JP2003520022A - DNA encoding human vanilloid receptor VR1 - Google Patents

Abstract

  (57) [Summary] DNA encoding the human VR1 receptor was cloned and characterized. Recombinant proteins are capable of forming biologically active proteins. The cDNA was expressed in a recombinant host cell producing an active recombinant protein. Recombinant proteins are also purified from recombinant host cells. In addition, recombinant host cells are utilized to establish methods of identifying modulators of receptor activity, and modulators of the receptor are identified.

Description

Detailed Description of the Invention

[0001] Technical Field Background harmful chemical of the invention, thermal and mechanical stimulation, peripheral sensory ganglia (e.g. dorsal root nodules and trigeminal ganglia) of small diameter sensory neurons (nociceptors) It stimulates nerve endings and produces signals that are perceived as pain. These neurons are associated with harmful or potentially harmful stimuli (heat) and tissue damage (H ⁺ (local acidosis) and / or) resulting from changes in the extracellular space during inflammatory or ischemic conditions.
Or tension) is extremely important for detection (Wall and Melzack, 1994).

[0002] Capsaicin (8-methyl-N-vanillyl-6-nonenamide), a major stimulant component in "spicy" peppers, and its homologues, are the primary sensations involved in nociception and neuroinflammation. It interacts at specific membrane recognition sites that are almost exclusively expressed by neurons (Bevan and Szolcsanyi, 1990). Capsaicin is a highly selective activator of the thin or unmyelinated nociceptive afferents (Szolcsanyi, 1993; Szolcsanyi, 1996). Capsaicin derivatives show structure-function relationships, and their effects can be blocked by the selective antagonist capsazepine. A very potent tricyclic diterpene, resiniferatoxin (RTX) :( Szolcsanyi, 1999), binds to the capsaicin binding site with nanomolar affinity and is the rat gastric and visceral primary of the capsaicin receptor. A very localized distribution for sensory neurons was revealed (Szallasi et al., 1995). Interestingly, the density of RTX receptor sites in the nodules and dorsal root nodes increased after vagus and radial nerve ligation (Szalla
si et al., 1995).

Electrophysical studies have shown that vanilloid stimulates small sensory neurons by activating plasma membrane channels that are non-selectively permeable to cations (Bevan and Szolcsanyi, 1990; Oh et al., 1996; Woo
d et al., 1988).

Recently, one receptor for capsaicin (VR1) has been cloned from rat (Caterina et al., 1997) and shown to be a co-detector of H ⁺ (low pH) and contraction (Tominaga). et al., 1998). VR1 is expressed on small nociceptive neurons in the dorsal root node, consistent with its role in modulating peripheral pain (To
minaga et al., 1998). The vanilloid (“capsaicin”) receptor VR1 is activated by capsaicin and RTX, and the activation of VR1 is the antagonists capsazepine (CPZ; (Bevan et al., 1992)) and ruthenium red (RR; (W;
ood et al., 1998)) (Caterina et al., 1997). VR1 is a well-known ligand-gated, non-selective cation channel that exhibits outward rectification (Caterina et al., 1997). Recently, partial cDNA sequences of rat VR1 and VR2 and human sequences were disclosed in WO 99/09140.

Topical application of vanilloids such as capsaicin (Zostrix 0.025% and Zostr
ix HP 0.075%) to relieve neuropathic pain and to treat postherpetic neuralgia, diabetic neuropathy, postmastectomy pain, complex site pain syndromes, and persistent pain associated with rheumatoid arthritis. Used for (Robb
ins et al., 1998; Rowbotham, 1994; Szallasi and Blumberg, 1996). Prolonged exposure to capsaicin renders nociceptor cells insensitive to such agonists as well as to other noxious stimuli (Szolcsan
yi, 1993). The mechanism by which capsaicin causes analgesia is unknown,
Desensitization of nociceptive sensory neurons and consumption of peptides from the peripheral terminals, and injury to sensory nerves may be involved (Jancso et al., 1997; Rowbotham,
1994). Stimulation of capsaicin has limited its use considerably, and the expression of novel compounds that block the acidic and / or heat activation of capsaicin-sensitive receptors is considered. While the antagonists RR and CPZ show antinociceptive effects in behavioral studies (Santos and Calixo, 1997), they probably do not antagonize endogenous modulators of the capsaicin receptor and therefore are not effective analgesics in humans Was shown (Kress and Zeikhofer, 1999). However, CPZ blocked H ⁺ -induced currents derived from rat VR1 expressed in Xenopus oocytes (Tominaga et al., 1998).

[0006] Low doses of capsaicin protected the gastric mucosa against injury produced by various ulcerative agents (Ome et al., 1997). "The gastroprotective effect of capsaicin-type agents involves the enhancement of microcirculation performed through the release of mediator peptides from sensory nerve endings, with calcitonin gene-related peptides being the most relevant peptide candidates. Capsaicin-sensitive fibers are involved in gastric mucosal repair mechanisms. In most studies, capsaicin given to rat or cat stomach suppressed gastric acid secretion (Ome et al., 1997). " DNA molecule encoding a summary human vanilloid receptor (hVR1) of the invention are cloned,
And was characterized. The biological and structural properties of these proteins are disclosed as amino acid and nucleotide sequences. Recombinant protein is a receptor
Useful for identifying modulators of VR1. The modulators identified in the assays disclosed herein are useful as therapeutic agents for the treatment of inflammatory conditions associated with capsaicin receptor activity and for post-herpetic neuralgia,
Diabetic neuropathy, postmastectomy pain, complex site pain syndrome, arthritis (
It is a candidate for use as an analgesic for refractory pain associated with, for example, rheumatism and osteoarthritis) and for use in ulcers, neurodegenerative diseases, asthma, chronic obstructive pulmonary disease, inflammatory bowel syndrome and psoriasis. Recombinant DNA molecules, and parts thereof, to isolate homologues of DNA molecules, to identify genomic equivalents of DNA molecules, and to isolate and to identify mutants of DNA molecules And is useful for detecting or isolating. DETAILED DESCRIPTION The present invention relates to a DNA encoding the isolated human VR1 receptor from thalamus cDNA library of human. As used herein, human VR1 receptor refers to a protein that can specifically function as a receptor.

The complete amino acid sequence of the human VR1 receptor has not been known so far, and the complete nucleotide sequence encoding the known human VR1 receptor has not been known. This is the first report of cloning a full-length DNA molecule encoding the human VR1 receptor. A wide range of cells and cell types are expected to contain the described receptors.

Other cells and cell lines may also be suitable for use to isolate human VR1 receptor cDNA. Selection of appropriate cells can be done by screening for human VR1 receptor activity in cell extracts. Human VR1 receptor activity is ³ H
-By performing a [resiniferatoxin] binding assay (Acs et al., 1994; Sza
llasi and Blumberg, 1990; Szallasi et al., 1994; Szallasi et al., 1993; Sza
llasi et al., 1991), or can be monitored by direct measurement of capsaicin-, RTX- and / or low pH-induced Ca ⁺ influx or by non-selective cation flow through the hVR1 receptor (Caterina et al. , 1997). Human VR in this assay
Cells harboring 1 receptor activity may be suitable for the isolation of human VR1 receptor DNA or mRNA.

Human VR1 receptor DNA can be molecularly cloned using a variety of techniques known in the art. Such methods include, but are not limited to, direct functional expression of the human VR1 receptor gene after construction of a cDNA library containing the human VR1 receptor in a suitable expression vector system. Another method is to screen a cDNA library containing the human VR1 receptor constructed in a bacteriophage or plasmid shuttle vector using a labeled oligonucleotide probe designed from the amino acid sequence of the human VR1 receptor subunit. . A further method consists of screening a cDNA library containing the human VR1 receptor constructed in a bacteriophage or plasmid shuttle vector with a partial cDNA encoding the human VR1 receptor protein. This partial cDNA, through the design of degenerate oligonucleotide primers from the amino acid sequence of purified human VR1 receptor protein,
Obtained by specific PCR amplification of the human VR1 receptor DNA fragment.

Another method is to isolate RNA from human VR1 receptor producing cells and translate the RNA into proteins using in vitro or in vivo translation systems. RNA
To a peptide protein will result in the production of at least a portion of the human VR1 receptor protein identified, for example, by immunological reactivity with anti-human VR1 receptor antibody or by the biological activity of the human VR1 receptor protein. Let's do it. In this method, a pool of RNA isolated from human VR1 receptor-producing cells was
The presence of RNA encoding at least a portion of the human VR1 receptor protein can be analyzed. Further fractionation of the RNA pool can be performed to purify human VR1 receptor RNA from non-human VR1 receptor RNA. The peptide or protein produced by this method is analyzed to provide an amino acid sequence, which is then used to provide a primer for the production of human VR1 receptor cDNA, or analyzed RNA used for translation. To provide a nucleotide sequence encoding the human VR1 receptor and generate a probe for the production of human VR1 receptor cDNA. This method is known in the art and is described in, for example, Maniatis, T.,
Fritsch, EF, Sambrook, J. Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989. You can

It will be apparent to those skilled in the art that other types of libraries as well as libraries constructed from other cells or cell types may be useful for isolating DNA encoding the human VR1 receptor. Other types of libraries include, but are not limited to, cDNA libraries derived from other types of cells and DNA genomic libraries, including YAC (yeast artificial chromosome) and cosmid libraries.

It will be apparent to those skilled in the art that suitable cDNA libraries can be prepared from cells or cell lines that have human VR1 receptor activity. The selection of cells or cell lines for use in preparing a cDNA library to isolate the human VR1 receptor cDNA is performed by measuring the biological activity associated with capsaicin or by using the capsaicin ligand binding assay. This can be done by first measuring the cells associated with the receptor activity.

Preparation of the cDNA library can be performed by standard techniques well known in the art. Well-known cDNA library construction techniques are described in, for example, Maniatis, T., Fritsch, E.
F., Sambrook, J., Molecular Cloning: Laboratory Manual (Molec
ular Cloning: A Laboratory Manual), 2nd edition (Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989).

It will be readily apparent to those skilled in the art that the DNA encoding the human VR1 receptor can be isolated from a suitable genomic DNA library. Construction of a genomic DNA library can be done by standard techniques well known in the art. A well-known method for constructing a genomic DNA library is described in Maniatis, T., Fritsch, EF, Sambrook, J. Molecular Cloning: Laboratory Manual (Molecular Cloning: A La
boratory Manual), 2nd edition (Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989).
To clone the human VR1 receptor gene by the method described above, the amino acid sequence of the human VR1 receptor may be required. To achieve this, the human VR1 receptor protein can be purified and the partial amino acid sequence determined by an automated sequencer. Although it is not necessary to determine the entire amino acid sequence, the linear sequences of two regions of 6-8 amino acids from the protein are determined for the production of primers for PCR amplification of the human VR1 receptor DNA fragment.

