; ATCC No. CCL61), CHO DHFR cells (U
rlaub et al., Proc. Natl. Acad. Sci. U. S. A, 97: 4
216-4220, 1980), human embryonic kidney (HEK), 293 cells or 293T cells (ATCC No. CRL 1573), or 3T3 cells (ATCC).
The number CCL92)).

Methods for selection of suitable mammalian host cells and transformation, culture, amplification, screening, product production and purification are known in the art. Other suitable mammalian cell lines are monkey COS-1 (ATCC number CRL 1650) and CO.
S-7 (ATCC No. CEL 1651) cell line as well as CV-1 (ATCC No. CCL70) cell line. Further exemplary mammalian host cells include primate and rodent cell lines, including transformed cell lines. Normal diploid cells, cell lines derived from in vitro culture of primary tissues, as well as primary explants are also suitable. Candidate cells may be genotypically deficient in the selection gene or may contain a dominantly acting selection gene. Other suitable mammalian cell lines include, but are not limited to: Swi
Mouse neuroblastoma N2A derived from ss, Balb-c or NIH mice
Cells, HeLa cells, mouse L-929 cells, 3T3 strains, or BHK or HaK hamster cell lines (these are available from ATCC). Each of these cell lines is known and available to those of skill in the art of protein expression.

Similarly, similarly useful as host cells suitable for the present invention are bacterial cells. For example, E. various strains of E. coli (eg HB101 (ATCC No.
33694), DH5α, DH10, and MC1061 (ATCC No. 5).
3338)) are well known as host cells in the field of biotechnology. B. subtilis, Pseudomonas spp. , Other Bacil
lus spp. , Streptomyces spp. Various strains such as can also be used in the method.

Many strains of yeast cells known to those of skill in the art are also available as host cells for expression of the polypeptides of the invention (eg, Saccharomyces, i.
chia, Candida, Hansenula, and Torulopsis
) (Bitter, G., Heterologous Gene Express)
sion in Yeast In: Berger, S.L. L. And Kimme
l, A. R. , 152: 673-684, 1987). Preferred yeast strains include, for example, Saccharomyces cerevisiae, which
It can be readily transformed with DNA either by the preparation of spheroplasts or by salting with an alkali salt (eg LiCl) (Itoh).
Et al., J. Bactriol. , 153: 163, 1983). Some proteins expressed in yeast cells are efficiently screened in the culture medium, while others accumulate intracellularly.

In addition, insect cell lines can be utilized in the methods of the invention. Such systems are described, for example, in Kitts et al. (Biotechniques 14: 810-817).
, 1993), Lucklow (Curr. Opin. Biotechnol.
4: 564-572, 1993) and Lucklow et al. (J. Virol. 6).
7: 4566-4579, 1993). Preferred insect cells are Sf
-9 and Hi5 (Invitrogen, Carlsbad, CA).
Preferably, the insect cells are infected with recombinant baculovirus particles, which have ChMIrp polypeptide sequences integrated into their genome. The baculovirus infection leads to efficient eukaryotic expression of recombinant ChMIrp. Such baculovirus expression systems include the Bac-to-Bac (R) system (Life Technologies) and the BacPAK (R) system (Clontech).

Polypeptide Production Host cells containing the ChMIrp polypeptide expression vector can be cultured using standard media well known to those of skill in the art. This medium usually contains all the nutrients necessary for the growth and survival of the cells. E. Suitable media for culturing E. coli cells include, for example, Luria Broth (LB) and / or Terrific
Broth (TB). A suitable medium for culturing eukaryotic cells is Ros
ewell Park Memorial Media 1640 (RPMI
1640), minimal essential medium (MEM), and / or Dulbecco's
Modified Eagle Media (DMEM), all of which can be supplemented with serum and / or growth factors exhibited by the particular cell line being cultured. A suitable medium for insect cultures is Grace's medium supplemented with yeastolate, lactalbumin hydrolyzate and / or fetal calf serum, if necessary.

[0177] Typically, antibiotics or other compounds useful for the selective growth of transformed cells are added to this medium as a supplement. The compound used will be dictated by the selectable marker element present on the plasmid with which the host cell was transformed. For example, if the selectable marker element is kanamycin resistance, the compound added to the culture medium is kanamycin. Other compounds for selective growth media include ampicillin, tetracycline and neomycin.

The amount of ChMIrp polypeptide produced by a host cell can be evaluated using standard methods known in the art. Such methods include, but are not limited to, Western blot analysis, SDS-polyacrylamide gel electrophoresis, non-denaturing gel electrophoresis, HPLC separation, immunoprecipitation, and / or activity assay.

If the ChMIrp polypeptide is designed to be secreted from the host cell,
The majority of polypeptides can be found in cell culture medium. However, ChMIr
When the p polypeptide is secreted from the host cell, the ChMIrp polypeptide is present in the cytoplasm and / or nucleus (for eukaryotic host cells) or cytosol (bacterial host cells).

For ChMIrp polypeptides present in the cytoplasm and / or nucleus of host cells (for eukaryotic hosts) or cytosol (for bacterial host cells):
The host cell is typically first mechanically disrupted or detergent disrupted, releasing the intracellular contents into a buffer solution. The ChMIrp polypeptide is
It can then be isolated from this solution.

Purification of ChMIrp polypeptides from solution can be accomplished using a variety of techniques. The polypeptide has a hexahistidine-like tag (ChMIrp polypeptide / HexaHisHis) at either its carboxy or amino terminus.
), Or other small peptides such as FLAG (Eastman Koda).
k Co. , New Haven, CT) or myc (Invitroge
n., Carlsbad, CA), or a fused IgG Fc fragment, the polypeptide has a high affinity for the tag or a direct affinity for the polypeptide. It can be essentially purified in one step by passing the solution through an affinity column having a PEG (ie, a monoclonal antibody that specifically recognizes a ChMIrp polypeptide). For example, polyhistidine binds nickel with great affinity and specificity, and thus nickel affinity columns (eg, Qiagen® Nickel columns) can be used for purification of ChMIrp polypeptides / PolyHis. (For example, Ausubel et al., Current Protoco
ls in Molecular Biology, Section 10.11.8, Joh
n Wiley & Sons, New York, 1993. 3.) Furthermore, ChMIrp polypeptides can be purified through the use of monoclonal antibodies that can specifically recognize and bind ChMIrp polypeptides.

Other well known procedures for purification can be used if the ChMIrp polypeptide is prepared without attached tags and if no antibody is available. Such procedures include, but are not limited to, ion exchange chromatography, molecular sieve chromatography, HPLC, native gel electrophoresis in combination with gel elution, and preparative isoelectric focusing (“Isoprime” machines / techniques). ,
Hoefer Scientific). In some cases, two or more of these purification techniques can be combined to achieve increased purity.

If the ChMIrp polypeptide is produced intracellularly, the intracellular material (including inclusion bodies for Gram-negative bacteria) can be derived from the host cell using any standard method known to those of skill in the art. And can be extracted. For example, host cells are lysed by detergent lysis (eg, Triton X-100), French press, homogenization, and / or sonication followed by centrifugation to remove periplasmic / cytoplasmic contents. Can be released.

When the ChMIrp polypeptide forms inclusion bodies in the cytoplasm, the inclusion bodies can often bind to the inner and / or outer surface of the cell membrane and are therefore predominantly in pellet material after centrifugation. Found. The pellet material is then
At an extreme pH or chaotropic agent (eg, surfactant, guanidine, guanidine derivative, urea, or urea derivative) in the presence of a reducing agent (eg, dithiothreitol at alkaline pH, or carboxyethylphosphine at acidic pH). To release, cleave, and solubilize the inclusion bodies. The ChMIrp polypeptide in its solubilized form can then be analyzed using gel electrophoresis, immunoprecipitation, or the like. If it is desired to isolate the ChMIrp polypeptide, isolation is described herein or in Marston et al. (Meth. Enz.
． , 182: 264-275, 1990).

In some cases, ChMIrp polypeptides may not be biologically active upon isolation. Various methods for "refolding" or converting a polypeptide into its tertiary structure and generating disulfide bonds can be used to restore biological activity. In such a method, the solubilized polypeptide is added to the pH, usually above pH 7, and in the presence of a particular concentration of chaotropic agent.
Exposure to. The choice of chaotropic agent is very similar to that used for solubilization of inclusion bodies, but usually chaotropic agents are used at low concentrations and not necessarily for solubilization. Not the same as a chaotropic agent. In most cases, the refolding / oxidizing solution also contains a reducing agent or reducing agent plus its oxidized form in a specific ratio to produce a specific redox potential, and disulfide shuffling is involved in the formation of protein cysteine bridges. Allows to occur. Some commonly used redox pairs include cysteine / cystamine, glutathione (GSH) / dithiobis GSH, copper chloride, dithiothreitol (DTT) / dithian DTT, 2-2.
Includes mercaptoethanol (bME) / dithio-b (ME). Cosolvents can be used to increase the efficiency of refolding, and more common reagents used for this purpose include glycerol, polyethylene glycols of various molecular weights, arginine, and the like.

When inclusion bodies are not formed to a significant extent upon expression of ChMIrp polypeptide, the polypeptide is found predominantly in the supernatant after centrifugation of cell homogenates. The polypeptide can be further isolated from the supernatant using methods as described herein.

In a preferred situation for partially or completely purifying a ChMIrp polypeptide such that it is partially or completely free of contaminants, standard methods known to those of skill in the art can be used. Such methods include electrophoretic separation and subsequent electroelution, various types of chromatography (affinity, immunoaffinity, molecular sieve, and / or ion exchange), and / or high pressure liquid chromatography. However, it is not limited to these. In some cases, it may be preferable to use one or more of these methods for complete purification.

ChMIrp polypeptides, fragments, and / or derivatives thereof can also be prepared by chemical synthetic methods (eg, solid phase peptide synthesis) using techniques known in the art, which are known, for example, Merrifield et al. (JA
m. Chem. Soc. 85: 2149, 193), Houghton et al. (Pr.
oc Natl Acad. Sci. USA 82: 5132, 1985), and Stewart and Young (Solid Phase Pepti).
de Synthesis, Pierce Chemical Co. , Roc
kford, IL, 1984). Such polypeptides may be synthesized with or without a methionine at the amino terminus. Chemically synthesized ChMIrp polypeptides or fragments can be oxidized to form disulfide bridges using the methods set forth in these references. The chemically synthesized ChMIrp polypeptide, fragment or derivative is the corresponding C that is recombinantly produced or purified from a natural source.
It is expected to have comparable biological activity to hMIrp polypeptides, fragments or derivatives and thus can be used interchangeably with recombinant ChMIrp polypeptides or native ChMIrp polypeptides.

Another means of obtaining ChMIrp polypeptides is by purification from biological samples such as tissues and / or fluids of a source in which ChMIrp polypeptides are naturally found. Such purification can be performed using methods for protein purification as described herein. During purification, the presence of ChMIrp polypeptides can be monitored, for example, using antibodies prepared against recombinantly produced ChMIrp polypeptides or peptide fragments thereof.

Many additional methods for producing nucleic acids and polypeptides are known in the art, and this method can be used to produce polypeptides with specificity for ChMIrp. For example, Roberts et al., Proc. N
atl. Acad. Sci. U. S. A. 94: 12297-12303, 19
See 97. This describes the production of fusion proteins between mRNA and its encoded peptide. Roberts, R.A. Curr. Opin. C
hem. See also Biol 3: 268-73, 1999. In addition, US Pat. No. 5,824,469 describes methods for obtaining oligonucleotides capable of performing particular biological functions. This procedure involves generating a heterogeneous pool of oligonucleotides, each having a 5'randomized sequence, a central preselected sequence, and a 3'randomized sequence. The resulting heterologous pool is introduced into a population of cells that do not exhibit the desired biological function. Subpopulations of cells are then screened for those exhibiting the desired biological function. From that subpopulation, oligonucleotides that can perform the desired biological function are isolated.

US Pat. Nos. 5,763,192; 5,814,476; 5,72.
3,323; and 5,817,483 describe processes for producing peptides or polypeptides. This is accomplished by producing stochastic genes or fragments thereof and then introducing those genes into host cells that produce one or more proteins encoded by the stochastic genes. The host is then screened to identify those clones that produce the peptide or polypeptide with the desired activity.

Another method for producing a peptide or polypeptide is Athersys
, Inc. PCT / US98 / 20094 (WO99 / 15
650) ("Random Activation of Gene Expr
(known as "session for Gene Discovery" (known as RAGE-GD)), which involves activation of endogenous gene expression or gene overexpression by in situ recombination methods. For example, expression of an endogenous gene is activated or increased by incorporating regulatory sequences into target cells that may activate expression of the gene by heterologous or aberrant recombination. This target DNA is first subjected to radiation and then inserted into the gene promoter. This promoter is finally placed at the branch point in front of the gene and initiates transcription of the gene. This results from the expression of the desired peptide or polypeptide.

These methods can also be used to generate a comprehensive ChMIrp polypeptide expression library, which can be followed by a variety of assays such as biochemical, cellular and whole-biological assays. (For example, plants, mice, etc.)
), It can be used for high throughput phenotypic screening.

ChMIrp Proteins, Polypeptides, Fragments, Variants and Muteins The polypeptides of the invention include isolated ChMIrp polypeptides and polypeptides related thereto (fragments, as described herein above, (Including variants, fusion polypeptides and derivatives).

ChMIrp fragments of the invention may result from truncations at the amino terminus (with or without leader sequences), carboxy terminus truncations, and / or internal deletions of the polypeptide. Most deletions and insertions, and especially substitutions, are not expected to result in extreme changes in the characteristics of ChMIrp proteins. However, if it is difficult to predict the exact effect of a substitution, deletion or insertion prior to implementation, the skilled artisan will appreciate that this effect will be assessed by routine screening assays. For example, a variant typically includes site-directed mutagenesis of a nucleic acid encoding a ChMIrp polypeptide, expression of the variant nucleic acid in recombinant cell culture, and, if desired, from the cell culture. Produced by purification, which purification is, for example, by immunoaffinity adsorption on a polyclonal anti-ChMIrp antibody column (to adsorb the variant by binding it to at least one remaining immune epitope). In preferred embodiments, the truncation and / or deletion comprises about 10 amino acids, or about 20 amino acids, or about 50 amino acids, or about 75 amino acids, or about 100 amino acids, or more than about 100 amino acids. The polypeptide fragment so produced has about 25 contiguous amino acids, or about 50 amino acids, or about 75 amino acids, or about 100 amino acids, or about 150 amino acids, or about 200 amino acids, or about 250 amino acids, or about It contains 275 amino acids, or about 300 amino acids. Such ChMIrp polypeptide fragments may optionally include an amino terminal methionine residue.

ChMIrp polypeptide variants of the invention include one or more amino acid substitutions, additions and / or deletions as compared to SEQ ID NO: 2. In a preferred embodiment, the variant is 1-3, or 1-5, or 1-10, or 1-15, or 1-20, or 1-25, or 1-50, or 1-75, or 1 to
100 or more than 100 amino acid substitutions, insertions, additions and / or deletions, wherein the substitutions may be conservative as described above, or non-conservative, or It can be a combination. More specifically, ChMI
The rp variant may comprise the amino acid sequence shown in SEQ ID NO: 2, in which amino acids 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50,
51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62,
63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86,
87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,
99, 100, 101, 102, 103, 104, 105, 106, 107, 1
08, 109, 110, 111, 112, 113, 114, 115, 116, 1
17, 118, 119, 120, 121, 122, 123, 124, 125, 1
26, 127, 128, 129, 130, 131, 132, 133, 134, 1
35, 136, 137, 138, 139, 140, 141, 142, 143, 1
44, 145, 146, 147, 148, 149, 150, 151, 152, 1
53, 154, 155, 156, 157, 158, 159, 160, 161, 1
62, 163, 164, 165, 166, 167, 168, 169, 170, 1
71, 172, 173, 174, 175, 176, 177, 178, 179, 1
80, 181, 182, 183, 184, 185, 186, 187, 188, 1
89, 190, 191, 192, 193, 194, 195, 196, 197, 1
98, 199, 200, 201, 202, 203, 204, 205, 206, 2
07, 208, 209, 210, 211, 212, 213, 214, 215, 2
16, 217, 218, 219, 220, 221, 222, 223, 224, 2
25, 226, 227, 228, 229, 230, 231, 232, 233, 2
34, 235, 236, 237, 238, 239, 240, 241, 242, 2
43, 244, 245, 246, 247, 248, 249, 250, 251, 2
52, 253, 254, 255, 256, 257, 258, 259, 260, 2
61, 262, 263, 264, 265, 266, 267, 268, 269, 2
70, 271, 272, 273, 274, 275, 276, 277, 278, 2
79, 280, 281, 282, 283, 284, 285, 286, 287, 2
88, 289, 290, 291, 292, 293, 294, 295, 296, 2
97, 298, 299, 300, 301, 302, 303, 304, 305, 3
06, 307, 308, 309, 310, 311, 312, 313, 314, 3
One or more amino acids from the group consisting of 15, 316, or 317 have been replaced with another amino acid. This variant may have the addition of amino acid residues at either the carboxy terminus or the amino terminus (with or without the leader sequence).

Preferred ChMIrp polypeptide variants include glycosylation variants in which the number and / or type of glycosylation sites are altered compared to the native ChMIrp polypeptide. In one embodiment, the ChMIrp variant comprises a greater or lesser number of N-linked glycosylation sites. The N-linked glycosylation site is characterized by the sequence Asn-X-Ser, where the amino acid residue designated as X can be any type of amino acid except proline. Substitution of amino acid residues to create this sequence provides a possible new site for the addition of N-linked equichains. Alternatively, a substitution to remove this sequence removes an existing N-linked isochain. Also, reconstitution of N-linked equichains in which one or more N-linked glycosylation sites (typically naturally occurring sites) are removed and one or more new N-linked sites are produced. Provided.

One of skill in the art can use well known techniques to determine the appropriate variant of the native ChMIrp polypeptide. For example, one can infer appropriate regions of the molecule that can be altered without destroying biological activity. One of skill in the art will also appreciate that conservative amino acid substitutions, even those regions that may be important for biological activity or structure, may be subjected to conservative amino acid substitutions without destroying the biological activity or adversely affecting the polypeptide structure. Recognize that you get.

To predict suitable regions of the molecule that can be altered without destroying activity, one of skill in the art can target regions that are considered important for activity. For example, if a similar polypeptide with similar activity from the same species or another species is known, one of skill in the art can compare the amino acid sequence of a ChMIrp polypeptide to such similar polypeptide. After making such a comparison, one of skill in the art can determine the residues and portions of the molecule that are conserved between similar polypeptides. Those of ordinary skill in the art will appreciate that C
We know that changes in regions of the hMIrp molecule are unlikely to adversely affect biological activity and / or structure. One of skill in the art can also possibly substitute chemically similar amino acids for naturally occurring residues while retaining activity, even in relatively conserved regions (eg, conservative amino acid residue substitutions). .

One of skill in the art can also review structure-function studies to identify residues in similar polypeptides that are important for activity or structure. In view of such comparisons, one of ordinary skill in the art would appreciate that ChMs corresponding to amino acid residues of similar activity or structure in similar polypeptides.
One can predict the importance of amino acid residues in Irp. One of ordinary skill in the art can select chemically similar amino acid substitutions for such putative key amino acid residues of ChMIrp.

When available, one of skill in the art can also analyze the crystal structure of similar polypeptides, and the amino acid sequences associated with that structure. Given that information, one of skill in the art would be able to predict the alignment of amino acid residues of a ChMIrp polypeptide with respect to its three-dimensional structure. One of ordinary skill in the art can choose not to make abrupt changes to amino acid residues predicted to be on the surface of the protein. Because such residues may be involved in important interactions with other molecules.

In addition, one of skill in the art can produce test variants that contain a single amino acid substitution at each amino acid residue. This variant can be screened using the activity assay disclosed herein. Such variants are used to gather information about suitable variants, for example, if one finds that a change to a particular amino acid residue resulted in a disruption of activity, such a change is made. Variants containing are avoided. Therefore, when attempting to find additional variants that are acceptable based on the information gathered from such experiments, those skilled in the art will avoid further substitutions either alone or in combination with other mutations. I know the amino acids that should be done.

ChMIrp fusion polypeptides of the invention include ChMIrp polypeptides, fragments, variants or derivatives fused to a heterologous functional portion of a peptide or protein. Heterologous peptides and proteins include epitopes that allow detection and / or isolation of ChMIrp fusion polypeptides, transmembrane receptor proteins or portions thereof (eg extracellular domain), or ligands or binding to transmembrane receptor proteins. Parts, catalytically active enzymes or parts thereof, proteins or peptides that promote oligomerization (eg leucine zipper domains) and proteins or peptides that increase stability, or circulation half-life (eg immunoglobulin constant regions). However, the present invention is not limited to these. The ChMIrp polypeptide may be fused to itself or a fragment, variant or derivative thereof. Fusion is ChMIrp
It can be made either at the amino-terminus or the carboxy-terminus of the polypeptide, and can be direct without a linker or adapter molecule, or a linker or adapter molecule (eg, from one or more amino acid residues to about 20 amino acid residues). , Or up to about 50 amino acid residues). The linker or adapter molecule can also be designed to include a cleavage site for DNA restriction endonucleases or a cleavage site for proteolytic cleavage to allow separation and subsequent folding of the fusion moiety.

