AU4237400A - Dna encoding the human vanilloid receptor vr1 - Google Patents
Dna encoding the human vanilloid receptor vr1 Download PDFInfo
- Publication number
- AU4237400A AU4237400A AU42374/00A AU4237400A AU4237400A AU 4237400 A AU4237400 A AU 4237400A AU 42374/00 A AU42374/00 A AU 42374/00A AU 4237400 A AU4237400 A AU 4237400A AU 4237400 A AU4237400 A AU 4237400A
- Authority
- AU
- Australia
- Prior art keywords
- receptor
- human
- protein
- dna
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/04—Centrally acting analgesics, e.g. opioids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
- C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Neurology (AREA)
- Pulmonology (AREA)
- Neurosurgery (AREA)
- Diabetes (AREA)
- Biomedical Technology (AREA)
- Rheumatology (AREA)
- Pain & Pain Management (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Psychiatry (AREA)
- Hematology (AREA)
- Endocrinology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Obesity (AREA)
- Cell Biology (AREA)
- Emergency Medicine (AREA)
- Zoology (AREA)
- Hospice & Palliative Care (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
Description
WO 00/63415 PCTIUSOO/09897 TITLE OF THE INVENTION DNA ENCODING THE HUMAN VANILLOID RECEPTOR VR1 BACKGROUND OF THE INVENTION Noxious chemical, thermal and mechanical stimuli excite peripheral nerve endings of small diameter sensory neurons (nociceptors) in sensory ganglia (eg., dorsal root, nodose and trigeminal ganglia) and initiate signals that are perceived as pain. These neurons are crucial for the detection of harmful or potentially harmful stimuli (heat) and tissue damage (H* (local tissue acidosis), and/or stretch) which arise from changes in the extracellular space during inflammatory or ischaemic conditions (Wall and Melzack, 1994). Capsaicin (8-methyl-N-vanillyl-6-nonenamide), the main pungent ingredient in "hot" capsicum peppers, and its analogs interact at specific membrane recognition sites (vanilloid receptors), expressed almost exclusively by primary sensory neurons involved in nociception and neurogenic inflammation (Bevan and Szolcsanyi, 1990). Capsaicin is a very selective activator of thinly or unmyelinated nociceptive afferents (Szolcsanyi, 1993; Szolcsanyi, 1996). Capsaicin derivatives show structure-function relationships and their effects can be blocked by a selective antagonist capsazepine. The ultra potent tricyclic diterpene resiniferatoxin (RTX; (Szolcsanyi et al., 1991)) binds with nanomolar affinity at the capsaicin binding site and has revealed a very localized distribution of capsaicin receptors to rat somatic and visceral primary sensory neurons (Szallasi et al., 1995). Interestingly, the density of RTX receptor sites in nodose and dorsal root ganglia increased after ligation of the vagal and sciatic nerves (Szallasi et al., 1995). Electrophysiological studies have shown that vanilloids excite small sensory neurons by activating a plasma membrane channel that is non-selectively permeable to cations (Bevan and Szolcsanyi, 1990; Oh et al., 1996; Wood et al., 1988). Recently, one receptor for capsaicin (VR1) was cloned from rat (Caterina et al., WO 00/63415 PCTUSOO/09897 1997) and shown to be a coincidence detector for H' (low pH) and heat (Tominaga et al., 1998). VRl is expressed in small nociceptive neurons of the dorsal root ganglion, consistent with its role in modulating peripheral pain (Tominaga et al., 1998). The vanilloid (" capsaicin") receptor VRI is activated by capsaicin and RTX, and activation of VR1 is blocked by the antagonists capsazepine (CPZ; (Bevan et al., 1992)) and ruthenium red (RR; (Wood et al., 1988)) (Caterina et al., 1997). VR1 is a ligand-gated non-selective cation channel that shows pronounced outward rectification (Caterina et al., 1997). Recently, rat VR1 and VR2 and a partial cDNA sequence of human sequences were disclosed in the WIPO publication WO 99/09140. Topical application of vanilloids such as capsaicin (Zostrix 0.025% and Zostrix HP 0.075%) have been used to mitigate neuropathic pain and to treat the intractable pain associated with postherpetic neuralgia, diabetic neuropathy, postmastectomy pain, complex regional pain syndromes and rheumatoid arthritis (Robbins et al., 1998; Rowbotham, 1994; Szallasi and Blumberg, 1996). With prolonged exposure to capsaicin, nociceptor cells become not only insensitive to this agonist but to other noxious stimuli as well (Szolcsanyi, 1993). The mechanism by which capsaicin produces analgesia is not known but likely includes desensitization of nociceptive sensory neurons, and depletion of peptides from peripheral terminals, as well as damage to sensory nerves (Jancso et al., 1977; Rowbotham, 1994). The irritancy of capsaicin severely limits its use, and the discovery of novel compounds that block the acidic and/or thermal activation of capsaicin sensitive receptors is sought. The antagonists RR and CPZ, while exerting antinociceptive effects in a behavioral study (Santos and Calixto, 1997), have not proven to be effective analgesics in man, presumably because they do not antagonize the endogenous modulators of the capsaicin receptor (Kress and Zeilhofer, 1999). However, CPZ blocked H*-induced currents from rat VRl expressed in Xenopus oocytes (Tominaga et al., 1998). 2 WO 00/63415 PCT/USOO/09897 Low doses of capsaicin protected the rat gastric mucosa against injury produced by different ulcerogenic agents (Ome et al., 1997). "The gastro protective effect of capsaicin-type agents involves an enhancement of the microcirculation effected through the release of mediator peptides from the sensory nerve terminals with calcitonin gene-related peptide being the most likely candidate implicated. Capsaicin-sensitive fibers are involved in the repair mechanisms of the gastric mucosa. In most studies, capsaicin given into the stomach of rats or cats inhibited gastric acid secretion (Ome et al., 1997)." SUMMARY OF THE INVENTION A DNA molecule encoding the human vanilloid receptor (hVRl) has been cloned and characterized. The biological and structural properties of these proteins are disclosed, as is the amino acid and nucleotide sequence. The recombinant protein is useful to identify modulators of the receptor VR1. Modulators identified in the assay disclosed herein are useful as therapeutic agents, which are candidates for the treatment of inflammatory conditions associated with capsaicin receptor activity and for use as analgesics for intractable pain associated with postherpetic neuralgia, diabetic neuropathy, postmastectomy pain, complex regional pain syndromes, arthritis (e.g., rheumatoid and osteoarthritis), as well as ulcers, neurodegenerative diseases, asthma, chronic obstructive pulmonary disease, irritable bowel syndrome, and psoriasis. The recombinant DNA molecules, and portions thereof, are useful for isolating homologues of the DNA molecules, identifying and isolating genomic equivalents of the DNA molecules, and identifying, detecting or isolating mutant forms of the DNA molecules. BRIEF DESCRIPTION OF THE DRAWING 3 WO 00/63415 PCT/USOO/09897 FIGURE 1 - The nucleotide sequence of coding region of hVR1 is shown (2520 bp). FIGURE 2 - The nucleotide sequence of hVR1 is shown including 921 bp 5' UT and 1383 bp 3'UT. FIGURE 3 - The amino acid sequence of hVR1 is shown (839 amino acids). FIGURE 4- Functional expression of hVR1 in Xenopus oocytes is shown: activation by capsaicin and resiniferatoxin and block of capsaicin response by capsazepine and ruthenium red. (a). Capsaicin (C; 1 pM) is applied at the time indicated by the bar (left panel). Preincubation with 0.6 p.M capsazepine (CPZ) for 2 min blocked residual current still present 6 min after the original response (small outward current in beginning of current trace (middle panel)) and completely blocked subsequent application of C (C + CPZ, middle panel). There was partial recovery of the response to C (right panel) after 6 minutes of continuous rinsing. (b.) Ruthenium red (RR, 1 pM) blocked the C response (middle panel) and the effect was partially reversible after washout of the antagonist. Time scale is indicated by the horizontal bar (50 sec). (c.) Voltage ramp-induced currents before (bottom current trace) and after (indicated with a C) capsaicin (1 pM) application. The membrane potential was ramped from -120 to +80 mV over 200 msec. The arrow indicates 0 mV. The current induced by C is much larger at positive voltages (outward currents) than at negative voltages (inward current) indicating a very strong outward rectification. (d.) A similar current is elicited by resiniferatoxin (RTX, 300 nM). FIGURE 5- Dose response for capsaicin applied to Xenopus oocytes expressing hVR1. The responses to the indicated concentrations of capsaicin were 4 WO 00/63415 PCT/USOO/09897 bath applied to oocytes expressing 2.5 ng hVR1 cRNA. Oocytes were continuously perfused for 6 min between agonist tests. n=4,3, 4
,
2 oocytes for 0.1, 0.3, 1 and 3 PM agonist, respectively. FIGURE 6- The oocyte was challenged with 0.6 p.M Capsaicin and the maximum response at +80 mV was determined using a voltage ramp protocol. After washing out the capsaicin (6 min), the oocyte was perfused with the indicated concentration of CPZ for 2 min and subsequently tested for its response to 0.6 pM capsaicin in the continued presence of the antagonist. (n= 3 for all values shown.) FIGURE 7- Functional expression of hVR1 in Xenopus oocytes is shown: activation by low pH (pH 5.5). A voltage ramp protocol was applied to a VR1 expressing oocyte (-120 to +80 mV over 200 ms) and the whole cell currents elicited are shown before (lower current trace in each a-c) and after (current trace indicated with a solid circle) pH5.5 application. Initially oocytes were bathed in ND96 with 100 pM Ca2+, pH 8. Experiment was performed at room temperature (20 deg C). Arrow indicates 0 mV. Low pH activates an outwardly rectifying current (a) that is blocked by CPZ) (b). The effect of CPZ is reversible ( c ). In this example inward currents are very small, presumably due to the low levels of extracellular Ca 2 . Whole cell currents recorded in the presence of low pH are indicated by the solid circles. FIGURE 8- Functional expression of hVR1 in a mammalian cell line is shown: HEK293 cells were transiently transfected with hVR1 (a) or vector alone (pcDNA3.1 -zeo) (b) and 4 days later were tested for their response to vanilloid agonists and antagonists. Ca 2 + influx was measured using the Ca 2 + sensitive dye Fluo-4 on a FLIPR system. 1: Cells were challenged with 1 pM capsaicin during the 5 WO 00/63415 PCT/US0O/09897 time indicated by the open bar (duration: about 1.5 min). 2: Cells were preincubated in 100 nM CPZ (solid bar) for about 1 min and then challenged with 1 pM Capsaicin (open bar) in the presence of 100 nM CPZ. 3: Cells were preincubated in 1 pM CPZ (solid bar) for about 1 min and then challenged with 1 pM Capsaicin in the continued presence of 1 pM CPZ. 4: Cells were challenged with 100 nM RTX (grey bar). 5: Cells were preincubated with 1 pM CPZ (solid bar) and then challenged with 100 nM RTX (grey bar) in the continued presence of CPZ. Responses were measured in 15 mM Ca" buffer. Cells were confluent the day of recording. Figure 9 A and B. HEK293 cells stably expressing hVR1 were tested for responsiveness to capsaicin and sensitivity to ruthenium red and capsazepine. The increase in intracellular Ca2+ evoked by 15 nM Capsaicin was blocked in a dose dependent manner by ruthenium red (A, B) and capsazepine (C). The parent cell line did not respond to capsaicin (top 2 rows). Figure 10 HEK293 cells stably expressing hVR1 show increased conductance in response to 100 nM capsaisin. The whole cell configuration of the patch clamp technique was used to record whole cell currents elicted by a voltage ramp protocol (bottom trace). The response to capsaicin was blocked by capsazepine and the effect was partially reversed after wash out of antagonist. Figure 11 HEK293 cells stably expressing hVR1 show increased conductance in response to RTX (160 nM). Figure 12 A, B, C. (A) HEK293 cells stably expressing hVR1 show increased conductance in response to low (pH 4.5). (B) Inhibition of the pH response by hVR1 antagonist CPZ at 1 micromolar. (C) pH response after CPZ washout. 6 WO 00/63415 PCT/US0O/09897 DETAILED DESCRIPTION The present invention relates to DNA encoding human VR1 receptor that was isolated from a human thalamus cDNA library. Human VR1 receptor, as used herein, refers to protein which can specifically function as a receptor. The complete amino acid sequence of human VR1 receptor was not previously known, nor was the complete nucleotide sequence encoding human VR1 receptor known. This is the first reported cloning of a full length DNA molecule encoding the human VR1 receptor. It is predicted that a wide variety of cells and cell types will contain the described receptor. Other cells and cell lines may also be suitable for use to isolate human VRl receptor cDNA. Selection of suitable cells may be done by screening for human VR1 receptor activity in cell extracts. Human VR1 receptor activity can be monitored by performing an 3 H-[resiniferatoxin] binding assay (Acs et al., 1994; Szallasi and Blumberg, 1990; Szallasi et al., 1994; Szallasi et al., 1993; Szallasi et al., 1991) or by direct measurement of a capsaicin-, RTX- and/or low pH-induced Ca" influx or non selective cation currents through the hVR1 receptor (Caterina et al., 1997). Cells that possess human VR1 receptor activity in this assay may be suitable for the isolation of human VR1 receptor DNA or mRNA. Any of a variety of procedures known in the art may be used to molecularly clone human VR1 receptor DNA. These methods include, but are not limited to, direct functional expression of the human VR1 receptor genes following the construction of a human VR1 receptor-containing cDNA library in an appropriate expression vector system. Another method is to screen human VR1 receptor containing cDNA library constructed in a bacteriophage or plasmid shuttle vector with a labelled oligonucleotide probe designed from the amino acid sequence of the human VR1 receptor subunits. An additional method consists of screening a human VR1 receptor-containing cDNA library constructed in a bacteriophage or plasmid 7 WO 00/63415 PCT/USOO/09897 shuttle vector with a partial cDNA encoding the human VR1 receptor protein. This partial cDNA is obtained by the specific PCR amplification of human VR1 receptor DNA fragments through the design of degenerate oligonucleotide primers from the amino acid sequence of the purified human VR1 receptor protein. Another method is to isolate RNA from human VR1 receptor-producing cells and translate the RNA into protein via an in vitro or an in vivo translation system. The translation of the RNA into a peptide a protein will result in the production of at least a portion of the human VR1 receptor protein which an be identified by, for example, immunological reactivity with an anti-human VR1 receptor antibody or by biological activity of human VR1 receptor protein. In this method, pools of RNA isolated from human VR1 receptor-producing cells can be analyzed for the presence of an RNA that encodes at least a portion of the human VRl receptor protein. Further fractionation of the RNA pool can be done to purify the human VR1 receptor RNA from non-human VR1 receptor RNA. The peptide or protein produced by this method may be analyzed to provide amino acid sequences, which in turn are used to provide primers for production of human VRl receptor cDNA, or the RNA used for translation can be analyzed to provide nucleotide sequences encoding human VR1 receptor and produce probes for this production of human VR1 receptor cDNA. This method is known in the art and can be found in, for example, Maniatis, T., Fritsch, E.F., Sambrook, J. in Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 1989. It is readily apparent to those skilled in the art that other types of libraries, as well as libraries constructed from other cells or cell types, may be useful for isolating human VR1 receptor-encoding DNA. Other types of libraries include, but are not limited to, cDNA libraries derived from other cells and genomic DNA libraries that include YAC (yeast artificial chromosome) and cosmid libraries. It is readily apparent to those skilled in the art that suitable cDNA libraries may be prepared from cells or cell lines which have human VRI receptor activity. 