Once the appropriate amino acid sequences have been identified, DNA sequences capable of encoding them are synthesized. Due to the degeneracy of the genetic code, one or more codons can be used to code for a particular amino acid, and therefore the amino acid sequences are similar in DN.
It can be encoded by any set of A oligonucleotides. Although only one member of this set is identical to the human VR1 receptor sequence, it can hybridize to human VR1 receptor DNA even in the presence of DNA oligonucleotides containing mismatches. This mispaired DNA oligonucleotide is able to hybridize well with human VR1 receptor DNA, allowing the DNA encoding the human VR1 receptor to be identified and isolated. DNA isolated by these methods can be isolated from various cell types,
DNA libraries can be screened from invertebrate and vertebrate sources and used to isolate homologous genes.

Purified biologically active human VR1 receptor can have several different physical states. The human VR1 receptor can be present as a full-length nascent or unprocessed polypeptide, or as a partially processed polypeptide or a combination with a processed polypeptide.
The full-length nascent human VR1 receptor polypeptide can be post-translationally modified by a specific proteolytic cleavage event, which results in the formation of fragments of the full-length nascent polypeptide. Although the fragment or physical association of fragments can have full biological activity associated with the human VR1 receptor, the extent of human VR1 receptor activity depends on the individual human VR1 receptor fragments and the physically associated human VR1 receptor poly. It can vary between peptide fragments.

The cloned human VR1 receptor DNA obtained through the methods described herein is molecularly cloned into an expression vector containing a suitable promoter and other suitable transcriptional regulatory elements, and recombinant human VR1 receptor protein is obtained. It can be expressed recombinantly by transfer into a prokaryotic or eukaryotic host cell for production.
Techniques for such manipulations are fully described in Maniatis, T, et al ., Supra ,
And it is well known in the art.

An expression vector is defined herein as a DNA sequence required for transcription of a cloned copy of a gene and translation of those mRNAs in the host. Such vectors are used to express eukaryotic genes in a variety of hosts such as bacteria including E. coli, fungal cells including cyanobacteria, insect cells, yeast cells and animal cells. be able to.

The specially designed vector allows the shuttle transport of DNA between hosts such as bacteria-yeast or bacteria-animal cells or bacteria-fungal cells or bacteria-invertebrate cells. Appropriately constructed expression vectors are:
It should contain origins of replication for autonomous replication in host cells, selectable markers such as a limited number of useful restriction enzyme sites, high copy number potential and active promoters. A promoter defines RNA polymerase as a DNA sequence that directs the binding of DNA to DNA and initiation of RNA synthesis. A strong promoter is one that frequently causes initiation of mRNA. Expression vectors include, but are not limited to, cloning vectors, modified cloning vectors, specially designed plasmids or viruses.

A variety of mammalian expression vectors can be used to express recombinant human VR1 receptor in mammalian cells. Commercially available mammalian expression vectors that may be suitable for recombinant human VR1 receptor expression include, but are not limited to, pMAMneo (
Clontech: pcDNA3 (Invitrogen), pMC1neo
(Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2-neo (ATCC37593) pBPV-1 (8-2) (ATCC37110), pdBPV-MMTneo (
342-12) (ATCC37224), pRSVgpt (ATCC37199), pRSVneo (ATCC37198), pSV2-dhfr
(ATCC37146), pUCTag (ATCC37460) and 1ZD35 (ATCC37565).

A variety of bacterial expression vectors can be used to express recombinant human VR1 receptor in bacterial cells. Commercially available mammalian expression vectors that may be suitable for recombinant human VR1 receptor expression include, but are not limited to, pET
Includes vectors (Novagen) and pQE vectors (Qiagen).

A variety of fungal cell expression vectors can be used to express recombinant human VR1 receptor in fungal cells such as yeast. Although not limited to commercially available fungal cell expression vectors that may be suitable for recombinant human VR1 receptor expression,
Includes pYES2 (In Vitrogen) and Pichia expression vector (Invitrogen).

A variety of insect cell expression vectors can be used to express recombinant human VR1 receptor in insect cells. Commercially available insect cell expression vectors that may be suitable for recombinant expression of recombinant human VR1 receptor include, but are not limited to, pBlu
Includes eBacII (Invitrogen).

The DNA encoding the human VR1 receptor can be cloned into an expression vector for expression in recombinant host cells. Recombinant host cells can be prokaryotic or eukaryotic cells, including but not limited to bacteria such as E. coli ,
Fungi such as yeast, mammalian cells including but not limited to human, bovine, porcine, simian and rodent sources, and insect cells including cell lines derived from, but not limited to, Drosophila and Bombyx mori. Including. Suitable and, but not limited to, cell lines derived from commercially available mammalian species include CV-1 (ATCC
CCL 70), COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651), CHO-K1 (ATCC
CCL 61), 3T3 (ATCC CCL 92), NIH / 3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2)
), C127I (ATCC CRL 1616), BS-C-1 (ATCC CCL 26), MRC-5 (ATCC CCL 171)
, L-cells and HEK-293 (ATCC CRL 1573).

Expression vectors include, but are not limited to, transformation, transfection,
It can be introduced into host cells via one of a number of techniques, including protoplast fusion, lipofectin and electroporation. Cells containing the expression vector are grown into colonies and analyzed individually to determine if they are producing the human VR1 receptor protein. Identification of host cell clones expressing the human VR1 receptor includes, but is not limited to, immunological reactivity with anti-human VR1 receptor antibodies, and the presence of human VR1 receptor activity associated with host cells.
This can be done by several means.

Expression of human VR1 receptor DNA can also be achieved by using synthetic mRNA produced in vitro. Synthetic mRNA or mRNA isolated from human VR1 receptor-producing cells can be efficiently translated in a variety of cell-free systems, including but not limited to wheat germ extract and reticulocyte extract, and Although not, it can be efficiently translated in a cell-based system that involves microinjection into frog oocytes, and microinjection into frog oocytes is generally preferred.

To determine the human VR1 receptor DNA sequence (s) that results in optimal levels of human VR1 receptor activity and / or human VR1 receptor protein, without limitation, the following human VR1 receptor DNA molecules: From about base 1 to about base 2517 (these numbers correspond to the first nucleotide of the first methionine and the final nucleotide before the first stop codon) to about 98,048 kD.
A full length open reading frame of human VR1 receptor cDNA encoding the protein of a, and some constructs comprising a portion of the cDNA encoding human VR1 receptor protein. All constructs were 5'or 3 of the human VR1 receptor cDNA.
'Can be designed to include no, all, or some untranslated regions. Levels of human VR1 receptor activity and protein expression can be measured after introduction of such constructs, either alone or in combination, into appropriate host cells. Human VR1 receptor D for optimal expression in a transient assay
After measurement of the NA cassette, this human VR1 receptor DNA construct was expressed for expression in host cells including, but not limited to, mammalian cells, baculovirus-infected insect cells, E. coli and yeast S. cerevisiae. And transferred to various expression vectors.

Both host VR1 receptor channel activity levels and human VR1 receptor protein levels can be assayed using host cell transfectants and microinjected oocytes by the following method. In the case of recombinant host cells, this involves co-transfection of one or possibly two or more plasmids containing human VR1 receptor DNA encoding one or more fragments or subunits. In the case of oocytes, this involves co-injection of synthetic RNA for the human VR1 receptor protein.
Is involved. After a suitable period of time to allow expression, cellular proteins, eg ³⁵ S-
It is metabolically labeled with methionine for 24 hours, after which cell lysates and cell culture supernatants are collected and subjected to immunoprecipitation with a polyclonal antibody against the human VR1 receptor protein.

Other methods for detecting human VR1 receptor activity include human VR1 receptor cD
Direct measurements of human VR1 receptor activity in whole cells transfected with NA or in oocytes injected with human VR1 receptor mRNA are involved. Human VR1 receptor activity is measured by the binding of specific ligands and the biological properties of host cells expressing human VR1 receptor DNA. For recombinant host cells expressing human VR1 receptor DNA, the patch voltage clamp technique is used.
que) can be used to measure receptor activity and quantify human VR1 receptor protein. The oocyte patch clamp as well as the two-electrode voltage clamp method can also be used to measure VR1 receptor activity by measuring single channel and whole cell conductivity, and to quantify human VR1 receptor protein.

The level of human VR1 receptor protein in host cells is quantified by immunoaffinity and / or ligand affinity methods. Cells expressing the human VR1 receptor can be assayed for the number of human VR1 receptor molecules expressed by measuring the amount of radioactive ligand bound to the cell membrane. Human VR1 receptor-specific affinity beads or human VR1 receptor-specific antibodies can be used to isolate, for example, ³⁵ S-methionine labeled or unlabeled human VR1 receptor protein. Labeled human VR1 receptor protein is analyzed by SDS-PAGE. Unlabeled human VR1 receptor protein can be isolated by Western blotting, ELISA or RI using human VR1 receptor-specific antibody.
Detect by A assay.

Due to the degeneracy of the genetic code, one or more codons can be used to encode a particular amino acid, and thus the amino acid sequence can be encoded by any set of similar DNA oligonucleotides. it can. Only one member of this group is human
It is able to hybridize to human VR1 receptor DNA under suitable conditions even in the presence of a DNA oligonucleotide that is identical to the VR1 receptor sequence but contains a mismatch. Under other conditions, this mispaired DNA oligonucleotide can hybridize to human VR1 receptor DNA, allowing the identification and isolation of DNA encoding human VR1 receptor.

DNA encoding the human VR1 receptor from a particular organism can be used to isolate and purify homologues of the human VR1 receptor from other organisms. To do this, the first human VR1 receptor DNA is mixed with a sample containing DNA encoding a homologue of the human VR1 receptor under suitable hybridization conditions. The hybridized DNA complex can be isolated and the DNA encoding the homologous DNA purified from them.

It is known that there is a substantial amount of redundancy in the various codons that code for particular amino acids. Therefore, the present invention is also directed to those DNA sequences that contain additional codons that ultimately encode translation into the same amino acid. The purpose of this specification is to define a sequence with one or more replaced codons as a degenerate mutation. Mutations in either the DNA sequence or the translated protein that do not substantially alter the ultimate physical properties of the expressed protein are also within the scope of the invention. For example, substitution of valine for leucine, arginine for lysine, or asparagine for glutamine does not cause a change in the function of the polypeptide.

It is known that the DNA sequence encoding a peptide can be modified to encode a peptide having properties that differ from those of the naturally occurring peptide. Methods for altering the DNA sequence include, but are not limited to, site-directed mutagenesis. Examples of modified properties include, but are not limited to, changes in the affinity of the enzyme for its substrate or of its receptor for its ligand.