Also, the ChMIrp polypeptide was circularly permuted (circular).
rly permuted) structural analogs are envisioned as part of the present invention.

The development of recombinant DNA methods has made it possible to study the effects of sequence transposition on protein folding, structure and function. The approach used in creating new sequences is the linear rearrangement of the amino acid sequence.
Similar to the naturally occurring pairwise approach of related proteins by r reorganization (Cunningham et al., Proc. Natl.
Acad. Sci. U. S. A. 76: 3218-3222, 1979; Tea.
ther and Erfle, J .; Bacteriol. 172: 3837-38
41, 1990; Schimming et al., Eur. J. Biochem. 204
: 13-19, 1992; Yamiuchi and Minamikawa, FE.
BS Lett 260: 127-130, 1991; MacGregor et al.,
FEBS Lett. 378: 263-266, 1996). The first in vitro application of this type of rearrangement to proteins has been shown by Goidenberg and Creighton (J. Mol. Biol. 165: 407-413, 198).
3). The new N-terminus is the internal site of the original sequence (breakpoint (b
reakpoint)), the new sequence has the same amino acid sequence from its breakpoint until it reaches an amino acid at or near the original C-terminus. In this respect, the novel sequence can be either directly or in additional sequence parts (
Via a linker) to the amino acid at or near the original N-terminus, and the novel sequence is at or near the amino acid N-terminal to the delimiter of the original sequence. The same sequence continues until the point is reached, this residue forming the new C-terminus of the chain.

This approach has been applied to proteins in the size range of 58-462 amino acids (Goldenberg & Creighton, J. Mol. Bi.
ol. 165: 407-413, 1983; Li & Cofino, Mol.
． Cell. Biol. 13: 2377-2383, 1993). The proteins tested represent a wide range of structural classes, including those containing predominantly α-helices (interleukin-4; Kreitman et al., Cytokine.
7: 311-318, 1995), a protein mainly containing β-sheet (interleukin-1; Horlick et al., Protein Eng. 5: 427-4).
31, 1992) or a protein containing a mixture of the two (yeast phosphoribosyl anthranilate isomerase; Luger et al., Science 243: 20).
6-210, 1989).

In a preferred embodiment, ChMIrp polypeptides, fragments, variants and / or derivatives are fused to the Fc region of human IgG. In one example, human IgG hinges, CH2 and CH, using methods known to those of skill in the art.
The 3 region can be fused to either the N-terminus or the C-terminus of the ChMIrp polypeptide. In another example, a portion of the hinge region and the CH2 and CH3 regions can be fused. The ChMIrp Fc fusion polypeptide thus produced is
Protein A affinity column (Pierce, Rockford,
IL). Furthermore, peptides and proteins fused to the Fc region have been found to exhibit in vivo half-lives that are substantially greater than their unfused counterparts. Also, fusion to the Fc region allows for dimerization / multimerization of this fusion polypeptide. The Fc region may be a naturally occurring Fc region or may be modified to improve certain qualities such as therapeutic quality, circulation time, reduced aggregation and the like.

ChMIrp polypeptide derivatives are also included within the scope of the invention. Covalent modifications of the ChMIrp protein of the invention are included within the scope of the invention. Variant ChMIrp proteins may be conveniently prepared by in vitro synthesis. Such modifications can be introduced intramolecularly by reacting the target amino acid residues of the purified or crude protein with an organic derivatizing agent that can react with selected side chains or terminal residues. The resulting covalent derivative is useful in a program to identify residues important for biological activity.

Cysteine residues are most commonly reacted with α-haloacetates (and corresponding amines), such as chloroacetic acid or chloroacetamide, to give carboxymethyl or carboxamidomethyl derivatives. Cysteine residues also include bromotrifluoroacetone, α-bromo-β (5-imidazoyl) propionic acid, chloroacetyl phosphate, N-alkali maleimide, 3-nitro-2-pyridyl disulfide, methyl 2-pyridyl disulfide, p- Derivatized by reaction with chloromercuribenzoic acid, 2-chloromercury-4-nitrophenol, or chloro-7-nitrobenzo-2-oxa-1,3-diazole.

Histidine residues are derivatized by reaction with diethylprocarbonate at pH 5.5-7.0. This drug is relatively specific for the histidine side chain. p-Bromophenacyl bromide is also useful; the reaction is preferably carried out in 0.1 M sodium cacodylate at pH 6.0.

The lysine residue and the amino terminal residue are reacted with succinic anhydride or carboxylic acid anhydride. Derivatization with these agents has the effect of reversing the charge of lysine residues. Other suitable reagents for derivatizing α-amino containing residues include imidoesters (eg, methylpicoline imidate); pyridoxal phosphate; pyridoxal; chloroborohydride; trinitrobenzene sulfonic acid;
O-methylisourea; 2,4 pentanedione; and transaminase (catalytic reaction with glyoxylate).

Arginine residues are modified by reaction with one or several conventional reagents, among them phenylglyoxal, 2,3-butanedione, 1,2-cyclohexanedione and ninhydrin. Derivatization of arginine residues, due to the high pK _a of the guanidine functional group, the reaction is, requires to be performed in alkaline conditions. In addition, these reagents contain lysine functional groups and arginine ε.
It can react with amino groups.

The specific modification of tyrosine residues has been extensively investigated in its own right, with particular interest in introducing spectral labels to tyrosine residues, especially by reaction with aromatic diazonium compounds or tetranitromethane. Get burned. Most commonly, N-acetylimidazole and tetranitromethane are used to form O-acetyltyrosine species and 3-nitro derivatives, respectively. Tyrosine residues are iodinated using ¹²⁵ I or ¹³¹ I to prepare labeled proteins for use in the radioimmunoassay, where the chloramine T method described above is suitable.

Carboxyl side groups (aspartic acid or glutamic acid) are carbodiimide (R ¹ ) (eg 1-cyclohexyl-3- (2-morpholinyl- (4-ethyl) carbodiimide or 1-ethyl-3 (4azonia 4 , 4-Dimethylpentyl) carbodiimide), and the aspartic acid and glutamine residues are converted to aspartic acid and glutamic acid residues by reaction with ammonium ions.

Derivatization with a bifunctional agent is a water-insoluble support matrix or for use in a method for cleaving a ChMIrp polypeptide fusion polypeptide to release and recover the cleaved polypeptide. ChMIrp for surface
Is useful for cross-linking. Commonly used or teaching materials are 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide ester (eg ester with 4-azidosalicylic acid)
, Homobifunctional imide esters (including 3,3′-dithio (including disuccinimidyl esters such as succinimidyl propionate), and bis-N-maleimido-1,8-octane. Functional maleimides are mentioned: Methyl-
Derivatizing agents such as 3- [p-azidophenyldithio] propioimidate are:
It produces a photoactivatable intermediate, which can form crosslinks in the presence of light. Alternatively, U.S. Pat. Nos. 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537.
And water-insoluble matrices (eg, cyanogen bromide-activated carbohydrates) and reactive substrates described in US Pat. No. 4,330,440 are used for protein immobilization.

Glutamine and asparagine residues are often deamidated to the corresponding glutamyl (glutamic acid) and aspartyl (aspartic acid) residues. Alternatively, these residues are deamidated under mildly acidic conditions. Either form of these residues falls within the scope of this invention.

Other modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of serine or threonine residues, methylation of α-amino acids of lysine, arginine and histidine side chains (Creighton, TE. Proteins
: Structure and Molecule Properties, W
． H. Freeman & Co. San Francisco, pp. 79
-86,1983), acetylation of N-terminal amines, and in some cases amidation of C-terminal carboxyl groups. Such derivatization is a chemically modified ChMIrp polypeptide composition in which the ChMIrp polypeptide is conjugated to a polymer. The polymer selected is typically water-soluble so that the attached protein does not precipitate in an aqueous environment (eg, physiological environment). The polymer selected is usually a single reactive group, such as an active ester for acylation or an aldehyde for alkylation, so that the degree of polymerization is provided in the method of the invention. Can be controlled as follows.

The polymer can be of any molecular weight and can be branched or unbranched. Each of the polymers is typically 2 kDa to about 100 kDa.
having an average molecular weight between a (herein, the term "about" means that in the preparation of the water-soluble polymer some molecules are higher or lower than the mentioned molecular weight). The average molecular weight of each polymer is preferably between about 5 kDa and about 50 kDa, more preferably between about 12 kDa and about 40 kDa, and most preferably between about 20 kDa and about 35 Da. Suitable water soluble polymers or mixtures thereof include, but are not limited to: N
Derived proteins, including linked or O-linked carbohydrates, sugars, phosphates, polyethylenes, glycols (PEG), including mono- (C1-C10), alkoxy-polyethylene glycols, or aryloxy-polyethylene glycols. Used in the form of PEG), monomethoxy-polyethylene glycol, dextran (eg, low molecular weight (eg, about 6 kD dextran)), cellulose, or other carbohydrate-based polymer, poly- (N-vinyl). Pyrrolidine) polyethylene glycol, propylene glycol homopolymers, polypropylene oxide / ethylene oxide copolymers, polyoxyethylated polyols (eg glycerol), and vinyl alcohol. Also included in the invention are bifunctional cross-linking molecules that can be used to prepare covalently linked polypeptide multimers of the polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or a ChMIrp polypeptide variant.

In general, chemical derivatization can be carried out under any suitable conditions used to react proteins with activated polymer molecules. Methods for preparing chemical derivatives of polypeptides generally include the following steps: (a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or a ChMIrp polypeptide variant is incorporated into one or more polymer molecules. Reacting a polypeptide with an activated polymer molecule (eg, a reactive ester or aldehyde derivative of the polymer molecule) under binding conditions, and (b) obtaining a reaction product. Optimal reaction conditions are determined based on known parameters and desired results. For example, the greater the ratio of polymer molecules to protein, the greater the percentage of polymer molecules bound. In one embodiment, the ChMIrp polypeptide derivative may have an amino-terminated single polymer molecular moiety. See, eg, US Pat. No. 5,234,784.

Pegylation of ChMIrp polypeptides can be specifically performed using any pegylation reaction known in the art. Such reactions are described, for example, in the following references: Focus on Growth.
h Factors 3: 4-10, l992; EP 0154316 and 0401384. For example, PEGylation can be carried out via an acylation or alkylation reaction with a reactive polyethylene glycol molecule (or similar reactive water-soluble polymer), as described below.

A particularly preferred water-soluble polymer for use herein is polyethylene glycol (abbreviation PEG). As used herein, polyethylene glycol refers to any form of PEG that has been used to derivatize other proteins, such as mono (C1-C10) alkoxy-polyethylene glycol or aryloxy. -Polyethylene glycol) is meant to be included. PEG is a linear or branched neutral polyether available in a wide range of molecular weights and is soluble in water and many organic solvents. PEG is
When present in water it is effective in eliminating other polymers or peptides,
This is mainly due to its high dynamic chain mobility and hydrophilic nature, thus
Forms a water shell or hydration sphere when attached to other proteins or polymer surfaces. PEG is non-toxic,
It is non-immunogenic and is approved by the Food and Drug Administration (FDA) for internal consumption.

Proteins or enzymes when conjugated to PEG showed reduced bioactivity, non-antigenic properties and clearance rates when administered to animals. F. M.
Veronese et al., Preparation and Properties.
of Monomethypoly (ethylene glyco.)
-Modified Enzymes for Therapeutic Ap
applications, J.C. M. Edited by Harris, Poly (Ethylene
Glycol Chemistry-Biotechnical and
Biomedical Applications 127-36, 1992 (
Incorporated herein by reference). This is due to the exclusion properties of PEG in blocking recognition by the immune system. Furthermore, PEG is widely used as a means of surface modification to reduce protein adsorption and improve hemocompatibility. S.
W. Kim et al., Ann. N. Y. Acad. Sci. 516: 116-30 1
987; Jacobs et al., Artif. Organs 12: 500-501,
1988; Park et al. Poly. Sci, Part A 29: 1725.
31, 1991, which is incorporated herein by reference. Hydrophobic polymer surfaces (eg polyurethane and polystyrene) are PEG (MW 3,400)
Modified as a non-thrombogenic surface. In these studies, the surface properties (contact angle) were more consistent with the hydrophilic surface due to the hydration effect of PEG. More importantly, the adsorption of proteins (albumin and other plasma proteins) is greatly reduced, which results from the high chain mobility, hydration spheres and protein exclusion properties of PEG.

PEG (MW 3,4000) is a surface immobilization study (Park et al., J. Biom).
ed. Mat. Res. 26: 739-45, 1992), while PEG (MW 5,000) was the most advantageous in reducing protein antigenicity (FM Veronese et al., JM. Harr
is edition, Poly (Ethylene Glycol) Chemistry ---
Biotechnical and Biomedical Applicat
ions 127-36, supra).

In general, chemical derivatization can be performed under any suitable conditions used to react biologically active agents with activated polymer molecules. PEGylated ChMIr
Methods for preparing p polypeptides generally include the following steps: (a)
Reacting the polypeptide with polyethylene glycol (eg, a reactive ester or aldehyde derivative of PEG) under conditions such that the ChMIrp polypeptide is attached to one or more PEG groups, and (b) obtaining a reaction product. Process. In general, the optimal reaction conditions for the acylation reaction will be determined based on known parameters and the desired result. For example, the higher the PEG: protein ratio, the more poly-
Higher percentage of PEGylated product.

[0225] In a preferred embodiment, the ChMIrp polypeptide derivative has a single PEG moiety at the N-terminus. See U.S. Patent No. 8,234,784, incorporated herein by reference.

[0226] In another embodiment, the ChMIrp polypeptide can be chemically linked to biotin. The biotin / Cdk11 polypeptide molecule can then be bound to avidin, resulting in a tetravalent avidin / biotin / Cdk11 polypeptide molecule. ChMIrp polypeptides also bind to dinitrophenol (DN
P) or trinitrophenol (TNP), and the resulting conjugate is precipitated with anti-DNP or anti-TNP-IgM to form the decavalent decameric conjugate.

In general, conditions that can be alleviated or modulated by administration of a ChMIrp polypeptide derivative of the present invention include those described herein for ChMIrp polypeptides. However, the ChMIrp polypeptide derivatives disclosed herein have further activity, enhanced or decreased biological activity, or other characteristics (eg, increased or decreased) as compared to underivatized molecules. Half-life)
Can have

Microarrays It is clear that DNA microarray technology can be utilized according to the present invention. The DNA microarray is arranged on a solid support (eg glass),
It is a small, high-density array of nucleic acids. Each cell or element in this array is
It has many copies of a single species of DNA, which acts as a target for hybridization to its cognate mRNA. In expression profiling using DNA microarray technology, mRNA is first extracted from a cell or tissue sample and then enzymatically converted to fluorescently labeled cDNA. This material was hybridized to the microarray and unbound c
The DNA is removed by washing. The expression of the discrete genes displayed on the array is then visualized by quantifying the amount of labeled cDNA specifically bound to each target DNA. In this way, expression of thousands of genes can be quantified from a single sample of biological material in a high-throughput, parallel fashion.

This high throughput expression profiling has widespread application for the ChMIrp molecules of the invention. These applications include, but are not limited to: identification and validation of ChMIrp disease-related genes as therapeutic targets; molecular toxicity studies of ChMIrp molecules and their inhibitors; for population stratification and clinical trials. Generation of surrogate markers in Cdk11;

Selective Binding Agents As used herein, the term “selective binding agent” refers to one or more ChMs.
Refers to a molecule that has specificity for an Irp polypeptide. Suitable selective binding agents include, but are not limited to, antibodies and their derivatives, polypeptides, and small molecules. Suitable selective binding agents can be prepared using methods known in the art. Exemplary polypeptide selective binding agents of the invention are ChM
A particular portion of an Irp polypeptide may be bound, thereby inhibiting the activity or function of the ChMIrp polypeptide.

Selective binding agents (eg, antibodies and antibody fragments) that bind ChMIrp polypeptides are within the scope of the invention. Antibodies include polyclonal (including monospecific polyclonal) antibodies, monoclonal antibodies (mAbs), recombinant antibodies, chimeric antibodies, humanized antibodies (eg CDR grafted antibodies), human antibodies, single chain antibodies and / or It can be a bispecific antibody, as well as fragments, variants or derivatives thereof. Antibody fragments include the portion of the antibody that binds to an epitope of ChMIrp polypeptide. Examples of such fragments include Fab fragments and F (ab ') produced by enzymatic cleavage of full length antibodies.
) Fragments. Other binding fragments include fragments purified by recombinant DNA techniques (eg, expression of recombinant plasmids containing nucleic acid sequences encoding antibody variable regions).

Polyclonal antibodies directed against ChMIrp polypeptides are generally produced in animals (eg, rabbits or mice) by multiple subcutaneous or intraperitoneal injections of ChMIrp and an adjuvant. It may be useful to conjugate the ChMIrp polypeptide or a variant, fragment or derivative thereof to a carrier protein, which carrier protein is immunogenic in the immunized species (eg, keyhole limpet hemocyanin. , Serum, albumin, bovine thyroglobulin or soybean trypsin inhibitor)
. Aggregating factors such as alum are also used to enhance the immune response. After immunization, animals are bled and serum is assayed for anti-ChMIrp antibody titer.

Monoclonal antibodies directed against ChMIrp are produced using any method that provides for production of antibody molecules by the passage cell lines in culture. For examples of suitable methods for preparing monoclonal antibodies, see Kohler et al., Na.
hybrid 256: 495-497, 1975 hybridoma method, and Ko.
Zbor, J .; Immunol. 133: 3001, 1984; Brodeur.
Et al., Monoclonal Antibody Production Tec
hnies and Applications 51-63 (Marc
el Dekker, Inc. , New York, 1987).

Hybridoma cell lines producing monoclonal antibodies reactive with ChMIrp polypeptides are also provided by the invention.

The monoclonal antibodies of the invention can be modified for use as therapeutic agents.
One embodiment is a “chimeric” antibody in which some of the heavy and / or light chains are from a particular species or the corresponding sequence in an antibody belonging to a particular antibody class or subclass. And the remainder of the chain is identical or homologous to the corresponding sequence in an antibody from another species or belonging to another antibody class or subclass. .. Fragments of such antibodies are also included so long as they exhibit the desired biological activity (US Pat. No. 4,816,567; Morrison et al., Proc. Nat).
l. Acad. Sci. U. S. A. 81: 6851-6855, 1985 (incorporated herein by reference)).

In another embodiment, the monoclonal antibodies of the invention are "humanized" antibodies. Methods for humanizing non-human antibodies are well known in the art (see US Pat. Nos. 5,585,089 and 5,693,762). Generally, a humanized antibody has one or more amino acid residues introduced into it from a non-human source. Humanization is accomplished by methods described in the art (Jones et al., Nature 321: 522, for example) by replacing at least a portion of the rodent complementarity determining regions (CDRs) with the corresponding regions of a human antibody. -52, 1986;
Riechmann et al., Nature 332: 323-327, 1988; V.
erhoeyen et al., Science 239: 1534-1536, 1988.
).

Fully human antibodies that bind ChMIrp polypeptides, fragments, variants and / or derivatives are also included in the invention. Such antibodies are produced by immunizing with the ChMIrp antigen (ie, having at least 6 contiguous amino acids), optionally conjugated to a carrier. Transgenic animals (eg, mice) that can produce a repertoire of human antibodies in the absence of endogenous immunoglobulin production are used. For example, Jakobovits et al., P.
roc. Natl. Acad. Sci. U. S. A. 90: 2551-2555
, 1993; Jakobovits et al., Nature 362: 255-258.
, 1993; Bruggermann et al., Year in Immuno. 7:
33, 1993. In one method, such transgenic animals are incapable of the endogenous loci encoding the heavy and light chains of immunoglobulins, and the loci encoding human heavy and light chain proteins are It is produced by introducing it into the genome. Partially modified animals (having less than complete complement modifications) are then crossbred to obtain animals with all of the desired immune system modifications. When administered with the immunogen, these transgenic animals produce antibodies with human amino acid sequences (eg, rather than mouse) that contain variable regions that are immunospecific for these antigens. PCT application number PCT / US
See 96/05928 and PCT / US93 / 06926. Further methods are described in US Pat. No. 5,545,807, PCT Application No. PCT / US91 /
245, PCT / GB89 / 01207, and EP546073B1 and EP546073A1. Human antibodies are also produced by expression of recombinant DNA in host cells or expression in hybridoma cells, as described herein.

Human antibodies can also be produced by expression of recombinant DNA in host cells or by expression in hybridoma cells, as described herein. In an alternative embodiment, human antibodies can be generated in phage display libraries (Hoogenboom et al., J. Mol. Biol.
． 227: 381, 1991; Marks et al., J. Am. Mol. Biol. 222:
581, 1991). These processes mimic immune selection by the display of antibody repertoires on the surface of filamentous bacteriophage, followed by selection of phage by their binding to selected antigens. One such technique is PCT Application No. PCT / US98 / 17364, which describes the isolation of high affinity and functional agonist antibodies to MPL- and msk-receptors using such an approach. Yes).

