JP2003518369A - A moss gene from Fiscomitrera patens encodes a protein involved in the synthesis of polyunsaturated fatty acids and lipids - Google Patents

Abstract

  (57) [Summary] For example, isolated nucleic acid molecules encoding novel LMRPs from Physcomitrella patens (referred to as LMRP nucleic acid molecules) are described. The present invention also provides antisense nucleic acid molecules, recombinant expression vectors containing LMRP nucleic acid molecules, and host cells into which the expression vectors have been introduced. The present invention further relates to isolated LMRPs, mutant LMRPs, fusion proteins, antigenic peptides, and desired forms from transformed cells, transformed organisms or transformed plants based on genetically engineering the LMRP gene in the organism. Further provided is a method for improving the production of the compound.

Description

Detailed Description of the Invention

BACKGROUND OF THE INVENTION Certain products and by-products of naturally occurring metabolic processes in cells are useful in a wide range of industries including the food, feed, cosmetics and pharmaceutical industries. These molecules, collectively referred to as "fine chemicals," include lipids and fatty acids, cofactors and enzymes. Fine chemicals can be produced in microorganisms by culturing on a large scale microorganisms that have been developed to produce and secrete large amounts of one or more desired molecules.

Their production is most conveniently carried out by carrying out large-scale cultivation of microorganisms that have been developed to produce and secrete large amounts of one or more desired molecules. One particularly useful organism for this purpose is Corynebacterium glutamicum, a gram-positive, non-pathogenic bacterium.
Lutamicum).

Furthermore, as particularly useful organisms for this purpose, Phaeedactylum tricornutum, algae that produce polyunsaturated fatty acids (PUFAs) or Styronychia remnae (Stylony)
Cilia lemnae). By selecting strains, a large number of mutant strains of each microorganism producing a series of desired compounds have been developed. However, selecting improved strains to produce a particular molecule is a time consuming and difficult process.

Alternatively, the production of fine chemicals can be most conveniently carried out by large scale production of plants developed to produce one of the above fine chemicals. Particularly well-suited plants for this purpose include oilseed plants containing high amounts of lipid compounds, such as canola, canola, flax, soybeans and sunflowers. However, other crop plants containing oils or lipids and fatty acids are also well suited as mentioned in the detailed description of the invention. Conventional breeding has developed a large number of mutant plants that produce a range of desired lipids and fatty acids, cofactors and enzymes. However, selecting improved new plant varieties to produce a particular molecule is a time consuming and difficult process, or the compounds are naturally present in each plant as in the case of polyunsaturated fatty acids. It is even impossible if it does not exist.

SUMMARY OF THE INVENTION The present invention is a novel and particularly useful for producing polyunsaturated fatty acids and for modifying lipids and fatty acids, cofactors and enzymes in the most preferred microorganisms and plants. A nucleic acid molecule is provided. Phaeodactylum (Phae)
Microorganisms, fungi and plants such as odactylum), Styronikia remnae and Corynebacterium are widely used in industry for the production of various fine chemicals on a large scale.

Cloning vectors used in Corynebacterium glutamicum, such as those disclosed in US Pat. No. 4,649,119 (Sinskey et al.), And C.I. Glutamicum and related Brevibacterium species (eg, lactofermentum) have been shown to be useful in genetic engineering techniques (Yoshihama et al., J. Bacteriol. 162: 591-5).
97 (1985); Katsumata et al., J. Am. Bacteriol. 159:
306-311 (1984); Santamaria et al., J. Am. Gen. Micr
obiol. 130: 2237-2246 (1984)), utilizing the nucleic acid molecules of the present invention in the genetic engineering of this organism to make it a better or more efficient producer of one or more fine chemicals. be able to. This improved production or production efficiency of fine chemicals may be due to the direct effect of engineering the gene of the invention or due to the indirect effect of such manipulation.

Ciliates, such as those disclosed in International Patent Application Publication WO9801572, or algae and related organisms (Falciatore et al., 1999, Marine B.
iotechnology, 1 (3): 239-251, and Dunaha
Y. et al., 1995, diatom gene transformation, J. et al. Phycol. 31: 10004
-1012, and the cloning vectors for Phaeodactylum tricornutum, etc., and the genetic engineering techniques described therein, the nucleic acid molecules of the invention have been used in genetic engineering of this organism. Can make the organism a better or more efficient producer of one or more fine chemicals. Is this improved production or production efficiency of fine chemicals may be due to the direct effect of manipulating the genes of the invention,
Or it may be due to the indirect effects of such manipulations.