8 WO 00/63415 PCTIUSOO/09897 The selection of cells or cell lines for use in preparing a cDNA library to isolate human VRl receptor cDNA may be done by first measuring cell associated human VR1 receptor activity using the measurement of Capsaicin-associated biological activity or a capsaicin ligand binding assay. Preparation of cDNA libraries can be performed by standard techniques well known in the art. Well known cDNA library construction techniques can be found for example, in Maniatis, T., Fritsch, E.F., Sambrook, J., Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989). It is also readily apparent to those skilled in the art that DNA encoding human VRl receptor may also be isolated from a suitable genomic DNA library. Construction of genomic DNA libraries can be performed by standard techniques well known in the art. Well known genomic DNA library construction techniques can be found in Maniatis, T., Fritsch, E.F., Sambrook, J. in Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989). In order to clone the human VRI receptor gene by the above methods, the amino acid sequence of human VR1 receptor may be necessary. To accomplish this, human VRl receptor protein may be purified and partial amino acid sequence determined by automated sequencers. It is not necessary to determine the entire amino acid sequence, but the linear sequence of two regions of 6 to 8 amino acids from the protein is determined for the production of primers for PCR amplification of a partial human VR1 receptor DNA fragment. Once suitable amino acid sequences have been identified, the DNA sequences capable of encoding them are synthesized. Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid, and therefore, the amino acid sequence can be encoded by any of a set of similar DNA oligonucleotides. Only one member of the set will be identical to the human VR1 9 WO 00/63415 PCT/USOO/09897 receptor sequence but will be capable of hybridizing to human VR1 receptor DNA even in the presence of DNA oligonucleotides with mismatches. The mismatched DNA oligonucleotides may still sufficiently hybridize to the human VR1 receptor DNA to permit identification and isolation of human VR1 receptor encoding DNA. DNA isolated by these methods can be used to screen DNA libraries from a variety of cell types, from invertebrate and vertebrate sources, and to isolate homologous genes. Purified biologically active human VR1 receptor may have several different physical forms. Human VR1 receptor may exist as a full-length nascent or unprocessed polypeptide, or as partially processed polypeptides or combinations of processed polypeptides. The full-length nascent human VR1 receptor polypeptide may be posttranslationally modified by specific proteolytic cleavage events, which result in the formation of fragments of the full-length nascent polypeptide. A fragment, or physical association of fragments may have the full biological activity associated with human VRl receptor, however, the degree of human VR1 receptor activity may vary between individual human VR1 receptor fragments and physically associated human VR1 receptor polypeptide fragments. The cloned human VR1 receptor DNA obtained through the methods described herein may be recombinantly expressed by molecular cloning into an expression vector containing a suitable promoter and other appropriate transcription regulatory elements, and transferred into prokaryotic or eukaryotic host cells to produce recombinant human VRI receptor protein. Techniques for such manipulations are fully described in Maniatis, T, et al., supra, and are well known in the art. Expression vectors are defined herein as DNA sequences that are required for the transcription of cloned copies of genes and the translation of their mRNAs in an appropriate host. Such vectors can be used to express eukaryotic genes in a variety of 10 WO 00/63415 PCT/USO0/09897 hosts such as bacteria including E. cpli, blue-green algae, plant cells, insect cells, fungal cells including yeast cells, and animal cells. Specifically designed vectors allow the shuttling of DNA between hosts such as bacteria-yeast or bacteria-animal cells or bacteria-fungal cells or bacteria invertebrate cells. An appropriately constructed expression vector should contain: an origin of replication for autonomous replication in host cells, selectable markers, a limited number of useful restriction enzyme sites, a potential for high copy number, and active promoters. A promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and initiate RNA synthesis. A strong promoter is one that causes mRNAs to be initiated at high frequency. Expression vectors may include, but are not limited to, cloning vectors, modified cloning vectors, specifically designed plasmids or viruses. A variety of mammalian expression vectors may be used to express recombinant human VR1 receptor in mammalian cells. Commercially available mammalian expression vectors which may be suitable for recombinant human VR1 receptor expression, include but are not limited to, pMAMneo (Clontech), pcDNA3 (Invitrogen), pMClneo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO pSV2-neo (ATCC 37593) pBPV-1(8-2) (ATCC 37110), pdBPV-MMTneo(342-12) (ATCC 37224), pRSVgpt (ATCC 37199), pRSVneo (ATCC 37198), pSV2-dhfr (ATCC 37146), pUCTag (ATCC 37460), and IZD35 (ATCC 37565). A variety of bacterial expression vectors may be used to express recombinant human VR1 receptor in bacterial cells. Commercially available bacterial expression vectors which may be suitable for recombinant human VR1 receptor expression include, but are not limited to pET vectors (Novagen) and pQE vectors (Qiagen). A variety of fungal cell expression vectors may be used to express recombinant human VR1 receptor in fungal cells such as yeast. Commercially available fungal cell expression vectors which may be suitable for recombinant 11 WO 00/63415 PCT/USO0/09897 human VR1 receptor expression include but are not limited to pYES2 (InVitrogen) and Pichia expression vector (InVitrogen). A variety of insect cell expression vectors may be used to express recombinant human VR1 receptor in insect cells. Commercially available insect cell expression vectors that may be suitable for recombinant expression of human VRl receptor include but are not limited to pBlueBacII (InVitrogen). DNA encoding human VR1 receptor may be cloned into an expression vector for expression in a recombinant host cell. Recombinant host cells may be prokaryotic or eukaryotic, including but not limited to bacteria such as E coli, fungal cells such as yeast, mammalian cells including but not limited to cell lines of human, bovine, porcine, monkey and rodent origin, and insect cells including but not limited to drosophila and silkworm derived cell lines. Cell lines derived from mammalian species which may be suitable and which are commercially available, include but are not limited to, CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651), CHO-Ki (ATCC CCL 61), 3T3 (ATCC CCL 92), NIH/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C1271 (ATCC CRL 1616), BS-C-1 (ATCC CCL 26), MRC-5 (ATCC CCL 171), L-cells, and HEK-293 (ATCC CRL1573). The expression vector may be introduced into host cells via any one of a number of techniques including but not limited to transformation, transfection, protoplast fusion, lipofection, and electroporation. The expression vector-containing cells are clonally propagated and individually analyzed to determine whether they produce human VR1 receptor protein. Identification of human VR1 receptor expressing host cell clones may be done by several means, including but not limited to immunological reactivity with anti-human VRl receptor antibodies, and the presence of host cell-associated human VRl receptor activity. Expression of human VRl receptor DNA may also be performed using in vitro produced synthetic mRNA. Synthetic mRNA or mRNA isolated from human VR1 receptor producing cells can be efficiently translated in various cell-free 12 WO 00/63415 PCT/USOO/09897 systems, including but not limited to wheat germ extracts and reticulocyte extracts, as well as efficiently translated in cell based systems, including but not limited to microinjection into frog oocytes, with microinjection into frog oocytes being generally preferred. To determine the human VR1 receptor DNA sequence(s) that yields optimal levels of human VRl receptor activity and/or human VR1 receptor protein, human VR1 receptor DNA molecules including, but not limited to, the following can be constructed: the full-length open reading frame of the human VRl receptor cDNA encoding the approximately 95,048 kDa protein from approximately base 1 to approximately base 2517 (these numbers correspond to first nucleotide of first methionine and last nucleotide before the first stop codon) and several constructs containing portions of the cDNA encoding human VRI receptor protein. All constructs can be designed to contain none, all or portions of the 5' or the 3' untranslated region of human VR1 receptor cDNA. Human VR1 receptor activity and levels of protein expression can be determined following the introduction, both singly and in combination, of these constructs into appropriate host cells. Following determination of the human VRl receptor DNA cassette yielding optimal expression in transient assays, this human VR1 receptor DNA construct is transferred to a variety of expression vectors, for expression in host cells including, but not limited to, mammalian cells, baculovirus-infected insect cells, E coli, and the yeast S. cerevisiae. Host cell transfectants and microinjected oocytes may be used to assay both the levels of human VRl receptor channel activity and levels of human VR1 receptor protein by the following methods. In the case of recombinant host cells, this involves the co-transfection of one or possibly two or more plasmids, containing the human VR1 receptor DNA encoding one or more fragments or subunits. In the case of oocytes, this involves the co-injection of synthetic RNAs for human VR1 receptor protein. Following an appropriate period of time to allow for expression, cellular 13 WO 00/63415 PCT/USO0/09897 protein is metabolically labelled with, for example 3 5 S-methionine for 24 hours, after which cell lysates and cell culture supernatants are harvested and subjected to immunoprecipitation with polyclonal antibodies directed against the human VR1 receptor protein. Other methods for detecting human VRl receptor activity involve the direct measurement of human VR1 receptor activity in whole cells transfected with human VR1 receptor cDNA or oocytes injected with human VR1 receptor mRNA. Human VR1 receptor activity is measured by specific ligand binding and biological characteristics of the host cells expressing human VR1 receptor DNA. In the case of recombinant host cells expressing human VRl receptor patch voltage clamp techniques can be used to measure receptor activity and quantitate human VR1 receptor protein. In the case of oocytes patch clamp as well as two-electrode voltage clamp techniques can be used to measure VRI receptor activity and quantitate human VR1 receptor protein by determining single channel and whole cell conductances. Levels of human VR1 receptor protein in host cells are quantitated by immunoaffinity and/or ligand affinity techniques. Cells expressing human VRl receptor can be assayed for the number of human VR1 receptor molecules expressed by measuring the amount of radioactive ligand binding to cell membranes. Human VR1 receptor-specific affinity beads or human VRl receptor-specific antibodies are used to isolate for example 3 5 S-methionine labelled or unlabelled human VRI receptor protein. Labelled human VR1 receptor protein is analyzed by SDS-PAGE. Unlabelled human VR1 receptor protein is detected by Western blotting, ELISA or RIA assays employing human VR1 receptor specific antibodies. Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid, and therefore, the amino acid sequence can be encoded by any of a set of similar DNA oligonucleotides. Only one member of the set will be identical to the human VR1 receptor sequence but will be capable of hybridizing to human VR1 receptor DNA even in the presence of DNA 14 WO 00/63415 PCT/US00/09897 oligonucleotides with mismatches under appropriate conditions. Under alternate conditions, the mismatched DNA oligonucleotides may still hybridize to the human VRl receptor DNA to permit identification and isolation of human VRl receptor encoding DNA. DNA encoding human VR1 receptor from a particular organism may be used to isolate and purify homolognes of human VR1 receptor from other organisms. To accomplish this, the first human VR1 receptor DNA may be mixed with a sample containing DNA encoding homologues of human VR1 receptor under appropriate hybridization conditions. The hybridized DNA complex may be isolated and the DNA encoding the homologous DNA may be purified therefrom. It is known that there is a substantial amount of redundancy in the various codons that code for specific amino acids. Therefore, this invention is also directed to those DNA sequences that contain alternative codons that code for the eventual translation of the identical amino acid. For purposes of this specification, a sequence bearing one or more replaced codons will be defined as a degenerate variation. Also included within the scope of this invention are mutations either in the DNA sequence or the translated protein which do not substantially alter the ultimate physical properties of the expressed protein. For example, substitution of valine for leucine, arginine for lysine, or asparagine for glutamine may not cause a change in functionality of the polypeptide. It is known that DNA sequences coding for a peptide may be altered so as to code for a peptide having properties that are different than those of the naturally occurring peptide. Methods of altering the DNA sequences include, but are not limited to site directed mutagenesis. Examples of altered properties include but are not limited to changes in the affinity of an enzyme for a substrate or a receptor for a ligand. As used herein, a "functional derivative" of human VR1 receptor is a compound that possesses a biological activity (either functional or structural) that is 15 WO 00/63415 PCT/USO0/09897 substantially similar to the biological activity of human VR1 receptor. The term "functional derivatives" is intended to include the "fragments," "variants," "degenerate variants," "analogs" and "homologues" or to "chemical derivatives" of human VR1 receptor. The term "fragment" is meant to refer to any polypeptide subset of human VR1 receptor. The term "variant" is meant to refer to a molecule substantially similar in structure and function to either the entire human VR1 receptor molecule or to a fragment thereof. A molecule is "substantially similar" to human VR1 receptor if both molecules have substantially similar structures or if both molecules possess similar biological activity. Therefore, if the two molecules possess substantially similar activity, they are considered to be variants even if the structure of one of the molecules is not found in the other or even if the two amino acid sequences are not identical. The term "analog" refers to a molecule substantially similar in function to either the entire human VR 1 receptor molecule or to a fragment thereof. Following expression of human VR1 receptor in a recombinant host cell, human VR1 receptor protein may be recovered to provide human VR1 receptor in active form. Several human VRl receptor purification procedures are available and suitable for use. As described above for purification of human VR1 receptor from natural sources, recombinant human VR1 receptor may be purified from cell lysates and extracts, or from conditioned culture medium, by various combinations of, or individual application of salt fractionation, ion exchange chromatography, size exclusion chromatography, hydroxylapatite adsorption chromatography and hydrophobic interaction chromatography. In addition, recombinant human VR1 receptor can be separated from other cellular proteins by use of an immunoaffinity column made with monoclonal or polyclonal antibodies specific for full length nascent human VR1 receptor, polypeptide fragments of human VR1 receptor or human VR1 receptor subunits. 16 WO 00/63415 PCTIUSO0/09897 Monospecific antibodies to human VRI receptor are purified from mammalian antisera containing antibodies reactive against human VR1 receptor or are prepared as monoclonal antibodies reactive with human VR1 receptor using the technique of Kohler and Milstein, Nature 256: 495-497 (1975). Monospecific antibody as used herein is defined as a single antibody species or multiple antibody species with homogenous binding characteristics for human VR1 receptor. Homogenous binding as used herein refers to the ability of the antibody species to bind to a specific antigen or epitope, such as those associated with the human VR1 receptor, as described above. Human VR1 receptor specific antibodies are raised by immunizing animals such as mice, rats, guinea pigs, rabbits, goats, horses and the like, with rabbits being preferred, with an appropriate concentration of human VRI receptor either with or without an immune adjuvant. Preimmune serum is collected prior to the first immunization. Each animal receives between about 0.1 mg and about 1000 mg of human VR1 receptor associated with an acceptable immune adjuvant. Such acceptable adjuvants include, but are not limited to, Freund's complete, Freund's incomplete, alum-precipitate, water in oil emulsion containing Corynebacterium parvum and tRNA. The initial immunization consists of human VR1 receptor in, preferably, Freund's complete adjuvant at multiple sites either subcutaneously (SC), intraperitoneally (IP) or both. Each animal is bled at regular intervals, preferably weekly, to determine antibody titer. The animals may or may not receive booster injections following the initial immunization. Those animals receiving booster injections are generally given an equal amount of the antigen in Freund's incomplete adjuvant by the same route. Booster injections are given at about three-week intervals until maximal titers are obtained. At about 7 days after each booster immunization or about weekly after a single immunization, the animals are bled, the serum collected, and aliquots are stored at about -20'C. Monoclonal antibodies (mAb) reactive with human VR1 receptor are prepared by immunizing inbred mice, preferably Balb/c, with human VRI receptor. The mice 17 WO 00/63415 PCT/USOO/09897 are immunized by the IP or SC route with about 0.1 mg to about 10 mg, preferably about 1 mg, of human VR1 receptor in about 0.5 ml buffer or saline incorporated in an equal volume of an acceptable adjuvant, as discussed above. Freund's complete adjuvant is preferred. The mice receive an initial immunization on day 0 and are rested for about 3 to about 30 weeks. Immunized mice are given one or more booster immunizations of about 0.1 to about 10 mg of human VRl receptor in a buffer solution such as phosphate buffered saline by the intravenous (IV) route. Lymphocytes, from antibody positive mice, preferably splenic lymphocytes, are obtained by removing spleens from immunized mice by standard procedures known in the art. Hybridoma cells are produced by mixing the splenic lymphocytes with an appropriate fusion partner, preferably myeloma cells, under conditions that will allow the formation of stable hybridomas. Fusion partners may include, but are not limited to: mouse myelomas P3/NSl/Ag 4-1; MPC-1 1; S-194 and Sp 2/0, with Sp 2/0 being generally preferred. The antibody producing cells and myeloma cells are fused in polyethylene glycol, about 1000 mol. wt., at concentrations from about 30% to about 50%. Fused hybridoma cells are selected by growth in hypoxanthine, thymidine and aminopterin supplemented Dulbecco's Modified Eagles Medium (DMEM) by procedures known in the art. Supernatant fluids are collected from growth positive wells on about days 14, 18, and 21 and are screened for antibody production by an immunoassay such as solid phase immunoradioassay (SPIRA) using human VR1 receptor as the antigen. The culture fluids are also tested in the Ouchterlony precipitation assay to determine the isotype of the mAb. Hybridoma cells from antibody positive wells are cloned by a technique such as the soft agar technique of MacPherson, Soft Agar Techniques, in Tissue Culture Methods and Applications, Kruse and Paterson, Eds., Academic Press, 1973. Monoclonal antibodies are produced in vivo by injection of pristane primed Balb/c mice, approximately 0.5 ml per mouse, with about 2 x 106 to about 6 x 106 hybridoma cells about 4 days after priming. Ascites fluid is collected at 18 WO 00/63415 PCTIUSOO/09897 approximately 8-12 days after cell transfer and the monoclonal antibodies are purified by techniques known in the art. In vitro production of anti-human VR1 receptor mAb is carried out by growing the hybridoma in DMEM containing about 2% fetal calf serum to obtain sufficient quantities of the specific mAb. The mAb are purified by techniques known in the art. Antibody titers of ascites or hybridoma culture fluids are determined by various serological or immunological assays which include, but are not limited to, precipitation, passive agglutination, enzyme-linked immunosorbent antibody (ELISA) technique and radioimmunoassay (RIA) techniques. Similar assays are used to detect the presence of human VR1 receptor in body fluids or tissue and cell extracts. It is readily apparent to those skilled in the art that the above described methods for producing monospecific antibodies may be utilized to produce antibodies specific for human VR1 receptor polypeptide fragments, or full-length nascent human VR1 receptor polypeptide, or the individual human VR1 receptor subunits. Specifically, it is readily apparent to those skilled in the art that monospecific antibodies may be generated which are specific for only one human VR1 receptor subunit or the fully functional receptor. Human VR1 receptor antibody affinity columns are made by adding the antibodies to Affigel-10 (Bio-Rad), a gel support which is activated with N hydroxysuccinimide esters such that the antibodies form covalent linkages with the agarose gel bead support. The antibodies are then coupled to the gel via amide bonds with the spacer arm. The remaining activated esters are then quenched with IM ethanolamine HC1 (pH 8). The column is washed with water followed by 0.23 M glycine HC1 (pH 2.6) to remove any non-conjugated antibody or extraneous protein. The column is then equilibrated in phosphate buffered saline (pH 7.3) and the cell culture supernatants or cell extracts containing human VR1 receptor or human VR1 19 WO 00/63415 PCT/USOO/09897 receptor subunits are slowly passed through the column. The column is then washed with phosphate buffered saline until the optical density (A 2 8 0 ) falls to background, then the protein is eluted with 0.23 M glycine-HCI (pH 2.6). The purified human VR1 receptor protein is then dialyzed against phosphate buffered saline. DNA clones, termed human VR1 receptor, are identified which encode proteins that, when expressed in a recombinant host cell, form receptors sensitive to capsaicin. The expression of human VR1 receptor DNA results in the reconstitution of the properties observed in oocytes injected with human VR1 receptor-encoding poly (A)+ RNA, including direct activation with the appropriate ligands. The present invention is also directed to methods for screening for compounds that modulate the expression of DNA or RNA encoding human VR1 receptor as well as the function of human VR1 receptor protein in vivo. Compounds that modulate these activities may be DNA, RNA, peptides, proteins, or non-proteinaceous organic molecules. Compounds may modulate by increasing or attenuating the expression of DNA or RNA encoding human VR1 receptor, or the function of human VR1 receptor protein. Compounds that modulate the expression of DNA or RNA encoding human VR1 receptor or the function of human VR1 receptor protein may be detected by a variety of assays. The assay may be a simple "yes/no" assay to determine whether there is a change in expression or function. The assay may be made quantitative by comparing the expression or function of a test sample with the levels of expression or function in a standard sample. Modulators identified in this process are useful as therapeutic agents. Kits containing human VR1 receptor DNA or RNA, antibodies to human VR1 receptor, or human VR1 receptor protein may be prepared. Such kits are used to detect DNA that hybridizes to human VR1 receptor DNA or to detect the presence of human VR1 receptor protein or peptide fragments in a sample. Such characterization is useful for a variety of purposes including but not limited to forensic analyses, diagnostic applications, and epidemiological studies. 20 WO 00/63415 PCT/USOO/09897 The DNA molecules, RNA molecules, recombinant protein and antibodies of the present invention may be used to screen and measure levels of human VR1 receptor DNA, human VR1 receptor RNA or human VRl receptor protein. The recombinant proteins, DNA molecules, RNA molecules and antibodies lend themselves to the formulation of kits suitable for the detection and typing of human VR1 receptor. Such a kit would comprise a compartmentalized carrier suitable to hold in close confinement at least one container. The carrier would further comprise reagents such as recombinant human VRI receptor protein or anti-human VR1 receptor antibodies suitable for detecting human VR1 receptor. The carrier may also contain a means for detection such as labeled antigen or enzyme substrates or the like. Nucleotide sequences that are complementary to the human VR1 receptor encoding DNA sequence can be synthesized for antisense therapy. These antisense molecules may be DNA, stable derivatives of DNA such as phosphorothioates or methylphosphonates, RNA, stable derivatives of RNA such as 2'-O-alkylRNA, or other human VR1 receptor antisense oligonucleotide mimetics. Human VR1 receptor antisense molecules may be introduced into cells by microinjection, liposome encapsulation or by expression from vectors harboring the antisense sequence. Human VR1 receptor antisense therapy may be particularly useful for the treatment of diseases where it is beneficial to reduce human VR1 receptor activity. Human VR1 receptor gene therapy may be used to introduce human VR1 receptor into the cells of target organisms. The human VR1 receptor gene can be ligated into viral vectors that mediate transfer of the human VR1 receptor DNA by infection of recipient host cells. Suitable viral vectors include retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, polio virus and the like. Alternatively, human VR1 receptor DNA can be transferred into cells for gene therapy by non-viral techniques including receptor-mediated targeted DNA transfer using ligand-DNA conjugates or adenovirus-ligand-DNA conjugates, lipofection 21 WO 00/63415 PCT/USOO/09897 membrane fusion or direct microinjection. These procedures and variations thereof are suitable for ex vivo as well as in