Chimeric, CDR-grafted, and humanized antibodies are typically produced by recombinant methods. Nucleic acids encoding these antibodies are introduced into host cells and expressed using the materials and methods described herein. In a preferred embodiment, the antibody is expressed in mammalian host cells (eg CHO cells). Monoclonal (eg, human) antibodies can be produced by the expression of recombinant DNA in host cells or by the expression in hybridoma cells as described herein.

For diagnostic applications, the anti-ChMIrp antibody will typically be labeled with a detectable moiety. The detectable moiety is any moiety that can produce a detectable signal either directly or indirectly. For example, the detectable moiety is a radioisotope (eg, ³ H, ¹⁴ C, ³² P, ³⁵ S or ¹²⁵ I), a fluorescent compound or a chemiluminescent compound (eg, fluoroscein isothiocyanate, rhodamine or luciferin); or Enzymes (eg alkaline phosphatase, β
-Galactosidase or horseradish peroxidase). Baye
r et al., Meth. Enz. 184: 138-163, 1990.

The anti-ChMIrp antibodies of the invention can be used in any known assay method for detection and quantification of ChMIrp polypeptides, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays (Sola, Monoclonal Antibodies: A Manual
l of Technologies, pp. 147-158 (CRC Press
, Inc. , 1987)). The antibody binds the ChMIrp polypeptide with an affinity suitable for the assay method used.

The activity of cell lysates or purified ChMIrp protein variants is then screened in a suitable screening assay for the desired characteristic. For example, changes in binding affinity for the ligand or immunological characteristics of the ChMIrp protein (eg, affinity for a given antibody) are measured by competitive immunoassays. Changes in immunomodulatory activity are measured by the appropriate assay. Such alterations in protein properties are assayed by methods well known to those skilled in the art as redox or thermostability, hydrophobicity, susceptibility to proteolysis or propensity to aggregate with carriers or proliferate into multimers. Competitive binding assays test sample analytes for binding to limited amounts of anti-ChMIrp antibody (
A labeled standard (eg ChMIrp) that competes with the ChMIrp polypeptide.
rp polypeptide or immunologically reactive portion thereof). The amount of ChMIrp polypeptide in the test sample is inversely proportional to the amount of standard bound to this antibody. To facilitate measurement of the amount of bound standard, the antibody is generally insolubilized before or after competition so that the standards and analytes that bind to the antibody are left unbound standard. And can be easily separated from the analyte.

Sandwich immunoassays typically involve two antibodies (each detected,
And / or different immunogenic parts of the protein to be quantified, capable of binding epitopes). In a sandwich assay, the test sample analyte typically comprises a first antibody immobilized on a solid support, followed by a second antibody bound to the analyte, thus insoluble in three parts. Form a complex that is composed. See, eg, US Pat. No. 4,376,110. Can the second antibody be labeled with a moiety that is itself detectable (eg, direct sandwich assay)
, Or with an anti-immunoglobulin antibody labeled with a detectable moiety (indirect sandwich assay). For example, one type of sandwich assay is an enzyme linked immunosorbent assay (ELISA), where the detectable moiety is an enzyme.

Selective binding agents, including anti-ChMIrp antibodies, are also useful for in vivo imaging. Antibodies labeled with a detectable moiety can be administered to an animal, preferably in the bloodstream, and the presence and location of the labeled antibody in the host assayed. The antibody may be labeled with any moiety detectable in the animal (either by nuclear magnetic resonance, radiology or other detection means known in the art).

Selective binding agents, including anti-ChMIrp antibodies of the invention, can be used as therapeutic agents. These therapeutic antibodies are generally agonists or antagonists, respectively, in that they either enhance or decrease at least one of the biological activities of the ChMIrp polypeptide. In one embodiment, the antagonist antibodies of the invention may specifically bind to ChMIrp polypeptides, fragments, variants and / or derivatives, and inhibit or eliminate functional activity of ChMIrp polypeptides in vivo or in vitro. The resulting antibody or binding fragment thereof. In a preferred embodiment, the antagonist antibody has a functional activity of the ChMIrp polypeptide of at least about 50%, preferably at least about 80%, more preferably 90%, and most preferably 1.
00% inhibition. Agonist anti-ChMIrp antibody and antagonist anti-ChM
The Irp antibody is identified by the screening assay described below.

The present invention also relates to kits comprising ChMIrp selective binding agents (eg, antibodies) and other reagents useful for detecting ChMIrp polypeptide levels in a biological sample. Such reagents may include: secondary activity, detectable label, blocking serum, positive and negative control samples, and detection reagents.

ChMIrp polypeptides can be isolated using the “expression cloning” strategy.
It can be used to clone a ChMIrp binding partner. Radiolabeled ( ¹²⁵ Iodine) ChMIrp Polypeptide or Affinity / Activity Tagged ChM
Irp polypeptides (eg, fusions of Fc portion or alkaline phosphatase) can be used in binding assays to identify cell types or cell lines or tissues that express ChMIrp binding partners. R isolated from such cells or tissues
NA can be converted to cDNA, cloned into a mammalian expression vector, and transfected into mammalian cells such as COS cells or 293 cells to create an expression library. The radiolabeled or tagged ChMIrp polypeptide is then used as an affinity ligand to bind C
A subset of cells in this library expressing the hMIrp binding partner can be identified and isolated. DNA can then be isolated from these cells and transfected into mammalian cells to produce a second expression library. In this second expression library, the percentage of cells expressing the ChMIrp binding partner is several times higher than in the first library. This enrichment process is called Ch
It can be iteratively repeated until a single recombinant clone containing the MIrp binding partner is isolated. Isolation of the ChMIrp receptor is useful for identifying or developing new agonists and antagonists of the ChMIrp polypeptide signaling pathway. Such agonists and antagonists include C
hMIrp binding partner, cyclin, Cdk inhibitor, Cdk cofactor,
Anti-CdkII binding partner antibodies, small molecules or antisense oligonucleotides.

Diagnostic Kits and Reagents The present invention provides ChMIrp polypeptides, fragments thereof, peptides, binding compositions, and fusions thereof in various diagnostic kits and methods for detecting the presence of receptors and / or antibodies or ligands. Contemplate the use of the product. Typically, the kit has compartments containing reagents (eg, binding reagents) that recognize the ChMIrp peptide or gene segment, or one or the other.

Kits for determining the binding affinity of a receptor or test compound for ChMIrp will typically include a receptor test compound; a labeled compound (eg, an antibody having a known binding affinity for this protein); or a ligand. Source (naturally occurring or recombinant) and means for separating free labeled compound from bound labeled compound (eg, solid phase for immobilizing the ligand or its receptor). Including. Once compounds have been screened, compounds having the appropriate binding affinity for the ligand or its receptor are evaluated in a suitable biological assay (well known in the art) to determine that these compounds are ChM
It can be determined whether the receptor can act as an agonist or antagonist of Irp activity. The availability of recombinant receptor polypeptides also provides well-defined standards for calibrating such assays or as positive control samples.

[0250] For example, a preferred kit for determining the concentration of ChMIrp in a sample typically includes a labeled compound having a known binding affinity for the target (eg,
Antibody), the source of the ligand or receptor (naturally occurring or recombinant), and means for separating the bound labeled compound from the free labeled compound (eg, for immobilizing the ligand or receptor). Solid phase). Normal,
A compartment containing reagents and instructions for use or disposal is provided.

Antibodies (including ligand- or receptor-specific antigen binding fragments) or fragments are useful in diagnostic applications to detect the presence of elevated levels of ligand, receptor and / or fragments thereof. Such diagnostic assays may use lysates, live cells, fixed cells, immunofluorescence, cell cultures, body fluids, and further include detection of antigens associated with ligands or receptors in serum and the like. Diagnostic assays may be homogeneous (no separation step between free reagent and antigen complex required) or heterogeneous (requires separation step). There are various commercially available assays including, for example, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA),
Enzyme immunoassay (EIA), enzyme-linked immunoassay technology (enzyme-
multiple immunoassay technique (EM)
IT), substrate-labeled fluorescent immunoassay (SLFIA) and the like. For example, unlabeled antibodies can be used by using a secondary antibody that is labeled and recognizes the primary antibody against the ligand or receptor or specific fragments thereof. Similar assays have also been extensively discussed in the literature (eg Ha
rrow and Lane (1988) Antibodies: A Labo
rally Manual, Cold Spring Harbor Lab
(See, Oratory Press).

Anti-idiotypic antibodies may have similar uses for diagnosing the presence of antibodies to a ligand or receptor and thus diagnosing various abnormal conditions. For example, overproduction of ligands or receptors can result in the production of various immunological reactions that can be diagnostic of abnormal physiological conditions, especially in various inflammatory or allergic conditions.

Frequently, reagents for diagnostic assays are supplied in kits to optimize the sensitivity of the assay. For the present invention, depending on the nature of the assay, the protocol, and the label, either labeled or unlabeled antibody or labeled ligand or receptor, it is provided. It is usually associated with other adducts (eg buffers, stabilizers, materials required for signal generation (eg enzyme substrates, etc.)). Preferably, the kit also contains instructions for proper use and disposal of the contents after use. Typically, the kit has compartments or containers for each useful reagent. Desirably, the reagent is provided as a lyophilized powder, where the reagent can be reconstituted in an aqueous medium that provides the appropriate concentration of reagent for performing the assay.

The aforementioned components of drug screening and diagnostic assays may be used unmodified or modified in various ways. For example, labeling can be achieved by covalently or non-covalently attaching a moiety that directly or indirectly provides a detectable signal. In any of these assays, the ligand, test compound, receptor, or antibody thereto, can be labeled either directly or indirectly. Direct labeling possibilities include the following groups of labels: radiolabels (eg ¹²⁵ I), enzymes such as peroxidase and alkaline phosphatase (US Pat. No. 3,645,090), and fluorescence intensities. A fluorescent label capable of monitoring changes, wavelength shifts or fluorescence polarization (US Pat. No. 3,940,475). Indirect labeling possibilities include the following:
Biotinylation of one component, followed by conjugation to avidin attached to one of the above labeling groups.

There are also many ways to separate bound ligand from free ligand, or to separate free test compound from bound test compound. The ligand or receptor, possibly with a detergent or related lipid, can be immobilized in various matrices and subsequently washed. ELIS is a suitable matrix
Examples include A-plates, filters, and plastics such as beads. Methods of immobilizing ligands or receptors on matrices include, but are not limited to, direct attachment to plastics, use of capture antibodies, chemical coupling, and biotin-avidin. The last step in this approach is to use the antigen /
It may include precipitation of the antibody complex. Other suitable separation techniques include, but are not limited to: Rattle et al., Clin. Chem. , 30: 1
457-1461, 1984, the fluorescent antibody magnetizable particle method, and the dual magnetic particle separation method described in US Pat. No. 4,659,6178, which is incorporated herein by reference.

Methods for linking proteins or their fragments to various labels have been extensively reported in the literature and need not be discussed at length here. Many of these techniques use carbodiimides or active esters to form peptide bonds, reaction of mercapto groups with activated halogens (eg, chloroacetyl) to form thioesters, activated olefins (eg, maleimide), linkages. Including the use of activated carboxyl groups by any of the following: Fusion proteins also find use in these applications.

The nucleic acid molecules of the invention can be used to map the location of the ChMIrp gene or related genes with respect to the chromosome. Mapping can be performed using techniques known in the art (eg, PCR amplification, in situ hybridization, and FIS).
H).

The present invention also provides ChMIrp as part of a diagnostic assay for detecting a disease associated with the presence of a mutated ChMIrp gene or susceptibility to this disease.
Regarding the use of genes. Such diseases are associated with aberrant expression of ChMIrp (eg, abnormal cell proliferation such as tumors and cancer).

Individuals carrying mutations in the human ChMIrp gene can be treated with DN by various techniques.
It can be detected at the A level. Nucleic acids for diagnosis can be obtained from cells of patients such as blood, urine, saliva, tissue biopsies and autopsy materials. The genomic DNA may be used directly for detection or may be enzymatically amplified using PCR before analysis (
Saiki et al., Nature, 324: 163-166, 1986). RNA or cDNA may also be used for the same purpose. As an example, PCR primers complementary to a nucleic acid encoding a ChMIrp polypeptide can be used to identify and analyze ChMIrp mutations. For example, deletions and insertions can be detected by changes in the size of the amplification product as compared to the normal genotype. The point mutation is a radiolabeled ChMIrp RNA or radiolabeled Ch
It can be identified by hybridizing to the MIrp antisense DNA sequence. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.

Genetic testing based on DNA sequence differences can be accomplished by detection of alterations in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished against the fragments on a denaturing formamide gradient gel. Here, the mobility of different DNA fragments is disturbed in the gel at different positions according to their specific melting temperature or partial melting temperature (eg Myers et al., Science, 230: 1242, 1985).
).

Sequence changes at specific positions may also cause nuclease protection assays (eg, RNa
se and S1 protection) or chemical cleavage methods (eg,
Cotton et al., Proc. Natl. Acad. Sci. , USA, 85: 4
397-4401, 1985).

Accordingly, detection of specific DNA sequences can be accomplished by hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes (eg restriction fragment length polymorphism (RFLP)) and Southern blotting of genomic DNA. Can be achieved by such a method.

In addition to more conventional gel electrophoresis and DNA sequencing, mutations also
It can be detected by in situ analysis.

The present invention also relates to diagnostic assays for detecting altered levels of ChMIrp protein in various tissues. Because protein overexpression can detect the presence of or susceptibility to disease (eg, tumors, cerebral malaria and hereditary periodic fever syndrome) as compared to normal control tissue samples. Assays used to detect levels of ChMIrp polypeptides in a sample obtained from a host are well known to those of skill in the art and include: radioimmunoassays, competitive binding assays, western blot analysis, EL.
ISA and "sandwich" assays. ELISA assay (Col
igan et al., Current Protocols in Immunolog.
y, 1 (2), Chapter 6, 1991), in part, involves the preparation of antibodies (preferably monoclonal antibodies) specific for the ChMIrp antigen. In addition, a reporter antibody is prepared against the monoclonal antibody. A detectable reagent (eg, radioactive, fluorescent, or horseradish peroxidase enzyme in this example) is attached to the reporter antibody. Here the sample is taken from the host,
It is then incubated on a solid support (eg polystyrene dish) that binds the proteins in the sample. Any free protein binding sites on this dish are then covered by incubation with a non-specific protein such as bovine serum albumin (BSA). The monoclonal antibody is then incubated in the dish during the time that the monoclonal antibody binds to any ChMIrp protein bound to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase is now placed in the dish,
This results in binding of the reporter antibody to any monoclonal antibody bound to ChMIrp. Unbound reporter antibody is then washed away. The peroxidase substrate is then added to the dish and the amount of color developed at a given time is a measure of the amount of ChMIrp polypeptide present in a given dose of patient sample when compared against a standard curve. Is.

A competition assay may be used wherein antibodies specific for ChMIrp are bound to a solid support and labeled ChMIrp and sample from the host are
The amount of label distributed and detected on the solid support (eg, by liquid scintillation chromatography) can be correlated to the amount of ChMIrp in the sample. In addition, the sandwich immunoassays described above can also be performed to quantify the amount of ChMIrp ligand in a biological sample.

The sequences of the present invention can be evaluated for chromosome identification and mapping. This sequence can be specifically targeted to and hybridized to a particular position on an individual human chromosome. Moreover, there is currently a need to identify specific sites on the chromosome where genes can be located. Chromosome marking reagents based on actual sequence data (repeated polymorphisms) are currently scarcely available for marking chromosomal locations. The mapping of DNA to chromosomes according to the invention is an important first step in correlating sequences with genes associated with disease.

Briefly, the sequence is from cDNA to PCR primers (preferably 15-25
It can be mapped to the chromosome by preparing bp). Computer analysis of the 3'untranslated region of this sequence is used to rapidly select primers that do not span more than one exon in genomic DNA and thus complicate the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only hybrids containing the human gene corresponding to this primer will yield an amplified fragment.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning specific DNA to specific chromosomes. Using the present invention with the same oligonucleotide primers, in a similar fashion, sub-localization can be achieved with a panel of fragments from a particular chromosome or pool of larger genomic clones.
Other mapping strategies that may also be used to map ChMIrp to its chromosomes include: in situ hybridization, flow sorted and labeled fl.
ow-sorted) chromosome pre-screening and chromosome-specific cDNA
Preselection by hybridization to construct A library.

Fluorescent in situ hybridization (FISH) to the metaphase chromosome spreads of the cDNA clones can be used to provide accurate chromosomal location in one step. This technique can be used with cDNAs as short as 500 or 600 bases; however, the likelihood that clones larger than 2,000 bp will bind to unique chromosomal locations with sufficient signal strength for easy detection. Is higher. FISH is
The use of genomic clones or clones from which expressed sequence tags (EST) are derived, and the larger the better. For example, 2,000 bp is preferred, 4,000 bp is more preferred, and more than 4,000 is probably not necessary to get good results in a reasonable percentage of the time. For a review of this technology, see Verma et al., Human Chromosomes: A Manual.
l of Basic Technologies, Pergamon Press
, New York (1988).

Once a sequence has been mapped to a precise chromosomal location, the physical location of this sequence on this chromosome can be correlated with genetic map data. Such data is, for example, V. McKusick, Mendelian Inheritance
e in Man (Johns Hopkins University We
(available online via lch Medical Library). The association between genes and diseases that have been mapped to the same chromosomal region is then analyzed by linkage analysis (coinherience of physically adjacent genes).
stance)).

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If the mutation is observed in some or all of the affected individuals but not in any normal individual, then the mutation is probably the causative agent of the disease.

At the current resolution of physical and genetic mapping techniques, a cDNA precisely located in a chromosomal region associated with this disease is one of the potentially causative factors between 50 and 500. Can be one. (This assumes 1 megabase mapping resolution and 1 gene per 20 kb).

The nucleic acid molecules of the invention are also useful as antisense inhibitors of ChMIrp expression. Such inhibition may be due to expression control sequences (triple helix formation) or C
It can be provided by a nucleic acid molecule that is complementary to and hybridizes to the hMIrp mRNA. The antisense probe is a ChMIr disclosed herein.
The p sequence can be used to design by available techniques. Antisense inhibitors provide information associated with the reduction or absence of ChMIrp polypeptides in cells or organisms.

The nucleic acid molecules of the invention can be used in gene therapy. Nucleic acid molecules expressing ChMIrp in vivo provide information relevant to the effect of this polypeptide in cells or organisms. ChMIrp nucleic acid molecules, fragments, and / or derivatives that do not encode biologically active polypeptides by themselves, either qualitatively or quantitatively, contain ChMIrp in mammalian tissue or body fluid samples.
It may be useful as a hybridization probe in a diagnostic assay to test for the presence of DNA or the corresponding RNA.

ChMIrp polypeptide fragments, variants, and / or derivatives are
It is useful for preparing antibodies that bind to ChMIrp polypeptides, whether biologically active or not. The antibody may be used for in vivo and in vitro diagnostic purposes (eg, in labeled form to detect the presence of ChMIrp polypeptides in body fluids or cell samples). This antibody is ChMI
Ch to reduce or block at least one active characteristic of the rp polypeptide.
It may bind to the MIrp polypeptide or may bind to the polypeptide so as to increase its activity.

Genetically Engineered Non-Human Animals Non-human animals such as mice, rats, or other rodents, rabbits, goats, sheep, or other domestic animals are also within the scope of the invention. Included, wherein the gene encodes a ChMIrp polypeptide, either the native form of the gene of the mammal or the heterologous ChMIrp polypeptide gene is overexpressed by the mammal, and thus "trans A "genic" mammal is produced. Such transgenic mammals can be prepared using well known methods such as those described in US Pat. No. 5,489,743 and PCT Publication No. WO94 / 28122.

Non-human animals such as mice, rats, or other rodents, rabbits, goats, sheep, or other farm animals are further included within the scope of the invention, wherein the native ChMIrp polypeptide. The gene coding for is disrupted (“knockout”) and the expression level of this gene is significantly reduced or completely abolished.
Such mammals can be prepared using the techniques and methods as described in US Pat. No. 5,557,032, incorporated herein by reference.

The present invention further includes non-human animals, wherein the promoter for one or more of the ChMIrp polypeptides of the present invention is (using homologous recombination methods as described below. Either) or is inactivated, altering the level of expression of one or more of the native ChMIrp polypeptides.

These non-human animals can be used for screening drug candidates.
The effect of this drug candidate in animals can be measured. For example, the drug candidate is C
Expression of the hMIrp polypeptide gene may be decreased or increased. In certain embodiments, the amount of ChMIrp polypeptide or fragment produced is
It can be measured after exposing a mammal to the drug candidate. In certain embodiments, the actual effect of a drug candidate on a mammal may be detected. For example, overexpression of a particular gene can result in or be associated with a disease or pathological condition. In such cases, the ability of the drug candidate to reduce the expression of this gene or its ability to prevent or inhibit a pathological condition may be tested. In another example, the production of a particular metabolite, such as a fragment of a polypeptide,
A disease or pathological condition can result or be associated therewith. In such cases, one may test the drug candidate's ability to reduce the production of such metabolites or its ability to prevent or inhibit a pathological condition.