As used herein, a “functional derivative” of the human VR1 receptor is a biological activity (functional or structural) that is substantially similar to the biological activity of the human VR1 receptor. Any of these compounds. The term “functional derivative” is intended to include “fragments”, “variants”, “degenerate variants”, “homologs” and “homologs” or “chemical derivatives” of the human VR1 receptor. The term "fragment" is meant to refer to any polypeptide subset of the human VR1 receptor. The term "variant" is meant to refer to a molecule of substantially similar structure and function to either the entire human VR1 receptor molecule or fragments thereof. A molecule is “substantially similar” to the human VR1 receptor if both molecules have substantially similar structures or if both molecules possess substantially similar biological activity. Thus, if two molecules possess substantially similar activity, they may be found even if one structure of the molecule is not found in the other, or even if
Even if the two amino acid sequences are not identical, they are considered to be variants. The term “homolog” refers to a molecule that is substantially similar in function to either the entire human VR1 receptor molecule or a fragment thereof. After expression of the human VR1 receptor in recombinant host cells, the human VR1 receptor protein can be recovered to provide the human VR1 receptor in its active state. Several purification methods for the human VR1 receptor are available and suitable for use. As described above for purifying human VR1 receptors from natural sources, recombinant human VR1 receptors are obtained from cell lysates or extracts, or from conditioned media, salt fractionation, ion exchange chromatography, size. It can be purified by various combinations of exclusion chromatography, hydroxyapatite adsorption chromatography and hydrophobic interaction chromatography or by individual application.

Further, recombinant human VR1 receptor may be derived from other cellular proteins such as full-length nascent human VR1 receptor, human VR1 receptor polypeptide fragment or human.
It can be separated by using an immunoaffinity column made of monoclonal or polyclonal antibodies specific for the VR1 receptor subunit.

Monospecific antibodies to the human VR1 receptor have been purified from mammalian antisera containing antibodies reactive to the human VR1 receptor, or Kohler and Milst.
Prepared as a monoclonal antibody reactive with human VR1 receptor using the technique of ein, Nature 256: 495-497 (1975). As used herein, a monospecific antibody is
It is defined as one antibody species or multiple antibody species with uniform binding properties for the human VR1 receptor. Homogenous binding, as used herein, refers to the ability of the antibody species to bind a specific antigen or epitope as associated with the human VR1 receptor as described above. Human VR1 receptor-specific antibodies may be prepared using a suitable concentration of human VR1 receptor with or without immunoadjuvant, such as mouse, rat, guinea pig, rabbit, goat, horse, etc., with rabbit being most preferred. It is an antibody specific for the human VR1 receptor produced by immunized animals.

Pre-immunization sera are collected before the first immunization. Each animal receives between about 0.1 mg and about 1000 mg of human VR1 receptor associated with an acceptable immune adjuvant.
Such acceptable adjuvants include, but are not limited to Freund's complete, Freund's incomplete, aluminum-precipitated, Corynebacterium parvum and water-in-oil emulsions containing tRNA. The primary immunization is composed of the human VR1 receptor at many sites, either subcutaneously (sc), intraperitoneally (IP) or both, preferably in Freund's complete adjuvant.
Each animal is bled at regular intervals (preferably weekly) and antibody titers are measured. Animals may or may not receive booster injections after the initial immunization. Animals receiving booster injections are generally given an equal amount of antigen in Freund's incomplete adjuvant by the same route. Booster injections are given at intervals of about 3 weeks until maximal titers are obtained. About 7 days after each boost, or about 1 week after a single immunization,
Animals are bled, serum collected, and aliquots stored at approximately -20 ° C.

Monoclonal antibody (mAb) reactive with human VR1 receptor is prepared by immunizing inbred mice (preferably Balb / c) with human VR1 receptor. Mice were immunized by the IP or SC route with about 0.1 mg to about 10 mg, preferably about 1 mg of human VR1 receptor in about 0.5 ml of buffer or saline containing the same volume of the above-mentioned acceptable adjuvant. Sensitize. Freund's complete adjuvant is preferred. Mice are primed on day 0 and rested for about 3 to about 30 weeks. Immunized mice receive one or more boosters by the intravenous (IV) route with about 0.1 to about 10 mg of the human VR1 receptor in a buffer solution such as phosphate buffered saline. Lymphocytes from antibody-positive mice, preferably splenic lymphocytes,
Obtained by removing the spleen from immunized mice by standard techniques known in the art. Hybridoma cells are produced by mixing spleen lymphocytes with a suitable fusion partner, preferably myeloma cells, under conditions which allow the formation of stable hybridomas. Fusion partners include, but are not limited to, mouse myeloma P3 / NS1 / Ag4-1; MPC-11; S-194 and Sp2 / 0, Sp
2/0 is generally preferred. About 30 to about 50% of antibody-producing cells and myeloma cells
Fusion in polyethylene glycol at a concentration of about 1000 molar weight. Fused hybridoma cells are selected by growing them in Dulbecco's Modified Eagle Medium (DMEM) supplemented with hypoxanthine, thymidine and aminopterin by procedures known in the art. Supernatants are collected from growth positive wells at about days 14, 18 and 21 and screened for antibody production by immunoassays such as the solid phase immunoradioassay (SPIRA) using the human VR1 receptor as the antigen. Cultures are also tested by the Ouchterlony precipitation assay to determine the isotype of the mAb. Hybridoma cells from antibody positive wells were analyzed by MacPherson, soft agar in tissue culture and application, (Soft Agar Technique, in Tissue Cultur
e Methods and Applications), edited by Kruse and Paterson, Academic Publishing, 1
Clone by a technique such as 973.

Monoclonal antibodies were applied to pre-stained primed (prid) 4 days after priming.
stane primed) Balb / c mice are produced by injecting about 2 x 10 ⁶ to about 6 x 10 ⁶ hybridoma cells at about 0.5 ml per mouse. About 8-12 after transferring cells
Ascites fluid is collected after days and the monoclonal antibody is purified by methods known in the art.

In vitro production of anti-human VR1 receptor mAb is carried out by growing hybridomas in DMEM containing about 2% fetal bovine serum to obtain sufficient quantities of specific mAbs. The mAb is purified by techniques known in the art.

Antibody titers in ascites or hybridoma cultures include, but are not limited to, precipitation, passive agglutination, enzyme-linked immunosorbent antibody (ELISA) method and radioimmunoassay (
It is measured by various serological or immunological assays including the RIA) method. A similar assay is used to detect the presence of human VR1 receptor in body fluids or tissue and cell extracts.

As will be readily apparent to one of skill in the art, the above methods for producing monospecific antibodies include human VR1 receptor polypeptide fragments, or full length nascent human VR1 receptor polypeptides, or individual human VR1 receptor polypeptides. It can be used to produce antibodies specific for the human VR1 receptor subunit. Specifically, the only human
It will be apparent to those skilled in the art that it is possible to produce monospecific antibodies specific for the VR1 receptor subunit or a fully functional receptor.

The human VR1 receptor antibody affinity column comprises an Affigel-10 (Bio-Rad) (gel activated with N-hydroxysuccinimide ester so that the antibody forms a covalent bond with the agarose gel bead support). It is created by adding it to a support). The antibody then binds to the gel via an amide bond using a spacer arm. Next, the remaining activated ester was treated with 1M ethanolamine HCl (pH 8).
To erase. The column is washed with water followed by 0.23M glycine HCl (pH 2.6) to remove unbound antibody or excess protein. The column is then equilibrated with phosphate buffered saline (pH 7.3) and the cell culture supernatant or cell extract containing human VR1 receptor or human VR1 receptor subunit is slowly passed through the column. Then the column is the optical density (A ₂₈₀₎ is washed with phosphate buffered saline down to background, then the protein is eluted with 0.23M glycine--HCl (pH 2.6). The purified human VR1 receptor protein is dialyzed against phosphate buffered saline.

A DNA clone designated the human VR1 receptor is identified which encodes a protein that forms a capsaicin-sensitive receptor when expressed in recombinant host cells. Expression of human VR1 receptor DNA results in reconstitution of the properties observed in oocytes injected with poly (A) ⁺ RNA encoding the human VR1 receptor, including direct activation with the appropriate ligand.

The present invention provides the expression of DNA or RNA encoding human VR1 receptor as well as human V1.
Also covered are methods of screening for compounds that modulate the function of the R1 receptor protein in vivo. Compounds that modulate such activity include DNA, R
It may be NA, peptide, protein or non-proteinaceous organic molecule. Compound is human
Compounds can be modulated by increasing or decreasing the expression of DNA or RNA encoding the VR1 receptor, or the function of the human VR1 receptor protein. Expression of DNA or RNA encoding the human VR1 receptor, or compounds that modulate the function of the human VR1 receptor protein can be detected by various assays. The assay can be a simple "yes / no" assay to determine if there is a change in expression or function. An assay can be made quantitative by comparing the expression or function of a test sample to the level of expression or function in a standard sample. The modulators identified in this way are useful as therapeutic agents.

Kits containing human VR1 receptor DNA or RNA, antibodies to human VR1 receptor, or human VR1 receptor protein can be prepared. Such kits are used to detect DNA in a sample that hybridizes to human VR1 receptor DNA or to detect the presence of human VR1 receptor protein or peptide fragments. Such characterizations are useful for a variety of purposes including, but not limited to forensic analysis, diagnostic applications and epidemiological studies.

The DNA molecules, RNA molecules, recombinant proteins and antibodies of the present invention can be used to screen and measure levels of human VR1 receptor DNA, human VR1 receptor RNA or human VR1 receptor protein. Recombinant proteins, DNA molecules, RNA molecules and antibodies serve to formulate kits suitable for their detection and typing of the human VR1 receptor. Such a kit will comprise a discrete carrier suitable for holding in a hermetically sealed manner in at least one container. The carrier can further include reagents such as recombinant human VR1 receptor protein or anti-human VR1 receptor antibody suitable for detecting human VR1 receptor. The carrier can also include detection means such as labeled antigens or enzyme substrates.

A nucleotide sequence complementary to the DNA sequence encoding the human VR1 receptor can be synthesized for antisense therapy. These antisense molecules are DNA
Stable derivatives of DNA, such as, phosphorothioate or methylphosphonate, 2
It may be a stable derivative of RNA, such as'-O-alkyl RNA, or other human VR1 receptor antisense oligonucleotide mimics. The human VR1 receptor antisense molecule can be introduced into cells by microinjection, liposome encapsulation, or by expression from a vector harboring the antisense sequence. Human VR1 receptor antisense therapy may be particularly useful in the treatment of diseases in which it is advantageous to reduce human VR1 receptor activity.