vivo human VRI receptor gene therapy. Human VRl receptor gene therapy may be particularly useful for the treatment of diseases where it is beneficial to elevate human VR1 receptor activity. Pharmaceutically useful compositions comprising human VR1 receptor DNA, human VR1 receptor RNA, or human VRl receptor protein, or modulators of human VR1 receptor activity, may be formulated according to known methods such as by the admixture of a pharmaceutically acceptable carrier. Examples of such carriers and methods of formulation may be found in Remington's Pharmaceutical Sciences. To form a pharmaceutically acceptable composition suitable for effective administration, such compositions will contain an effective amount of the protein, DNA, RNA, or modulator. Therapeutic or diagnostic compositions of the invention are administered to an individual in amounts sufficient to treat or diagnose disorders in which modulation of human VR1 receptor-related activity is indicated. The effective amount may vary according to a variety of factors such as the individual's condition, weight, sex and age. Other factors include the mode of administration. The pharmaceutical compositions may be provided to the individual by a variety of routes such as subcutaneous, topical, oral and intramuscular. The term "chemical derivative" describes a molecule that contains additional chemical moieties that are not normally a part of the base molecule. Such moieties may improve the solubility, half-life, absorption, etc. of the base molecule. Alternatively the moieties may attenuate undesirable side effects of the base molecule or decrease the toxicity of the base molecule. Examples of such moieties are described in a variety of texts, such as Remington's Pharmaceutical Sciences. Compounds identified according to the methods disclosed herein may be used alone at appropriate dosages defined by routine testing in order to obtain optimal inhibition of the human VR1 receptor or its activity while minimizing any potential 22 WO 00/63415 PCT/USOO/09897 toxicity. In addition, co-administration or sequential administration of other agents may be desirable. The present invention also has the objective of providing suitable topical, oral, systemic and parenteral pharmaceutical formulations for use in the novel methods of treatment of the present invention. The compositions containing compounds or modulators identified according to this invention as the active ingredient for use in the modulation of human VR1 receptor receptors can be administered in a wide variety of therapeutic dosage forms in conventional vehicles for administration. For example, the compounds or modulators can be administered in such oral dosage forms as tablets, capsules (each including timed release and sustained release formulations), pills, powders, granules, elixirs, tinctures, solutions, suspensions, syrups and emulsions, or by injection. Likewise, they may also be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous, topical with or without occlusion, or intramuscular form, all using forms well known to those of ordinary skill in the pharmaceutical arts. An effective but non-toxic amount of the compound desired can be employed as a human VR1 receptor modulating agent. The daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per patient, per day. For oral administration, the compositions are preferably provided in the form of scored or unscored tablets containing 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, and 50.0 milligrams of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated. An effective amount of the drug is ordinarily supplied at a dosage level of from about 0.0001 mg/kg to about 100 mg/kg of body weight per day. The range is more particularly from about 0.001 mg/kg to 10 mg/kg of body weight per day. The dosages of the human VR1 receptor modulators are adjusted when combined to achieve desired effects. On the other hand, dosages of these various agents may be independently optimized and combined to achieve a synergistic result wherein the pathology is reduced more than it would be if either agent were used alone. 23 WO 00/63415 PCTIUSOO/09897 Advantageously, compounds or modulators of the present invention may be administered in a single daily dose, or the total daily dosage may be administered in divided doses of two, three or four times daily. Furthermore, compounds or modulators for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in that art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen. For combination treatment with more than one active agent, where the active agents are in separate dosage formulations, the active agents can be administered concurrently, or they each can be administered at separately staggered times. The dosage regimen utilizing the compounds or modulators of the present invention is selected in accordance with a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular compound thereof employed. A physician or veterinarian of ordinary skill can readily determine and prescribe the effective amount of the drug required to prevent, counter or arrest the progress of the condition. Optimal precision in achieving concentrations of drug within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the drug's availability to target sites. This involves a consideration of the distribution, equilibrium, and elimination of a drug. In the methods of the present invention, the compounds or modulators herein described in detail can form the active ingredient, and are typically administered in admixture with suitable pharmaceutical diluents, excipients or carriers (collectively referred to herein as "carrier" materials) suitably selected with respect to the intended 24 WO 00/63415 PCT/USOO/09897 form of administration, that is, oral tablets, capsules, elixirs, syrups and the like, and consistent with conventional pharmaceutical practices. For instance, for oral administration in the form of a tablet or capsule, the . active drug component can be combined with an oral, non-toxic pharmaceutically acceptable inert carrier such as ethanol, glycerol, water and the like. Moreover, when desired or necessary, suitable binders, lubricants, disintegrating agents and coloring agents can also be incorporated into the mixture. Suitable binders include, without limitation, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth or sodium alginate, carboxymethylcellulose, polyethylene glycol, waxes and the like. Lubricants used in these dosage forms include, without limitation, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like. Disintegrators include, without limitation, starch, methyl cellulose, agar, bentonite, xanthan gum and the like. For liquid forms the active drug component can be combined in suitably flavored suspending or dispersing agents such as the synthetic and natural gums, for example, tragacanth, acacia, methyl-cellulose and the like. Other dispersing agents that may be employed include glycerin and the like. For parenteral administration, sterile suspensions and solutions are desired. Isotonic preparations, which generally contain suitable preservatives, are employed when intravenous administration is desired. Topical preparations containing the active drug component can be admixed with a variety of carrier materials well known in the art, such as, eg., alcohols, aloe vera gel, allantoin, glycerine, vitamin A and E oils, mineral oil, PPG2 myristyl propionate, and the like, to form, eg., alcoholic solutions, topical cleansers, cleansing creams, skin gels, skin lotions, and shampoos in cream or gel formulations. The compounds or modulators of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be 25 WO 00/63415 PCTIUSOO/09897 formed from a variety of phospholipids, such as cholesterol, stearylamine or phosphatidylcholines. Compounds of the present invention may also be delivered by the use of monoclonal antibodies as individual carriers to which the compound molecules are coupled. The compounds or modulators of the present invention may also be coupled with soluble polymers as targetable drug carriers. Such polymers can include polyvinyl-pyrrolidone, pyran copolymer, polyhydroxypropylmethacryl-amidephenol, polyhydroxy-ethylaspartamidephenol, or polyethyl-eneoxidepolylysine substituted with palmitoyl residues. Furthermore, the compounds or modulators of the present invention may be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydro-pyrans, polycyanoacrylates and cross-linked or amphipathic block copolymers of hydrogels. For oral administration, the compounds or modulators may be administered in capsule, tablet, or bolus form or alternatively they can be mixed in the animals feed. The capsules, tablets, and boluses are comprised of the active ingredient in combination with an appropriate carrier vehicle such as starch, talc, magnesium stearate, or di-calcium phosphate. These unit dosage forms are prepared by intimately mixing the active ingredient with suitable finely-powdered inert ingredients including diluents, fillers, disintegrating agents, and/or binders such that a uniform mixture is obtained. An inert ingredient is one that will not react with the compounds or modulators and which is non-toxic to the animal being treated. Suitable inert ingredients include starch, lactose, talc, magnesium stearate, vegetable gums and oils, and the like. These formulations may contain a widely variable amount of the active and inactive ingredients depending on numerous factors such as the size and type of the animal species to be treated and the type and severity of the infection. The active ingredient may also be administered as an additive to the feed by simply mixing the compound with the 26 WO 00/63415 PCT/USOO/09897 feedstuff or by applying the compound to the surface of the feed. Alternatively the active ingredient may be mixed with an inert carrier and the resulting composition may then either be mixed with the feed or fed directly to the animal. Suitable inert carriers include corn meal, citrus meal, fermentation residues, soya grits, dried grains and the like. The active ingredients are intimately mixed with these inert carriers by grinding, stirring, milling, or tumbling such that the final composition contains from 0.001 to 5% by weight of the active ingredient. The compounds or modulators may alternatively be administered parenterally via injection of a formulation consisting of the active ingredient dissolved in an inert liquid carrier. Injection may be either intramuscular, intraluminal, intratracheal, or subcutaneous. The injectable formulation consists of the active ingredient mixed with an appropriate inert liquid carrier. Acceptable liquid carriers include the vegetable oils such as peanut oil, cotton seed oil, sesame oil and the like as well as organic solvents such as solketal, glycerol formal and the like. As an alternative, aqueous parenteral formulations may also be used. The vegetable oils are the preferred liquid carriers. The formulations are prepared by dissolving or suspending the active ingredient in the liquid carrier such that the final formulation contains from 0.005 to 10% by weight of the active ingredient. Topical application of the compounds or modulators is possible through the use of a liquid drench or a shampoo containing the instant compounds or modulators as an aqueous solution or suspension. These formulations generally contain a suspending agent such as bentonite and normally will also contain an antifoaming agent. Formulations containing from 0.005 to 10% by weight of the active ingredient are acceptable. Preferred formulations are those containing from 0.01 to 5% by weight of the instant compounds or modulators. 27 WO 00/63415 PCT/USOO/09897 The following examples illustrate the present invention without, however, limiting the same thereto. EXAMPLE I Generation of a human thalamus library cDNA synthesis: First strand synthesis: Approximately 5 pg of human thalamus mRNA (Clontech) was used to synthesize cDNA using the cDNA synthesis kit (Life Technologies). Two microliters of NotI primer adapter was added to 5pl of mRNA and the mixture was heated to 70 0 C for 10 minutes and placed on ice. The following reagents were added on ice: 4pl of 5x first strand buffer (250mM TRIS-HCl (pH8.3), 375mM KCl, 15mM MgCl 2 ), 2pl of 0.1M DTT, 10mM dNTP (nucleotide triphosphates) mix and Ipl of DEPC treated water. The reaction was incubated at 42 0 C for minutes. Finally, 5pl of Superscript RT II was added and incubated at 42*C for 2 more hours. The reaction was terminated on ice. Second strand synthesis: The first strand product was adjusted to 93pl with water and the following reagents were added on ice: 30 g1 of 5x 2nd strand buffer (100 mM TRIS-HCl (pH6.9),450 mM KCl, 23 mM MgCl 2 , 0.75 mM p-NAD+, 50mM (NH 4 ) 2
SO