Internalization Proteins TAT protein sequences (from HIV) can be used to internalize proteins into cells by targeting the lipid bilayer component of cell membranes.
For example, Falwell et al., Proc. Natl. Acad. Sci. 91: 6
See 64-668, 1994. For example, one of the HIV TAT proteins
The one amino acid sequence (YGRKKRRQRRR; SEQ ID NO: 16) (referred to as the "protein transduction domain", or TAT PDT) is used to identify the cytoplasmic membrane and nuclear of the cytoplasmic membrane of large bioactive proteins such as β-galactosidase and p27Kip. Shown to mediate delivery across a membrane. Schwarze et al., Sc
ience 285: 1569-1572, 1999; and Nagahara.
Et al., Nature Medicine, 4: 1449-1452, 1998. Schwartze et al. (Science, 285: 1569-72,
1999) demonstrated that cultured cells acquired β-gal activity when exposed to a fusion of TAT PDT and β-galactosidase. Injection of the TAT-β-gal fusion protein into mice has been demonstrated in many tissues (liver, kidney, lung,
(Including heart and brain tissue) results in expression of β-gal.

Thus, it is understood that TAT protein sequences can be used to internalize a desired protein or polypeptide into cells. In the context of the present invention, this TAT protein sequence may be fused to another molecule such as a ChMIrp antagonist (ie an anti-ChMIrp selective binding agent or small molecule),
It can then be administered intracellularly to inhibit the activity of ChMIrp molecules. If desired, the ChMIrp protein itself, or a peptide fragment or modified form of ChMIrp, can be fused to such a protein transducer for administration to cells using the procedures described above.

Assays for Other Modulators of ChMIrp Polypeptide Activity In some situations, it may be desirable to identify molecules (ie, agonists or antagonists) that are modulators of ChMIrp polypeptide activity. Natural or synthetic molecules that regulate ChMIrp can be identified using one or more of the screening assays described below. Such molecules can be administered by either local or intravenous (iv) injection, or by oral delivery, implantation devices, etc., in either an in vivo or in vitro manner. "Test molecule"
Refers to a molecule that is being evaluated for its ability to bind to a ChMIrp polypeptide and thereby modulate its activity. The test molecule has a ChMI with an affinity constant of at least about 10 ⁻⁶ M, preferably about 10 ⁻⁸ M, more preferably about 10 ⁻⁹ M, and even more preferably about 10 ⁻¹⁰ M.
It binds to the rp polypeptide.

Methods for identifying compounds that interact with ChMIrp polypeptides are encompassed by the invention. Generally, a ChMIrp polypeptide is a test molecule of ChMIrp.
It is incubated with the test molecule under conditions that allow binding to the rp polypeptide and the extent of binding is measured. The test molecule can be screened in a substantially purified form or crude mixture. Test molecules can be nucleic acid molecules, proteins, peptides, carbohydrates, lipids, or low molecular weight organic or inorganic compounds. Once a set of test molecules is identified as binding to a ChMIrp polypeptide, the molecule can be further evaluated for its ability to increase or decrease ChMIrp activity.

Measuring the interaction of a test molecule with a ChMIrp polypeptide can be performed in several forms, including cell-based binding assays, membrane binding assays, solution phase assays, and immunoassays. . Generally, the test molecule has a specific period C
Incubated with hMIrp polypeptide and the extent of binding to ChMIrp polypeptide was determined by filtration, electrochemiluminescence (ECL by IGEN, ORI.
GEN system), cell-based assays or immunoassays.

Homogeneous assay techniques for radioactivity (SPA; Amersham) and time resolved fluorescence (HTRF, Packard) are also performed. The bond is a radioisotope ( ¹²⁵ I, ³⁵ S, ³ H), a fluorescent dye (fluorescein), a lanthanide (
For example, it can be detected by labeling with europium (Eu ³⁺ ) chelator or cryptate), or bipyridyl-ruthenium (Ru ²⁺ ) complex. It will be appreciated that the choice of labeled probe will depend on the detection system used.
Alternatively, the ChMIrp polypeptide can be modified with an unlabeled epitope tag (eg, biotin, peptide, His6, myc, Fc), and a protein with a detectable label as described above (eg, streptavidin, anti-antibody). Peptide or anti-protein antibody).

Interactions of test molecules with ChMIrp polypeptides can also be directly assayed using polyclonal or monoclonal antibodies in immunoassays. Alternatively, modified forms of ChMIrp polypeptides containing an epitope tag as described above can be used in solution and in immunoassays.

In one embodiment, ChMIrp agonists or antagonists can be proteins, peptides, carbohydrates, lipids, or low molecular weight molecules, which interact with ChMIrp to regulate its activity. Potential protein antagonists of ChMIrp include antibodies that bind to the active region of the polypeptide and inhibit or eliminate at least one activity of ChMIrp. A molecule that regulates expression of a ChMIrp polypeptide is complementary to a nucleic acid that encodes a ChMIrp polypeptide, or a nucleic acid molecule that is complementary to a nucleic acid sequence that directs or controls the expression of the polypeptide, and It may include nucleic acid molecules that act as antisense regulators.

In cases where a ChMIrp polypeptide exhibits biological activity via interaction with a binding partner (eg, receptor or ligand), various assays will bind the ChMIrp polypeptide to its corresponding binding partner. Can be used to measure These assays rely on ChMI for its binding partner.
It can be used to screen test molecules for their ability to increase or decrease the rate and / or extent of binding of rp polypeptides. In one assay, ChMIrp polypeptides are immobilized by attachment to the bottom of the wells of a microtiter plate. Radiolabeled ChMIrp binding partners (eg, iodinated ChMIrp binding partners) and test molecules can then be added to the wells either individually (in either order) or simultaneously. After incubation, the wells can be washed and counted for radioactivity using a scintillation counter to determine the extent to which the binding partner binds the ChMIrp polypeptide. Typically, molecules are tested over a range of concentrations, and a series of control wells lacking one or more elements of the test assay can be used for the accuracy of assessing the results. An alternative to this method is to reverse the "location" of the protein (ie immobilize the ChMIrp polypeptide binding partner in the wells of a microtiter plate, incubate the test molecule with radiolabeled ChMIrp polypeptide, and Determining the degree of binding) (eg Ausub)
el et al., Current Protocols in Molecular
Biology, John Wiley & Sons, New York, NY,
(See Chapter 18 of 1995).

As an alternative to radiolabelling, the ChMIrp polypeptide or its binding partner can be conjugated with biotin and then the presence of the biotinylated protein can be detected by an enzyme such as horseradish peroxidase (HRP) or alkaline phosphatase. (AP)), which can be detected colorimetrically, using streptavidin or can be detected by fluorescent tagging of streptavidin. ChMIrp polypeptide or ChMIr
Antibodies directed against p-binding partners and conjugated with biotin can also be used, and this can be detected after incubation with enzyme-linked streptavidin linked to AP or HRP.

ChMIrp polypeptides and ChMIrp binding partners can also be immobilized by attachment to agarose beads, acrylic beads, or other types of such inert substrates. The substrate-protein complex can be placed in a solution containing a complementary protein and a test compound; after incubation, these beads can be precipitated by centrifugation and binding between the ChMIrp polypeptide and its binding partner. Can be assessed using the method described above. Alternatively,
The substrate-protein complex can be immobilized in a column, and the test molecule and complementary protein pass through the column. The formation of a complex between the ChMIrp polypeptide and its binding partner can then be assessed using any of the techniques described above (ie, radiolabelling, antibody binding, etc.).

Another in vitro assay useful for identifying test molecules that increase or decrease the formation of a complex between a ChMIrp binding protein and a ChMIrp binding partner is the Surface Plasmon Resonance Detector system (eg, Biacore assay system). (Pharmacia, Piscataway, NJ)). The Biacore system can be implemented using manufacturer's procedures. This assay essentially consists of a sensor chip coated with dextran, either ChMIrp or ChMIrp binding partner, which is located in the detector.
Involved in covalent binding to. The test compound and other complementary proteins can then be injected, either simultaneously or sequentially, into the chamber containing the sensor chip and the amount of complementary protein binding to each other determined by the dextran coated side of the sensor chip. Can be evaluated based on the change in mass of the molecule physically related to the change in mass of this molecule is measured by the detector system.

In some cases, it may be desirable to evaluate two or more test compounds together for their ability to increase or decrease the formation of a complex between a ChMIrp polypeptide and a ChMIrp binding partner complex. Can be done. In these cases, the assay described above may be readily modified by the addition of such additional test compounds, either concomitantly with or subsequent to the first test compound. The rest of the steps in this assay are as described above.

In vitro assays, such as the assay described above, were performed using ChMIrp and ChMIrp.
It can be advantageously used to rapidly screen large numbers of compounds for effects on complex formation by binding partners. These assays can be automated to screen compounds produced in phage display, synthetic peptides, and chemically synthesized libraries.

Compounds that increase or decrease the formation of complexes between ChMIrp polypeptides and ChMIrp binding partners can also be used in cell culture using cells and cell lines expressing either ChMIrp or ChMIrp binding partners. Can be screened. The cells and cell lines can be obtained from any mammal, but are preferably derived from human or other primate, canine or rodent sources. ChM to cells expressing a ChMIrp binding partner on its surface
Irp polypeptide binding is assessed in the presence or absence of test compound, and the extent of binding can be determined, for example, by flow cytometry using biotinylated antibodies to ChMIrp binding partners. Cell culture assays can be advantageously used to further evaluate compounds that score positive in the protein binding assays described above.

Cell cultures can also be used to screen the effects of drug candidates. For example, the drug candidate may reduce or increase expression of the ChMIrp polypeptide gene. In certain embodiments, the amount of ChMIrp polypeptide or fragment produced can be measured after exposure of the cell culture to the drug candidate.
In certain embodiments, the actual effect of a drug candidate on cell culture can be detected. For example, overexpression of a particular gene can have a particular effect on cell culture. In such cases, the ability of the drug candidate to increase or decrease expression of this gene, or its ability to prevent or inhibit a particular effect on cell culture, can be tested. In other examples, the production of specific metabolites (eg, fragments of polypeptides) can result in or be associated with a disease or pathological condition. In such cases, the ability of drug candidates to reduce the production of such metabolites in cell culture can be tested.

Yeast two-hybrid system (Chien et al., Proc. Natl. Acad. S
ci. USA, 88: 9578-9583, 1991) can be used to identify novel polypeptides that bind to or interact with ChMIrp polypeptides. As an example, a yeast two-hybrid bite construct can be generated in a vector such as pAS2-1 from Clontech, which encodes the yeast GAL4-DNA binding domain fused to a ChMIrp polynucleotide. This bait construct can be used to screen a human cDNA library, where the sequence of this cDNA library is GA
Fuse to the L4 activation domain. Positive interaction results in activation of a reporter gene such as β-Gal. Positive clones resulting from the screen can be further characterized to identify interacting proteins.

Composition and Administration of ChMIrp Polypeptides Members of the chondromodulin family are known to induce chondrogenesis and bone growth. Furthermore, these proteins have been suggested to be inhibitors of angiogenesis. Angiogenesis mediates many pathological conditions.
These described biological activities suggest possible therapeutic uses for the administration of chondromodulin.

Pharmaceutical compositions of ChMIrp polypeptides provide reduced levels of ChMIrp.
It is within the scope of this invention if it is determined that administration of a ChMIrp polypeptide results in prophylactic and therapeutic treatment of humans and animals for the indication resulting from p, or amelioration or cure of that indication. Such compositions comprise a therapeutically effective amount of a ChMIrp polypeptide and / or its binding partner, or a therapeutically active fragment, variant or derivative thereof, mixed with a pharmaceutically acceptable additive and / or carrier. May be included. Suitable formulation materials or pharmaceutically acceptable agents include, but are not limited to, antioxidants, preservatives, colorants, flavoring agents, diluents, emulsifiers, suspending agents, Solvents, fillers, fillers, buffers, delivery vehicles, diluents, excipients and / or pharmaceutical adjuvants. Typically, a therapeutic compound comprising a ChMIrp polypeptide is a composition comprising a purified polypeptide, fragment, variant or derivative together with one or more physiologically acceptable carriers, excipients or diluents. It is administered in the form of a product. For example, a suitable vehicle may be water for injection, physiological solution, or artificial cerebrospinal fluid, which may be supplemented with other substances common in compositions for parenteral delivery. .

[0299] Neutral buffered saline, or saline mixed with serum albumin, is an exemplary suitable carrier. Preferably the product is formulated as a lyophilizate with appropriate excipients (eg sucrose). Other standard carriers,
Diluents and excipients can be included if desired. Other exemplary compositions include Tris buffer of about pH 7.0-8.5 or acetate buffer of about pH 4.0-5.5, which further comprises sorbitol or a suitable substitute thereof. May include things. The pH of the solution should also be chosen based on the relative solubility of the ChMIrp ligand at various pHs.

The primary solvent in the composition may be either aqueous or non-aqueous in nature. In addition, the vehicle may be used in other formulations for modifying or maintaining the pH, osmolality, viscosity, clarity, color, sterility, stability, isotonicity, dissolution rate, or odor of a formulation. Materials may be included. Similarly, the composition may include additional formulation materials to modify or maintain the release rate of the ChMIrp polypeptide or to enhance absorption or penetration of the ChMIrp polypeptide.

Compositions including ChMIrp polypeptide compositions can be administered parenterally.
Alternatively, the composition may be administered intravenously or subcutaneously. When administered systemically, therapeutic compositions for use in the present invention can be in the form of a pyrogen-free, parenterally acceptable aqueous solution. The preparation of such pharmaceutically acceptable protein solutions is within the skill of the art, with due regard to pH, isotonicity, stability and the like.

Therapeutic formulations of ChMIrp polypeptide compositions useful in practicing the present invention include any physiologically acceptable carrier, excipient or stabilizer (Reming).
ton's Pharmaceutical Sciences, 18th Edition, A
． R. Gennaro, ed., Mack Publishing Company
, 1990) with selected compositions having the desired degree of purity, and can be prepared for storage in the form of lyophilized cakes or aqueous solutions.

Acceptable carriers, excipients or stabilizers are non-toxic to recipients and are preferably inert at the dosages and concentrations employed.
And include: buffers (eg, phosphates, citrates, or other organic acids); antioxidants (eg, ascorbic acid); low molecular weight polypeptides; proteins (eg, serum albumin, gelatin or Immunoglobulins); hydrophilic polymers (eg polyvinylpyrrolidone); amino acids (eg glycine, glutamine, asparagine, arginine or lysine); monosaccharides, disaccharides and other carbohydrates (including glucose, mannose, or dextrin); chelating agents. (Eg EDTA); sugar alcohols (eg mannitol or sorbitol); salt forming counterions (eg sodium); and / or nonionic surface active agents (eg Tween, pluronic or polyethylene glycol (eg. EG)).

An effective amount of a ChMIrp polypeptide composition used therapeutically is, for example, for therapeutic purposes (eg, indication for which the composition is used, route of administration (eg, locally or systemically)). , And the condition of the patient (eg, the general health of the patient, an aureuesis, age, weight, sex). The amount of ChMIrp or other members of the secreted chondromodulin family responsible for this disease and the endogenous ChM when determining a therapeutically effective dose
It is essential to consider the amount of Irp. Accordingly, the therapist will need to titer the dosage and / or modify the route of administration in vivo as needed to obtain the optimal therapeutic effect. A typical daily dosage might range from about 0.1 mg / kg to 100 mg / kg or more, depending on the factors mentioned above. Typically,
The clinician will administer the composition until a dosage is reached that achieves the desired effect. Therefore, the composition may be administered as a single dose or in two or more doses over time (which
With or without the same amount of ChMIrp polypeptide) or as a continuous infusion through an implantation device or catheter.

The frequency of dosing depends on the pharmacokinetic parameters of the ChMIrp molecule in the formulation used. Typically, the clinician will administer the composition until a dosage is reached that achieves the desired effect. Therefore, the composition may be administered as a single dose, or in two or more doses over time, which may or may not contain the same amount of the desired molecule, or continuously via an implantation device or catheter. It can be administered as an infusion. Further refinement of the appropriate dosage is routinely made by those of ordinary skill in the art and is within the ambit of tasks routinely performed by those of ordinary skill in the art. Appropriate dosages can be ascertained through the use of appropriate dose response data.

The more studies are conducted, the more information will be revealed on the appropriate dosage levels for the treatment of different conditions in different patients, and the person skilled in the art will be aware of the therapeutic situation, the type of disorder being treated. , The recipient's age and general health may be considered to ensure proper dosing.

ChMIrp polypeptide compositions used for in vivo administration must be sterile. This is easily accomplished by filtration through a sterile filtration membrane. When the composition is lyophilized, sterilization using these methods can occur either before or after lyophilization and reconstitution. Compositions for parenteral administration are usually stored in lyophilized form or in solution.

Therapeutic compositions generally include containers with sterile access ports (eg, intravenous solution bags or vials with stoppers pierceable by a hypodermic injection needle).
Can be put inside.

Effective dosage forms (eg, (1) slow-release formulations, (
2) inhalant mists or (3) orally active formulations) are also envisaged. Pharmaceutical compositions containing therapeutically effective doses of ChMIrp polypeptides can also be formulated for parenteral administration. Such parenterally-administered therapeutic compositions are typically in the form of a pyrogen-free, parenterally acceptable aqueous solution containing ChMIrp in a pharmaceutically acceptable vehicle. ChMIr
The pharmaceutical composition of p may also include the introduction of ChMIrp into particulate preparations or liposomes of polymeric compounds such as polylactic acid, polyglycolic acid and the like.
Hyaluronic acid may also be used, and this may have the effect of promoting duration in the circulation.

A particularly suitable vehicle for parenteral injection is sterile distilled water, properly preserved, in which ChMIrp is formulated as a sterile, isotonic solution. Yet another preparation provides a controlled or sustained release of the protein product, which can then be delivered as a depot injection (eg, injectable microspheres, bio-erodible particles or Formulations of ChMIrp with beads, or liposomes) can be included. Other suitable means for introduction of ChMIrp include implantable drug delivery devices that include ChMIrp and / or its binding partners.

The preparations of the present invention may be formulated with other ingredients (eg, parenterally acceptable preservatives, tonicity agents, cosolvents, wetting agents, complexing agents, as is well known in the art). , Buffers, antibacterial agents, antioxidants and surfactants). For example, suitable tonicity enhancing agents include alkali metal halides (preferably sodium chloride or potassium chloride), mannitol, sorbitol and the like. Suitable preservatives include, but are not limited to, benzalkonium chloride, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid and the like. Hydrogen peroxide can also be used as a preservative. Suitable cosolvents are, for example, glycerin, propylene glycol and polyethylene glycol. Suitable complexing agents are, for example, caffeine, polyvinylpyrrolidone, β-cyclodextrin or hydroxypropyl-β-cyclodextrin. Suitable surfactants or wetting agents include sorbitan esters, polysorbates (eg,
Examples thereof include polysorbate 80), tromethamine, lecithin, cholesterol, tyloxapol and the like. Buffering agents include conventional buffering agents such as borate, citrate, phosphate, bicarbonate or Tris-H.
Cl).

The formulation components are present in concentrations that are acceptable to the site of administration. For example, a buffer may bring the composition to a physiological pH or to a slightly lower pH (typically about 5 to about 8).
(In the pH range of).

When intended for parenteral administration, therapeutic compositions for use in the present invention include a desired ChMIrp molecule in a pharmaceutically acceptable vehicle, pyrogen-free, parenterally. It may be in the form of an aqueous solution that is receptive to water. A particularly suitable vehicle for parenteral injection is sterile distilled water, stored properly, where ChMI
The rp molecule is formulated as a sterile, isotonic solution. Yet another preparation provides a controlled or sustained release of the product, which can then be delivered via depot injection (eg, injectable microspheres, bioerodible particles, polymeric compounds ( Polylactic acid or polyglycolic acid) or beads or liposomes) together with a formulation of the desired molecule. Hyaluronic acid may also be used, and this may have the effect of promoting duration in the circulation. Other suitable means for introduction of the desired molecule include implantable drug delivery devices.

In one embodiment, the pharmaceutical composition may be formulated for inhalation. For example, the ChMIrp molecule can be formulated as a dry powder for inhalation. ChMI
Inhalation solutions of rp polypeptides or ChMIrp nucleic acid molecules can also be formulated with propellants for aerosol delivery. In yet another embodiment, the solution may be nebulized. Pulmonary administration is further described in PCT application No. PCT / US94 / 00187.
No. 5 is described. PCT application No. PCT / US94 / 001875 described pulmonary delivery of chemically modified proteins.

It is also contemplated that certain formulations containing ChMIrp may be administered orally.
In one embodiment of the invention, ChMIrp molecules administered in this manner may be formulated with or without carriers customarily used in admixtures of solid dosage forms such as tablets and capsules. For example, a capsule may release the active portion of the formulation at some point in the gastrointestinal tract, where bioavailability is maximized and pre-systemic degradation is minimized. Can be designed. Additional agents may be included to facilitate absorption of ChMIrp molecules. Diluent, flavoring agent, low melting wax, vegetable oil, lubricant,
Suspending agents, tablet disintegrating agents and binders may also be used.

Another pharmaceutical composition may comprise an effective amount of ChMIrp molecules in admixture with non-toxic excipients that are suitable for the manufacture of tablets. Solutions can be prepared in unit dose form by dissolving the tablet in sterile water, or other appropriate vehicle. Suitable excipients include inert diluents (eg calcium carbonate, sodium carbonate or sodium bicarbonate, lactose or calcium phosphate); or binders (eg starch, gelatin or acacia); or lubricants (eg Magnesium stearate, stearic acid or talc), but is not limited thereto.