Mosses and algae are the only known to produce significant amounts of polyunsaturated fatty acids such as arachidonic acid (ARA) and / or eicosapentaenoic acid (EPA) and / or docosahexaenoic acid (DHA). It is a plant system. Therefore,
Physcomitrella patens
Nucleic acid molecules derived from moss are particularly suitable for modifying the production system of lipids and PUFAs in the host, especially microorganisms and plants. Furthermore, nucleic acids derived from the moss of Fiscomitella patens are PUFs in each organism.
It can be used to identify such DNA sequences and enzymes in other species that are useful for modifying the biosynthesis of precursor molecules for A.

The moss Physcomitrella patens is one of the members of the moss. this is,
Ceratodon purpleus (Cerat) that can grow in the absence of light
Odon purpureus) and the like. Mosses such as Ceratodon and Physcomitrella have significant homology at the DNA sequence and polypeptide levels, and such homology allows the heterogeneous screening of probes with DNA molecules evolved from other moss or organisms. Ready for use,
Thus, a consensus sequence suitable for heterologous screening or functional understanding and prediction of gene function in yet another species can be obtained. Therefore, the ability to identify such a function is highly relevant, for example, to predicting the substrate specificity of an enzyme. Furthermore, these nucleic acid molecules can serve as reference points for mapping the moss genome or the genome of related organisms.

These novel nucleic acid molecules are referred to herein as lipid metabolism related proteins (LMRs).
Encodes the protein designated as P). These LMRPs can perform the functions involved in, for example, the metabolism (eg, biosynthesis or degradation) of compounds required for lipid or fatty acid biosynthesis, or one or more lipids / membranes that cross a membrane.
It can help either the intracellular transport of fatty acid compounds or the extracellular transport. Cloning vectors and plant transformations used in plants, such as Plant Molecular Biology and Biote.
chnology (CRC Press, Boca Raton, Florid
a), chapters 6/7, S.S. 71-119 (1993); F. White, Vector for Gene Transfer in Higher Plants, Transgenic Plants, No. 1
Volume, Engineering and Utilization, Editor: Kun
g and R.G. Wu, Academic Press, 1993, 15-38; B
． Genes et al., Gene transfer technology, Transgenic Plants, No. 1.
Volume, Engineering and Utilization, Editor: Kun
g and R.G. Wu, Academic Press (1993), 128-14
3; Potrykus, Annu. Rev. Plant Physiol. Pl
ant Molec. Biol. 42 (1991), 205-225, and the vectors and techniques cited therein, and the like, can be used to utilize the nucleic acid molecule of the present invention in genetic engineering of a wide range of plants, The organism can be a better or more efficient producer of one or more fine chemicals. This improved production or production efficiency of fine chemicals may be due to the direct effect of engineering the gene of the invention or due to the indirect effect of such manipulation.

There are a number of mechanisms by which the LMRP alterations of the present invention may have a direct impact on the yield, production and / or production efficiency of fine chemicals from oilseed plants due to such modified proteins. To do. Such LMRPs, which are involved in the transport of fine chemical molecules out of cells, have higher amounts of these compounds located in various plant cell compartments or the outer space of cells from which they are more easily recovered,
The number or activity can then be increased to be distributed or deposited in the biosynthetic flux. Similarly, such LMRPs involved in intracellular transport of nutrients required for biosynthesis of one or more fine chemicals (eg fatty acids, polar lipids and neutral lipids) are associated with these precursors, cofactors. Alternatively, the number or activity can be increased to increase the intracellular or intracellular compartment concentration of the intermediate compound. Moreover, fatty acids and lipids are themselves desirable fine chemicals. Thus, by optimizing or increasing the activity of one or more LMRPs of the invention involved in the biosynthesis of these compounds, or in the degradation of these compounds. Yield of fatty acid and lipid molecules from plants or microorganisms by impairing the activity of one or more LMRPs,
It may be possible to increase production and production efficiency.