4 ), 3pl of 10 mM dNTP (nucleotide triphosphates), 1 l E. coli DNA ligase (10units )l 1 RNase H (2units), 4 g1 DNA pol l (10 units). The reaction was incubated at 16*C for 2 hours. The DNA from second strand synthesis was treated with T4 DNA polymerase and placed at 16*C to blunt the DNA ends. The double stranded cDNA was extracted with 150 pl of a mixture of phenol and chloroform (1:1, v:v) and precipitated with 0.5 volumes of 7.5 M NH40Ac and 2 volumes of absolute ethanol. The pellet was washed with 70% ethanol and dried down at 37*C to remove the residual ethanol. The double stranded DNA pellet was resuspended in 25 pl of water and the following reagents were added; 10 pl of 5x T4 DNA ligase buffer, 28 WO 00/63415 PCT/USOO/09897 10 p1 of Sail adapters and 5 pl of T4 DNA ligase. The ingredients were mixed gently and ligated overnight at 160 C. The ligation mix was extracted with phenol:chloroform:isoamyl alcohol, vortexed thoroughly and centrifuged at room temperature for 5 minutes at 14,000 x g to separate the phases. The aqueous phase was transferred to a new tube and the volume adjusted to 100 ml with water. The purified DNA was size selected on a chromaspin 1000 column (Clontech) to eliminate the smaller cDNA molecules. The double stranded DNA was digested with Notl restriction enzyme for 3-4 hours at 370 C. The restriction digest was electrophoresed on a 0.8 % low melt agarose gel. The cDNA in the range of 1-5 kb was cut out and purified using Gelzyme (Invitrogen). The product was extracted with phenol:chloroform and precipitated with NH 4 0Ac and absolute ethanol. The pellet was washed with 70% ethanol and resuspended in 10 ml of water. Ligation of cDNA to the Vector: The cDNA was split up into 5 tubes (2pl each) and the ligation reactions were set up by adding 4.5 pl of water, 2 pl of 5x ligation buffer, Il of p-Sport vector DNA (cut with Sal-1 / Notl and phosphatase treated) and 0.5 pl of T4 DNA ligase. The ligation was incubated at 40' C overnight. Introduction of Ligated cDNA into E.coli by Electroporation: The ligation reaction volume was adjusted to a total volume of 20 p1 with water. Five milliliters of yeast tRNA, 12.5 ml of 7.5M NH 4 OAc and 70 ml of absolute ethanol ( 20*C) was added. The mixture was vortexed thoroughly, and immediately centrifuged at room temperature for 20 minutes at 14000 xg. The pellets were washed in 70% ethanol and each pellet was resuspended in 5 ml of water. All 5 ligations (25ml) were pooled and 100p1 of DH1OB electro-competent cells (Life Technologies) were electroporated with 1 ml of DNA (total of 20 electroporations), then plated out on ampicillin plates to determine the number of recombinants (cfu) per microliter. The 29 WO 00/63415 PCT/US0O/09897 entire library was seeded into 2 liters of Super Broth and maxipreps were made using Promega Maxi Prep kit and purified on cesium chloride gradients. EXAMPLE 2: Library Screening / human VR1 Generation Human thalamus library screening: One microliter aliquots of the human thalamus library were electroporated into Electromax DH10B cells (Life Technologies). The volume was adjusted to I ml with SOC media and incubated for 45 minutes at 37*C with shaking. The library was then plated out on 150cm 2 plates containing LB to a density of 20000 colonies per plate. These cultures were grown overnight at 37 0 C. A human VR1 receptor probe was generated by polymerase chain reaction using the following primer pair: 5' oligo (SEQ.ID. NO.1): 5' GACCCTAACTCCAGGCCACCTCCAG 3' oligo (SEQ.ID.NO.2): 5'AGATACTCCTGCGATCATAGAGCCTGAGGG The probe was generated by PCR using regular PCR conditions using 5' and 3' probe oligos (1Ong each) and 10 ng of diluted miniprep DNA. The resulting 274 bp fragment was run on 1% agarose gel and purified using a QUIAquick Gel extraction kit (Quiagen). About 100 ng of the purified probe was labeled with alpha 32P using oligolabeling kit from Pharmacia and the labeled DNA was purified with S-200 columns (Pharmacia). The library colonies were lifted on Protran nitrocellulose filters (Scheicher & Schuel) and the DNA was denatured in 1.5 M NaCl, 0.5 M NaOH. The filter disks were neutralized with 1.5 M NaCl, 1.0 M Tris-HCI, pH 7.5 and then UV crosslinked to the membrane using a UV-Stratalinker (Stratagene). The filters were washed several times in wash solution (1 M Tris-HCI, pH 8.0; 5 M NaCl; 0.5 M EDTA; 20% SDS) at 42 0 C. Then the disks were incubated in lx southern pre-hybridization buffer (5'-3' Inc) containing 50% formamide and 100 ug/ml of sheared salmon sperm DNA (5' - 3' Inc) for 6 hours at 30 WO 00/63415 PCT/USOO/09897 42 C. Finally, hybridization was performed overnight at 42C in 1x hybridization buffer (5'-3') containing 50% formamide, 1OOng of sheared salmon sperm DNA in the presence of labeled probe (5x10 5 to 1x10 6 cmp/ml of hybridization buffer). The disks were washed twice in 2xSSC, 0.2% SDS at room temperature (20 min each) and once in 0.2xSSC, 0.1%SDS at 50C for 30 minutes. The membranes were than placed on sheets of filter paper, wrapped in the Saran Wrap and exposed to the film at 20C overnight. Positive clones were identified and collected by coring the colonies from the original plate. The colonies were incubated in LB for 1 hour at 37*C. Dilutions of the cultures were plated onto LB agar plates and the filter-lifting, hybridizing, washing, colony-picking procedure was repeated. Individual clones from the second screen were picked and digested with EcoRI/NotI to determine the size of the inserts, and the inserts were sequenced. The full length clone was generated by PCR with Pfu polymerase using 10 ng of the sequenced library clone as a template and full length oligos with EcoRI (FL 5'oligo SEQ.ID.NO.3) and NotI (FL 3' oligo SEQ.ID.NO.4) sites. FL 5' oligo (SEQ.ID.NO.3): 5' AACGTTGAATTCGCCACCATGAAGAAATGGAGCAGCACAGACTTGG FL3' oligo: (SEQ.ID.NO.4): 5' AACGTTGCGGCCGCGTGCTGTCTGCGTGACGTCCTCAC The PCR product was digested with EcoRI and NotI enzymes and cloned into a pGem HE expression vector. Large-scale preparation of DNA was done using a MEGA prep kit (Quiagen). EXAMPLE 3- Cloning human VR1 receptor cDNA into a Mammalian Expreion 31 WO 00/63415 PCT/USOO/09897 Vector The human VRl receptor cDNAs (collectively referred to as hVR1) were cloned into the mammalian expression vector pcDNA3.1 /Zeo(+). The cloned PCR product was purified on a column (Wizard PCR DNA purification kit from Promega) and digested with Not I and EcoRl (NEB) to create cohesive ends. The product was purified by a low melting agarose gel electrophoresis. The pcDNA3.1/Zeo(+) vector was digested with EcoRl and Noti enzymes and subsequently purified on a low melt agarose gel. The linear vector was used to ligate to the human VR1 cDNA inserts. Recombinants were isolated, designated human VR1 receptor, and used to transfect mammalian cells (HEK293, COS-7 or CHO-Kl cells) using the Effectene non liposomal lipid based transfection kit (Quiagen). Stable cell clones were selected by growth in the presence of zeocin. Single zeocin resistant clones were isolated and shown to contain the intact human VR1 receptor gene. Clones containing the human VR1 receptor cDNAs were analyzed for hVR1 protein expression. Recombinant plasmids containing human VR1 encoding DNA were used to transform the mammalian COS or CHO cells or HEK293 cells. Cells expressing human VR1 receptor, stably or transiently, were used to test for expression of human VR1 receptor and for 3 H-RTX binding activity. These cells were used to identify and examine other compounds for their ability to modulate, inhibit or activate the human VR1 receptor and to compete for radioactive 3 H-RTX binding. Cassettes containing the human VR1 receptor cDNA in the positive orientation with respect to the promoter are ligated into appropriate restriction sites 3' of the promoter and identified by restriction site mapping and/or sequencing. These cDNA expression vectors are introduced into fibroblastic host cells for example COS-7 (ATCC# CRL1651), and CV-1 tat [Sackevitz et al., Science 238: 1575 (1987)], 293, L (ATCC# CRL6362)] by standard methods including but not limited to 32 WO 00/63415 PCT/USOO/09897 electroporation, or chemical procedures (cationic liposomes, DEAE dextran, calcium phosphate). Transfected cells and cell culture supernatants are harvested and analyzed for human VR1 receptor expression as described herein. All of the vectors used for mammalian transient expression can be used to establish stable cell lines expressing human VR1 receptor. Unaltered humanVR1 receptor cDNA constructs cloned into expression vectors are expected to program host cells to make human VR1 receptor protein. The transfection host cells include, but are not limited to, CV-1-P [Sackevitz e al., Science 238: 1575 (1987)], tk-L [Wigler, eta. Cell 11: 223 (1977)], NS/0, and dHFr- CHO [Kaufman and Sharp, J. Mol. Biol. 159: 601, (1982)]. Co-transfection of any vector containing human VR1 receptor cDNA with a drug selection plasmid including, but not limited to G418, aminoglycoside phosphotransferase; hygromycin, hygromycin-B phospholransferase; APRT, xanthine-guanine phosphoribosyl-transferase, will allow for the selection of stably transfected clones. Levels of human VR1 receptor are quantitated by the assays described herein. Human VR1 receptor cDNA constructs are also ligated into vectors containing amplifiable drug-resistance markers for the production of mammalian cell clones synthesizing the highest possible levels of human VR1 receptor. Following introduction of these constructs into cells, clones containing the plasmid are selected with the appropriate agent, and isolation of an over-expressing clone with a high copy number of plasmids is accomplished by selection in increasing doses of the agent. The expression of recombinant human VR1 receptor is achieved by transfection of full-length human VRI receptor cDNA into a mammalian host cell. EXAMPLE 4 Characterization of functional protein encoded by pVRlR in Xenopus oocytes 33 WO 00/63415 PCT/USOO/09897 Xenopus laevis oocytes were prepared and injected using standard methods previously described and known in the art (Fraser et al., 1993). Ovarian lobes from adult female Xenopus laevis (Nasco, Fort Atkinson, WI) were teased apart, rinsed several times in nominally Ca-free saline containing: 82.5mM NaCl, 2.5mM KCI, 1mM MgCl 2 , 5 mM HEPES, adjusted to pH 7.0 with NaOH (OR-2), and gently shaken in OR-2 containing 0.2% collagenase Type 1 (ICN Biomedicals, Aurora, Ohio) for 2-5 hours. When approximately 50% of the follicular layers were removed, Stage V and VI oocytes were selected and rinsed in media consisting of 75% OR-2 and 25% ND-96. The ND-96 contained: 100 mM NaCl, 2 mM KCI, 1 mM MgCl 2 , 1.8 mM CaCl 2 , 5 mM HEPES, 2.5 mM Na pyruvate, gentamicin (50 ug/ml), adjusted to pH 7.0 with NaOH. The extracellular Ca 2 was gradually increased and the cells were maintained in ND-96 for 2 24 hours before injection. For in vitro transcription, pGEM HE (Liman et al., 1992) containing human VR1 was linearized with NheI and transcribed with T7 RNA polymerase (Promega) in the presence of the cap analog m7G(5')ppp( 5 ')G. The synthesized cRNA was precipitated with ammonium acetate and isopropanol, and resuspended in 50pil nuclease-free water. cRNA was quantified using formaldehyde gels (1% agarose, 1xMOPS , 3% formaldehyde) against 1,2 and 5 p1l RNA markers (Gibco BRL, 0.24 - 9.5 Kb). Oocytes were injected with 50 nl of the human VR1 receptor RNA (0.025-2.5 ng). Control oocytes were injected with 50 nl of water. Oocytes were incubated for 1-10 days in ND-96 before analysis for expression of the human VR1 . Incubations and collagenase digestion were carried out at room temperature. Injected oocytes were maintained in 48 well cell culture clusters (Costar; Cambridge, MA) at 18 0 C. Whole cell agonist-induced currents were measured 1-14 days after injection with a conventional two-electrode voltage clamp (GeneClamp500, Axon Instruments, Foster City, CA) using standard methods previously described and known in the art (Dascal, 1987). The microelectrodes were filled with 3 M KCl, which had resistances of 1 and 2 MQ. Cells 34 WO 00/63415 PCT/US00/09897 were continuously perfused with ND96 at 10 ml/min at room temperature unless indicated. Membrane voltage was clamped at -60 mV unless indicated. Capsaicin (C; 0.1- 10 piM) elicited inward currents in oocytes that had been injected with RNA transcribed from the cloned hVR1 receptor cDNA as shown in FIGURE 4, a,b,c. The inward current (at -60 mV) through hVR1 receptors elicited by 1 p.M capsaicin exposure (peak current -0.144 +/- 0.035 (n=15)) was slowly rising and usually did not show appreciable desensitization over the time studied in BaSOS (FIGURE 4a,b). The response to I p.M capsaicin was completely blocked by preincubation in the antagonists 3 p.M capsazepine (CPZ), a highly selective antagonist of VR1 receptors (FIGURE 4a; n=3)) and 1-10 p.M ruthenium red (RR; FIGURE 4b; n=3). The capsaicin response was partially recovered after extensive washout of antagonists (FIGURE 4 a, b right panels). Some of this data were reproduced in 2 other batches of oocytes. The magnitude of the capsaicin-induced response depended on the amount of cRNA injected. Maximum responses to 1 p.M capsaicin (at a -40 mV holding potential) were -0.02 +/- 0.004 pA (n=3), -0.34 +/- 0.32 pA (n=3), and -2.03 +/- 1.07 pA (n=3) for 0.025 ng, 0.25 ng and 2.5 ng cRNA-injected oocytes, respectively. Currents elicited by capsaicin (FIGURE 4c) and RTX (FIGURE 4d) were measured at voltages between -120 and 80 mV by using a voltage ramp protocol. The currents induced by both agonists were strongly outwardly rectifying, as reported previously for the rat VR1 (Caterina et al., 1997). Responses to capsaicin and RTX were consistent with the activation of a non-selective cation channels since they reversed at -2.7 +/- 0.9 mV (n=12) and -5.6 +/- 1.0 mV (n=4), respectively. Non-inactivating currents were elicited by resiniferatoxin in both Ca 2 + and Ba 2 +-containing media. Capsaicin induced inward currents in a dose dependent manner (FIGURE 5). 35 WO 00/63415 PCT/USOO/09897 Capsaicin responses were recorded during application of compound to cells either voltage-clamped at -60 mV or challenged with a voltage ramp protocol. The EC50 for capsaicin was about 200 nM. RTX effects were also dose dependent. Cells were held at negative membrane potential (e.g., -40 mV). 