Additional ChMIrp pharmaceutical compositions will be apparent to those of skill in the art, including formulations that include ChMIrp polypeptides in sustained or controlled delivery formulations. Techniques for formulating a variety of other sustained or controlled delivery means, such as liposome carriers, bioerodible microparticles or porous beads and depot injections, are also known to those of skill in the art. For example, PCT Application No. PCT / US93 / 008, which describes controlled release porous polymeric microparticles for delivery of pharmaceutical compositions.
See No. 29.

Once the pharmaceutical composition is formulated, it can be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dry or lyophilized powder. Such formulations may be stored either in a ready-to-use form or in a form that requires reconstitution prior to administration (eg, lyophilized).

In a particular embodiment, the invention relates to a kit for producing a single dose dosage unit. The kit may each include both a first container having the desired protein and a second container having the aqueous formulation. Also within the scope of the present invention are kits that include single-chamber and multi-chamber pre-filled syringes (eg, liquid syringes and lyosyringes).

Regardless of the mode of administration, a particular dose is calculated according to organ weight, surface area or size. Further refinement of the calculations necessary to determine the appropriate dosage for treatment containing each of the above formulations is within the skill of the art and routine work performed by those of ordinary skill in the art. Appropriate dosages can be determined by the use of appropriate dose response data.

The route of administration of the pharmaceutical composition can be determined by known methods (eg, oral, intravenous, intraperitoneal,
Through injection by intracerebral (intraparenchymal), intracerebroventricular, intramuscular, intraocular, intraarterial or intralesional routes, or by sustained release systems, or by implantation devices, which optionally include the use of catheters. Obey))). If desired, the composition may be administered by bolus injection, or continuously by infusion, or by implantation device. Alternatively, or in addition, the composition comprises ChMIrp
It can be administered locally via implantation of a membrane, a sponge or another suitable material in which the polypeptide is absorbed, into the affected area.

The pharmaceutical compositions of this invention may be further administered by pulmonary administration. See, for example, International Publication No. WO 94/20069. International Publication No. WO 94/2006
No. 9 discloses chemically modified protein pulmonary delivery. For pulmonary delivery, the particle size should be suitable for delivery distal to the lung. For example, the size of the particles can be from 1 mm to 5 mm, but larger particles can be used, for example, if each particle is fairly porous. Alternatively, or in addition, the composition may be administered locally to the affected area via implantation of a membrane, sponge or other suitable material onto which the receptor polypeptide has been absorbed or encapsulated. If an implantation device is used, the device may be implanted in any suitable tissue or organ and delivery may be via a bolus or via continuous administration or via a catheter with continuous infusion. It can be direct through the device.

ChMIrp-ligand polypeptides and / or their binding partners can also be administered in sustained release formulations or preparations. Suitable polymer compositions preferably have inherent and controllable biodegradability due to: lasting from about 1 week to about 6 weeks; containing no significant toxic monomers and into non-toxic components. Non-degradable, non-toxic; biocompatible, chemically compatible with the substance to be delivered and does not tend to denature the active substance; uptake of biologically active molecules, Sufficiently porous to allow their release from the polymer by subsequent diffusion, corrosion or a combination thereof; adhesion or geometrical action (
It may remain at the application site due to geometric function (eg,
Formed or softened in place, and then shaped and formed into microparticles, which are captured at the desired location); by minimally invasive techniques (eg, catheter, laparoscopic or endoscopic) Can be delivered (by a mirror). Sustained release matrices include polyesters, hydrogels, polylactides (US Pat. No. 3,7,7).
73,919, EP 58,481), L-glutamic acid and γ-ethyl-L-.
Copolymers with glutamate (Sidman et al., Biopolymers, 22
: 547-556, 1983), poly (2-hydroxyethyl-methacrylate) (Langer et al., J. Biomed. Mater. Res., 15: 167.
-277, 1981 and Langer, Chem. Tech. , 12: 98-
105, 1982), ethylene vinyl acetate (Langer et al., Supra) or poly-D (-)-3-hydroxybutyric acid (EP 133,988). Sustained release compositions may also include liposomes. Liposomes can be prepared by any of several methods known in the art (eg, Eppstein et al., Pro.
c. Natl. Acad. Sci. USA, 82: 3688-3692,198.
5; EP 36,676; EP 88,046; EP 143,949).

ChMIrp polypeptides, variants, derivatives or fragments thereof can be used alone, together, or with other pharmaceutical compositions, or in combination. ChMIrp polypeptides, fragments, variants and derivatives may be used in combination with cytokines, cytokine inhibitors, growth factors, antibiotics, anti-inflammatory and / or chemotherapeutic agents where appropriate for the indication being treated.

In some cases, it may be desirable to use pharmaceutical compositions of ChMIrp in an ex vivo manner. In such cases, cells, tissues or organs removed from the patient are exposed to the pharmaceutical composition of ChMIrp, which cells, tissues and / or organs are subsequently subsequently transplanted back into the patient.

In other cases, the ChMIrp polypeptide is transplanted by genetically engineered specific cells using the methods as described herein to express and secrete the polypeptide. Can be delivered. Such cells can be animal cells or human cells and can be autologous, heterologous or xenogeneic. If desired, the cells can be immortalized. To reduce the chance of immunological response, the cells can be encapsulated to avoid penetration of surrounding tissues. The encapsulating material is typically a biocompatible, semipermeable polymeric encapsulation or membrane, which allows the release of the protein product, but is dependent on other deleterious factors from the patient's immune system or surrounding tissues. To prevent cell collapse).

The methods used for membrane encapsulation of cells are familiar to those skilled in the art, and the preparation of encapsulated cells and their implantation into patients can be accomplished without undue experimentation (eg, US Patent Nos. 4,892,538; 5,011,472;
And No. 5,106,627). A system for encapsulating viable cells is described in International Application No. WO 91/10425. Techniques for formulating a variety of other sustained or controlled delivery means (eg, liposome carriers, bioerodible particles or beads) are also known to those of skill in the art, and include, for example:
Described in US Pat. No. 5,653,975. The cells, with or without encapsulation, can be transplanted into a suitable body tissue or organ of the patient.

Treating an isolated cell population (eg, stem cells, lymphocytes, erythrocytes, chondrocytes, neurons, etc.) as described above; as appropriate, one or more ChMI.
It may be desirable to add rp polypeptides, variants, derivatives and / or fragments. This can be accomplished by directly exposing the isolated cells to a polypeptide, variant, derivative, or fragment, where they are in a permeable form to the cell membrane.

Further embodiments herein include cells and methods (eg, homologous recombination and / or homologous recombination and / or) involving both in vitro production of therapeutic polypeptides and production and delivery of therapeutic polypeptides by gene therapy or cell therapy. Other recombinant production methods)
Regarding

Homologous Recombination ChMIrp polypeptides can be produced by homologous recombination or using recombinant production methods that utilize control elements introduced into cells that already contain DNA encoding the ChMIrp polypeptide. Is further envisioned. For example, homologous recombination methods can be used to modify cells that contain a normally transcriptionally silent ChMIrp gene (ie, a gene whose expression is suppressed), and thereby express a therapeutically effective amount of ChMIrp. Cells are produced. Homologous recombination was originally a technique developed to target genes to induce or correct mutations in transcriptionally active genes (Kucherla).
pati et al., 1989, Prog. in Nucl. Acid Res. & M
ol. Biol. 36: 301). Because basic techniques introduce specific mutations into specific regions of the mammalian genome (Thomas et al., 1986, Cell 44:
419-428; Thomas and Capecchi, 1987, Cell.
51: 503-512; Doetschman et al., 1988, Proc. Nat
l. Acad. Sci. U. S. A. 85: 8583-8587), or to correct specific mutations in the defective gene (Doetschman et al., 1987).
, Nature 330: 576-578). Exemplary homologous recombination techniques are described in US Pat. No. 5,272,071; EP 9190.
No. 3051; European Publication No. 505 500; PCT / US90 / 0764
2; International Publication No. WO 91/09955).

The DNA sequence inserted into the genome by homologous recombination is
Can be directed to a particular region of the gene of interest. This targeting DNA is a nucleotide sequence that is complementary (homologous) to a region of genomic DNA. A small piece of targeting DNA complementary to a specific region of the genome is DN
During the A replication process, it is contacted with the parent strand. This is a general property of DNA that has been inserted into cells to hybridize and therefore recombines with other fragments of endogenous DNA via shared regions of homology. If this complementary strand is attached to an oligonucleotide containing a mutated or different sequence or additional nucleotides, it will also be incorporated into the newly synthesized strand as a result of this recombination. As a result of the proofreading function, new sequences of DNA can act as templates. Therefore, the transferred DNA is integrated into the genome.

D capable of interacting with or controlling the expression of ChMIrp polypeptides
Regions of NA (eg, flanking sequences) are attached to these fragments of targeting DNA. For example, a promoter / enhancer element, suppressor, or exogenous transcriptional regulatory element is sufficient to affect the transcription of this DNA in the vicinity of the DNA encoding the desired ChMIrp polypeptide in the genome of the intended host cell. Inserted in different orientations. The regulatory element is D present in this host cell genome.
Controls part of NA. Thus, expression of the desired ChMIrp polypeptide is C
Targeted DNA linked to a DNA regulatory segment that provides an endogenous gene sequence with a recognizable signal for transcription of the ChMIrp gene, but not by transfection of the DNA encoding the hMIrp gene itself (the endogenous gene of interest (Including regions of homology).

In an exemplary method, expression of a desired target gene (ie, a desired endogenous cellular gene) in a cell is regulated by homologous recombination into the cell genome at a preselected site, at least a regulatory sequence, It is modified by the introduction of DNA containing exons and splice donor sites. These components are introduced into chromosomal (genomic) DNA in such a way that they actually result in the production of new transcription units (where the regulatory sequences, exons, and splice donor sites present in the DNA construct are Operably linked to an endogenous gene). The introduction of these components into chromosomal DNA results in altered expression of the desired endogenous gene.

As described herein, altered gene expression may result in activation (or expression) of the normally silent (unexpressed) gene in the cell when obtained, as well as in Increased expression of genes that are not expressed at physiologically significant levels in cells when exposed. This embodiment further comprises the step of altering the pattern of regulation or induction so that it differs from the pattern of regulation or induction that occurs in the cells when obtained and in the cells when obtained. Reduce (including eliminate) expression of the expressed gene.

One way in which homologous recombination can be used to increase or cause the production of ChMIrp polypeptides from the cell's endogenous ChMIrp gene is to first use homologous recombination to set up Alternate sequences from site-specific recombination systems (eg, Cre / loxP, FLP / FRT) (Sauer et al., 1994, Curr.
ent Opinion In Biotechnology, 5: 521-5
27; Sauer et al., 1993, Methods Enzymology, 22.
5: 890-900) upstream of (ie 5'to) the endogenous genomic ChMIrp polypeptide coding region of the cell. A plasmid containing a recombination site homologous to the site located immediately upstream of the genomic ChMIrp polypeptide coding region is introduced into the modified cell line along with the appropriate recombinase enzyme. The recombinase causes the integration of the plasmid into the recombination site located immediately upstream of the genomic ChMIrp polypeptide coding region of this cell line via the recombination site of this plasmid (Baubonis and Sauer, 1993, Nucleic Acids Res. 21: 2025
-29; O'Gorman et al., 1991, Science 251: 1351-.
1355). Any flanking sequences known to increase transcription (eg, enhancers / promoters, introns, translational enhancers), when properly placed in this plasmid, are novel or increased from the cell's endogenous ChMIrp gene. It is incorporated in such a way as to create a new or modified transcription unit that results in the production of ChMIrp polypeptide.

A further method using a cell line in which the site-specific recombination sequences are placed immediately upstream of the cell's endogenous genomic ChMIrp polypeptide coding region is a second recombination at another location in the genome of the cell line. The use of homologous recombination to introduce the site. The appropriate recombinase enzyme is then introduced into the cell line at the two recombination sites, resulting in recombination events (deletions, inversions, and translocations) (Sauer et al., 1994,
Current Opinion In Biotechnology (above)
Sauer, 1993, Methods In Enzymology (supra), which is a novel or increased C from the cell's endogenous ChMIrp gene.
A new or modified transcription unit that results in hMIrp polypeptide production is generated.

A further approach to increasing or causing expression of a ChMIrp polypeptide from the cell's endogenous ChMIrp gene is the endogenous ChCh of the cell.
Increase or cause expression of gene (s) (eg, transcription factor) and / or gene (s) in a manner that results in the production of new or increased ChMIrp polypeptides from the MIrp gene. (Eg, transcriptional repressor). This method involves adding a non-naturally occurring polypeptide (eg, a polypeptide containing a site-specific DNA binding domain fused to a transcription factor domain) to a new or increased ChMIrp polypeptide from the cell's endogenous ChMIrp gene. Introducing into the cell so that production occurs.

The present invention further relates to DNA constructs useful in the method of altering the expression of a target gene. In certain embodiments, an exemplary DNA construct comprises: (a) one or more targeting sequences; (b) regulatory sequences; (c) exons; and (d).
) Unpaired splice donor site. The targeting sequence in the DNA construct is the element (a
)-(D) directs integration into the target gene in the cell, so that these elements (b)-(d) are operably linked to the sequence of the endogenous target gene. In another embodiment, the DNA construct comprises: (a) one or more targeting sequences, (b) regulatory sequences, (c) exons, (d) splice donor sites, (e) introns, and ( f) Splice acceptor site. Where the targeting sequence is
Directing the incorporation of elements (a)-(f), so that these elements (
b)-(f) are operably linked to an endogenous gene. The target sequence is homologous to a preselected site in the cellular chromosomal DNA where homologous recombination occurs. In this construct, the exon is generally 3'of the regulatory sequence and the splice donor site is 3'of this exon.

If the sequence of a particular gene (eg, the nucleic acid sequence of a ChMIrp polypeptide shown herein) is known, the D complementary to the selected region of the gene.
Fragments of NA can be synthesized or otherwise obtained, for example, by appropriate restriction of the native DNA at a particular recognition site bound to the region of interest. This fragment, when inserted into a cell, acts as a targeting sequence and hybridizes to a region of homology within its genome. If this hybridization occurs during DNA replication, the fragment of this DNA, and any additional sequences attached to it, will act as the Okazaki fragment and be incorporated into the newly synthesized daughter strand of the DNA. Thus, the invention includes a nucleotide encoding a ChMIrp polypeptide, which nucleotide can be used as a targeting sequence.

[0340]   Alternatively, gene therapy can be used as described below.

ChMIrp Cell and Gene Therapy ChMIrp cell therapy (eg, transplantation of cells that produce ChMIrp) is also contemplated. This embodiment involves implanting into the patient cells that are capable of synthesizing and secreting a biologically active form of the ChMIrp polypeptide. C like this
The hMIrp polypeptide producing cell can be a cell that is a natural producer of ChMIrp, or a recombinant cell, the ability of which to produce the ChMIrp polypeptide is the gene encoding the desired ChMIrp polypeptide or the ChMIrp polypeptide. It may be a recombinant cell which has been expanded by transforming with a gene which increases the expression of the peptide. Such modification can be accomplished by a vector suitable for delivering the gene and promoting its expression and secretion. ChM
Native cells producing a ChMIrp polypeptide are of human origin if they can be accompanied by the administration of a polypeptide of a foreign species to minimize potential immunological reactions in patients receiving the Irp polypeptide. And it is preferred to produce human ChMIrp polypeptides. Similarly, recombinant cells producing a ChMIrp polypeptide are preferably transformed with an expression vector containing a gene encoding a human ChMIrp polypeptide.

Transplanted cells can be encapsulated to avoid infiltration of surrounding tissue. Human or non-human animal cells are biocompatible semipermeable polymer inclusions or membranes (which are C
It allows the release of hMIrp polypeptides, but prevents the destruction of cells by other deleterious factors from the patient's immune system or surrounding tissues) and can be transplanted to the patient. Alternatively, the patient's own cells transformed to produce the ChMIrp polypeptide ex vivo can be directly transplanted into the patient without such encapsulation.

Techniques for encapsulating viable cells are known in the art, and preparation of encapsulated cells and their implantation into patients can be accomplished routinely.
For example, Baetge et al. (International Publication No. WO95 / 05452; International Application No. P
CT / US94 / 09299) describes a membrane capsule containing cells that have been genetically engineered for efficient delivery of biologically active molecules. The capsules are biocompatible and easily retrievable. The capsule is transfected with a recombinant DNA molecule containing a DNA sequence encoding a biologically active molecule that is operably linked to a promoter that is not subject to downregulation in vivo when implanted in a mammalian host. Encapsulated cells. This device provides delivery of molecules from living cells to specific sites within the recipient. Further, US Pat. Nos. 4,892,538 and 5,0
See 11,472 and 5,106,627. A system for encapsulating viable cells is described in International Application WO 91/10425 (Aebischer).
Et al. International application WO 91/10470 (Aebischer et al.); Winn et al., 1
991, Expert. Neurol. 113: 322-329; Aebisch.
er et al., 1991, Exper. Neurol. 111: 269-275; and Tresco et al., 1992, ASAIO 38: 17-23.

In vivo and in vitro gene therapy delivery of ChMIrp is also included in the invention. In vivo gene therapy can be achieved by introducing the gene encoding ChMIrp into cells by local injection of a polynucleotide molecule or other suitable delivery vector (Hefti, J. Neurobiol.
25: 1418-1435, 1994). For example, a polynucleotide molecule encoding ChMIrp can be included in an adeno-associated viral vector for targeted cell delivery (International Publication No. WO 95/34670; International Application No. PCT / US95 / 07178). Recombinant adeno-associated virus (AAV
) The genome is typically ChMIrp operably linked to a functional promoter.
AAV inverted terminal repeats flanking the DNA sequence encoding, and a polyadenylation sequence.

Alternative viral vectors include, but are not limited to, retroviral vectors, adenovirus vectors, herpes simplex virus vectors, and papillomavirus vectors. US Pat. No. 5,672,344 describes an in vivo virus-mediated gene transfer system comprising a recombinant neurotrophic HSV-1 vector. US Pat. No. 5,399,346 provides an example of a process for providing a therapeutic protein to a patient by delivery of human cells treated in vitro to insert a DNA segment encoding the therapeutic protein. Additional methods and materials for the practice of gene therapy techniques are described in US Pat. No. 5,631,236; Gene therapy involving adenovirus vectors is described in US Pat. No. 5,672,510; and Gene therapy involving the use of retroviral vectors is described in US Pat. No. 5,635,399.

Non-viral delivery methods include liposome-mediated transfer, naked DNA delivery (direct injection), receptor-mediated transfer (ligand-DNA complex), electroporation, calcium phosphate precipitation and microparticle bombardment (eg gene gun).
Is mentioned. Materials and methods for gene therapy also include inducible promoters, tissue-specific enhancer-promoters, DNA sequences designed for site-specific uptake, DNA sequences capable of providing selective advantages over parental cells, Labels to identify transformed cells, negative selection and expression control systems (safety measures), cell-specific binding factors (for cell targeting), cell-specific internalization factors, vector expression And a method for producing a vector. Such additional methods and materials for the practice of gene therapy techniques are described in US Pat. No. 4,970,154, International Application No. WO 9640958; US Pat. No. 5,679,559; S. 5,676
, 954; U.S. Pat. No. 5,593,875; and U.S. Pat.
No. 050. Expression control technology includes chemically induced regulation (
For example, International Application Nos. WO 9641865 and WO 9731899), Use of Progesterone Antagonists in Modified Steroid Hormone Receptor Systems (eg US Pat. No. 5,364,791), Ecdysone Regulatory Systems (eg International Application No. WO 9637609). And positive tetracycline controllable transactivators (eg, US Pat. Nos. 5,589,362; 5,650,298; and 5,654,168).

In vivo and in vitro gene therapy delivery of ChMIrp polypeptides is also envisioned. One example of gene therapy technology is the ChMIrp gene (genomic DNA, cDNA, and / or synthetic DNA encoding a ChMIrp polypeptide, or a fragment, variant thereof, which may be operably linked to a constitutive or inducible promoter. Or any of the derivatives) to form a "gene therapy DNA construct". This promoter is an endogenous C
The promoter may be homologous or heterologous to the hMIrp gene, provided that the promoter is active in the cell or tissue type in which the construct is inserted.
Other components of the gene therapy DNA construct are optionally a DNA molecule designed for site-specific uptake (eg, an endogenous flanking sequence useful for homologous recombination), a tissue-specific promoter, Enhancers, or silencers, DNA molecules that can provide selective advantages over parental cells, DNA molecules useful as targets for identifying transformed cells, negative selection systems, cell-specific binding agents (
For example, for cell targeting), cell-specific internalization factors, and transcription factors to enhance expression by the vector, and factors that allow the production of the vector.

The gene therapy DNA construct can then be introduced into cells using either viral or non-viral vectors (either ex vivo or in vivo).
One method for introducing gene therapy DNA constructs is by viral vectors. Suitable viral vectors are typically used in gene therapy for the delivery of gene therapy DNA constructs by the means of viral vectors described herein. Certain retroviral vectors deliver the DNA construct to the chromosomal DNA of the cell, and the DNA construct can integrate into the chromosomal DNA. Other vectors function as episomes and the gene therapy DNA construct remains in the cytoplasm.