Human VR1 receptor antisense therapy can be used to introduce human VR1 receptors into cells of a target organism. The human VR1 receptor gene can be linked to a viral vector that mediates transport of human VR1 receptor DNA upon infection of the recipient host cell. Suitable viral vectors include retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, polio virus and the like. Alternatively, human VR1 receptor DNA can be used for gene therapy by non-viral techniques including receptor-mediated targeted DNA transfer, lipofectin membrane fusion or direct microinjection using ligand-DNA conjugates or adenovirus-ligand-DNA conjugates. Can be transported to cells for. Such techniques, and their modifications, have been demonstrated in humans in vivo and in vivo.
Suitable for VR1 receptor gene therapy. Human VR1 receptor gene therapy, human VR1
It may be particularly useful in the treatment of diseases where it is advantageous to increase receptor activity.

A pharmaceutically useful composition comprising human VR1 receptor DNA, human VR1 receptor RNA, or human VR1 receptor protein, or a modulator of human VR1 receptor activity may be prepared by admixing a pharmaceutically acceptable carrier. It can be formulated according to known methods. Examples of such carriers and methods of formulation can be found in Remington's Pharmaceutical Science. Such compositions will contain an effective amount of protein, DNA, RNA or modulator to form a pharmaceutically acceptable composition suitable for effective administration.

The therapeutic or diagnostic compositions of the invention are administered to an individual in an amount sufficient to treat or diagnose a disease that exhibits modulation of the activity associated with the human VR1 receptor.
The effective amount can vary according to various factors such as the individual's condition, weight, sex and age. Other factors include the mode of administration. The pharmaceutical composition is administered to an individual subcutaneously, topically,
It can be provided by various routes such as oral and intramuscular.

The term “chemical derivative” describes a molecule that contains additional chemical moieties that are not normally a part of the basic molecule. Such moieties can improve solubility, half-life, absorption, etc. of the base molecule. Alternatively, this moiety can reduce unwanted side effects of the base molecule or reduce the toxicity of the base molecule. Examples of such moieties are Remington's Pharmaceutical Scien
CE).

The compounds identified in accordance with the methods disclosed herein may be appropriately determined by routine testing to obtain optimal inhibition of the human VR1 receptor or its activity with minimal possible toxicity. It can be used alone at a dosage. Simultaneous or sequential administration of other agents may be desirable.

The present invention aims to provide suitable topical, oral, systemic and parenteral pharmaceutical formulations for use in the novel methods of treatment of the present invention. For use in modulating the human VR1 receptor, a composition comprising as an active ingredient a compound or modulator identified by the methods of the present invention is provided in a wide variety of therapeutic dosage forms for administration in conventional excipients. Can be administered at. For example, the compound or modulator may be a tablet, capsule (each of which may include an appropriate release and sustained release formulation),
It can be administered in oral dosage forms such as pills, powders, granules, elixirs, tinctures, solutions, suspensions, syrups and emulsions, or by injection. Similarly, the compositions can be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous, closed or non-topical, or intramuscular forms, all forms of use being well-known to those of ordinary skill in the pharmaceutical arts. Is well known to. An effective, but non-toxic amount of the desired compound can be used as a modulator of the human VR1 receptor.

The daily dosage of product may be varied over a wide range from 0.01 to 1,000 mg per patient per day. For oral administration, the composition is preferably 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 2 for a symptomatic dosage for the patient to be treated.
Notched or marked with 5.0 and 50.0 mg of active ingredient
Not provided in tablet form. Effective amount of drug is usually 0.0001 mg / kg daily
Supplied at a dosage level of about 100 mg / kg body weight. This range is more detailed every day,
It is about 0.001 mg / kg to about 10 mg / kg body weight. The dosage of human VR1 receptor modulator is adjusted at the time of combination to achieve the desired effect. On the other hand, the dosages of such various agents can be adjusted independently and combined so that the synergistic effect of reducing the pathology is achieved even when either agent is used alone.

Advantageously the compounds or modulators of the present invention may be administered in a single daily dose or the total daily dosage may be administered in divided doses of two, three or four times daily. . In addition, the compounds or modulators of the invention may be administered intranasally via topical use of suitable intranasal vehicles, or using transdermal skin patch vehicles known to those of ordinary skill in the art. It can be administered via the dermal route. For administration in the form of transdermal delivery systems, the frequency of dosing will, of course, be continuous rather than intermittent throughout the dosing schedule.

For co-treatment with one or more active agents, the active agents can be administered simultaneously, where the active agents are in separate dosage formulations, or each can be administered at separate times.

Dosage regimens utilizing the compounds or modulators of the invention will vary depending on the type of patient,
Species, age, weight, sex and medical condition: severity of condition to be treated: route of administration: and renal and hepatic function of the patient: and selected according to a variety of factors including those particular compounds used. A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the drug required to prevent, counter or arrest the progress of the condition. Optimal formulations to achieve drug concentrations within the range that yields efficacy without toxicity require formulations based on the kinetics of drug availability to the target site. This involves drug distribution, equilibration and exclusion.

In the methods of the present invention, the compounds or modulators described in detail herein can be formed into an active ingredient and are typically intended for administration, ie oral tablets, capsules, elixirs. And the like, and is administered in admixture with a suitable pharmaceutical diluent, adjuvant or carrier (collectively referred to herein as "carrier" material), which is appropriately selected for such as and consistent with conventional pharmaceutical practice.

For oral administration, eg in the form of tablets or capsules, the active ingredient is ethanol,
It may be combined with an oral non-toxic pharmaceutically acceptable inert carrier such as glycerol, water and the like. In addition, if desired or necessary, suitable binders, lubricants, disintegrating agents and coloring agents can also be included in the mixture. Suitable binders include, but are not limited to, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, or natural and synthetic gums such as acacia, tragacanth or sodium alginate, carboxymethylcellulose, Includes polyethylene glycol, wax, etc. Lubricants used in these dosage forms include, but are not limited to, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like. Disintegrators include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan and the like.

For liquid dosage forms, the active ingredient can be admixed with synthetic and suitable gums, for example suitable flavored suspensions or dispersions such as tragacanth, acacia, methylcellulose and the like. Other dispersants that can be used include glycerin and the like. For parenteral administration, sterile suspensions and solvents are desired. Isotonic preparations which generally contain suitable preservatives are employed when intravenous administration is desired.

Topical preparations containing the active pharmaceutical ingredient may be prepared by a variety of techniques known in the art such as alcohol, aloe vera gel, allantoin, glycerin, vitamin A and E oils, mineral oil, PPG2 myristyl propionate and the like. Mixed with carrier material,
For example, alcoholic solvents, topical cleansers, cleansing creams, skin gels, skin lotions and shampoos can be formed with cream or gel formulations.

The compounds or modulators of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles and large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from various phospholipid states such as cholesterol, stearylamine or phosphatidylcholines.

The compounds of the present invention may be delivered by the use of monoclonal antibodies as individual carriers to which compound molecules are attached. The compounds or modulators of the present invention can also be coupled with soluble polymers as targetable drug carriers. Such polymers can include polyvinyl-pyrrolidone, pyran copolymer, polyhydroxypropylmethacryl-amidophenol, polyhydroxy-ethylaspartamidophenol, or polyethyl-ene oxide polylysine substituted with palmitoyl residues. Additionally, the compounds or modulators of the invention are biodegradable polymers of the type useful to achieve controlled release of a drug,
For example, polyacetic acid, polyepsilon-caprolactone, polyhydroxybutyric acid, polyorthoesters, polyacetals, polydihydro-pyrans, polycyanoacrylates and hydrogels can be linked to crosslinked or amphiphilic block copolymers.

For oral administration, the compounds or modulators may be administered in capsules, tablets or boluses or they may be mixed with animal feed. Capsules, tablets and boluses consist of the active ingredient in combination with a suitable carrier excipient such as starch, talc, magnesium stearate or dicalcium phosphate. Such unit dosage form is an intimate admixture of the active ingredient with suitable finely divided powdered inert material containing diluents, fillers, disintegrating agents and / or binders so as to obtain a uniform mixture. Is prepared by. Inactive materials do not react with compounds or modulators and are non-toxic to the treated animal. Suitable inert materials include starch, lactose, talc, magnesium stearate, vegetable gums and oils and the like. Such a formulation may include the size and type of animal species being treated,
And depending on a number of factors such as the type and severity of the infection, widely variable amounts of active ingredient and inert material can be included. The active ingredient can be obtained by simply mixing the compound with the feed or by placing the compound on the surface of the feed.
It may be administered as an additive to feed. Alternatively, the active ingredient may be mixed with an inert carrier and the resulting composition either mixed with the feed or fed directly to the animal. Suitable inert carriers include corn meal, citrus meal, fermentation residues, soy grit, dried cereals and the like. The active ingredients are thoroughly mixed with these inert carriers by grinding, stirring, milling or rolling so that the final composition comprises from 0.001% to 5% by weight of active ingredient.

Alternatively, the compound or modulator may be administered parenterally via infusion of a formulation consisting of the active ingredient dissolved in an inert liquid carrier. The injection can be either intramuscular, intraductal, intrathecal or subcutaneous. Injectable formulations consist of the active ingredient in admixture with a suitable inert liquid carrier. Acceptable liquid carriers include
Vegetable oils such as peanut oil, cottonseed oil, sesame oil, etc. as well as solketal (solk
et al), glycerol formal and the like organic solvents. As another formulation, an aqueous parenteral formulation can also be used. Vegetable oils are a suitable liquid carrier. This formulation is prepared by dissolving or suspending the active ingredient in a liquid carrier so that the final formulation contains 0.005-10% by weight of active ingredient.

Topical application of the compounds or modulators is possible through the use of liquid drenches or shampoos containing the compound or modulator as an aqueous solvent or suspension. These formulations generally include a suspending agent such as bentonite, and usually also an antifoaming agent. Formulations containing 0.005-10% by weight of the active ingredient are acceptable. Suitable formulations are those containing 0.01-5% by weight of the compound or modulator.

The following examples illustrate the invention but do not limit them.