10 nM RTX elicited 17, 39 and 35 % of the response to 1 pM capsaicin (n=3) and 100 nM RTX elicited 436 and 277 % (n=2) of the response to 1 pM capsaicin. The magnitude of the response to RTX was larger than expected compared to that observed for the rat VR1, and may be dependent on different experimental methods used. In these experiments, capsaicin was applied first because it was reversible after 10 minutes of continuous washing. CPZ produced a dose-dependent block of the capsaicin response as shown in Figure 6. Oocytes were challenged with capsaicin (0.6 piM) and 4 minutes later, preincubated with the indicated concentration of capsazepine (CPZ; Figure 6). CPZ dose-dependently blocked a subsequent response to 0.6 pM capsaicin (in the continued presence of CPZ). The IC50 for CPZ was about 100 nM. The human VR1 expressed from the human VR1-encoding DNA molecule described herein was activated by low pH solutions (ND96, pH 5.5; FIGURE 7). Low pH activated a current that was similar to that induced by capsaicin. The response had a reversal potential near 0 mV (n=2). The low pH activated current activated with a similar time course as that elicited by capasaicin in the same cell and it was blocked by CPZ (1 p.M; FIGURE 7b). EXAMPLE 5 Characterization of Human VRI transiently and stable expressed in mammalian cell lines. Human HEK293 cells were transfected with either human VR1 receptor pVR1R or the vector pcDNA3.1/zeo(+). Transient transfections 1 pg of pVR1R or vector per 106 cells per 100 mm dish were performed using the Effectene tranfection kit (Quiagen; 36 WO 00/63415 PCT/USOO/09897 301425). Three days after transfection, cells were plated onto 96-well plates (Biocoat, poly-D-lysine coated black/clear plate; Becton Dickinson part # 354640). After one day, wells were rinsed with F12/DMEM, then incubated in Fluo-4 (2 piM) with Pluronic acid (20%, 40pl used in 20 mis total volume) for 1 hour at room temperature. Plates were assayed using the FLIPR (Molecular Devices, FL-101). Cells were challenged with agonists (at 3-fold concentration in 40 pl added to 80 pl at a velocity of 50 pl/sec). Transfections with vector alone were tested as controls. Antagonists were included for ~ 1-2 minutues, as indicated, prior to the addition of agonist in the presence of antagonist. After three days the cells were selected in the presence of zeocin (200 pg/ml) and grown through three 1:10 dilution passages for approximately two weeks. Individual colonies were picked and grown in 6-well dishes. Cells were then plated onto 96-well plates (Biocoat, poly-D-lysine coated black/clear plate; Becton Dickinson part # 354640). Plates were assayed using the FLIPR (Molecular Devices, FL-101) as described above. Ca 2 + influxes were observed in HEK293 cells transiently transfected with hVR1 in response to capsaicin (1 piM) and RTX (100 nM) (Figure 8a). Capsaicin caused an influx of Ca 2 + into cells transiently transfected with hVR1 (Figure 8al) but not cells transfected with vector alone (Figure 8bl), indicating specific function of the expressed human VR1 protein. The capsaicin response was partially blocked by ~1 min preincubation in 0.1 p.M (Figure 8a2) and 1 p.M CPZ (Figure 8a3) (about 11% and 30% block, respectively). A slower rising response to 100 nM RTX was observed in hVR1 transfected cells (Figure 8a4) which was completely blocked by 1 p.M CPZ (Figure 8a5). Again, the responses were specific for hVR1-transfected cells since cells transfected with vector only did not produce a specific Ca 2 + influx in response to RTX (Figure 8b4-5). HEK293 cells stably expressing hVR1 were constructed and tested for their responsiveness to capsaicin (15 nM) and their sensitivity to ruthenium red (FIGURE 9A 37 WO 00/63415 PCT/USOO/09897 B) and CPZ (FIGURE 9C). Agonist induced increases in intracellular Ca2+ were observed as an increase in fluorescence intensity measured on the FLIPR and are shown in A. The concentration of ruthenium red present for 2 min preincubation (as well as together with the stimulus) was increased from 0.1 iM (second column) to 17 ptM ( 1 1 th column). The concentrations were 0, 0.1, 0.3, 0.45, 0.7, 1, 1.7, 3, 6, 10, 17 and 0 ptM in columns 1 to 12, respectively. The IC50 for ruthenium red against 15 nM capsaicin was 0.88 [95% confidence interval: 0.63- 1.2 iM; n= 6 separate experiments]. Similar experiments were performed with CPZ and the IC50 was 200 nM (95% confidence interval: 90- 460 nM) (n= 5 experiments). The whole cell patch clamp technique (Hamill et al., 1981) was used to record ligand-induced currents from HEK293 stably expressing human VR1 receptor maintained for >2 days on 12 mm coverslips. Cells were visualized using a Nikon Diaphot 300 with DIC Nomarski optics. Cells are continuously perfused in a physiological saline (-0.5 ml/min) unless otherwise indicated. The standard physiological saline ("Tyrodes") contained: 130 mM NaCl, 4 mM KCI, 1 mM CaC12, 1.2mM MgCl2, and 10mM hemi-Na HEPES (pH 7.3, 295-300 mOsm as measured using a Wescor 5500 vapor-pressure (Wescor, Inc., Logan, UT). Recording electrodes were fabricated from borosilicate capillary tubing (R6; Garner Glass, Claremont, CA), the tips were coated with dental periphery wax (Miles Laboratories, South Bend, IN), and had resistances of 1-2 MQ when containing intracellular saline: 100 mM K-gluconate, 25 mM KCl, 0.483 mM CaCl2, 3 mM MgCl2, 10 mM hemi-Na-HEPES and 1 mM K4-BAPTA (1OOnM free Ca"); pH 7.4, with dextrose added to achieve 290 mOsm). Liquid junction potentials were -18 mV using standard pipette and bath solutions as determined both empirically and using the computer program JPCalc ((Barry, 1994)). The voltage data shown were not corrected for liquid junction potential (ie., a voltage presented as +10 would be -8 mV after correcting for the junction potential). Current and voltage signals were detected and filtered at 2 kHz with an 38 WO 00/63415 PCTIUSOO/09897 Axopatch ID patch-clamp amplifier (Axon Instruments, Foster City, CA), digitally recorded with a DigiData 1200B laboratory interface (Axon Instruments), and PC compatible computer system and stored on magnetic disk for off-line analysis. Data acquisition and analysis were performed with PClamp software. The total membrane capacitance (Cm) was determined as the difference between the maximum current after a 30 mV hyperpolarizing voltage ramp from -68 mV generated at a rate of 10 mV/ms and the steady state current at the final potential (-98 mV) (Dubin et al., 1999). Apparent reversal potentials (Vrev) of ligand-induced conductance changes were determined using a voltage-ramp protocol (Dubin et al., 1999). Voltage ramps were applied every 1 second and the resulting whole cell ramp-induced currents were recorded. Usually the voltage was ramped from negative to positive to negative values. The current required to clamp the cells at -68 mV was continuously monitored. Ligand-induced conductances were determined from whole-cell currents elicited by a voltage-ramp protocol in the presence and absence of ligand. Voltage ramp-induced currents measured before (control) and in the presence of ligand were compared to reveal the effect of the ligand on the channel to modulate the channel current output. The voltage at which there was no net ligand-induced current was determined (Vrev). Most values are presented as the arithmetic mean +/- standard error of the mean (S.E.M.). Capsaicin caused an increase in conductance in HEK293 cells stably expressing hVRl, consitent with its activation of a flux of non-selective cations. The Vrev was 10.4 +/- 2.2 mV (n= 5) (FIGURE 10). In the example shown, Vrev was +13 mV. This value (taking in to account the junction potential, Vrev is -8.4 mV) is similar to that obtained in two electrode voltage clamp studies on oocytes. A high level of expression of VR1 mediated currents was attained: capsaicin-induced currents measured at +60 mV were 1630 +/- 530 pA. The current density was determined by normalizing to the cell capacitance and was 80 +/- 40 pA/pF. The response to 100 nM capsaicin was 39 WO 00/63415 PCT/US00/09897 completely blocked by 2 min preincubation in CPZ (1 pM) (FIGURE lOb). Shown are voltage ramp-induced currents elicited by a steadily depolarizing command potential from --100 to +100 mV over 200 msec. 1 pM CPZ blocked the response to capsaicin in 3 cells. Partial recovery from CPZ block was observed. The potent agonist RTX (160 nM) produced an increase in conductance similar to that observed with capsaicin (FIGURE 11). The reversal potential was +10 mV. In this case, the current density was 26 pA/pF. Challenge with low pH extracellular solutions reversibly increased the conductance of hVRl-expressing cells (FIGURE 12a). Similar responses were not observed in control cells. The antagonist CPZ at 1 pM inhibited the pH4.5-induced response (FIGURE 12b). The low pH response recovered after washout of CPZ (FIGURE 12c). The current scale bar represents 1 nA (a and b) and 2 nA (c). The Vrev for low pH responses was +7 +/- 5 mV (n= 4). Differences between pH-induced and capsaicin and RTX-induced responses may be due to confounding effects of low pH on outward currents activated by the ramp protocol. EXAMPLE 6 -Binding assay on human hVR1 transfected mammalian cells. HEK293 cells stably expressing hVR1 receptor can be used in 3 H-RTX binding assays. Equilibrium ligand binding assays can be performed using conventional procedures. Specific 3 H-[RTX] binding is observed in membrane preparations from VR1 receptor transfected cells. EXAMPLE 7-Binding assay on human VR1 receptor RNA injected oocytes Oocytes injected with hVRl in vitro RNA are used in 3 H-[RTX] binding assays. hVR1 RNA (2.5 ng) is injected into oocytes individually and 2 days later the oocytes are disrupted with a dounce homogenizer and yolk proteins removed using 40 WO 00/63415 PCT/USOO/09897 standard methods known in the art. Equilibrium ligand binding assays are performed using conventional procedures. Oocytes expressing hVRI should bind 3 H-[RTX] with high affinity, approximately I nM. Specific 3 H-[RTX] binding is observed in membrane preparations from hVR1 -injected oocytes. Oocytes expressing hVR1 are used to measure the affinity of binding of test compounds by their ability to modulate 3 H-[RTX] binding. EXAMPLE 8 -Primary Structure Of The Human VR1 receptor Protein The nucleotide sequences of human VR1 receptor revealed single large open reading frame of about 2520 human VR1 receptor base pairs encoding 839 amino acids. The cDNAs have 5' and 3'-untranslated extensions of about 921 and about 1383 nucleotides for human VRI receptor. The first in-frame methionine was designated as the initiation codon for an open reading frame that predicts a human VR1 receptor protein with an estimated molecular mass (Mr) of about 95,048 kDa. The predicted human VR1 receptor protein was aligned with nucleotide and protein databases and found to be related to the rat VR1 receptor. Approximately 93% of the amino acids in human VR1 receptor were highly conserved, showing at least 86% amino acid identity with rat VR1. The conserved motifs found in this family of receptor, such as a large putative N-terminal hydrophilic segment (about 433 amino acids), three putative ankyrin repeat domains in the N-terminus region and 6 predicted transmembrane regions and pore region, were also found in the human VR1 receptor sequence. A putative N-linked glycosylation site is contained in the putative transmembrane 5-P loop (Nx(S/T)). There are 17 putative phosphorylation sites (PKA: 3; PKC: 12; mammary gland casein kinase: 2). EXAMPLE 9-Cloning human VR1 receptor cDNA into E. oli Expression Vectors Recombinant human VR1 receptor is produced in E. coli following the transfer of the human VR1 receptor expression cassette into E coli expression 41 WO 00/63415 PCT/USOO/09897 vectors, including but not limited to, the pET series (Novagen). The pET vectors place human VR1 receptor expression under control of the tightly regulated bacteriophage T7 promoter. Following transfer of this construct into an E. coli host that contain a chromosomal copy of the T7 RNA polymerase gene driven by the inducible lac promoter, expression of human VR1 receptor is induced when an appropriate lac substrate (IPTG) is added to the culture. The levels of expressed human VR1 receptor are determined by the assays described herein. The cDNA encoding the entire open reading frame for human VR1 receptor is inserted into the NdeI site of pET [16 )11a. Constructs in the positive orientation are identified by sequence analysis and used to transform the expression host strain BL2 1. Transformants are then used to inoculate cultures for the production of human VR1 receptor protein. Cultures may be grown in M9 or ZB media, whose formulation is known to those skilled in the art. After growth to an OD 60 0 = 1.5, expression of human VRI receptor is induced with 1 mM IPTG for 3 hours at 37"C. EXAMPLE 10-Cloning human VR1 receptor cDNA into a Baculovirus Exressio Vector for Expression in Insect Cells Baculovirus vectors, which are derived from the genome of the AcNPV virus, are designed to provide high level expression of cDNA in the Sf9 line of insect cells (ATCC CRL# 1711). Recombinant baculoviruses expressing human VRI receptor cDNA is produced by the following standard methods (InVitrogen Maxbac Manual): the human VR1 receptor cDNA constructs are ligated into the polyhedrin gene in a variety of baculovirus transfer vectors, including the pAC360 and the BlueBac vector (InVitrogen). Recombinant baculoviruses are generated by homologous recombination following co-transfection of the baculovirus transfer vector and linearized AcNPV genomic DNA [Kitts, P.A., Nuc. Acid. Res. 18: 5667 (1990)] into Sf9 cells. Recombinant pAC360 viruses are identified by the absence of inclusion bodies in infected cells and recombinant pBlueBac viruses are identified on the basis 42 WO 00/63415 PCTUSOO/09897 of B-galactosidase expression (Summers, M. D. and Smith, G. E., Texas Agriculture Exp. Station Bulletin No. 1555). Following plaque purification, human VR1 receptor expression is measured by the assays described herein. The cDNA encoding the entire open reading frame for human VR1 receptor is inserted into the BamHI site of pBlueBacII. Constructs in the positive orientation are identified by sequence analysis and used to transfect Sf9 cells in the presence of linear AcNPV mild type DNA. Authentic, active human VR1 receptor is found in the cytoplasm of infected cells. Active human VR1 receptor is extracted from infected cells by hypotonic or detergent lysis. EXAMPLE 11-Cloning human VR1 receptor cDNA into a yeast expression vector Recombinant human VR1 receptor is produced in the yeast S. cerevisiae following insertion of the optimal human VR1 receptor cDNA cistron into expression vectors designed to direct the intracellular or extracellular expression of heterologous proteins. In the case of intracellular expression, vectors such as EmBLyex4 or the like are ligated to the human VR1 receptor cistron [Rinas, U. gd &l., Biotechnology 8: 543-545 (1990); Horowitz B. et al., J. Biol. Chem. 265: 4189-4192 (1989)]. For extracellular expression, the human VR1 receptor cistron is ligated into yeast expression vectors which fuse a secretion signal (a yeast or mammalian peptide) to the NH2 terminus of the human VR1 receptor protein [Jacobson, M. A., Gene 85: 511-516 (1989); Riett L. and Bellon N. Biochem. 28: 2941-2949 (1989)]. These vectors include, but are not limited to pAVE 1>6, which fuses the human serum albumin signal to the expressed cDNA [Steep 0. Biotechnology 8: 42 46 (1990)], and the vector pL8PL which fuses the human lysozyme signal to the expressed cDNA [Yamamoto, Y., Biochem. 