In yet another embodiment, the regulatory elements are ChMI in target cells.
May be included for controlled expression of the rp gene. Such elements turn on in response to the appropriate effector. In this way, the therapeutic polypeptide can be expressed when desired. One conventional control means is the use of small molecule binding domains, which are used to dimerize chimeric proteins (eg, DNA binding proteins or transcriptional activator proteins) that contain domains that can initiate biological processes. Includes the use of quantifying agents or rapalogs (PCT Publication WO9641865 (PCT / US96 / 0994).
86); WO9731898 (PCT / US97 / 03137) and WO9
731899 (PCT / US95 / 03157)). Protein dimerization can be used to initiate transcription of a transgene.

An alternative regulation technique uses the method of storing the protein expressed from the gene of interest inside the cell as aggregates or clusters. The gene of interest is expressed as a fusion protein containing a conditional aggregation domain, resulting in retention of the aggregation protein in the endoplasmic reticulum. The stored protein is stable and inactive inside the cell. However, the protein can be released by administering a drug that removes the conditional aggregation domain, such as a small molecule ligand, thereby specifically destroying the aggregate or cluster, resulting in the protein It can be secreted from the cell. Science 287: 816-17 and 826-3.
See 0.

Other suitable control means or gene switches include, but are not limited to, the following systems. Mifepristone (RU486) is used as a progesterone antagonist. Binding of the modified progesterone receptor ligand binding domain to the progesterone antagonist activates transcription by forming a dimer of two transcription factors, which in turn leads to the nucleus, D
Bind to NA. This ligand binding domain is modified to eliminate the ability of the receptor to bind the natural ligand. The modified steroid hormone receptor system is further described in US Pat. No. 5,364,791, and WO9640.
911 and WO9710337.

Yet another regulatory system binds to the ecdysone receptor (cytoplasmic receptor),
And ecdysone (Drosophila steroid hormone) which activates this is used. This receptor then translocates to the nucleus, where specific DN
It binds to the A response element (promoter derived from ecdysone responsive gene).
The ecdysone receptor contains a transactivation domain / DNA binding domain / ligand binding domain and initiates transcription. The ecdysone system is further described in US Pat. No. 5,514,578, and WO 9738117, WO 9637609; and WO 9303162.

Another control means uses positive tetracycline controllable transactivators. This system gives rise to a mutant tet repressor protein DNA binding domain (reverse tetracycline-regulated transactivator protein linked to a polypeptide that activates transcription (ie, in the presence of tetracycline).
mutated tetR-4 amino acid change) that binds to the t operator). Such systems are described in US Pat. Nos. 5,464,758; 5,650,298 and 5,654,168.

Additional expression control systems and nucleic acid constructs are described in US Patent Nos. 5,741,679 and 5,834,186 (Innovir Laboratories).
Inc. ).

In vivo gene therapy involves the introduction of the gene encoding the ChMIrp polypeptide into C
It can be achieved by introducing it into cells by local injection of the hMIrp nucleic acid molecule or by other suitable viral or non-viral delivery vector. (Hefti, Neurobiology 25: 1418-35, 1994.
). For example, a nucleic acid molecule encoding a ChMIrp polypeptide can be included in an adeno-associated virus (AAV) vector for delivery to target cells (eg, J.
OHSON, International Publication Number WO95 / 34670; International Application Publication PCT / US
95/07178). Recombinant AAV genomes typically contain AAV inverted terminal repeats flanking a DNA sequence encoding a ChMIrp polypeptide operably linked to a functional promoter and polyadenylation sequences.

Alternative suitable viral vectors include retroviruses, adenoviruses,
Vectors include, but are not limited to, herpes simplex virus, lentivirus, hepatitis virus, parvovirus, papovavirus, poxvirus, alphavirus, coronavirus, rhabdovirus, paramyxovirus, and papillomavirus. US Pat. No. 5,672,344 describes an in vivo virus-mediated gene transfer system containing a recombinant neurotrophic HSV-1 vector. US Pat. No. 5,399,346 provides an example of a process for providing therapeutic proteins to a patient by delivery of human cells that have been treated in vitro to insert a DNA segment encoding the therapeutic protein. Additional methods and materials for practicing gene therapy techniques are described in US Pat. Nos. 5,631,236 (for adenoviral vectors), 5,672,510 (for retroviral vectors), 5,635. , 399 (for retroviral vectors expressing cytokines).

Non-viral delivery methods include liposome-mediated transfer, direct injection of naked DNA, receptor-mediated transfer (ligand-DNA complex), electroporation, calcium phosphate precipitation, and particulate bombardment (eg gene gun). Examples include, but are not limited to: Gene therapy materials and methods also include inducible promoters, tissue-specific enhancer-promoters, DNA sequences designed for site-specific integration, DNA sequences capable of providing selective advantages over parental cells, and transformed. To identify isolated cells, negative selection and expression control systems (safety indicators), cell-specific binding factors (for cell targeting), cell-specific internalization factors, and expression by vectors Increasing transcription factors as well as methods of making the vector may be included. Such additional methods and materials for the practice of gene therapy technology are described in US Pat. No. 4,970,154 (for electroporation technology); WO96 / 40958 (for nuclear ligands); 5,679,559. No. (describes a lipoprotein-containing system for gene delivery); No. 5,676,954 (relating to liposome carriers); No. 5,59.
No. 3,875 (describes a method for calcium phosphate transfection) and No. 4,945,050 (biologically active particles are sprayed onto cells at a constant rate, whereby the particles are Describes the process of penetrating the surface of cells and being incorporated inside the cells).

It is also contemplated that ChMIrp gene therapy or cell therapy may further include delivery of one or more additional polypeptides in the same or different cell (s). Such cells can be introduced separately into the patient, or the cells can be contained in a single implantable device (eg, the encapsulating membrane described above), or the cells can be separated by a viral vector. Can be modified to.

Another means of increasing expression of an endogenous ChMIrp polypeptide in cells by gene therapy is to insert one or more enhancer elements in the promoter of the ChMIrp gene, where the enhancer elements are ChMIrp.
It may act to increase the transcriptional activity of the rp polypeptide gene. The enhancer elements used are selected based on the tissue in which it is desired to activate the gene-enhancer elements known to confer promoter activation in that tissue are selected. For example, if the gene encoding the ChMIrp polypeptide is "turned on" in T cells, then l
A ck promoter enhancer element can be used. Here, the functional part of the transcription element added is the ChM, using standard cloning techniques.
Can be inserted into a fragment of DNA containing the Irp polypeptide promoter (
And, if necessary, inserted into a vector and / or 5 ′ and / or 3 ′ flanking sequence or the like). This construct, known as the "homologous recombination construct", can then be introduced into the desired cells, either ex vivo or in vivo.

Gene therapy can also be used to reduce ChMIrp polypeptide expression by modifying the nucleotide sequence of the endogenous promoter. Such modifications are typically accomplished by homologous recombination methods. For example, a DNA molecule containing all or part of the promoter of the ChMIrp gene selected for inactivation can be engineered to remove and / or replace a fragment of the promoter that regulates transcription. For example, the TATA box and / or binding site of the promoter's transcriptional activator can be deleted using standard molecular biology techniques; such deletion can inhibit promoter activity, Corresponding ChMI
It can block transcription of the rp gene. Deletion of the TATA box or transcriptional activator binding site in the promoter is accomplished by generating a DNA construct containing all or a relevant portion of the ChMIrp polypeptide promoter (from the same or a related species as the regulated ChMIrp gene). It can be achieved, where the nucleotides of one or more TATA boxes and / or transcriptional activator binding sites are mutated by substitutions, deletions and / or insertions of one or more nucleotides. As a result, the TATA box and / or activator binding site have diminished activity or are completely inactivated. This construct also typically contains the native (endogenous) 5'and 3 flanking the modified promoter segment.
'Includes DNA of at least about 500 bases corresponding to the DNA sequence. This construct can be introduced into suitable cells (either ex vivo or in vivo) either directly or via a viral vector as described herein.
Typically, the integration of this construct into the genomic DNA of the cell is by homologous recombination, where the 5'and 3'DNA sequences of this promoter construct are modified by hybridization to the endogenous chromosomal DNA. It may act to help integrate the promoter region.

Further Uses of ChMIrp Nucleic Acids and Polypeptides Nucleic acid molecules of the invention, including nucleic acid molecules that themselves do not encode biologically active polypeptides, can be used to map the ChMIrp gene and related gene chromosomes. The top position can be mapped. The mapping is performed by a technique known in the art (for example, P
CR amplification and in situ hybridization).

ChMIrp nucleic acid molecules, including nucleic acid molecules that do not themselves encode biologically active polypeptides, are used to detect ChMIrpD in mammalian tissue or body fluid samples.
It may be useful as a hybridization probe in a diagnostic assay to test for the presence of NA or the corresponding RNA, either qualitatively or quantitatively. ChMIrp can serve as a diagnostic / predictive marker or can assay a wide variety of human cancers. Changes in monitoring in ChMIrp expression during cancer treatment can be used as a surrogate marker to monitor tumor growth and treatment success.

The CHMIrp polypeptide is used in combination (simultaneously or subsequently) with one or more cytokines, growth factors, antibiotics, anti-inflammatory and / or chemotherapeutic agents, where appropriate for the condition being treated. obtain. ChMIrp may be useful as a small molecule inhibitor. Moreover, peptide inhibitors designed from ChMIrp polypeptides can be used as therapeutic or identifying agents that modulate ChMIrp polypeptide activity.

Other methods may also be used where it is desired to inhibit the activity of one or more ChMIrp polypeptides. Such inhibition may be provided by a nucleic acid molecule that is complementary to the expression control sequence (triple helix formation) or ChMIrp mRNA and hybridizes to the expression control sequence (triple helix formation) or ChMIrp mRNA. For example, antisense DNA or RNA molecules (these are
Having a sequence complementary to at least part of the selected ChMIrp gene)
Can be introduced into the cell. Antisense probes can be designed by available techniques using the sequences of ChMIrp polypeptides disclosed herein. Typically, each such antisense molecule will be associated with each selected ChMI.
It is complementary to the start site (5 'end) of the rp gene. When this antisense molecule then hybridizes to the corresponding ChMIrp mRNA, the mRN
Translation of A is prevented or reduced. Antisense inhibitors provide information associated with the reduction or absence of ChMIrp polypeptides in cells or organisms.

Alternatively, gene therapy may be used to produce a dominant negative inhibitor of one or more ChMIrp polypeptides. In this situation, DNA encoding each selected variant of ChMIrp polypeptide may be prepared, and using either viral or non-viral methods described herein. It can be introduced into the cells of a patient. Each of these variants
It is typically designed to compete with the endogenous polypeptide in its biological role. In particular, ChMIrp contains a kinase domain that may be useful in designing dominant negative gene therapies for treatment in a wide variety of tumors.

In addition, the ChMIrp polypeptide (whether biologically active or not) is
It can be used as an immunogen, ie these polypeptides contain at least one epitope against which antibodies can be raised. Selective binding agents that bind ChMIrp polypeptides (as described herein) can be used for in vivo and in vitro diagnostic purposes, including:
Includes, but is not limited to, use in labeled form to detect the presence of ChMIrp polypeptides in body fluid or cell samples. These antibodies can also be used to prevent, treat, or diagnose a number of diseases and disorders, including those listed herein. These antibodies can be used to reduce or block at least one activity characteristic of the ChMIrp polypeptide, Ch
ChMI capable of binding to a MIrp polypeptide or binding to a polypeptide
At least one activity characteristic of the rp polypeptide may be increased, including by increasing the pharmacokinetics of the ChMIrp polypeptide.

The test substances of the present invention are further described by the following examples. The following examples are intended for illustrative purposes only and should not be construed as limiting the invention in any way.

Example 1 Isolation of Mouse cDNA Encoding a Chondromodulin-I Related Gene A commercially available RNA extraction kit (Pharmacia B) according to the manufacturer's instructions.
Osteoprogerin (iotech, Psicaway, NJ) using
Osteoprogerin transgenic mice (Simonet et al.,
Cell, 89: 309-319, 1997), a mouse cDNA library was prepared from total RNA extracted from osteopetrotic bone. Dynabeads O
Poly A + RNA was selected using a ligo (dT) 25 column (Dynal, Oslo, Norway). Superscript Plasmid for cDNA synthesis and plasmid cloning according to the manufacturer's protocol
This cDNA was synthesized using System (Gibco-BRL, Rockville, MD). The obtained cDNA was digested with SalI restriction enzyme and NotI.
Restriction enzymes (Boehringer Mannheim, Indianapoli
s, IN) to create sticky ends to aid in ligation into the vector. The designed cDNA was cloned into T4 DNA ligase (Promega, Madi
son, WI) using the SALI / NOTI predesigned pSPORT vector (
Gibco-BRL). The ligated product was transformed into E. coli by electroporation. coli DB10B electrocompetent bacteria (Gibco-
BRL). Transformed bacteria were plated on LB agarose plates containing 100 mg / ml ampicillin. Clones were randomly selected for sequencing.

By sequencing the clones generated from the above mouse cDNA library,
The DNA corresponding to the EST sequence smbo2-00029-h3 was identified.
It is currently referred to as chondromodulin-1-related peptide (ChMIrp). BLAST analysis of the SWISS-PROT database revealed that the mouse ChMIrp cDNA shown in SEQ ID NO: 3 showed a protein showing 32% identity over 116 amino acids to the amino terminal portion of bovine chondromodulin-I polypeptide (SEQ ID NO: 7). It was confirmed that it was coded. By homology to chondromodulin-I, ChMIr
It allowed the determination of both strands of the entire p insert. As shown in FIG. 1, the mouse ChMIrp polynucleotide sequence (SEQ ID NO: 3) has an open reading frame of 951 nucleotides. The mouse ChIrp polynucleotide sequence was prepared according to the Budapest Treaty on August 8, 2000 by the American Type Culture Collection (10801 University Boullevar).
d. Manassas, VA), ATCC Registration No. PTA-2329
Was given.

Example 2 Identification of Human Ortholog of Mouse ChMIrp Geneb Using Full Length Mouse ChMIrp Nucleotide Sequence (SEQ ID NO: 3)
By BLAST analysis of the ank EST database, seven human ESTs (Genebank Accession No. aa) encoding human orthologs of ChMIrp were identified.
297231, t121280, t12179, ai123839, ai146
280, 11453695, and ai147044). Full length human cDNA was generated by 3'RACE and 5'RACE using the primers shown in Table 1 below. This primer sequence is based on a consensus sequence derived from a comparison of 7 human ESTs.

[0371]

[Table 3] Human Skeletal Muscle Marathon Preparation (Human Skeleton Muscle M
arathon Ready) cDNA and human heart marathon preparation (Huma
n Heart Marathon Ready) cDNA was used as template DNA for 5'RACE (Clontech, Palo Alto, CA). This is because Northern blot analysis (see Example 3 below) detected ChMIrp in human skeletal muscle and human heart. 5
'AP-1 primer (SEQ ID NO: 15) as PCR primer, and 3'P
Using human skeletal muscle marathon-prepared cDNA (Human Skeletal Muscle), primers 2244 to 19 (SEQ ID NO: 13) were used as CR primers.
5'RACE from Marathon Ready cDNA) was generated.
Human skeletal muscle marathon-prepared cDNA (Human Skeletal Muscle Mara) was prepared using AP1 (SEQ ID NO: 15) as a 5 ′ PCR primer and primers 2244-23 (SEQ ID NO: 11) as a 3 ′ PCR primer.
5'RACE derived from thond Ready cDNA). Manufacturer(
The first RACE reaction was performed according to the Clontech protocol. Add 1 ml of a 1:50 dilution of the first 5'RACE product to the nested 5'RACE
Used as a template for CE. The nested 5'RACE reaction primers for skeletal muscle were AP-2 (SEQ ID NO: 16) for the 5'primer and primers 2244-20 (SEQ ID NO: 14) for the 3'primer. In human heart nested 5'RACE, AP-2 (SEQ ID NO: 16) was used as the 5'PCR nested primer and 2244-22 as the 3'nested primer. Nested PCR reactions were performed according to the manufacturer's (Clontech) protocol.

Human skeletal muscle marathon preparation cDNA (Human Skeletal Musc
le Marathon Ready cDNA) was used as template DNA for 3'RACE. Primer 2311-20 as 5'primer
A 3'RACE product was generated using (SEQ ID NO: 14) and AP-1 (SEQ ID NO: 15) as the 3'PCR primer. The first 3'RACE reaction was performed according to the manufacturer's (Clontech) protocol. First 3'R
One microliter of a 1:50 dilution of ACE product was used as template DNA for the nested 3'RACE reaction. Primer 2311-21 (SEQ ID NO: 18
) As a 5'PCR nested primer, and AP-2 (SEQ ID NO: 16
) Was used as a 3'PCR nested primer. Nested PCR reactions were performed according to the manufacturer's (Clontech) protocol.

The products of the 5'RACE and 3'RACE reactions were separated by electrophoresis on a 1% agarose gel. Appropriately sized bands were excised from this agarose gel and the Qiaquick Gel Extraction Kit (Qiag) according to the manufacturer's instructions.
En, Valencia, CA). The extracted DNA is 10 mM containing Taq polymerase (Boehringer Mannheim)
Tris-HCl (pH 8.3), 1.5 mM MgCl ₂ , 50 mM KCl
, 0.2 mM dNTP's (dATP, dTTP, dGTP, dCTP) were incubated at 37 ° C. for 5 minutes. The DNA was then ligated into the PCR2.1 vector (Invitrogen, Carlsbad, CA) and transformed into bacteria according to the manufacturer's instructions. The size of the insert (insert), E
By digestion with coRI restriction enzyme (Boehringer Mannheim)
It was subsequently determined by electrophoresis on a 1% agarose gel. Sequenced, p
Confirmed the identification of 5'RACE and 3'RACE products expressed by the CR2.1 vector.

As shown in FIG. 2, the human ChMIrp cDNA (SEQ ID NO: 1) was 5 ′.
In addition to 86 bp in the untranslated region and 182 bp in the 3'untranslated region, it constitutes an open reading frame of 953 nucleotides (SEQ ID NO: 2). The human (huChIrp) and mouse (muChIrp) amino acid sequences (SEQ ID NOS: 2 and 4, respectively) sequences (FIG. 3) show 97% identity. The human ChMIrp polypeptide sequence is described in the American Type Culture Collection (10801 University Boulev) under the Budapest Treaty.
Ard Manassas, VA) was deposited on August 8, 2000 and was assigned ATCC deposit no. PTA-2328.

As shown in FIG. 4, huChMIrp and muChMIrp are mouse (Genebank accession number: U43509), rat (Genebank accession number: AF051425), bovine (Swiss-Prot accession number: CHM1). BOVIN), human (Genbank accession number: AB006000), and rabbit (Genebank accession number: AF0712129) (respectively SEQ ID NO: 5)
~ 9) from several species including chondromulin-I (chondromo)
dulin-I). BLAST analysis determined that the muChMIrp open reading frame showed 39% identity over 289 amino acids of rat chondromudulin-I. Furthermore, concordance with human, mouse, bovine and rabbit chondromedulin-I showed about 35% identity.
BLAST analysis showed that the open reading frame of muChMIrp was 4 over 262 amino acids for rat chondromudulin-I polypeptide.
2 showing 1% identity and 2 for mouse chondromdulin-I polypeptides
It shows 40% identity over 62 amino acids, 36% identity over 314 amino acids for bovine chondromudulin-I polypeptide and 37 over 262 amino acids for rabbit chondromudulin-I polypeptide.
% Identity, and for human chondromudulin-I polypeptides,
It was determined to show 37% identity over 260 amino acids. In addition, mouse ChMIrp was found to be 2 for chicken chondromudulin-I polypeptide.
It shows 39% identity over 89 amino acids (not shown). Since the conservation between human ChMIrp and mouse ChMIrp is very high, the BLAST analysis data between huChMIrp and chondromedulin-I of other species are shown in the above muCh.
It was comparable to MIrp identity.

Example 3 Tissue-Specific Expression of ChMIrp The tissue-specific expression pattern of ChMIrp gene was studied by Northern Brod. A PCR-produced ³² P-labeled probe was used to detect the presence of ChMIrp transcripts in various tissues from both human and mouse. pSPORT
The mouse ChMIrp cDNA (SEQ ID NO: 3) inserted in the vector (Gibco-BRL) was used as a template to PCR amplify the entire coding region and used as a probe for Northern blot analysis. 5'primer,
Primer 2245-78, which is the sequence ATGGCAAA.
GAATCCTCCAGAGAAC (SEQ ID NO: 19) and the 3'primer was designated Primer 2245-79 and is of the sequence CTAT.
TAGACTCTCCCAAGCATGCG (SEQ ID NO: 20). 10
mM Tris-HCl (pH 8.3), 1.5 mM MgCl ₂ , 50 mM
KCl, 0.2 mM dATP, dTTP and dGTP, 0.01 mM dC
P in a 100 ml volume containing TP, 0.17 mM (α- ³² P) dCTP, 0.4 mM of each primer and 10 ng of muChMIrp template DNA.
A CR reaction was performed. PCR parameters were: 94 ° C. for 30 seconds, 40 cycles of 2 minutes, 94 ° C. denaturation step, 30 seconds at 70 ° C. annealing, and 72 ° C. for 1 minute.
Included a minute extension. This probe is compatible with the Sepharose G50 column (5
'-3' Inc, Boulder, CO).