[0070]

Example 1 Preparation of human thalamus library cDNA synthesis: First strand synthesis: Approximately 5 μg of human thalamus mRNA (Clontec: Clontec
h) using a cDNA synthesis kit (Life Technologies: Life Technologies
) Was used to synthesize cDNA. Two microliters of NotI primer adapter was added to 5 μl of mRNA and the mixture was heated to 70 ° C. for 10 minutes and placed on ice. The following reagents were added on ice: 4 μl of 5 × first strand buffer (250 mM TRIS-HCl
(pH 8.3), 375 mM KCl, 15 mM MgCl ₂ ), 2 μl of 0.1 M DTT, 10 mM dNTP (nucleotide triphosphate) mix and 1 μl of DEPC treated water. The reaction was incubated at 42 ° C for 5 minutes. Finally 5 μl of Superscript RTII was added and incubated at 42 ° C. for more than 2 hours. The reaction was stopped on ice. Second Strand Synthesis: The first strand product was adjusted to 93 μl with water and the following reagents were added on ice: 30 μl of 5 × second strand buffer (100 mM TRIS-HCl (pH 6.9), 450 mM KCl,
23 mM MgCl ₂ ), 0.75 mM β-NAD +, 50 mM (NH ₄ ) ₂ SO ₄ ), 3 μl of 10 mM dNTP (nucleotide triphosphate), 1 μl of E. coli DNA ligase (10 units) 1 μl RNaseH
(2 units), 4 μl DNA pol I (10 units). The reaction was incubated at 16 ° C for 2 hours. DNA from second strand synthesis was treated with T4 polymerase and placed at 16 ° C to blunt the DNA ends. Double-stranded cDNA was extracted with 150 μl of phenol and chloroform mixture (1: 1, volume: volume) and precipitated with 0.5 volume of 7.5M NH4OAc and 2 volumes of absolute ethanol. The pellet was washed with 70% ethanol and dried at 37 ° C to remove residual ethanol. The double-stranded DNA pellet was resuspended in 25 μl water and the following reagents were added: 10 μl 5 × T4 DNA ligase buffer, 10 μl SalI adapter and 5 μl T4 DNA ligase. The materials were mixed gently and allowed to ligate overnight at 16 ° C. The ligation mix was extracted with phenol: chloroform: isoamyl alcohol, vortexed thoroughly and centrifuged at 14,000 xg for 5 minutes at room temperature to separate the phases. The aqueous phase was transferred to a new tube and the volume adjusted to 100 ml with water. Chromaps the purified DNA
Smaller cDNA molecules were excluded by size selection on an in 1000 column (Clontech). The double-stranded DNA was digested with NotI restriction enzyme at 37 ° C for 3 to 4 hours. The restriction digest was electrophoresed on a 0.8% low melting agarose gel. A cDNA in the range of 1-5 kb was excised and purified using Gelzyme (Invitrogen). The product was extracted with phenol: chloroform and precipitated with NH ₄ OAc and absolute ethanol. The pellet was washed with 70% ethanol and resuspended in 10 ml water. Ligation of cDNA to vector: Divide the cDNA into 5 tubes (2 μl each), and ligate the reaction with 4.5 μl water, 2 μl 5 × ligation buffer, 1
Prepared by adding μl of p-Sport vector DNA (digested with Sal-1 / Not1 and phosphatase treated) and 0.5 μl of T4 DNA ligase. Ligation was incubated overnight at 40 ° C. Introduction of ligated cDNA into E. coli by electroporation: The ligation reaction volume was adjusted to a total volume of 20 μl with water. 5 ml of yeast tRNA, was added absolute ethanol 7.5M NH ₄ OAc and 70ml of 12.5ml (-20 ℃). Vortex the mixture thoroughly, and immediately at room temperature for 20 minutes, 14,000x.
Centrifuge at g. The pellets were washed with 70% ethanol and each pellet resuspended in 5 ml water. Pool all 5 ligations (25 ml) and add 100 μl
DH10B electro-competent cells (Life Technologies) were electroporated with 1 ml of DNA (total 20 electroporations) and then plated on ampicillin plates to determine the number of recombinants per microliter (cfu). It was measured. Seed the entire library in 2 liters of Super Broth and
ga) Maxipreps were made using the MaxiPrep kit and purified by a cesium chloride gradient. Example 2: Library Screening / Preparation of Human VR1 Human Thalamus Library Screening: A 1 microliter aliquot of the human thalamus library was used for Electromax DH1.
OB cells (Life Technologies) were electroporated. The volume was adjusted to 1 ml with SOC medium and incubated at 37 ° C for 45 minutes with shaking. The library was then plated on 150 cm ² plates containing LB to a density of 20000 colonies per plate. This culture was grown overnight at 37 ° C.

The human VR1 receptor probe was made by polymerase chain reaction using the following primer pairs: 5'oligo (SEQ ID NO: 1): 5'GACCCTAACTCCAGGCCACCTCCAG 3'oligo (SEQ ID NO: 2): 5'AGATACTCCTGCGATCATAGAGCCTGAGGG probe , 5'and 3'probe oligos (100 for each) using normal PCR conditions.
ng) and 10 ng of the diluted miniprep DNA. The generated 274 bp fragment was run on a 1% agarose gel and QUIAquick Gel
Purified using an extraction kit (Qiagen). About 100 ng of purified probe
Alpha 32P using oligo labeling kit from Pharmacia
And labeled DNA was purified on S-200 column (Fermacia).

Library colonies were labeled with Protran nitrocellulose (Shashire and
Swell: Scheicher & Schuel) and the DNA was denatured in 1.5M NaCl, 0.5M NaOH. Filter discs were neutralized with 1.5 M NaCl, 1.0 M Tris-HCl, pH 7.5 and UV cross-linked to the membrane using UV-Stratalinker (Stratagene). Filter washing solution (1M Tris-HCl, pH8.0; 5M NaCl; 0.5M EDTA; 20% SDS)
Washed several times at 42 ° C in. The disc is then filled with 50% formaldehyde and 10
The cells were incubated at 42 ° C. for 6 hours in 1 × Southern prehybridization buffer (5′-3 ′) containing 0 ug / ml sheared salmon testis DNA (5′-3 ′). Finally, hybridization was carried out at 42 ° C. overnight in the presence of a labeled probe in 1 × hybridization buffer (5′-3 ′ company) containing 50% formaldehyde and 100 ng of sheared salmon testis DNA. .

The disks were placed in 2 × SSC, 0.2% SDS twice at room temperature (20 minutes each) and 0.2 × SS.
Washed in C, 0.1% SDS at 50 ° C for 30 minutes. The membrane was then placed on several pieces of filter paper, wrapped in Saran wrap and exposed to film overnight at -20 ° C.

Positive colonies were identified and collected by picking colonies from the original plate. Colonies were incubated in LB at 37 ° C for 1 hour. Culture dilutions were placed on LB agar plates and filters were raised, hybridized, washed and the colony picking procedure repeated. Individual colonies from the second screen were picked and digested with EcoRI / NotI to determine insert size and insert sequence.

The full-length clone was cloned using Pfu polymerase by PCR with 10 ng of the sequenced library clone as template and EcoRI (FL5 'oligo SEQ ID NO: 3) and NotI (FL3' oligo SEQ ID NO: 4) sites. Was made using the full length oligo containing.
FL 5'oligo (SEQ ID NO: 3): 5'AACGTTGAATTCGCCACCATGAAGAAATGGAGCAGCACAGACTTGG FL3 'oligo (SEQ ID NO: 4): 5'AACGTTGCGGCCGCGTGCTGTCTGCGTGACGTCCTCAC PCR product was digested with EcoRI and NotI enzymes and cloned into pGem HE expression vector. Large scale DNA preparation was performed using the MEGA prep kit (Qiagen). Example 3-Cloning of human VR1 receptor cDNA into a mammalian expression vector Human VR1 receptor cDNA (collectively referred to as hVR1) is a mammalian expression vector pc.
It was cloned into DNA3.1 / Zeo (+). The cloned PCR product was purified on a column (Wizard PCR DNA Purification Kit from Promega) and digested with NotI and EcoRI (NEB) to create sticky ends. The product was purified by low melting point agarose gel. pcDNA3
The .1 / Zero (+) vector was digested with EcoRI and NotI enzymes and subsequently purified by low melting agarose gel. A linear vector was used to ligate to the human VR1 cDNA insert. To isolate the recombinant, name it human VR1 receptor, and to transfect mammalian cells (HEK293, COS-7 or CHO-K1 cells), Effect
The ene non-liposome lipid-based transfection kit (Qiagen) was used. Stable cells were selected by growth in the presence of Zeocin. One zeocin resistant colony was isolated and shown to contain the complete human VR1 receptor gene. Colonies containing human VR1 receptor cDNA were analyzed for hVR1 protein expression. Recombinant plasmids containing DNA encoding the human VR1 receptor were used to transform mammalian COS or CHO cells or HEK293 cells.

Using cells that stably or transiently express the human VR1 receptor,
Expression of human VR1 receptor and ³ H-RTX binding activity were tested. Using these cells, the ability of other compounds to modulate, inhibit or activate the human VR1 receptor and antagonize radioactive ³ H-RTX binding was identified and investigated.

A cassette containing the human VR1 receptor cDNA in the positive direction with respect to the promoter,
It is linked to the appropriate restriction sites 3'of the promoter and identified by mapping and / or sequencing the restriction sites. These cDNA expression vectors are used in fibroblastic host cells such as COS-7 (ATCC # CRL1651) and CV-1 tat [Sackevitz et al.
al., Science 238: 1575 (1987)], 293, L (ATCC # CRL 6362)], including but not limited to electroporation or chemical methods (cationic liposomes, DEAE dextran, calcium phosphate). Introduce by method. Transfected cells and cell culture supernatants are harvested and analyzed for human VR1 receptor expression as described herein.

All vectors used for mammalian transient expression can be used to establish stable cell lines expressing the human VR1 receptor. The unmodified human VR1 receptor cDNA construct cloned into the expression vector is expected to program the host cell to make the human VR1 receptor protein. Transfected host cells include, but are not limited to, CV-1-P [Sackevitz et al., Scie
nce 238: 1575 (1987)], tk-L [Wigler, et al ., Cell 11: 223 (1977)], NS / O, and
dHFr-CHO [Kaufman and Sharp, J. Mol. Biol. 159 : 601, (1982)].

Any vector containing the human VR1 receptor cDNA, including but not limited to G41
8. Co-transfection with drug selection plasmid containing aminoglycoside phosphotransferase; hygromycin, hygromycin-B phosphotransferase; APRT, xanthine-guanine phosphoribosyl-transferase allows stable transfection of clones. Would do. Levels of human VR1 receptor are quantified by the assays described herein.

The human VR1 receptor cDNA construct can also be ligated to a vector containing an amplifiable drug-resistance marker to produce a clone of mammalian cells that synthesizes the highest possible level of human VR1 receptor. After introduction of such a construct into cells, selection of plasmid-containing clones with an appropriate drug, and isolation of over-expressing clones containing high copy number plasmids at higher drug doses. By.