28: 2728-2732)]. In addition, human VR1 receptor is expressed in yeast as a fusion protein conjugated to ubiquitin utilizing the vector pVEP [Ecker, D. J., J. Biol. Chem. 264: 7715-7719 (1989), Sabin, 43 WO 00/63415 PCTIUSOO/09897 E. A., Biotechnology 7: 705-709 (1989), McDonnell D. P., Mol. Cell Biol. 9: 5517 5523 (1989)]. The levels of expressed human VR1 receptor are determined by the assays described herein. EXAMPLE 12-Purification of Recombinant human VRl receptor Recombinantly produced human VR1 receptor may be purified by antibody affinity chromatography. Human VRl receptor antibody affinity columns are made by adding the anti human VR1 receptor antibodies to Affigel-10 (Bio-Rad), a gel support that is pre activated with N-hydroxysuccinimide esters such that the antibodies form covalent linkages with the agarose gel bead support. The antibodies are then coupled to the gel via amide bonds with the spacer arm. The remaining activated esters are then quenched with IM ethanolamine HCl (pH 8). The column is washed with water followed by 0.23 M glycine HC1 (pH 2.6) to remove any non-conjugated antibody or extraneous protein. The column is then equilibrated in phosphate buffered saline (pH 7.3) together with appropriate membrane solubilizing agents such as detergents and the cell culture supernatant or cell extract containing solubilized human VR1 receptor is slowly passed through the column. The column is then washed with phosphate buffered saline together with detergents until the optical density (A280) falls to background, then the protein is eluted with 0.23 M glycine-HCI (pH 2.6) together with detergents. The purified human VR1 receptor protein is then dialyzed against phosphate buffered saline. 44 WO 00/63415 PCTIUSO0/09897 References Acs, G., Palkovits, M., and Blumberg, P. M. (1994). [3H]Resiniferatoxin binding by the human vanilloid (capsaicin) receptor. Mol. Brain Res. 23, 185-90. Barry, P. (1994). JPCalc, a software package for calculating liquid junction potential corrections in patch-clamp, intracellular, epithelial and bilayer measurements and for correcting junction potential measurements. J. Neurosci Methods 51, 107-116. Bevan, S., Hothi, S., Hughes, G., James, I. F., Rang, H. P., Shah, K., Walpole, C. S. J., and Yeats, J. C. (1992). Capsazepine: a competitive antagonist of the sensory neuron excitant capsaicin. Br. J. Pharmacol. 107, 544-52. Bevan, S., and Szolcsanyi, J. (1990). Sensory neuron-specific actions of capsaicin: mechanisms and applications. Trends Pharmacol. Sci. 11, 330-3. Caterina, M. J., Schumacher, M. A., Tominaga, M., Rosen, T. A., Levine, J. D., and Julius, D. (1997). The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature (London) 389, 816-824. Dascal, N. (1987). The use of Xenopus oocytes for the study of ion channels. CRC Critical Reviews in Biochemistry 22, 317-387. Dubin, A. E., Bahnson, T., Weiner, J. A., Fukushima, N., and Chun, J. (1999). Lysophosphatidic acid stimulates neurotransmitter-like conductance changes that precede GABA and L-glutamate in early, presumptive cortical neuroblasts.J. Neurosci. 19, 1371-1381. 45 WO 00/63415 PCT/USO0/09897 Fraser, S. P., Moon, C., and Djamgoz, M. B. A. (1993). Electrophysiology of Xenopus oocytes: An expression system in molecular neurobiology. In Electrophysiology, D. Wallis, ed.: IRL, Oxford, UK), pp. 65-86. Hamill, 0., Marty, A., Neher, E., Sakmann, B., and Sigworth, F. (1981). Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Archives 391, 85-100. Jancso, G., Kiraly, E., and Jancso-Gabor, A. (1977). Pharmacologically induced selective degeneration of chemosensitive primary sensory neurons. Nature (London) 270,741-3. Kress, M., and Zeilhofer, H. U. (1999). Capsaicin, protons and heat: new excitement about nociceptors. TiPS 20, 112-118. Liman, E. R., Tytgat, J., and Hess, P. (1992). Subunit stoichiometry of a mammalian potassium channel determined by construction of multimeric cDNAs. Neuron 9, 861 71. Oh, U., Hwang, S. W., and Kim, D. (1996). Capsaicin activates a nonselective cation channel in cultured neonatal rat dorsal root ganglion neurons. J. Neurosci. 16, 1659 67. Ome, A.-S., Szolcsanyi, J., and Mozsik, G. (1997). Capsaicin and the stomach. A review of experimental and clinical data. J. Physiol. (Paris) 91, 151-171. 46 WO 00/63415 PCT/USOO/09897 Robbins, W. R., Staats, P. S., Levine, J., Fields, H. L., Allen, R. W., Campbell, J. N., and Pappagallo, M. (1998). Treatment of intractable pain with topical large-dose capsaicin: preliminary report. Anesth. Analg. (Baltimore) 86, 579-583. Rowbotham, M. C. (1994). Topical analgesic agents. In Progress in Pain Research and Management, H. L. F. a. J. C. Liebeskind, ed. (Seattle: IASP Press), pp. 211-227. Santos, A. R. S., and Calixto, J. B. (1997). Ruthenium red and capsazepine antinociceptive effect in formalin and capsaicin models of pain in mice. Neurosci. Lett. 235, 73-76. Szallasi, A., and Blumberg, P. M. (1990). Resiniferatoxin and its analogs provide novel insights into the pharmacology of the vanilloid (capsaicin) receptor. Life Sci. 47, 1399-408. Szallasi, A., and Blumberg, P. M. (1996). Vanilloid receptors: new insights enhance potential as a therapeutic target. Pain 68, 195-208. Szallasi, A., Blumberg, P. M., Nilsson, S., Hoekfelt, T., and Lundberg, J. M. (1994). Visualization by [3H]resiniferatoxin autoradiography of capsaicin-sensitive neurons in the rat, pig and man. Eur. J. Pharmacol. 264, 217-21. Szallasi, A., Goso, C., Blumberg, P. M., and Manzini, S. (1993). Competitive inhibition by capsazepine of [3H]resiniferatoxin binding to central (spinal cord and dorsal root ganglia) and peripheral (urinary bladder and airways) vanilloid (capsaicin) receptors in the rat. J. Pharmacol. Exp. Ther. 267, 728-33. 47 WO 00/63415 PCT/USOO/09897 Szallasi, A., Nilsson, S., Farkas-Szallasi, T., Blumberg, P. M., Hoekfelt, T., and Lundberg, J. M. (1995). Vanilloid (capsaicin) receptors in the rat: distribution in the brain, regional differences in the spinal cord, axonal transport to the periphery, and depletion by systemic vanilloid treatment. Brain Res. 703, 175-83. Szallasi, A., Szolcsanyi, J., Szallasi, Z., and Blumberg, P. M. (1991). Inhibition of [3H]resiniferatoxin binding to rat dorsal root ganglion membranes as a novel approach in evaluating compounds with capsaicin-like activity. Naunyn Schmiedeberg's Arch. Pharmacol. 344, 551-6. Szolcsanyi, J. (1993). Actions of capsaicin on sensory receptors. In Capsaicin Study Pain, J. N. Wood, ed.: Academic, London, UK), pp. 1-26. Szolcsanyi, J. (1996). Capsaicin-sensitive sensory nerve terminals with local and systemic efferent functions: facts and scopes of an unorthodox neuroregulatory mechanism. Prog. Brain Res. 113, 343-359. Szolcsanyi, J., Szallasi, A., Szallasi, Z., Joo, F., and Blumberg, P. M. (1991). Resiniferatoxin. An ultrapotent neurotoxin of capsaicin-sensitive primary afferent neurons. Ann. N. Y. Acad. Sci. 632, 473-5. Tominaga, M., Caterina, M. J., Malmberg, A. B., Rosen, T. A., Gilbert, H., Skinner, K., Raumann, B., Basbaum, A. I., and Julius, D. (1998). The cloned capsaicin receptor integrates multiple pain-producing stimuli. Neuron 21, 531-543. Wall, P. D., and Melzack, R. (1994). Textbook of Pain (New York: Churchill Livingstone). 48 WO 00/63415 PCTIUSOO/09897 Wood, J. N., Winter, J., James, I. F., Rang, H. P., Yeats, J., and Bevan, S. (1988). Capsaicin-induced ion fluxes in dorsal root ganglion cells in culture. J. Neurosci. 8, 3208-20. 49 WO 00/63415 PCT/USOO/09897 SEQUENCE LISTING <110> Dubin, Adrienne Elizabeth Erlander, Mark Gottfrid Huvar, Arne Huvar, Rene <120> Human VR1 receptor cDNA <130> ORT988 <140> <141> <160> 7 <170> PatentIn Ver. 2.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: 50 WO 00/63415 PCT/US00/09897 oligonucleotide <400> 1 25 gaccctaact ccaggccacc tccag <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: oligonucleotide <400> 2 agatactcct gcgatcatag agcctgaggg 30 <210> 3 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: oligonucleotide 51 WO 00/63415 PCT/USOO/09897 <400> 3 aacgttgaat tcgccaccat gaagaaatgg agcagcacag acttgg 46 <210> 4 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: oligonucleotide <400> 4 aacgttgcgg ccgcgtgctg tctgcgtgac gtcctcac 38 <210> 5 <211> 2520 <212> DNA <213> Homo sapiens <400> 5 atgaagaaat ggagcagcac agacttgggg gcagctgcgg acccactcca aaaggacacc 60 tgcccagacc ccctggatgg agaccctaac tccaggccac ctccagccaa gccccagctc 120 tccacggcca agagccgcac ccggctcttt gggaagggtg actcggagga ggctttcccg 180 52 WO 00/63415 PCT/UTSOO/09897 gtggattgcc ctcacgagga aggtgagctg gactcctgcc cgaccatcac agtcagccct 240 gttatcaCCa tccagaggcc aggagacggc cccaccggtg ccaggctgct gtcccaggaC 300 tctgtcgccg ccagcaccga gaagaccctc aggctctatg atcgcaggag tatctttgaa 360 gccgttgctc agaataactg ccaggatctg gagagcctgc tgctcttcct gcagaagagc 420 aagaagcacc tcacagacaa cgagttcaaa gaccctgaga cagggaagac ctgtctgctg 480 aaagccatgc tcaacctgca cgacggacag aacaccacca tccccctgct cctggagatc 540 gcgcggcaaa cggacagcct gaaggagctt gtcaacgcca gctacacgga cagctactac 600 aagggccaga cagcactgca catcgccatc gagagacgca acatggccct ggtgaccctc 660 ctggtggaga acggagcaga cgtccaggct gcggcccatg gggacttctt taagaaaacc 720 aaagggcggc ctggattcta cttcggtgaa ctgcccctgt ccctggccgc gtgcaccaac 780 cagctgggca tcgtgaagtt cctgctgcag aactcctggc agacggccga catcagcgcc 840 agggactcgg tgggcaacac ggtgctgcac gccctggtgg aggtggccga caacacggcc 900 gacaacacga agtttgtgac gagcatgtac aatgagattc tgatcctggg ggccaaactg 960 cacCCgacgc tgaagctgga ggagctcacc aacaagaagg gaatgacgcc gctggctctg 1020 gcagctggga ccgggaagat cggggtcttg gcctatattc tccagcggga gatccaggag 1080 cccgagtgca ggcacctgtc caggaagttc accgagtggg cctacgggcc cgtgcactcc 1140 tcgctgtacg acctgtcctg catcgacaCC tgcgagaaga actcggtgct ggaggtgatc 1200 gcctacagca gcagcgagac ccctaatcgc cacgacatgc tcttggtgga gccgctgaac 1260 cgactcctgc aggacaagtg ggacagattc gtcaagcgca tcttctactt caacttcctg 1320 gtctactgcc tgtacatgat catcttcacc atggctgcct actacaggcc cgtggatggc 1380 ttgcctccct ttaagatgga aaaaactgga gactatttcc gagttactgg agagatcctg 1440 tctgtgttag gaggagtcta cttctttttc cgagggattc agtatttcct gcagaggcgg 1500 ccgtcgatga agaccctgtt tgtggacagc tacagtgaga tgcttttctt tctgcagtca 1560 ctgttcatgc tggccaccgt ggtgctgtac ttcagccacc tcaaggagta tgtggcttcc 1620 atggtattCt ccctggcctt gggctggacc aacatgctct actacaCCCg cggtttccag 1680 53 WO 00/63415 PCT/US0O/09897 cagatgggca tctatgccgt catgatagag aagatgatcc tgagagacct gtgccgtttc 1740 atgtttgtct acgtcgtctt cttgttcggg ttttccacag cggtggtgac gctgattgaa 1800 gacgggaaga atgactccct gccgtctgag tccacgtcgc acaggtggcg ggggcctgcc 1860 tgcaggcccc ccgatagctc ctacaacagc ctgtactcca cctgcctgga gctgttcaag 1920 ttcaccatcg gcatgggcga cctggagttc actgagaact atgacttcaa ggctgtcttc 1980 atcatcctgc tgctggccta tgtaattctc acctacatcc tcctgctcaa catgctcatc 2040 gccctcatgg gtgagactgt caacaagatc gcacaggaga gcaagaacat ctggaagctg 2100 cagagagcca tcaccatcct ggacacggag aagagcttcc ttaagtgcat gaggaaggcc 2160 ttccgctcag gcaagctgct gcaggtgggg tacacacctg atggcaagga cgactaccgg 2220 tggtgcttca gggtggacga ggtgaactgg accacctgga acaccaacgt gggcatcatc 2280 aacgaagacc cgggcaactg tgagggcgtc aagcgcaccc tgagcttctc cctgcggtca 2340 agcagagttt caggcagaca ctggaagaac tttgccctgg tccccctttt aagagaggca 2400 agtgctcgag ataggcagtc tgctcagccc gaggaagttt atctgcgaca gttttcaggg 2460 tctctgaagc cagaggacgc tgaggtcttc aagagtcctg ccgcttccgg ggagaagtga 2520 <210> 6 <211> 4824 <212> DNA <213> Homo sapiens <400> 6 ccacgcgtcc ggcagccagg agccgtcagc cagatcccaa atgagtgcct tccgaaattg 60 acccacctgg gagctattta caaatgtcca tgtgggagag agagagcatg agagcacagt 120 agcccagcct gctggtcagc aggctcatct gtggttcacc tgtagacaga gagcagatca 180 atgtgtactt cagacaccag aaagtctggt ggctttggtc ccaagtggga aaagagaact 240 54 WO 00/63415 PCT/USOO/09897 gccccatgcc cagcttgtga ttatcgtttt tggagacctg aagcccacac tcgggtcgta 300 tggacttctg gaaaagttct tgtctcctgg actgaaccat gtgaccggag gcccctttcc 360 tagtctcatc ctcccctggc tgcagatgct tagctgggcc agggattgac ccaagcgcga 420 tgcagcaggc aggctcagaa gacgatgcgg ggctgtgtgc cggccttctt gctgcatgta 480 ctcagcctca ggagagcttg ctgcacccag gccgcccagg tcttcacagc acaactgcct 540 ggaaggCagg ttgcgagaag gagaggcgga tggcatgagc agcaaggggg accgatgctg 600 tgcagctcac accactccag aacctgacaa ggcaccagca ggaccccttg ccaggagcat 660 gtctgtgcag cagtgttttt gcccctgcac attccagaag ccctcatggg aagggatgca 720 gccaggcaga ctcctgccag atggggcagt gtgatggaga gtctctgccg tgccatctgg 780 gatgcaaacc gtccctgtgt cccccacgtc caggccgtag atgctccccg ccggtcagtc 840 acttagtcgt cagatcgccc gtcctggtat cacagtcctt ctgttcaggt tgcacactgg 900 gccacagagg atccagcaag gatgaagaaa tggagcagca cagacttggg ggcagctgcg 960 gacccactCC aaaaggacac ctgcccagac cccctggatg gagacctaa ctccaggcca 1020 cctccagcca agccccagct ctccacggcc aagagccgca cccggctctt tgggaagggt 1080 gactcggagg aggctttccc ggtggattgc cctcacgagg aaggtgagct ggactcctgc 1140 ccgaccat.ca cagtcagccc tgttatCacc atccagaggc caggagacgg ccccaccggt 1200 gccaggctgc tgtcccagga ctctgtcgcc gccagcaccg agaagaccct caggctctat 1260 gatcgcagga gtatctttga agccgttgct cagaataact gccaggatct ggagagcctg 1320 ctgctcttcc tgcagaagag caagaagcac ctcacagaca acgagttcaa agacctgag 1380 acagggaaga cctgtctgct gaaagccatg ctcaacctgc acgacggaca gaacaccacc 1440 atccccctgc tcctggagat cgcgcggcaa acggacagcc tgaaggagct tgtcaacgcc 1500 agctacacgg acagctacta caagggccag acagcactgc acatcgccat cgagagacgc 1560 aacatggccc tggtgaccct cctggtggag aacggagcag acgtccaggc tgcggcccat 1620 ggggacttct ttaagaaaac caaagggcgg cctggattct acttcggtga actgcccctg 1680 tccctggccg cgtgcaccaa ccagctgggc atcgtgaagt tcctgctgca gaactcctgg 1740 55 WO 00/63415 PCTIUSOO/09897 cagacggccg acatcagcgc cagggactcg gtgggcaaca cggtgctgca cgccctggtg 1800 gaggtggccg acaacacggc cgacaacacg aagtttgtga cgagcatgta caatgagatt 1860 ctgatcctgg gggccaaact gcacccgacg ctgaagctgg aggagctcac caacaagaag 1920 ggaatgacgc cgctggctct ggcagctggg accgggaaga tcggggtctt ggcctatatt 1980 ctccagcggg agatccagga gcccgagtgc aggcacctgt ccaggaagtt caccgagtgg 2040 gcctacgggc ccgtgcactc ctcgctgtac gacctgtcct gcatcgacac ctgcgagaag 2100 aactcggtgc tggaggtgat cgcctacagc agcagcgaga cccctaatcg ccacgacatg 2160 ctcttggtgg agccgctgaa ccgactcctg caggacaagt gggacagatt cgtcaagcgc 2220 atcttctact tcaacttcct ggtctactgc ctgtacatga tcatcttcac catggctgcc 2280 tactacaggc ccgtggatgg cttgcctccc tttaagatgg aaaaaactgg agactatttc 2340 cgagttactg gagagatcct gtctgtgtta ggaggagtct acttcttttt ccgagggatt 2400 cagtatttcc tgcagaggcg gccgtcgatg aagaccctgt ttgtggacag ctacagtgag 2460 atgcttttct ttctgcagtc actgttcatg ctggccaccg tggtgctgta cttcagccac 2520 ctcaaggagt atgtggcttc catggtattc tccctggcct tgggctggac caacatgctc 2580 tactacaccc gcggtttcca gcagatgggc atctatgccg tcatgataga gaagatgatc 2640 ctgagagacc tgtgccgttt catgtttgtc tacgtcgtct tcttgttcgg gttttccaca 2700 gcggtggtga cgctgattga agacgggaag aatgactccc tgccgtctga gtccacgtcg 2760 cacaggtggc gggggcctgc ctgcaggccc cccgatagct cctacaacag cctgtactcc 2820 acctgcctgg agctgttcaa gttcaccatc ggcatgggcg acctggagtt cactgagaac 2880 tatgacttca aggctgtctt catcatcctg ctgctggcct atgtaattct cacctacatc 2940 ctcctgctca acatgctcat cgccctcatg ggtgagactg tcaacaagat cgcacaggag 3000 agcaagaaca tctggaagct gcagagagcc atcaccatcc tggacacgga gaagagcttc 3060 cttaagtgca tgaggaaggc cttccgctca ggcaagctgc tgcaggtggg gtacacacct 3120 gatggcaagg acgactaccg gtggtgcttc agggtggacg aggtgaactg gaccacctgg 3180 aacaccaacg tgggcatcat caacgaagac ccgggcaact gtgagggcgt caagcgcacc 3240 56 WO 00/63415 PCT/USOO/09897 ctgagcttct ccctgcggtc aagcagagtt tcaggcagac actggaagaa ctttgccctg 3300 gtcccccttt taagagaggc aagtgctcga gataggcagt ctgctcagcc cgaggaagtt 3360 tatctgcgac