Commercially available multi-tissue Northern blots containing human, fetal and adult mouse tissues (Clontech, Palo Alto, CA), and commercial Zoo B.
lot (Clontech) was investigated using muChMIrp. further,
Standard techniques (Sambrook et al., Molecular Cloning, C.
old Springs Harbor Laboratory Press,
RNA was analyzed by Osteoprotege by New York, 1989).
rin (OPG) transgenic mouse, OPG knockout mouse (Bu
Cay et al., Genes Dev. , 12: 1260-1268) and normal C
Isolated from D-1 mouse. Tissue was treated with 20 ml of TRIzol reagent (Gibco-
BRL), homogenized for 30 seconds and extracted with 40 ml chloroform. The tube was centrifuged at 4000 rpm for 30 minutes and the aqueous phase transferred to a new tube. Add 10 ml isopropanol, mix, and 4
RNA was precipitated by centrifugation at 200 rpm for 30 minutes. The RNA pellet was washed with 10 ml 70% ethanol, gently dried and resuspended in 0.5 ml TE buffer. RNA was fractionated using a formaldehyde / agarose gel electrophoresis system. After electrophoresis, the gel was processed and RNA was transferred to a nylon membrane (Sambrook et al.,
See above).

Northern blots were analyzed using Rapid-hyb buffer (Amersham Life).
e Sciences, Arlington Heights, IL), 65
Prehybridization was carried out at 30 ° C. for 30 seconds. The blot was then hybridized for 2 hours at 65 ° C. in the same solution with the ³² P-labeled muChMIrp probe added. The filters were first washed with 2 × SSC / 0.1% SDS for 5 minutes at room temperature, then 5 × with 0.1 × SSC / 0.1% SDS, 5 times.
It was washed at 5 ° C for 15 minutes. These blots were exposed to X-ray film at -80 ° C for 4 days.

Northern blot analysis of mouse fetal tissue under stringent conditions detected a 1.2 kb transcript in 15 and 17 day old fetuses. Low level expression was detected in day 11 fetuses, but not high in day 15 and 17 fetuses. Mouse multi-tissue blot detected transcripts of similar size in skeletal muscle.

The muChMIrp probe was also used in human mRNA from multiple tissues to
A 1.2 kb transcript was detected. Expression was detected in human ovary and to a lesser extent in skeletal muscle, prostate and heart.

RNA from femurs and tibias from control CD-1 mice, and femurs and tibias from osteopetrosis of OPG transgenic mice expressed weak levels of muChMIrp, while marble bones from OPG knockout mice. No expression was detected in the diseased femur and tibia.

Zoo Blot (Clontech) was loaded with Rapid-hyb buffer (Am).
Prehybridization in ersham Life Sciences) at 65 ° C. for 30 seconds. The blot was then hybridized for 2 hours at 65 ° C. in the same solution with ³² P-labeled muChMIrp probe. The filter was first washed twice with 2 × SSC for 15 minutes at room temperature and then with 0.1 × SSC / 0.
． Washed twice with 1% SDS for 15 minutes at 55 ° C. The blot was exposed to X-ray film at -80 ° C for 3 days.

The muChMIrp probe detected two bands from mouse, rat, rabbit and bovine DNA in Zoo Blot. Southern blot analysis was performed using high stringency washes, which was muChMIrp.
It has been shown that there must be a high degree of homology between ChMIrp from and rat, rabbit and bovine origin.

In situ hybridization was performed to determine the tissue site of ChMIrp expression. A panel of normal fetal (E8.5-E18.5) and adult mouse and rat tissues was fixed in 4% paraformaldehyde, embedded in paraffin and cut to 5 micrometers. Tissues were permeabilized with 0.2 M HCl prior to in situ hybridization, followed by 10 mg / ml.
Digested with proteinase K and acetylated with triethanolamine and acetic anhydride. The sections were labeled with ³³ P-labeled antisense RN complementary to full-length ChMIrp.
Hybridized with A probe and sense (control) probe at 55 ° C. overnight. The antisense and sense ³³ P-labeled probes were labeled with muChM
Obtained by in vitro transcription of plasmid DNA containing the Irp cDNA. After hybridization, the sections were washed twice at 55 ° C. with 4 × SSC for 20 m.
treatment with g / ml RNase A to remove hybridized probe,
It was then subjected to high stringency washing at 55 ° C. in 0.1 × SSC. The slides were dipped in Kodak NTB2 emulsion, exposed at 44 ° C for 2-3 weeks, developed and concentrated. Sections were examined using dark field illumination and standard illumination to perform simultaneous evaluation of histomorphology and hybridization signals. The following tissues were then examined: brain, parotid, submandibular and sublingual glands, esophagus, stomach, duodenum, jejunum, proximal and distal colon, liver, pancreas, heart, lungs, trachea, blood vessels, Lymph node, spleen, thymus, bone marrow, kidney, bladder, thyroid, adrenal gland, testis, prostate, ovary, uterus, fallopian tube, placenta, bone, skeletal muscle, skin, and adipose tissue.

The muChMIrp antisense probe produced a well-defined signal detectable above the very low levels of background seen with the sense control probe. No signal was detected in sections of E8.5, 10.5 or 11.5. Expression of E13.5-adult sections was detected in tendons, presumably fascia. There was a clear signal in all distinguishable tendons, but no signal was detected in muscle, bone or cartilage. Signals were also detected in cells adjacent to the hair follicles of the skin and in specialized epithelial cells located on intestinal lymphoid plaques known as M cells. Further sites of expression were detected in the thymic medulla, the cerebral cortex just above the corpus callosum of the brain, and in the granule cells surrounding the developing follicle in the ovary.

Example 4 Characterization of ChMIrp Genomic DNA BLAST analysis showed that Genbank Accession No. AL035608 was human ChM
It was identified to contain the Irp genomic sequence. This sequence is on chromosome Xq21.33.
It was derived from clone 479J7 containing human genomic DNA from 23. The human ChMIrp genomic DNA (SEQ ID NO: 10) contains 7 exons and 6 this intron and is shown in FIG.

Example 5 Production of ChMIrp Polypeptides A. Expression of ChMIrp Polypeptides in Bacteria Using PCR, ChMIrp was prepared using primers corresponding to the 5 ′ and 3 ′ ends of the sequences. A template DNA sequence encoding the polypeptide was amplified.
The amplified DNA product can be modified to contain restriction enzyme sites and inserted into an expression vector using standard recombinant DNA methods. Representative vectors containing a gene encoding lux promoter and commamycin resistance (eg, pAM
G21 (ATCC NO: 98113) was digested with BamHI and NdeI for the directional cloning of the inserted DNA. The ligation mixture was transformed into E. coli by electrophoresis and transformants selected for cannamycin resistance. coli
The host strain Top10 (Invitrogen) was transformed. Plasmid DNA from selected colonies was isolated and subjected to sequencing to confirm the presence of insert.

Transformed host cells were incubated for 30 minutes in 2xYT medium containing 30 mg / ml cannamycin prior to incubation. N- (
Gene expression is induced by adding 3-oxohexanoyl) -D1-homoserine lactose to a final concentration of 30 ng / ml, followed by incubation at either 30 ° C. or 37 ° C. for 6 hours. The culture was centrifuged by centrifugation, the bacterial pellet resuspended and lysed, and the host cell proteins analyzed by SDS polyacrylamide gel electrophoresis (SDS-PAGE).
Expression of the hMIrp polypeptide is evaluated.

Inclusion bodies containing ChMIrp were purified as follows: Bacterial cells were pelleted by centrifugation and resuspended in water. The cell suspension was lysed by sonication and pelleted by centrifugation at 195,000 xg for 5-10 minutes. The supernatant was discarded and the pellet was washed and transferred to a homogenizer. This pellet was added to 5 ml of Percoll solution (75%
Homogenize in liquid Percoll / 0.15M NaCl) until uniformly suspended, then dilute and centrifuge at 21,600 xg for 30 minutes.
Gradient fractions containing inclusion bodies are collected and pooled. The isolated inclusion bodies are then analyzed by SDS-PAGE.

E. SDS-PAG corresponding to ChMIrp polypeptide produced by E. coli
The E signal band was excised from the gel, and the N-terminal amino acid sequence was essentially sequenced from Matsudarira et al.
35, 1987).

B. Expression of ChMIrp Polypeptides in Mammalian Cells PCR is used to amplify template DNA sequences encoding ChMIrp polypeptides using primers corresponding to the 5 ′ and 3 ′ ends of the sequences. To do. The amplified DNA product is modified to contain a restriction enzyme site and inserted into an expression vector. The PCR product is gel purified and inserted into an expression vector using standard recombinant DNA methods. A typical vector, pCEP4 (Invit
rogen), which contains the Epstein-Barr viral origin of replication.
Can be used for the expression of ChMIrp in COS cells. The amplified, gel-purified PCR product is ligated into pCEP4 and lipofected into COS cells. Transfected cells are selected in 100 mg / ml hygromycin and the resulting drug resistant cultures are grown to confluence, then the cells are cultured for 72 hours in serum-free medium and conditioned medium. Removed,
Then ChMIrp polypeptide expression is analyzed by SDS-PAGE.

Expression of ChMIrp polypeptides can be detected, for example, by silver staining.
Alternatively, ChMIrp is produced as a fusion protein with an epitope tag (eg IgG contact domain or FLAG epitope), which can be detected by Western blot analysis using antibodies to the tag peptide.

ChMIrp polypeptides can be either removed from SDS-PAGE gels or ChMIrp fusion proteins can be purified by affinity chromatography against this epitope tag and subjected to N-terminal amino acid sequence analysis as described above.

Example 6 Production of ChMIrp Antibodies Antibodies to ChMIrp polypeptides can be produced by immunizing with purified proteins or by biologically or chemically synthesizing ChMrp.
It can be obtained by immunizing with the Irp peptide. Substantially pure ChMI
The rp polypeptide or polypeptide can be isolated from the transfected cells as described in Example 5. The concentration of protein in the final preparation can be adjusted to, for example, several μg / ml by concentrating on an Amicon filter device
Can be adjusted to the level of. Monoclonal or polyclonal antibodies to this protein can then be generated by procedures known in the art to generate antibodies (eg, the method described by Hudson and Bay (Practical).
Immunology 2nd Edition, Blackwell Scientific
Products).

A. Anti-ChMIrp Monoclonal Antibody Production Monoclonal antibodies against epitopes of any of the peptides identified and isolated as described above were obtained from Kohler and Milstein (Nature, 2).
56: 495, 1975) or a derivative method thereof, and can be prepared from mouse hybridomas. Briefly, mice were exposed to several μ over several weeks.
Repeatly seed g of the selected protein. The mouse was then sacrificed,
Then, antibody-producing cells of the spleen are isolated. These spleen cells were fused with mouse melanoma cells (eg, NS-1 cells) by polyethylene glycol, and excess unfused cells were selected with hypoxanthine; aminopterin; and thymidine-containing selective medium ( It is destroyed by growth of this system on HAT medium). The successfully fused cells are diluted and an aliquot of this dilution is placed in the wells of a microtiter plate, where growth of the culture is continued. After selection, tissue culture supernatant was harvested from the wells of each fusion and ChM by EIA.
Test for Irp antibody production. Selection positive clones can be expanded and their monoclonal antibody product recovered for use. Detailed procedures for the production of monoclonal antibodies are described in Davis et al. (Basic Methods in
Molecular Biology, Section 21-2, Elsev
ier, New York, NY).

B. Polyclonal ChMIrp Antibody Production Polyclonal antisera containing antibodies to heterologous epitopes of a single protein can be prepared by immunizing a suitable animal with the expressed protein as described above. Effective polyclonal antibody production is affected by many factors related to both the antigen and the host species. For example, small molecules tend to be less immunogenic than large molecules and may require the use of carrier adjuvants. Host animals also change in response to the site of inoculation and dose, with either inadequate or excessive doses of antigen producing low titers of antisera. Small doses (ng levels) of antigen administered to multiple intradermal sites appear to be the most reliable. An effective immunization protocol for rabbits is Vaitukaitis
(J. Clin. Endocrinol. Metab., 33: 988-99.
1, 1971).

Booster injections can be given at regular intervals and the antisera will be assayed if their antibody titers are determined semiquantitatively (eg by double immunodiffusion in agar against known concentrations of antigen). ), You can collect it when you start descending. For example, Ouchter
lony et al. (Chap. 19: Handbook of Experiment)
al Immunology, D.I. Weir (ed.), Blackwell, 19
73). Plateau concentration of antibody is usually 0.1-0.2 mg / 1 m
It is in the range of 1 serum (about 12 mM). The affinity of the antisera for the antigen can be determined by constructing a competitive binding curve (eg Fischer, D., (Chap.
2: Manual of Clinical Immunology, 2nd edition (
Rose and Friedman) Amer. Soc. For Microb
iol, Washington, D.I. C. , 1980)).

Alternative procedures for obtaining anti-ChMIrp antibodies (eg, immunization of transgenic mice with human IgG loci for the production of fully human antibodies, and synthetic antibody libraries (by mutagenesis of antibody variable domains) Screening)) can also be used.

Example 7 Functional Analysis of the Role of ChMIrp To determine the functional role of ChMIrp in vivo, ChMIrp
The gene is overexpressed in the germ line of the animal or is inactivated in the germ line of the mammal by homologous recombination. Animals in which this gene is overexpressed under the regulatory control of exogenous or endogenous promoter elements are known as transgenic animals. Animals in which the endogenous gene has been inactivated by homologous recombination are also known as "knockout" animals. Typical mammals include
Rabbit and rodent species (eg, mouse) are included. Exemplary procedures are described in US Pat. No. 5,489,743 and International Patent Publication No. WO 94/28122.

Transgenic animals are challenged with ChMIrp for developmental and disease processes.
Allows the determination of the effects of overexpression or inappropriate expression of. ChMIrp transgenic animals can also be used as a model system to test compounds that can modulate receptor activity.

“Knockout” animals are C in embryonic development and immune and proliferative responses.
Allows the determination of the role of hMIrp polypeptides. The role of ChMIrp polypeptides in the developmental and proliferative response has been analyzed in these animals by analysis of the effects of gene knockouts on embryonic development and the development and differentiation of various organs and tissues, such as skeletal components such as bone and cartilage. It is determined.

Example 8 Biological Activity of ChMIrp Polypeptides Proliferation and morphological assays to determine whether ChMIrp biological activity is similar to that of chondromodulin-I. Can be done. Recombinant ChMIrp (C prepared and purified as described in Example 5) for all assays
OS cell derived) is used.

A. Stimulation of Chondrocytes The ability of ChMIrp to stimulate DNA and proteoglycan synthesis in chondrocytes can be investigated as chondromodulin family activity. Chondrocytes
Himomura et al. (Calcif. Tissue Res. 19: 179-1.
87,1975) and isolated from growth plate cartilage of ribs from young rabbits. Isolated chondrocytes are plated at 1 × 10 ⁴ cells / well in 96-well microtiter plates and cultured in modified Eagle's medium (MEM) supplemented with 10% fetal bovine serum (FBS). Upon confluence, proteoglycan synthesis was determined by Hiraki et al. (Eur. J. Biochem., 260
: 869-878, 1999). Briefly, chondrocytes are pre-incubated in 0.3% serum. After 24 hours, add 0.3%
Replace with medium containing serum and recombinant ChMIrp polypeptide (10-1000 ng / ml). After 3 hours, cells are labeled with 5 mCi / ml [ ³⁵ S] -sulfate for an additional 17 hours. The proteoglycan is then precipitated with 1% cetylpyridinium chloride and the radioactivity incorporated is measured.
Insulin-like growth factor I or II can be used as a positive control.

To determine whether DNA synthesis is stimulated by ChMIrp polypeptides, isolated chondrocytes were cultured in MEM medium containing 10% FBS in 1 × 10 ⁴ cells in 96-well microtiter plates. / Plate wells. Twenty-four hours later, the medium was replaced with 0.3% serum + recombinant ChMIrp polypeptide (10-1000
ng / ml) and the cells are incubated for 20 hours. The cells are then labeled with [ ³ H] -thymidine (5 mCi / ml) for an additional 4 hours. The cells are then washed with PBS and fixed with cold 100% methanol for 10 minutes. After fixation, incorporated radioactivity is precipitated with 10% trichloroacetic acid and counted.

Chondromodulin-I cooperates with FGF-2 to induce chondrocyte colony formation in soft agar. To determine whether the ChMIrp polypeptide exhibits this activity, isolated chondrocytes (5 × 10 ³ cells / well) were treated with Ino.
ue et al. (Biochem. Biophys. Res. Comm., 241: 39.
5-400, 1997) and HAM F-12 supplemented with 5% FBS, 0.2 mM hydrocortisone, and 60 mg / ml transferrin.
Suspend in 0.5 ml 0.41% agarose in medium. This cell suspension is
． Pour onto basal layer of 72% agarose and incubate overnight. Increasing concentrations of recombinant ChMIrp polypeptide (1-1 000 ng / ml) and 1 ng / ml
ml FGF-2 is diluted in serum-free F-12 medium containing 0.5% bovine serum albumin. This mixture is evenly added to the top layer of the wells. After 10 days, colonies are counted under a phase contrast microscope.

B. Endothelial Cell Stimulation: Endothelial cell proliferation and morphogenesis in the presence of ChMIrp polypeptides was assayed, and inhibition of endothelial cell proliferation and tube formation was compared to those in the presence of chondromodulin-I. Determine if they occur in a similar manner. Proliferation and tube morphogenesis in bovine carotid artery endothelial cells in vitro was demonstrated by Hiraki et al. (FEBS, 415: 32).
1-324, 1997). Briefly, bovine carotid artery (BCAE) cells are isolated by gently scraping the inner surface of the carotid artery. The isolated BCAE cells were treated with RPMI-1 supplemented with 10% FBS.
Proliferate and expand in 640. To determine whether recombinant ChMIrp can inhibit the growth of BCAE cells, [ ³ H] -thymidine incorporation is measured as described above. To test the effect of ChMIrp on tube morphogenesis of endothelial cells, BCAE cells (1 × 10 ⁵ cells / well) were diluted in 0.1 M NaOH and 10 × MEM medium in 0.3% type I collagen gel. Grow in 12-well plates containing After 24 hours, the medium is aspirated and the recombinant ChM
Aqueous mixture (70 ml) containing Irp polypeptide (10-1000 ng / ml)
) Is added. Then, the collagen solution is overlaid to prepare an upper layer. Three days later,
The morphological changes of cells into the tube-like network are observed under a phase contrast microscope. An in vivo assay for measuring endothelial cell angiogenesis is described by Hiraki et al. (Eur. J. Bio.
chem. 260: 869-878, 1999), a chicken chorioallantoic membrane assay. Briefly, 3 fertilized white Leghorn chicken eggs
Incubate at 7.8 ° C. On day 5, the airspace is punctured and a 1 cm ² window is opened in the egg. Recombinant ChMIrp polypeptide (500 ng / m
l) was diluted in 0.75% agarose. The fixed gel is placed on the chorioallantoic membrane in the egg for 24 hours. The membrane is examined under a dissecting microscope for fine capillary formation.

C. Osteoblast Stimulation The effect of ChMIrp on osteoblast proliferation was also demonstrated by Mori et al. (FEBS 4
06: 310-314, 1997), as an indicator of chondromodulin-I activity. The clonal osteoblast cell line MC3T3-E1 is treated with increasing concentrations of recombinant ChMIrp (10-1000 ng / ml). DNA
As a measure of synthesis, osteoblast [ ³ H] -thymidine incorporation is measured as described above.

This putative biological function of ChMIrp polypeptides is similar to that of chondromodulin-I. In particular, chondromodulin-I is known to stimulate chondrocyte proliferation and differentiation. Furthermore, chondromodulin-I
Inhibits endothelial cell proliferation and microcapillary formation in vivo, chondromodulin-I has anti-angiogenic activity. ChMIrp, by itself,
It may play a role in cartilage development and blood vessel formation.

ChMIrp polypeptides are expressed in tendons, skeletal muscle, thymus, ovary, cerebral cortex of brain, intestinal M cells, and cells adjacent to hair follicles, as determined by Northern blot analysis and in situ hybridization. Was done. Expression in tendons and muscles indicates that ChMIrp may play a role in tendon and muscle development and muscle attachment to bone. Expression in M-cells of the sternum, hair follicle and intestine indicates a potential role for ChMIrp in immune function. ChMIr
p can act as a growth factor involved in the regeneration (proliferation and development) of tissues and certain cell types present in tendons, skeletal muscle, thymus, ovary, brain, intestines and hair follicles.

Based on these potential functions, ChMIrp is associated with tendon disorders (eg, tendonitis and tendon rupture), skeletal muscle disorders (eg, cachexia and muscular dystrophy), immune system dysfunction disorders (eg, Inflammation and allergies, poor wound healing, arthritis and allergies), and infertility disorders may be useful in diagnosis and / or treatment.

Although the present invention has been described with reference to preferred embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, it is intended that the appended claims cover all such equivalent variations that occur within the scope of the claimed invention.