[0012] Mutagenesis of one or more LMRPs of the invention also results in an LMRP with altered activity that has an indirect effect on producing one or more desired fine chemicals from a plant. be able to. For example, the LMRPs of the present invention, which are involved in the extracellular transport of unwanted products, show that normal metabolic waste of cells (possibly increased in amount due to the overproduction of the desired fine chemicals) causes them to become intracellular. Cells before damage to nucleotides and proteins (which reduces cell viability) or interferes with the phychemical biosynthetic pathway (which reduces the yield, production or production efficiency of the desired fine chemical) The number or activity can be increased so that it can be efficiently transported out. further,
The relatively large intracellular amount of the desired fine chemical may itself be toxic to the cell or may interfere with enzymatic feedback mechanisms such as allosteric regulation, thus removing such compounds from the compartment extracellularly. Viability of seed cells can be increased by increasing the activity or number of transporters that can be transported to the cells, thereby obtaining a higher cell number in the culture producing the desired fine chemical. You can The LMRPs of this invention can also be engineered to produce relatively different amounts of different lipid and fatty acid molecules. This can have a profound effect on the lipid composition of the cell's membrane. Since each type of lipid has different physical properties, changes in the lipid composition of the membrane can significantly change the fluidity of the membrane. Changes in membrane fluidity can affect transport of molecules across the membrane as well as cellular integrity. Both of these have a great impact on the production of fine chemicals. In plants, these changes may also affect other traits such as resistance to abiotic and biotic stress conditions.

The present invention encodes a protein (which is referred to herein as LMRP) that may be involved in, for example, the metabolism of compounds required for the assembly of cell membranes or lipids and fatty acids, or the transport of molecules across the membrane. Provided are novel nucleic acid molecules. Nucleic acid molecules that encode LMRPs are referred to herein as LMRP nucleic acid molecules. In a preferred embodiment, LMRP is involved in the metabolism of compounds required for the assembly of cell membranes in plants, or the transport of molecules across these membranes in oilseed plants. Examples of such proteins include the proteins encoded by the genes shown in Table 1. As resistance to biotic and abiotic stress,
Corn, wheat, rye, oats, triticale, rice, barley,
Soybean, peanut, cotton, canola and canola, cassava, pepper, sunflower and tagetes, solanaceous plants (such as potato, tobacco, eggplant and tomato), broad bean (Vicia) species, peas, alfalfa, shrub ( Coffee, cacao, tea), weeping willow (Salix)
Species of the genus, trees (oil palm, coconut), and common traits desired to be inherited by a wide range of plants such as perennials and forage crops. These crop plants are also preferred target plants for genetic engineering as a further embodiment of the invention.

Accordingly, one aspect of the invention is an isolated nucleic acid molecule (eg, a cDNA) that includes a nucleotide sequence that encodes LMRP or a biologically active portion thereof.
, As well as nucleic acid fragments suitable as primers or hybridization probes for detecting or amplifying nucleic acid (eg DNA or mRNA) encoding LMRP. In a particularly preferred embodiment, the isolated nucleic acid molecule comprises one of the nucleotide sequences shown in Appendix A, or the coding region or complement of one of these nucleotide sequences. In another particularly preferred embodiment, the isolated nucleic acid molecule of the invention has at least a nucleotide sequence that hybridizes to one of the nucleotide sequences shown in Appendix A, or has at least homology to one of the nucleotide sequences shown in Appendix A. About 50%, preferably at least about 60%, more preferably at least about 70%, 80.
% Or 90%, and most preferably at least about 95%, 96%, 9
7%, 98%, 99% or more of the nucleotide sequence, or a portion thereof. In another preferred embodiment, the isolated nucleic acid molecule encodes one of the amino acid sequences shown in Appendix B. The preferred LMRP of the invention is also
Preferably, it has at least one of the LMRP activities described herein.