agttttcagg gtctctgaag ccagaggacg ctgaggtctt caagagtcct 3420 gccgcttccg gggagaagtg aggacgtcac gcagacagca ctgtcaacac tgggccttag 3480 gagaccccgt tgccacgggg ggctgctgag ggaacaccag tgctctgtca gcagcctggc 3540 ctggtctgtg cctgcccagc atgttcccaa atctgtgctg gacaagctgt gggaagcgtt 3600 cttggaagca tggggagtga tgtacatcca accgtcactg tccccaagtg aatctcctaa 3660 cagactttca ggtttttact cactttacta aacagtttgg atggtcagtc tctactggga 3720 catgttaggc ccttgttttc tttgatttta ttcttttttt tgagacagaa tttcactctt 3780 ctcacccagg ctggaatgca gtggcacaat tttggctccc tgcaacctcc gcctcctgga 3840 ttccagcaat tctcetgcct cggcttccca agtagctggg attacaggca cgtgccacca 3900 tgtctggcta attttttgta tttttttaat agatatgggg tttcgccatg ttggccaggc 3960 tggtctcgaa ctcctgacct caggtgatcc gcccacctcg gcctcccaaa gtgctgggat 4020 tacaggtgtg agcctccaca cctggctgtt ttctttgatt ttattctttt ttttttttct 4080 gtgagacaga gtttcactct tgttgcccag gctggagtgc agtggtgtga tcttggctca 4140 ctgcaacctc tgcctcccgg gttcaagcga ttcttctgct tcagtctccc aagtagcttg 4200 gattacaggt gagcactacc acgcccggct aatttttgta tttttaatag agacggggtt 4260 tcaccatgtt ggccaggctg gtctcgaact cttgacctca ggtgatctgc ccgccttggc 4320 ctcccaaagt gctgggatta caggtgtgag ccgctgcgct cggccttctt tgattttata 4380 ttattaggag caaaagtaaa tgaagcccag gaaaacacct ttgggaacaa actcttcctt 4440 tgatggaaaa tgcagaggcc cttcctctct gtgccgtgct tgctcctctt acctgcccgg 4500 gtggtttggg ggtgttggtg tttcctccct ggagaagatg ggggaggctg tcccactccc 4560 agctctggca gaatcaagct gttgcagcag tgccttcttc atccttcctt acgatcaatc 4620 acagtctcca gaagatcagc tcaattgctg tgcaggttaa aactacagaa ccacatccca 4680 aaggtacctg gtaagaatgt ttgaaagatc ttccatttct aggaacccca gtcctgcttc 4740 57 WO 00/63415 PCT/USOO/09897 tccgcaatgg cacatgcttc cactccatcc atactggcat cctcaaataa acagatatgt 4800 atacataaaa aaaaaaaaaa aagg 4824 <210> 7 <211> 839 <212> PRT <213> Homo sapiens <400> 7 Met Lys Lys Trp Ser Ser Thr Asp Leu Gly Ala Ala Ala Asp Pro Leu 1 5 10 15 Gln Lys Asp Thr Cys Pro Asp Pro Leu Asp Gly Asp Pro Asn Ser Arg 20 25 30 Pro Pro Pro Ala Lys Pro Gln Leu Ser Thr Ala Lys Ser Arg Thr Arg 35 40 45 Leu Phe Gly Lys Gly Asp Ser Glu Glu Ala Phe Pro Val Asp Cys Pro 50 55 60 His Glu Glu Gly Glu Leu Asp Ser Cys Pro Thr Ile Thr Val Ser Pro 65 70 75 80 Val Ile Thr Ile Gln Arg Pro Gly Asp Gly Pro Thr Gly Ala Arg Leu 58 WO 00/63415 PCTIUSOO/09897 85 90 95 Leu Ser Gln Asp Ser Val Ala Ala Ser Thr Glu Lys Thr Leu Arg Leu 100 10S 110 Tyr Asp Arg Arg Ser Ile Phe Glu Ala Val Ala Gln Asn Asn Cys Gln 115 120 125 Asp Leu Glu Ser Leu Leu Leu Phe Leu Gln Lys Ser Lys Lys His Leu 130 135 140 Thr Asp Asn Glu Phe Lys Asp Pro Glu Thr Gly Lys Thr Cys Leu Leu 145 150 155 160 Lys Ala Met Leu Asn Leu His Asp Gly Gln Asn Thr Thr Ile Pro Leu 165 170 175 Leu Leu Glu Ile Ala Arg Gln Thr Asp Ser Leu Lys Glu Leu Val Asn 180 185 190 Ala Ser Tyr Thr Asp Ser Tyr Tyr Lys Gly Gln Thr Ala Leu His Ile 195 200 205 Ala Ile Glu Arg Arg Asn Met Ala Leu Val Thr Leu Leu Val Glu Asn 210 215 220 59 WO 00/63415 PCTUSO0/09897 Gly Ala Asp Val Gln Ala Ala Ala His Gly Asp Phe Phe Lys Lys Thr 225 230 235 240 Lys Gly Arg Pro Gly Phe Tyr Phe Gly Glu Leu Pro Leu Ser Leu Ala 245 250 255 Ala Cys Thr Asn Gln Leu Gly Ile Val Lys Phe Leu Leu Gln Asn Ser 260 265 270 Trp Gln Thr Ala Asp Ile Ser Ala Arg Asp Ser Val Gly Asn Thr Val 275 280 285 Leu His Ala Leu Val Glu Val Ala Asp Asn Thr Ala Asp Asn Thr Lys 290 295 300 Phe Val Thr Ser Met Tyr Asn Glu Ile Leu Ile Leu Gly Ala Lys Leu 305 310 315 320 His Pro Thr Leu Lys Leu Glu Glu Leu Thr Asn Lys Lys Gly Met Thr 325 330 335 Pro Leu Ala Leu Ala Ala Gly Thr Gly Lys Ile Gly Val Leu Ala Tyr 340 345 350 60 WO 00/63415 PCTIUSOO/09897 Ile Leu Gln Arg Glu Ile Gln Glu Pro Glu Cys Arg His Leu Ser Arg 355 360 365 Lys Phe Thr Glu Trp Ala Tyr Gly Pro Val His Ser Ser Leu Tyr Asp 370 375 380 Leu Ser Cys Ile Asp Thr Cys Glu Lys Asn Ser Val Leu Glu Val Ile 385 390 395 400 Ala Tyr Ser Ser Ser Glu Thr Pro Asn Arg His Asp Met Leu Leu Val 405 410 415 Glu Pro Leu Asn Arg Leu Leu Gln Asp Lys Trp Asp Arg Phe Val Lys 420 425 430 Arg Ile Phe Tyr Phe Asn Phe Leu Val Tyr Cys Leu Tyr Met Ile Ile 435 440 445 Phe Thr Met Ala Ala Tyr Tyr Arg Pro Val Asp Gly Leu Pro Pro Phe 450 455 460 Lys Met Glu Lys Thr Gly Asp Tyr Phe Arg Val Thr Gly Glu Ile Leu 465 470 475 480 Ser Val Leu Gly Gly Val Tyr Phe Phe Phe Arg Gly Ile Gln Tyr Phe 61 WO 00/63415 PCT/US00/09897 485 490 495 Leu Gln Arg Arg Pro Ser Met Lys Thr Leu Phe Val Asp Ser Tyr Ser 500 505 510 Glu Met Leu Phe Phe Leu Gln Ser Leu Phe Met Leu Ala Thr Val Val 515 520 525 Leu Tyr Phe Ser His Leu Lys Glu Tyr Val Ala Ser Met Val Phe Ser 530 535 540 Leu Ala Leu Gly Trp Thr Asn Met Leu Tyr Tyr Thr Arg Gly Phe Gln 545 550 555 560 Gln Met Gly Ile Tyr Ala Val Met Ile Glu Lys Met Ile Leu Arg Asp 565 570 575 Leu Cys Arg Phe Met Phe Val Tyr Val Val Phe Leu Phe Gly Phe Ser 580 585 590 Thr Ala Val Val Thr Leu Ile Glu Asp Gly Lys Asn Asp Ser Leu Pro 595 600 605 Ser Glu Ser Thr Ser His Arg Trp Arg Gly Pro Ala Cys Arg Pro Pro 610 615 620 62 WO 00/63415 PCT/USOO/09897 Asp Ser Ser Tyr Asn Ser Leu Tyr Ser Thr Cys Leu Glu Leu Phe Lys 625 630 635 640 Phe Thr Ile Gly Met Gly Asp Leu Glu Phe Thr Glu Asn Tyr Asp Phe 645 650 655 Lys Ala Val Phe Ile Ile Leu Leu Leu Ala Tyr Val Ile Leu Thr Tyr 660 665 670 Ile Leu Leu Leu Asn Met Leu Ile Ala Leu Met Gly Glu Thr Val Asn 675 680 685 Lys Ile Ala Gln Glu Ser Lys Asn Ile Trp Lys Leu Gln Arg Ala Ile 690 695 700 Thr Ile Leu Asp Thr Glu Lys Ser Phe Leu Lys Cys Met Arg Lys Ala 705 710 715 720 Phe Arg Ser Gly Lys Leu Leu Gln Val Gly Tyr Thr Pro Asp Gly Lys 725 730 735 Asp Asp Tyr Arg Trp Cys Phe Arg Val Asp Glu Val Asn Trp Thr Thr 740 745 750 63 WO 00/63415 PCT/US00/09897 Trp Asn Thr Asn Val Gly Ile Ile Asn Glu Asp Pro Gly Asn Cys Glu 755 760 765 Gly Val Lys Arg Thr Leu Ser Phe Ser Leu Arg Ser Ser Arg Val Ser 770 775 780 Gly Arg His Trp Lys Asn Phe Ala Leu Val Pro Leu Leu Arg Glu Ala 785 790 795 800 Ser Ala Arg Asp Arg Gln Ser Ala Gln Pro Glu Glu Val Tyr Leu Arg 805 810 815 Gln Phe Ser Gly Ser Leu Lys Pro Glu Asp Ala Glu Val Phe Lys Ser 820 825 830 Pro Ala Ala Ser Gly Glu Lys 835 64
Claims (23)
1. An isolated and purified DNA molecule which encodes human VR1 receptor channel protein, wherein said protein optionally functions as a receptor, or a functional derivative thereof.
2. The isolated and purified DNA molecule of claim 1, having a nucleotide sequence selected from a group consisting of: (SEQ.ID.NO.:5); (SEQ.ID.NO.:6); and functional derivatives thereof.
3. The isolated and purified DNA molecule of claim 1, wherein said DNA molecule is genomic DNA.
4. An expression vector for expression of an human VR1 receptor channel protein in a recombinant host, wherein said vector contains a recombinant gene encoding human VR1 receptor protein, said protein optionally functions as a receptor, and functional derivatives thereof.
5. The expression vector of claim 4, wherein the expression vector contains a cloned gene encoding human VR1 receptor channel protein wherein said protein optionally functions as a receptor, having a nucleotide sequence selected from a group consisting of: (SEQ.ID.NO.:5); (SEQ.ID.NO.:6); and functional derivatives thereof.
6. The expression vector of claim 4, wherein the expression vector contains genomic DNA encoding human VR1 receptor channel protein wherein said protein optionally functions as a receptor. 65 WO 00/63415 PCT/USOO/09897
7. A recombinant host cell containing a recombinantly cloned gene encoding human VR1 receptor channel protein wherein said protein optionally functions as a receptor, or functional derivative thereof.
8. The recombinant host cell of claim 7, wherein said gene has a nucleotide sequence selected from a group consisting of: (SEQ.ID.NO.:5); (SEQ.ID.NO.:6); and functional derivatives thereof.
9. The recombinant host cell of claim 7, wherein said cloned gene encoding receptor is genomic DNA.
10. A protein, in substantially pure form which functions as human VR1 receptor channel protein wherein said protein optionally functions as a receptor.
11. The protein according to claim 10, having an amino acid sequence selected from a group consisting of: (SEQ.ID.NO.:7); and functional derivatives thereof.
12. A monospecific antibody immunologically reactive with human VR1 receptor channel protein wherein said protein optionally functions as a receptor.
13. The antibody of Claim 12, wherein the antibody blocks activity of the receptor.
14. A process for expression of human VR1 receptor channel protein wherein said protein optionally functions as a receptor in a recombinant host cell, comprising: 66 WO 00/63415 PCT/USOO/09897 (a) transferring the expression vector of Claim 4 into suitable host cells; and (b) culturing the host cells of step (a) under conditions which allow expression of the human VR1 receptor channel protein from the expression vector.
15. A method of identifying compounds that modulate human VR 1 receptor channel protein activity, comprising: (a) combining a modulator of human VR1 receptor protein activity with human VR1 receptor channel protein wherein said protein optionally functions as a receptor; and (b) measuring an effect of the modulator on the protein.
16. The method of claim 15, wherein the effect of the modulator on the protein is inhibiting or enhancing binding of receptor ligands.
17. The method of claim 15, wherein the effect of the modulator on the protein is stimulation or inhibition of human VR1 receptor channel protein.
18. The method of claim 17, wherein the human VR1 receptor channel comprises the amino acid sequence set forth in Seq.Id.No.:7.
19. A compound active in the method of Claim 15, wherein said compound is a modulator of a receptor.
20. A compound active in the method of Claim 15, wherein said compound is an agonist or antagonist of a receptor.
21. A compound active in the method of Claim 15, wherein said compound is a modulator of expression of a receptor. 67 WO 00/63415 PCT/USOO/09897
22. A pharmaceutical composition comprising a compound active in the method of Claim 15, wherein said compound is a modulator of receptor activity.
23. A method of treating a patient in need of such treatment for a condition which is mediated by a receptor, comprising administration of a receptor modulating compound active in the method of Claim 15. 68
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US29270099A | 1999-04-15 | 1999-04-15 | |
US09292700 | 1999-04-15 | ||
PCT/US2000/009897 WO2000063415A1 (en) | 1999-04-15 | 2000-04-13 | Dna encoding the human vanilloid receptor vr1 |
Publications (1)
Publication Number | Publication Date |
---|---|
AU4237400A true AU4237400A (en) | 2000-11-02 |
Family
ID=23125812
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU42374/00A Abandoned AU4237400A (en) | 1999-04-15 | 2000-04-13 | Dna encoding the human vanilloid receptor vr1 |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1175504A4 (en) |
JP (1) | JP2003520022A (en) |
AU (1) | AU4237400A (en) |
CA (1) | CA2370570A1 (en) |
WO (1) | WO2000063415A1 (en) |
Families Citing this family (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU742391B2 (en) | 1997-08-20 | 2002-01-03 | Regents Of The University Of California, The | Nucleic acid sequences encoding capsaicin receptor and capsaicin receptor-related polypeptides and uses thereof |
GB9907097D0 (en) | 1999-03-26 | 1999-05-19 | Novartis Ag | Organic compounds |
US6482611B1 (en) | 1999-09-23 | 2002-11-19 | Neurogen Corporation | Human capsaicin receptor and uses thereof |
EP1170365A1 (en) * | 2000-07-04 | 2002-01-09 | Smithkline Beecham Plc | Member of the ion channel family of polypeptides; vanilrep4 |
DE10043674A1 (en) * | 2000-09-02 | 2002-03-21 | Gruenenthal Gmbh | New antisense oligonucleotides and ribozymes, useful for treating e.g. pain and for diagnosis, are directed against mRNA for vanilloid-family receptors |
HUP0301805A3 (en) | 2000-09-02 | 2005-12-28 | Gruenenthal Gmbh | Antisense oligonucleotides against vanilloid receptor 1 |
GB0128161D0 (en) * | 2001-11-23 | 2002-01-16 | Merck Sharp & Dohme | Receptor protein |
RU2392278C2 (en) | 2004-07-15 | 2010-06-20 | Джапан Тобакко Инк. | Condensed benzamide derivative and inhibitor of vanilloid receptor type 1 activity (vri) |
US7906508B2 (en) | 2005-12-28 | 2011-03-15 | Japan Tobacco Inc. | 3,4-dihydrobenzoxazine compounds and inhibitors of vanilloid receptor subtype 1 (VRI) activity |
GB201918103D0 (en) * | 2019-12-10 | 2020-01-22 | Oblique Therapeutics Ab | Epitopes and antibodies |
CN111455470A (en) * | 2020-04-09 | 2020-07-28 | 嘉兴菲沙基因信息有限公司 | Small fragment DNA library construction method capable of improving data quality of Hi-C library |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU742391B2 (en) * | 1997-08-20 | 2002-01-03 | Regents Of The University Of California, The | Nucleic acid sequences encoding capsaicin receptor and capsaicin receptor-related polypeptides and uses thereof |
AU2466799A (en) * | 1998-01-22 | 1999-08-09 | Regents Of The University Of California, The | Nucleic acid sequences encoding capsaicin receptors |
EP0943683A1 (en) * | 1998-03-10 | 1999-09-22 | Smithkline Beecham Plc | Human vanilloid receptor homologue Vanilrep1 |
-
2000
- 2000-04-13 AU AU42374/00A patent/AU4237400A/en not_active Abandoned
- 2000-04-13 CA CA002370570A patent/CA2370570A1/en not_active Abandoned
- 2000-04-13 JP JP2000612492A patent/JP2003520022A/en active Pending
- 2000-04-13 WO PCT/US2000/009897 patent/WO2000063415A1/en not_active Application Discontinuation
- 2000-04-13 EP EP00922143A patent/EP1175504A4/en not_active Withdrawn
Also Published As
Publication number | Publication date |
---|---|
JP2003520022A (en) | 2003-07-02 |
WO2000063415A1 (en) | 2000-10-26 |
EP1175504A1 (en) | 2002-01-30 |
CA2370570A1 (en) | 2000-10-26 |
EP1175504A4 (en) | 2002-07-31 |
WO2000063415A8 (en) | 2001-01-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU4237400A (en) | Dna encoding the human vanilloid receptor vr1 | |
US6358706B1 (en) | DNA encoding human alpha1G-C T-Type calcium channel | |
US7179604B2 (en) | Methods of use of DNA encoding a human histamine receptor of the H3 subtype | |
US7094877B2 (en) | Human vanilloid receptor VR3 protein | |
EP1035856B1 (en) | Isolated dna encoding human h3 histamine receptor | |
AU776347B2 (en) | DNA encoding a human subunit 5-HT3-C of the 5-HT3 serotonin receptor | |
US7820792B2 (en) | CDNA encoding the human α2 δ4 calcium channel subunit | |
US6548270B1 (en) | DNA encoding human acid-sensing ion channel BNaC4 (ASIC4) | |
WO2003044059A1 (en) | Agonists of recombinant human histamine h3 receptor | |
CA2374432A1 (en) | Dna encoding a human subunit of the 5-ht3 serotonin receptor | |
AU2001238176A1 (en) | DNA encoding human acid-sensing ion channel BNaC4 (ASIC4) |