[Sequence list]

[Brief description of drawings]

FIG. 1 is a mouse ChMI containing an open reading frame (SEQ ID NO: 4).
Figure 3 shows the polynucleotide sequence shown as SEQ ID NO: 3, which represents the entire coding region of the rp cDNA.

FIG. 2 is a human ChMIr containing an open reading frame (SEQ ID NO: 2).
1 shows the polynucleotide sequence shown as SEQ ID NO: 1 representing the entire coding region of pcDNA.

FIG. 3 is a human ChMIrp polypeptide sequence (SEQ ID NO: 2) and mouse Ch
2 shows the sequence of MIrp polypeptide sequence (SEQ ID NO: 4).

FIG. 4 shows human and mouse ChMIrp polypeptide sequences (SEQ ID NO: 2, respectively).
And homology to SEQ ID NO: 4) and chondromodulin-I polypeptides from various mammalian species (SEQ ID NOs: 5-9).

FIG. 5 shows the complete genomic DNA sequence of human ChMIrp, shown as SEQ ID NO: 10, with exons and splice acceptor / donor sites underlined in bold.

─────────────────────────────────────────────────── ─── Continued Front Page (51) Int.Cl. ⁷ Identification Code FI Theme Coat (Reference) A61K 38/00 A61K 39/395 N 4B064 38/22 45/00 4B065 39/395 47/48 4C076 48/00 4C084 45/00 A61P 1/16 4C085 47/48 9/00 4C086 48/00 9/10 101 4C087 A61P 1/16 9/12 4H045 9/00 17/06 9/10 101 19/10 9/12 29 / 00 17/06 35/00 19/10 C07K 16/40 29/00 16/42 35/00 16/46 C07K 16/40 C12N 1/15 16/42 1/19 16/46 1/21 C12N 1/15 9/12 1/19 11/04 1/21 C12Q 1/02 5/10 1/48 Z 9/12 1/68 A 11/04 G01N 33/53 D C12Q 1/02 M 1/48 33/566 1 / 68 33/577 B G01N 33/53 33/58 A C12P 21/08 33/566 C12N 15/00 ZNAA 33/577 5/00 A 33/58 B // C12P 21/08 61K 37/24 37/02 (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE , TR), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR , HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM , TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Yun, Genie United States California 91316, Encino, Newcastle Avenue 5348, Apartment 227 (72) Inventor Clarkine , Christie United States California 93030, Oxnard, Eagle Creek Lane 2318 F term (reference) 2G045 AA34 AA35 BB07 BB20 BB50 CB01 DA13 DA36 FA16 FB02 FB03 FB08 4B024 AA01 AA11 BA10 BA41 GA01 GA01 GA01 GA01 DA01 GA04 GA01 GA02 DA06 DA01 GA02 GA01 GA02 GA06 GA02 HA17 4B033 NA16 NA25 NB58 NC06 ND12 NF06 4B050 CC01 CC03 DD11 FF13E LL03 4B063 QA01 QA18 QA19 QQ03 QQ27 QQ42 QR32 QR38 QR41 QR55 QR69 Q R77 QR82 QS12 QS25 QS34 QS39 QX07 4B064 AG27 CA10 CA20 CC24 DA01 DA13 4B065 AA26X AA90X AA91X AA93Y AB02 AC14 BA02 BA08 CA25 CA29 CA44 CA46 4C076 AA94 BB11 BB16 BB32 CC04 CC11 CC27 EE59 4C084 AA01 AA02 AA03 AA06 AA13 AA16 BA01 BA02 BA08 CA17 CA23 DB52 DB60 MA17 MA22 MA24 MA27 MA37 MA43 MA44 MA55 MA56 MA65 MA66 MA67 NA14 ZA362 ZA422 ZA452 ZA752 ZA972 ZB112 4C085 AA13 AA14 AA15 AA16 BB41 BB43 BB44 CC22 CC23 EE01 GG02 GG04 4C086 AA02 AA03 EA16 MA01 MA05 MA17 MA22 MA23 MA24 MA35 MA37 MA44 MA52 MA55 MA56 MA65 MA66 MA67 NA14 ZA26 ZA36 ZA45 ZA75 ZA89 ZA97 ZB11 4C087 BB33 BC83 MA22 MA23 MA24 MA27 MA35 MA37 MA43 MA44 MA52 MA56 MA58 MA65 MA66 NA14 ZA26 ZA36 ZA42 ZA75 ZA89 ZA97 ZA97 FA75 DA75 89 ZA97 DAB30 DA97 DAB30 ]

Claims (73)

[Claims] 1. An isolated nucleic acid molecule, the nucleic acid molecule comprising: (a) a nucleotide sequence shown in SEQ ID NO: 1; (b) a nucleotide sequence encoding the polypeptide shown in SEQ ID NO: 2. (C) a nucleotide sequence that hybridizes to the complement of (a) or (b) under moderately or highly stringent conditions, the encoded polypeptide being the polypeptide shown in SEQ ID NO: 2; A nucleic acid molecule comprising a nucleotide sequence having peptide activity; and (d) a nucleotide sequence selected from the group consisting of nucleotide sequences complementary to any of (a) to (c). 2. An isolated nucleic acid molecule, wherein the nucleic acid molecule is: (a) a nucleotide sequence encoding a polypeptide that is at least about 70% identical to the polypeptide set forth in SEQ ID NO: 2. The polypeptide is a nucleotide sequence having the activity of the polypeptide shown in SEQ ID NO: 2; (b) a nucleotide sequence encoding an allelic variant or splice variant of the nucleotide sequence shown in SEQ ID NO: 1. The encoded polypeptide is a nucleotide sequence having the activity of the polypeptide set forth in SEQ ID NO: 2; (c) SEQ ID NO: 1, (a) encoding a polypeptide fragment of at least about 25 amino acid residues. Or (b) the nucleotide sequence, wherein the polypeptide is that of the polypeptide shown in SEQ ID NO: 2. A nucleotide sequence having activity; (d) a nucleotide sequence of SEQ ID NO: 1 or (a)-(c), comprising a fragment of at least about 16 nucleotides; (e) the complement of any of (a)-(d). A nucleotide sequence which hybridizes under moderately or highly stringent conditions, the polypeptide having the activity of the polypeptide set forth in SEQ ID NO: 2;
And (f) a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of nucleotide sequences complementary to any of (a) to (c). 3. An isolated nucleic acid molecule, the nucleic acid molecule comprising: (a) a nucleotide sequence encoding a polypeptide set forth in SEQ ID NO: 2 having at least one conservative amino acid substitution. A nucleotide sequence having the activity of the polypeptide shown in SEQ ID NO: 2; (b) a nucleotide sequence encoding the polypeptide shown in SEQ ID NO: 2 having at least one amino acid insertion, wherein: The polypeptide is a nucleotide sequence having the activity of the polypeptide shown in SEQ ID NO: 2; (c) a nucleotide sequence encoding the polypeptide shown in SEQ ID NO: 2 having at least one amino acid deletion, The peptide is a nucleotide sequence having the activity of the polypeptide shown in SEQ ID NO: 2; (d) C A nucleotide sequence encoding a polypeptide shown in SEQ ID NO: 2 having a truncation and / or an N-terminal truncation, said polypeptide having the activity of the polypeptide shown in SEQ ID NO: 2; ) A nucleotide sequence encoding the polypeptide shown in SEQ ID NO: 2 having at least one modification selected from the group consisting of amino acid substitution, amino acid insertion, amino acid deletion, C-terminal truncation and N-terminal truncation, The peptide is
A nucleotide sequence having the activity of the polypeptide shown in SEQ ID NO: 2; (f) a nucleotide sequence of (a) to (e) containing a fragment of at least 16 nucleotides; (g) any of (a) to (f) A nucleotide sequence that hybridizes to its complement under moderately or highly stringent conditions, the polypeptide having the activity of the polypeptide set forth in SEQ ID NO: 2;
And (h) a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of nucleotide sequences complementary to any of (a) to (e). 4. A vector comprising the nucleic acid molecule according to claim 1, 2 or 3. 5. A host cell containing the vector of claim 4. 6. The host cell according to claim 5, which is a eukaryotic cell. 7. The host cell according to claim 5, which is a prokaryotic cell. 8. A process for producing a ChMIrp polypeptide comprising culturing the host cell of claim 5 under conditions suitable for expressing said polypeptide, and optionally said culturing. A process comprising the step of isolating the polypeptide from a product. 9. A polypeptide produced by the process of claim 8. 10. The process of claim 8, wherein the nucleic acid molecule comprises a promoter DNA other than the promoter DNA for the native ChMIrp polypeptide, the promoter operating on the DNA encoding the ChMIrp polypeptide. Processes that are connected as possible. 11. The isolated nucleic acid molecule of claim 2, wherein:
The percent identity is GAP, BLASTP, BLASTN, FASTA,
BLASTA, BLASTX, BestFit and Smith-Waterm
A nucleic acid molecule, as determined using a computer program selected from the group consisting of an algorithm. 12. A process for identifying a candidate inhibitor of activity or production of a ChMIrp polypeptide, said process exposing a cell according to claim 5, 6 or 7 to said candidate inhibitor. ChMI in cells
measuring the activity or production of rp polypeptide, and comparing the ChMIrp activity in cells exposed to said candidate inhibitor with the activity in cells not exposed to said candidate inhibitor. 13. A process for identifying a candidate stimulator of activity or production of a ChMIrp polypeptide, the process exposing a cell according to claim 5, 6 or 7 to the candidate stimulator. Measuring the activity or production of a ChMIrp polypeptide in said cell, and comparing the ChMIrp activity in cells exposed to said candidate stimulator to the activity in cells not exposed to said stimulator. . 14. An isolated polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2. 15. An isolated polypeptide, which polypeptide comprises: (a) a mature amino acid sequence set forth in SEQ ID NO: 2 comprising a mature amino terminus at residue 1, optionally Optionally further comprising an amino terminal methionine; (b) an amino acid sequence of the ortholog of SEQ ID NO: 2, wherein the encoded polypeptide has the activity of the polypeptide shown in SEQ ID NO: 2 (C) an amino acid sequence that is at least about 70% identical to the amino acid sequence set forth in SEQ ID NO: 2, wherein the polypeptide has the activity of the polypeptide set forth in SEQ ID NO: 2; ) A fragment of the amino acid sequence set forth in SEQ ID NO: 2 comprising at least about 25 amino acid residues, wherein the polypeptide is set forth in SEQ ID NO: 2. A fragment having the activity of a polypeptide as described above; (e) an amino acid sequence of an allelic variant or splice variant of any of the amino acid sequences shown in SEQ ID NO: 2 or at least one of (a) to (c). The polypeptide comprises an amino acid sequence selected from the group consisting of amino acid sequences having the activity of the polypeptide shown in SEQ ID NO: 2. 16. An isolated polypeptide, which is: (a) the amino acid sequence set forth in SEQ ID NO: 2 having at least one conservative amino acid substitution, wherein the polypeptide is An amino acid sequence having the activity of the polypeptide shown in SEQ ID NO: 2; (b) an amino acid sequence shown in SEQ ID NO: 2 having at least one amino acid insertion, which polypeptide is shown in SEQ ID NO: 2 An amino acid sequence having the activity of a polypeptide; (c) an amino acid sequence set forth in SEQ ID NO: 2 having at least one amino acid deletion, wherein the polypeptide has the activity of the polypeptide set forth in SEQ ID NO: 2 (D) an amino acid sequence represented by SEQ ID NO: 2 having a C-terminal truncation and / or an N-terminal truncation, The polypeptide has an amino acid sequence having the activity of the polypeptide shown in SEQ ID NO: 2; and (e) at least selected from the group consisting of amino acid substitution, amino acid insertion, amino acid deletion, C-terminal truncation and N-terminal truncation. Amino acid sequence represented by SEQ ID NO: 2 having one modification, wherein the polypeptide comprises an amino acid sequence selected from the group consisting of amino acid sequences having the activity of the polypeptide represented by SEQ ID NO: 2. peptide. 17. The polypeptide according to claim 15 or 16, wherein the amino acid at position 276 of SEQ ID NO: 2 is cysteine, serine or alanine. 18. The polypeptide according to claim 15 or 16, wherein the amino acid at position 280 of SEQ ID NO: 2 is cysteine, serine or alanine. 19. The polypeptide according to claim 15 or 16, wherein the amino acid at position 281 of SEQ ID NO: 2 is glutamic acid or aspartic acid. 20. The polypeptide according to claim 15 or 16, wherein the amino acid at position 285 of SEQ ID NO: 2 is glycine, proline or alanine. 21. The polypeptide according to claim 15 or 16, wherein the amino acid at position 297 of SEQ ID NO: 2 is arginine, lysine, glutamine or asparagine. 22. The polypeptide according to claim 15 or 16, wherein the amino acid at position 300 of SEQ ID NO: 2 is cysteine, serine or alanine. 23. The polypeptide according to claim 15 or 16, wherein the amino acid at position 306 of SEQ ID NO: 2 is cysteine, serine or alanine. 24. The polypeptide according to claim 15 or 16, wherein the amino acid at position 310 of SEQ ID NO: 2 is valine, isoleucine, methionine, leucine, phenylalanine, alanine or norleucine. 25. An isolated polypeptide encoded by the nucleic acid molecule of claim 1, 2 or 3. 26. The isolated polypeptide of claim 15, wherein the percent identity is GAP, BLASTP, BLASTN, FAS.
TA, BLASTA, BLASTX, BestFit and Smith-Wat
A polypeptide determined using a computer program selected from the group consisting of the Erman algorithm. 27. An antibody produced by immunizing an animal with a peptide comprising the amino acid sequence of SEQ ID NO: 2. 28. An antibody or fragment thereof that specifically binds the polypeptide of claim 14, 15 or 16. 29. The antibody according to claim 28, which is a monoclonal antibody. 30. A hybridoma producing a monoclonal antibody that binds to a peptide containing the amino acid sequence of SEQ ID NO: 2. 31. A method of detecting or quantifying the amount of ChMIrp in a sample, the method comprising detecting a sample suspected of containing a ChMIrp polypeptide.
30. A method comprising contacting the anti-h2520-109 antibody or fragment thereof according to 7, 28 or 29, and detecting binding of the antibody or fragment. 32. A selective binding agent or a fragment thereof that specifically binds at least one polypeptide, the polypeptide comprising: (a) the amino acid sequence set forth in SEQ ID NO: 2; (b) the sequence A fragment of the amino acid sequence shown in at least one of number 2;
And (c) a selective binding agent comprising an amino acid sequence selected from the group consisting of naturally occurring variants of (a) or (b). 33. The selective binding agent according to claim 32, which is an antibody or a fragment thereof. 34. The selective binding agent of claim 32, which is a humanized antibody. 35. The selective binding agent according to claim 32, which is a human antibody or a fragment thereof. 36. The selective binding agent according to claim 32, which is a polyclonal antibody or a fragment thereof. 37. The selective binding agent according to claim 32, which is a monoclonal antibody or a fragment thereof. 38. The selective binding agent of claim 32 which is a chimeric antibody or fragment thereof. 39. The selective binding agent of claim 32, which is a CDR-grafted antibody or fragment thereof. 40. The selective binding agent of claim 32, which is an anti-idiotype antibody or fragment thereof. 41. The selective binding agent of claim 32, which is a variable region fragment. 42. A Fab fragment or a Fab ′ fragment,
42. The variable region fragment according to claim 41. 43. A selective binding agent or a fragment thereof, comprising at least one complementarity determining region having specificity for a polypeptide having the amino acid sequence of SEQ ID NO: 2. 44. The selective binding agent of claim 32, wherein a detectable label is attached. 45. The selective binding agent of claim 32, which antagonizes the biological activity of the ChMIrp polypeptide. 46. A method for treating, preventing or ameliorating a disease, condition or disorder, comprising administering to a patient an effective amount of a selective binding agent according to claim 32. 47. A selective binding agent produced by immunizing an animal with a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2. 48. A hybridoma producing a selective binding agent capable of binding the polypeptide of claim 14, 15 or 16. 49. A composition comprising the polypeptide of claim 14, 15 or 16 and a pharmaceutically acceptable formulation. 50. The composition of claim 49, wherein the pharmaceutically acceptable formulation is a carrier, adjuvant, solubilizer, stabilizer, or antioxidant. 51. The composition of claim 50, wherein said polypeptide comprises the mature amino acid sequence set forth in SEQ ID NO: 2. 52. A polypeptide comprising a derivative of the polypeptide of claim 14, 15 or 16. 53. The water-soluble polymer is covalently modified.
2. The polypeptide according to 2. 54. The polypeptide of claim 53, wherein the water soluble polymer is polyethylene glycol, monomethoxy-polyethylene glycol,
A polypeptide selected from the group consisting of dextran, cellulose, poly- (N-vinylpyrrolidone) polyethylene glycol, propylene glycol homopolymer, polypropylene oxide / ethylene oxide copolymer, polyoxyethylated polyol, and polyvinyl alcohol. 55. A composition comprising the nucleic acid molecule of claim 1, 2 or 3 and a pharmaceutically acceptable formulation agent. 56. The composition of claim 55, wherein the nucleic acid molecule is contained in a viral vector. 57. A viral vector comprising the nucleic acid molecule of claim 1, 2 or 3. 58. The method of claim 14, 15 or 1 fused to a heterologous amino acid sequence.
A fusion polypeptide comprising the polypeptide of claim 6. 59. The fusion polypeptide of claim 58, wherein the heterologous amino acid sequence is an IgG constant domain or fragment thereof. 60. A method for treating, preventing or ameliorating a medical condition in a mammal that results from decreased ChMIrp polypeptide levels, the polypeptide of claim 14, 15 or 16 or claim 1. A method comprising the step of administering to the mammal a polypeptide encoded by the nucleic acid according to 2 or 3. 61. A method of diagnosing a pathological condition or susceptibility to a pathological condition in a subject caused by or resulting from abnormal levels of a ChMIrp polypeptide, comprising: (a) in a sample Determining the presence or expression level of expression of the polypeptide of claim 14, 15 or 16 or of the polypeptide encoded by the nucleic acid molecule of claim 1, 2 or 3; and (b) a normal test. Comparing the level of ChMIrp polypeptide in a biological, tissue or cell sample from the body or an early subject, wherein susceptibility to a pathological condition is the presence of expression of the polypeptide. Alternatively, a method including a step based on the expression level. 62. A device comprising: (a) a membrane compatible with implantation; and (b) cells encapsulated within the membrane, wherein the cells are as claimed in claim 14, 15. Or a device which secretes the polypeptide according to 16, and the membrane is permeable to the protein and impermeable to substances harmful to the cells. 63. A device, comprising:   (A) a membrane compatible with implantation; and   (B) ChMIrp polypeptide encapsulated in the membrane The device, wherein the membrane is permeable to the polypeptide. 64. A method of identifying a compound that binds to a polypeptide, comprising:
The following: (a) contacting a compound with the polypeptide of claim 14, 15 or 16; and (b) determining the degree of binding of the polypeptide to the compound. 65. A method of modulating the level of a polypeptide in an animal, comprising the step of administering to the animal the nucleic acid molecule of claim 1, 2 or 3. 66. A transgenic non-human mammal comprising the nucleic acid molecule of claim 1, 2 or 3. 67. A diagnostic reagent, which is the amino acid sequence shown in SEQ ID NO: 2,
Alternatively, a diagnostic reagent comprising a detectably labeled polynucleotide encoding a fragment, variant or homolog thereof, including allelic and splice variants thereof. 68. The diagnostic reagent according to claim 67, wherein the labeled polynucleotide is a single-stranded cDNA. 69. A method for determining the presence of a ChMIrp nucleic acid in a biological sample, comprising the steps of: (a) providing a biological sample suspected of containing the ChMIrp nucleic acid; b) contacting the biological sample with the diagnostic reagent of claim 84, wherein the diagnostic reagent is included in the biological sample.
-C) under conditions that hybridize to the nucleic acid; (c) detecting hybridization between the ChMIrp nucleic acid and the diagnostic reagent in the biological sample; and (d) the biological sample. Comparing the level of hybridization between the diagnostic reagent and a ChMIrp nucleic acid of known concentration to the diagnostic reagent. 70. A method for determining the presence of a ChMIrp nucleic acid in a tissue or cell sample comprising the steps of: (a) providing a tissue or cell sample suspected of containing the ChMIrp nucleic acid. (B) a step of bringing the diagnostic reagent according to claim 68 into contact with the tissue sample or the cell sample, the step being performed under a condition in which the diagnostic reagent hybridizes with a ChMIrp nucleic acid; c) detecting hybridization between the ChMIrp nucleic acid and the diagnostic reagent in the tissue or cell sample; and (d) determining the level of hybridization between the tissue or cell sample and the diagnostic reagent. , A level of hybridization between a known concentration of ChMIrp nucleic acid and the diagnostic reagent. And comparing to encompass, method. 71. The method of claim 70 or 71, wherein the ChMIrp polynucleotide molecule is DNA. 72. The method of claim 70 or 71, wherein the ChMIrp polynucleotide molecule is RNA. 73. An antagonist of ChMIrp polypeptide activity, wherein the antagonist has specificity for a ChMIrp polypeptide, C
An antagonist selected from the group consisting of hMIrp selective binding agents, small molecules, antisense oligonucleotides and peptides or derivatives thereof.