Expression of recombinant human VR1 receptor is achieved by transfecting a full-length human VR1 receptor cDNA into a mammalian host cell. Example 4 Functional protein encoded by pVR1R in Xenopus oocytes
Characterization Xenopus laevis oocytes were prepared and injected using standard methods previously described and known in the art (Fraser et al., 1993). Adult female Xenopus laevis (Nas)
co), Fort Atkinson, Wisconsin)
Rinse several times with Ca-free saline (containing 82.5 mM NaCl, 2.5 mM KCl, 1 mM MgCl ₂ , 5 mM HEPES and adjusted to pH 7.0 with NaOH (OR-2)), and 0.2% type 1 collagenase ( ICN
Shake gently with OR-2 containing ICN Biomedicals, Aurora, OH for 2-5 hours. When approximately 50% of the follicular layer was removed, the V and VI
Stage oocytes were selected and rinsed in media consisting of 75% OR-2 and 25% ND-96. ND-96 is 100 mM NaCl, 2 mM KCl, 1 mM MgCl ₂ , 1.8 mM CaCl ₂ , 5 mM HEPES.
, 2.5 mM Na pyruvate, gentamicin (50 ug / ml), and adjusted to pH 7.0 with NaOH. Extracellular Ca ⁺ was progressively elevated and cells were maintained in ND-96 for 2-24 hours prior to injection. For in vitro transcription, pGEM HE (Liman et al.,
1992) was linearized with NheI and transcribed with T7 RNA polymerase (Promega) in the presence of the cap analog m7G (5 ') ppp (5') G. The synthesized cRNA was precipitated with ammonium acetate and isopropanol and resuspended in 50 μl nuclease-free water. cRNA is formaldehyde gel (1% agarose, 1 x MOP
S, 3% formaldehyde), 1, 2 and 5 μl RNA marker (Gibco
(Gibco) BRL, 0.24-9.5 Kb).

Oocytes were injected with 50 nl of human VR1 receptor RNA (0.025-2.5 ng). Control oocytes were injected with 50 nl of water. Oocytes were incubated in ND-96 for 1-10 days and then analyzed for human VR1 receptor expression. Incubation and collagenase digestion were performed at room temperature. Injected oocytes were maintained at 18 ° C in 48-well cell culture clusters (Costar; Cambridge, MA). Whole-cell agonist-induced currents were measured 14 days after injection by the standard two-electrode voltage clamp (GeneClamp500, Axon In
struments), Foster City, California)
It was then measured using methods known in the art (Dascal, 1987). The microelectrode was filled with 3M KCl, which had resistances of 1 and 2Ω. Cells were continuously perfused with ND96 at 10 ml / min at room temperature unless indicated. Membrane voltage is -60 mV unless indicated
Clamped to.

Capsaicin (C: 0.1-10 μM) induced an inward current in oocytes injected with RNA transcribed from cloned hVR1 receptor cDNA as shown in FIGS. 4, a, b, c. . The inward current through the hVR1 receptor evoked by exposure to 1 μM capsaicin (peak current -0.144 +/- 0.035 (n = 15)) rises slowly,
And it did not show normally discernible desensitization over the period of experimentation with BaSOS (Fig. 4a, b). The response to 1 μM capsaicin is 3 μM, which is an antagonist
Capsazepine (CPZ) (a highly selective antagonist of the VR1 receptor (Fig. 4a;
n = 3)) and 1-10 μM ruthenium red (RR; FIG. 4b; n = 3) preincubation completely blocked. The capsaicin response was partially restored after exhaustive washout of the antagonist (right panel in Figures 4a, b). Some of this data was also replicated in two other batches of oocytes.

The magnitude of the capsaicin-induced response depended on the amount of cRNA injected. 1 μM
Response to capsaicin (at a holding potential of -40 mV) was 0.025 ng, 0.25 ng
And for oocytes injected with 2.5 ng of cRNA, -0.02 +/- 0.004 μA (
n = 3), -0.34 +/- 0.32 μA (n = 3) and -2.03 +/- 1.07 μA (n = 3).

The currents evoked by capsaicin (Fig. 4c) and RTX (Fig. 4d) were -120 to 8 by using the voltage ramp protocol.
It was measured at a voltage between 0 mV. The currents induced by both agonists were strongly rectified out as previously reported for rat VR1 (Caterina et al., 1997). The response to capsaicin and RTX was that they were -2.7 +/- 0.9mV (n = 12
) And -5.6 +/- 1.0-mV (n = 4), respectively, which is consistent with non-selective cation channel activation. The non-inactivating currents are both Ca ²⁺ and Ba ²⁺
Induced by Resiferratoxin in a medium containing

Capsaicin induced an inward current in a dose-dependent manner (FIG. 5). The capsaicin response was recorded while applying the compound to cells either voltage clamped at -60 mV or challenged with the voltage ramp protocol. The EC50 for capsaicin was approximately 200 nM. The RTX effect was also dose-dependent. Cells to a negative membrane potential (
For example -40 mV). 10nM RTX gave 17% of the response to 1 μM capsaicin,
Induced 39% and 35% (n = 3), and 100 nM RTX induced 436 and 277% response to 1 μM capsaicin (n = 2). The magnitude of the response to RTX is
It is larger than expected compared to that observed for rat VR1 and may depend on various experimental methods used. In such experiments, capsaicin
It was applied first as it was reversible after a continuous wash of minutes.

CPZ produced a dose-dependent block of the capsaicin response as shown in FIG. Oocytes were pre-incubated with capsaicin (0.6 μM) and after 4 minutes with the indicated concentrations of capsazepine (CPZ; FIG. 6). CPZ dose-dependently blocked the continuous response to 0.6 μM capsaicin (in the continuous presence of CPZ). CPZ IC50
Was about 100 nM.

Human VR1 expressed from the DNA molecules encoding human VR1 described herein has low p
It was activated by H solution (ND96, pH 5.5; Figure 7). Low pH activated the current as well as induced by capsaicin. The response had a reverse potential close to 0 mV (n =
2). The low pH activating current was activated in the same cells as the time course induced by capsaicin, and blocked by CPZ (1 μM; FIG. 7b). Example 5 Characterization of Human VR1 Transiently and Stablely Expressed in Mammalian Cell Lines Human HEK293 cells were transfected with human VR1 receptor pVR1R or vector pcDNA3.1 / zeo (+).
Transfected with either. 1 μg of transient transfectants of pVR1R or vector per 10 ⁶ cells per 100 mm dish was achieved using the Effectene Transfection Kit (Qiagen: 301425). Three days after transfection, cells were plated in 96-well plates (Biocoat, Poly-
Black / clear plate coated with D-lysine; Becton Dicki
nson) Product # 354640). After 1 day, rinse the wells with F12 / DMEM and then Flu
Incubated with pluronic acid (20%, used at 40 μl in a total volume of 20 ml) in o-4 (2 μM) for 1 hour at room temperature. The plate is FLIPR (Molecular Device is
(Molecular Devices), FL-101). Cell agonist (8
Challenged at a concentration of 3 × in 40 μl added to 0 μl at a rate of 50 μl / sec). Transfection with vector alone was tested as a control. Antagonists were included for 1-2 minutes as indicated before adding agonist in the presence of antagonist.

After 3 days, cells were selected in the presence of Zeocin (200 μl / ml) and for about 2 weeks,
Grow through three 1:10 dilution passages. Individual colonies were picked and grown in 6-well dishes. The cells are then placed in a 96-well plate (Biocoat,
Black / transparent plate coated with poly-D-lysine; Becton Decksonson product # 35
4640). The plate is FLIPR (Molecular Devices
ces), FL-101) and assayed as above.

Ca ²⁺ influx was observed in HEK293 cells transiently transfected with hVR1 in response to capsaicin (1 μM) and RTX (100 nM) (FIG. 8a). Capsaicin caused an influx of Ca ²⁺ into cells transiently transfected with hVR1 (FIG. 8a1), but not cells transfected with vector alone (FIG. 8b1), and was specific for the expressed human VR1 protein. It showed the function. The capsaicin response was partially blocked by preincubation with 0.1 μM (FIG. 8a2) and 1 μM CPZ (FIG. 8a3) for up to 1 minute (approximately 11% and 30% block, respectively). A slow rise to 100 nM RTX was observed in cells transfected with hVR1 (FIG. 8a4), which was completely blocked by 1 μM CPZ (FIG. 8a5). Again, the response was specific to cells transfected with hVR1 as the cells transfected with the vector alone did not produce a specific Ca ²⁺ influx in response to RTX (FIGS. 8b4-5).

HEK293 cells stably expressing hVR1 were constructed and their capsaicin (15
nM) and ruthenium red (Fig. 9A-B) and CPZ (Fig. 9C).
) Was tested. FLIP is an agonist that induces an increase in intracellular Ca2 +.
Observed as an increase in fluorescence intensity measured at R, and shown in Figure A. The concentration of ruthenium red (as well as the stimulant) present in the 2 minute preincubation was increased from 0.1 μM (2nd column) to 17 μM (11th column). The concentrations are 0, 0.1, 0.3, 0.45, 0.7, 1, 1.7, 3, 6, 10, respectively in columns 1-12.
17 and 0 μM. IC50 for ruthenium red is 0 for 15 nM capsaicin
0.88 [95% confidence interval: 0.63 to 1.2 μM; n = 6 separate experiments]. Similar experiments were performed with CPZ and the IC50 was 200 nM (95% confidence interval: 90-46.
0 nM) (n = 5 experiments).

Whole cell patch clamp technique (Hamill et al., 1981)
VR1 Receptor maintained on a 12 mm cover strip for 2 days or longer using
Ligand-induced currents were recorded from HEK293 cells that were stably expressing A. Cells were visualized with a DIC Nomarski optical machine using a Nikon Diaphot 300. Cells are continuously perfused in saline unless otherwise indicated (~ 0.5 ml / min).
Standard saline (“Tyrodes”) is: 130 mM NaCl, 4 mM KCl, 1 mM CaCl ₂ , 1.2 mM MgC
l ₂ and 10 mM Hemi-Na-HEPES (pH 7.3, Wescor 5500 steam-pressure (Wesc
or), Logan, Utah) and 295-300 mOsm). Recording electrodes were made from borosilicate capillaries (R6; Garner Glass, Claremont, Calif.) And the tip was coated with a dental peripheral wax (Miles Laboratories, South Bent, Indiana). , And intracellular salt solution: 100 mM K-glucose, 25 mM KCl, 0.483 mM CaCl ₂ , 3 mM MgCl ₂ ,
It contained a resistance of 1-2 MΩ when it contained 10 mM hemi-Na-HEPES and 1 mM K ₄ -BAPTA (100 nM free Ca ²⁺ ); pH 7.4 (with dextrose added to achieve 290 mOsm). Both liquid connection potentials are empirical, and the computer program JPCalc ((Ba
-18 mV using standard pipettes and bath solutions, as measured using rry, 1994)). The voltage data shown was not corrected for liquid connection potential (ie after correction for connection potential, the voltage shown at +10 would be -8 mV). Axopatch ID patch-clamp amplifier (Axon Instruments) where current and voltage signals are detected and digitally recorded on DigiData 1200B Laboratory Interface (Axon Instruments) and PC compatible computer systems and stored on magnetic disk for off-line analysis. , Foster City, CA) at 2 kHz. Data acquisition and analysis was performed with PClamp software. Total membrane capacitance (Cm) was determined as the difference between the maximum current after a 30 mV hyperpolarized voltage ramp from -68 mV generated at a rate of 10 mV / ms and the steady-state current at the final potential (-98 mV). Did (Dubin
et al., 1999).

The apparent reversal potential (V _rev ) of the ligand-induced change in conductivity was measured using the voltage-ramp protocol (Dubin et al. 1999). A voltage ramp was applied every second and the whole cell ramp-induced current produced was recorded. Normally, the voltage ramped from negative to positive to negative value. The current required to ramp the cells at -68 mV was continuously monitored. Ligand-induced conductivity was measured from whole cell currents evoked by a voltage-ramp protocol in the presence and absence of ligand. Comparing the voltage-ramp-induced currents measured in advance (control) and in the presence of ligand revealed the effect of ligand to modulate channel current output. The voltage without the net ligand-induced current was determined (
V _rev ).

Most values are given as the standard error of the mathematical mean +/- mean (SEM)
.

Capsaicin causes an increase in conductivity in HEK293 cells stably expressing hVR1, consistent with activation of its influx of non-selective cations. V _rev is 10.4 +/-
It was 2.2 mV (n = 5) (FIG. 10). In the example shown, V _rev was +13 mV. This value (V _rev is -8.4 mV considering connection potential) is 2 in oocytes.
It is similar to the value obtained in the electrode voltage clamp experiment. The current mediated by high expression levels of VR1 was weakened: the capsaicin-induced current at +60 mV was 1630 +/- 530 pA. Current density was determined by normalizing to cell capacitance, and 80
It was +/- 40 pA / pF. The response to 100 nM capsaicin was completely blocked by preincubation in CPZ (1 μM) for 2 minutes (Fig. 10b). Shown is a voltage ramp induced current induced by a stable depolarizing command potential from -100 to +100 mV for 200 ms. 1 μM CPZ blocked the response to capsaicin in 3 cells. Partial recovery from CPZ block was observed.

The potent agonist RTX (160 nM) produced an increase in conductivity similar to that observed with capsaicin (FIG. 11). The reverse potential was +10 mV. In this case, the current density was 26 pA / pF.

[0097]   Challenge with low pH extracellular solution reversely increases the conductivity of cells expressing hVR1
(Fig. 12a). No similar response was observed in control cells. Antagoni
StroCPZ at 1 μM inhibited the pH4.5-induced response (FIG. 12b). Cleaning out CPZ
After that, the low pH response was restored (Fig. 12c). The current scale bar is 1 nA (a and b
), And 2nA (c). V regarding low pH reaction_revIs +7 +/− 5 mV
(N = 4). Differences between pH induction and capsaicin- and RTX-induced responses.
The difference is the mixing effect of low pH on the outward current activated by the lamp protocol.
May be due to confounding effects.Example 6-Binding Assay on Mammalian Cells Transfected with Human VR1   HEK293 cells stably expressing the hVR1 receptor³Used for H-RTX binding assay
Can be used. The equilibrium ligand binding assay can be performed using standard methods.
Wear. Specific³H- [RTX] binding prepared from VR1 receptor-transfected cells
Observed on the film.Example 7-Binding assay for oocytes injected with VR1 receptor RNA   oocytes injected with hVR1 in vitro RNA,³Used for H- [RTX] binding assay
. hVR1 RNA (2.5 ng) was injected individually into the oocytes, and 2 days later the oocytes were dosed.
Disrupt with a dounce homogenizer and remove the yolk protein in the art.
Remove using standard methods. Equilibrium ligand binding assay uses standard methods
Then do. Oocytes expressing hVR1 have a high affinity, at about 1 nM³Combined with H- [RTX]
Should do. Specific³H- [RTX] binding is a membrane preparation from hVR1-injected oocytes
Observed in. Oocytes expressing hVR1³Modulate H- [RTX] coupling
The ability to rate is used to measure the affinity of binding of a test compound. Example 8-Primary structure of human VR1 receptor protein   The nucleotide sequence of human VR1 receptor is approximately 2520 amino acids that encodes 839 amino acids.
Elucidation of one large open reading frame of the VR1 receptor base pair
I chose The cDNA is a 5'-nucleotide of about 921 and about 1383 nucleotides of the human VR1 receptor.
And a 3'-untranslated extension. The first in-frame methionine is approximately 95,048 kDa
Expected molecular weight of (M_r) Indicating the human VR1 receptor protein
Represents the start codon of the framing frame.

The predicted human VR1 receptor protein was aligned with the nucleotide and protein databases and was found to be associated with the rat VR1 receptor. About 93% of the amino acids in the human VR1 receptor are highly conserved, exhibiting at least 86% amino acid identity with rat VR1. Large putative N-terminal hydrophilic segment (
Conserved motifs found in this receptor family, such as the three putative ankyrin repeat domains in the N-terminal region and in the six putative transmembrane and pore regions (about 433 amino acids), are also human VR1 receptors. Found in the array. The putative N-linked glycosylation site is a putative transmembrane 5-P
Included in the loop (N × (S / T)). There are 17 putative phosphorylation sites (PKA: 3;
PKC: 12; mammary casein kinase: 2). Cloning recombinant human VR1 receptors into E. coli (E. coli) expression vector of Example 9 Human VR1 receptor cDNA is the human VR1 receptor expression cassette E. coli (E.co li) expression vector (without limitation , PET series (Novagen)
It is produced in E. coli . The pET vector places expression of the human VR1 receptor under the control of the strongly regulated bacteriophage T7 promoter. After transfer of this construct to E. coli containing a chromosomal copy of the T7 RNA polymerase gene driven by the inducible lac promoter, expression of the human VR1 receptor was achieved by adding the appropriate lac substrate (IPTG) to the culture. Will be induced when given. Human V
Expression levels of R1 receptors are measured by the assays described herein.

CDNA encoding the entire open reading frame of human VR1 receptor was cloned into p
Insert at the NdeI site of ET [16] 11a. The positive orientation construct was identified by sequence analysis and used to transform the expression host strain BL21. The transformants are then used to inoculate the culture for the production of human VR1 receptor protein. Cultures are grown in M9 or ZB medium, the medium composition of which is known to those skilled in the art. After growing to OD ₆₀₀ = 1.5, human VR1 receptor expression is induced with 1 mM IPTG for 3 hours at 37 ° C. Example 10- Cloning of Human VR1 Receptor cDNA into a Baculovirus Expression Vector for Expression in Insect Cells A baculovirus vector derived from the AcNPV virus genome was cloned into cDNA in Sf9 line insect cells (ATCC CRL # 1711). Designed to provide high level expression of. Recombinant baculovirus expressing the human VR1 receptor cDNA was prepared using standard methods (
Invitrogen MaxBac Manual: InVitrogem Maxbac Manual): Human VR1 receptor cDNA constructs were constructed with pAC360 and BlueBac.
It is ligated to the polyhedrin gene in various baculovirus transfer vectors, including the vector (Invitrogen). Recombinant baculovirus consisted of baculovirus transfer vector and linearized AcNPV genomic DNA [Kitts, PANucleic Acids Res. 18: 5567 (
1990)] and is produced by homologous recombination after cotransfection into Sf9 cells. Recombinant pAC360 virus is confirmed by the absence of inclusion bodies in infected cells, and recombinant pBlueBac virus is confirmed based on β-galactosidase expression (Summers, MDand Smith, GE, Texas Agriculture Exp. Station Bulletin No.
.1555). After plaque purification, human VR1 receptor expression is measured by the assay described herein.

The cDNA encoding the entire open reading frame of the human VR1 receptor is p
Insert at the BamHI site of BlueBacII. The positive orientation construct was analyzed by sequence analysis,
It is then used to transfect Sf9 cells in the presence of linear AcNPV mild type DNA.

Genuine active human VR1 receptor is found in the cytoplasm of infected cells. Active human VR1 receptor is extracted from infected cells by hypotonic or detergent lysis. Example 11-Cloning of Human VR1 Receptor cDNA into Yeast Expression Vectors Recombinant human VR1 receptor expresses an optimal human VR1 receptor cDNA cistron designed to direct intracellular or extracellular expression of heterologous proteins. Produced by yeast (S. cerevisiae) after insertion into the vector. For intracellular expression, a vector such as EmBLyex4 is linked to the human VR1 receptor cistron [Rinas, U. et al ., Biotechnology 8: 543-545 (1990); Horowitz B et al .,
J. Biol. Chem. 265: 4189-4192 (1989)]. For extracellular expression, the human VR1 receptor cistron ligates into a yeast expression vector that fuses a secretory signal (yeast or mammalian peptide) to the NH ₂ terminus of the human VR1 receptor protein [Jacobson, MA, G
ene 85: 511-516 (1989); Riett L. and Bellon N, Biochem. 28: 2941-2949 (1989)].

Without being limited to these vectors, pAVE1> 6 (which fuses the human serum albumin signal to the expressing cDNA [Steep O. Biotechnology 8: 42-46 (
1990)]), and the vector pL8PL, which fuses the human lysozyme signal to the expressed cDNA [Yamamoto, Y., Biochem. 28: 2728-2732)]. Further human VR
1 receptor is expressed in yeast as a fusion protein linked to ubiquinone using vector pVEP [Ecker, DJ, J. Biol. Chem. 264: 7715-7719 (1989), Sabi
n, EABiotechnology 7: 705-709 (1989), McDonnell DP, Mol.Cell.Biol.9: 5517-
5523 (1989)]. Expression levels of human VR1 receptor are measured as described herein. Example 12-Purification of recombinant human VR1 receptor Recombinantly produced human VR1 receptor can be purified by antibody affinity chromatography.

The human VR1 receptor antibody affinity column was prepared by pre-activating the anti-human VR1 receptor antibody with N-succinimide ester so that the Affigel-10 (Bio-Rad) (antibody forms a covalent bond with the agarose gel support). Prepared gel support). The antibody is then bound to the gel via an amide bond using the spacer arm. The remaining activated ester is then quenched with 1M ethanolamine HCl (pH 8). The column is washed with water, then 0.23 M glycine HCl (pH 2.6) to remove unbound antibody or excess protein. The column was then equilibrated with phosphate buffered saline (pH 7.3) with a suitable membrane solubilizer such as a detergent, and cell culture containing the solubilized human VR1 receptor. Slowly pass the supernatant or cell extract through the column. The column is then washed with phosphate buffered saline together with detergent until the optical density (A280) drops to background, then the protein is washed with 0.23 M glycine-HCl (pH 2) together with detergent. Elute in .6). The purified human VR1 receptor protein is dialyzed against phosphate buffered saline.

[0104]

[Table 1]

[0105]

[Table 2]

[0106]

[Table 3]

[0107]

[Table 4]

[0108]

[Table 5]

[Sequence list]

[Brief description of drawings]

[Figure 1]   The nucleotide sequence of the coding region of hVR1 is represented (2520 bp).

[Fig. 2]   1 depicts the nucleotide sequence of hVR1 including 921 bp 5'UT and 1383 bp 3'UT.

[Figure 3]   Represents the amino acid sequence of hVR1 (839 amino acids).

FIG. 4 depicts the functional expression of hVR1 in Xenopus oocytes: activation by capsaicin and resiniferatoxin and blockade of the capsaicin response by capsazepine and ruthenium red. (A) Apply capsaicin (C: 1 μM) at the times indicated by bars (left panel). Using 0.6μM capsazepine (CPZ) 2
Minute preincubation blocked the remaining current present 6 minutes after the original response (small outward current at the beginning of the current trace), and completely blocked subsequent application of C (C + CPZ, middle panel). ). There was a partial recovery of response to C after 6 minutes of continuous rinsing. (B) Ruthenium red (RR, 1 μM) blocked the C response (middle panel), and this effect was partially reversible after antagonist wash. The time scale is indicated by a horizontal bar (50 seconds). (C) Voltage-ramp induced current before (bottom current trace) and after (shown as C) application of capsaicin (1 μM). The membrane potential was ramped from -120 to +80 mV for 200 ms. The arrow indicates 0 mV. The current induced by C is a positive voltage (outward current) and a negative voltage (inward current).
It shows an even larger, very powerful outward commutation. (D) Similar currents are evoked by resiniferatoxin (RTX, 300 nM).

FIG. 5. Dose response of capsaicin applied to Xenopus oocytes expressing VR1. Responses to the indicated concentrations of capsaicin were bath applied to oocytes expressing 2.5 ng of hVR1 cRNA. Oocytes were continuously perfused for 6 minutes during the agonist test. N for 0.1, 0.3, 1 and 3 μM agonists respectively
= 4, 3, 4, 2 egg cells.

FIG. 6: Oocytes were challenged with 0.6 μM capsaicin and the maximal response at +80 mV was measured with a voltage ramp protocol. After washing out the capsaicin (6 minutes), the oocytes were perfused with the indicated concentrations of CPZ for 2 minutes and subsequently tested for their response to 0.6 μM capsaicin during the continuous presence of the antagonist. (N = 3 for all values shown)

FIG. 7 depicts functional expression of hVR1 in Xenopus oocytes: low pH (pH 5.5
) Activation. A voltage ramp protocol was applied to VR1-expressing oocytes (200ms
Shown are whole-cell currents evoked over -120 to +80 mV) and before and after application of pH 5.5 (respective low voltage traces in ac) and after (current traces indicated by filled circles).
First, the oocytes were placed in a bath of ND96 at pH 8 containing 100 μM Ca 2+. The experiment was performed at room temperature (20 ° C). The arrow indicates 0 mV. The low pH activates the outwardly rectifying current that is blocked by CPZ (b). The effect of CPZ is reversible (c). In this experiment, the inward current was very small, probably due to low levels of extracellular Ca ²⁺ . Whole cell currents recorded in the presence of low pH are indicated by solid circles.

FIG. 8 depicts functional expression of hVR1 in a mammalian cell line: HEK293 cells are transiently transfected with hVR1 (a) or vector alone (pcDNA3.1-zeo) (b), and 4 A day later, their response to vanilloid agonists and antagonists was tested. Ca ²⁺ influx was measured with the FLIPR system using the Ca ²⁺ sensitive dye Fluo-4-. 1: Cells were challenged with 1 μM capsaicin for the period indicated by hollow bars (duration: about 1.5 minutes). 2: Cells were preincubated in 100 nM CPZ (black bars) for about 1 min and challenged with 1 μM capsaicin (open bars) in the presence of 100 nM CPZ. 3: Cells were preincubated in 1 μM CPZ (black bars) for about 1 minute and challenged with 1 μM capsaicin in the continuous presence of 1 μM CPZ. 4: Cells were challenged with 100 nM RTX (grey bar). 5: Cell 1μ
Preincubated with M CPZ (black bars), and then in continuous presence of CPZ
Attacked with 100 nM RTX (grey bar). Responses were measured in 15 mM Ca ²⁺ buffer. The cells were confluent on the day of recording.

9A and B HEK293 cells stably expressing hVR1 were tested for responsiveness to capsaicin and sensitivity to ruthenium red and capsazepine. 15nM
The increase of intracellular Ca ²⁺ induced by capsaicin was observed in ruthenium red (A, B
) And capsazepine (C) in a dose-dependent manner. The parental cell line was only responsive to capsaicin (top two rows).

FIG. 10. HEK293 cells stably expressing hVR1 show increased conductivity in response to 100 nM capsaicin. Whole cell currents evoked by the voltage ramp protocol were recorded using the patch clamp technique whole cell array (bottom traces). The response to capsaicin was blocked by capsazepine, and the effect was partially reversed after washout of antagonist.

FIG. 11. HEK293 cells stably expressing hVR1 show increased conductivity in response to RTX (160 nM).

12A, B, C: (A) HEK293 cells stably expressing hVR1 show increased conductivity in response to low pH (pH 4.5). (B) pH with 1 microliter of hVR1 antagonist CPZ
Inhibition of response. (C) pH response after washing out CPZ.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61P 11/00 A61P 11/06 4H045 11/06 17/06 17/06 19/02 19/02 25/04 25/04 25/28 25/28 29/00 29/00 101 101 C07K 14/47 C07K 14/47 16/18 16/18 C12N 1/15 C12N 1/15 1/19 1/19 1/21 1 / 21 C12P 21/02 C 5/10 21/08 C12P 21/02 G01N 33/15 Z 21/08 33/50 Z G01N 33/15 C12N 15/00 ZNAA 33/50 5/00 A (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI) , CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP ( H, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL , AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG , MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, UZ, VN, YU, ZA, ZW (72) Inventor Rogers, Kaslyn E. United States Sylvania 19403 Oudbon Lettwing Lane 4036 (72) Inventor Hvar, Ahn United States California California 91942 La Mesa Syastalane No. 67 5560 (72) Inventor Hover, Rene United States California 92071 Santee Crossway Court No. 35 8732 F-term (reference) 2G045 AA40 CB01 FA34 GC20 4B024 AA01 AA11 BA63 BA80 CA04 CA09 CA12 CA20 DA02 DA03 DA06 DA12 EA02 EA04 FA10 GA11 GA27 HA03 HA13 HA14 4B064 AG01 AG20 CE01 CA20 CA01 CA13 CA12 CC01 DA24 CC01 CC24 CA01 CA12 CA01 CC24 AA58X AA80X AA87X AA90X AA93X AA93Y AB01 AC14 AC20 BA02 BA25 BD14 CA24 CA44 CA46 4C084 AA17 BA44 CA59 NA14 ZA012 ZA082 ZA592 ZA662 ZA682 ZA892 ZA962 ZB152 ZC352 4H045 AA40 A30A50 A30 A50A30 A50A30 AA10 AA11 AA10 AA10 AA11 AA10 A30 AA11 A30

Claims (23)

[Claims] 1. A human VR in which a protein optionally functions as a receptor.
1 An isolated and purified DNA molecule encoding a receptor channel protein or a functional derivative thereof. 2. The isolated and purified DNA molecule of claim 1 having a nucleotide sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6 and functional derivatives thereof. 3. The isolated and purified DNA molecule of claim 1, wherein the DNA molecule is genomic DNA. 4. An expression vector for expressing a human VR1 receptor channel protein in a recombinant host, the vector comprising a recombinant gene encoding a human VR1 receptor protein, the protein optionally functioning as a receptor, And the above expression vector containing the functional derivative thereof. 5. A human VR in which the protein optionally functions as a receptor.
5. An expression vector according to claim 4, comprising a cloned gene encoding a 1 receptor channel protein and having a nucleotide sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6 and functional derivatives thereof. 6. The expression vector of claim 4, wherein the expression vector comprises DNA encoding a human VR1 receptor channel protein, which protein optionally functions as a receptor. 7. A human VR in which the protein optionally functions as a receptor.
1 A recombinant host cell containing a recombinantly cloned gene encoding a receptor channel protein, or a functional derivative thereof. 8. The recombinant host cell of claim 7, wherein the gene has a nucleotide sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6 and functional derivatives thereof. 9. A recombinant host cell according to claim 7, wherein the cloned gene encoding the receptor is genomic DNA. 10. A substantially pure protein that functions as a human VR1 receptor channel protein, wherein the protein optionally functions as a receptor. 11. A protein according to claim 10 having an amino acid sequence selected from the group consisting of SEQ ID NO: 7 and functional derivatives thereof. 12. A monospecific antibody immunologically reactive with the human VR1 receptor channel protein, wherein the protein optionally functions as a receptor. 13. The antibody of claim 12, wherein the antibody blocks the activity of the receptor. 14. A method of expressing a human VR1 receptor channel protein in a recombinant host cell, wherein the protein optionally functions as a receptor, comprising: (a) expressing the expression vector of claim 4 in a suitable host cell. And (b) culturing the host cell of step (a) under conditions that allow expression of the human VR1 receptor channel protein from the expression vector. 15. A method of identifying a compound that modulates human VR1 receptor channel protein activity, comprising: (a) a human VR1 wherein the protein optionally functions as a receptor for a modulator of human VR1 receptor channel protein activity. Combining with a receptor channel protein; and (b) measuring the effect of the modulator on the protein. 16. The method of claim 15, wherein the effect of the modulator on the protein inhibits or enhances binding of the receptor ligand. 17. The effect of the modulator on the protein is VR1 in humans.
16. The method of claim 15, which is stimulation or inhibition of a receptor channel protein. 18. The method of claim 17, wherein the human VR1 receptor channel comprises the amino acid sequence set forth in SEQ ID NO: 7. 19. A compound active in the method of claim 15 wherein said compound is a receptor modulator. 20. A compound active in the method of claim 15, wherein said compound is a receptor agonist or antagonist. 21. The compound is a modulator of expression of a receptor,
A compound active by the method of claim 15. 22. A pharmaceutical composition comprising a compound active in the method of claim 15, wherein the compound is a modulator of receptor activity. 23. A method of treating a patient in need of treatment of a condition mediated by the receptor, comprising administering a compound that modulates an active receptor according to the method of claim 15.