In another embodiment, the isolated nucleic acid molecule encodes a protein or portion thereof. In this case, the protein or a portion thereof has sufficient homology to the amino acid sequence of Appendix B, eg, sufficient amino acid sequence to the amino acid sequence of Appendix B such that the protein or a portion thereof maintains LMRP activity. It includes amino acid sequences having homology. Preferably, the protein encoded by the nucleic acid molecule, or a portion thereof, retains the ability to participate in the metabolism of compounds required for the assembly of plant cell membranes or the transport of molecules across these membranes. In one embodiment, the protein encoded by the nucleic acid molecule has at least homology to one amino acid sequence of Appendix B (eg, one complete amino acid sequence selected from such sequences shown in Appendix B). About 50%, preferably at least about 60%, more preferably at least about 70%, 80% or 90%.
%, And most preferably at least about 95%, 96%, 97%, 98%
, 99% or more. In another preferred embodiment, the protein is substantially homologous to one complete amino acid sequence of Appendix B (encoded by one open reading frame shown in Appendix A) of Fiscomitella patens. Is a full-length protein of.

In another preferred embodiment, the isolated nucleic acid molecule is derived from Physcomitrella patens and has at least about 50% homology to one of the amino acid sequences of Appendix B, and of the cell membrane A protein containing a biologically active domain that may be involved in the metabolism of compounds required for assembly or the transport of molecules across these membranes, or that has one or more of the activities shown in Table 1 ( For example, LMRP fusion protein). An isolated nucleic acid molecule also includes a heterologous nucleic acid sequence that encodes a heterologous polypeptide or regulatory region.

Another aspect of the invention is that the amino acid sequence is altered, for example, with the aid of computer simulation programs (molecular modeling) known in the art that result in polypeptides with improved activity or altered regulation. It relates to LMRP polypeptides that can be regulated. Based on this artificially generated polypeptide sequence, the corresponding nucleic acid sequence encoding such a regulated polypeptide is
The desired host cell (eg, microorganism, moss, algae, ciliate, fungus or plant)
Can be synthesized in vitro using the specific codon usage of

In a preferred embodiment, even these artificial nucleic acid molecules encoding improved LMRP proteins are within the scope of the invention.

In another embodiment, the isolated nucleic acid molecule is at least 15 nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule comprising the nucleotide sequence of Appendix A. Preferably, the isolated nucleic acid molecule corresponds to a naturally occurring nucleic acid molecule. More preferably, the isolated nucleic acid molecule encodes a naturally occurring RMRP of Fiscomitella patens or a biologically active portion thereof.

Another aspect of the invention is a vector containing a nucleic acid molecule of the invention (eg a recombinant expression vector), and a host cell into which such a vector has been introduced (particularly,
Microorganism, plant cell, plant tissue or organ or whole plant). In one embodiment, such host cells are cells capable of storing fine chemical compounds for isolation of the desired compound from the collected material. In that case, the compound or LMRP can be isolated from the medium or host cells,
In plants, host cells are cells that contain and store fine chemical compounds, most preferably cells of storage tissue such as epidermal cells and seed cells.

[0021] Yet another aspect of the present invention is the introduction of the LMRP gene or LM
It relates to a genetically altered Fiscomitella patens plant in which the RP gene is altered. In one embodiment, the genome of the Fiscomitella patens plant has been altered by introducing as transgene a nucleic acid molecule of the present invention encoding a wild-type or mutant LMRP sequence. In another embodiment,
The endogenous LMRP gene present in the genome of the Fiscomitella patens plant is altered (eg, functionally disrupted) by homologous recombination with the altered LMRP gene. In a preferred embodiment, the plant organism is the genus Physcomitrella or Ceratodon.
of the genus Don), with the genus Fiscomitrera being particularly preferred. In a preferred embodiment, the Physcomitrella patens plant is also utilized to produce desired compounds such as lipids or fatty acids, with PUFA being particularly preferred.

Therefore, in another preferred embodiment, the moss Physcomitrella patens is moss or plant new but not yet identified using the nucleic acid-based homologous recombination described in the present invention. It can be used to reveal the function of a missing gene.

Yet another aspect of the invention relates to an isolated LMRP or portion thereof (eg, biologically active portion). In a preferred embodiment, the isolated LMRP or a portion thereof may be involved in the metabolism of compounds required for the assembly of cell membranes in microbial cells or plant cells or the transport of molecules across the membranes. In another preferred embodiment, the isolated LMRP or portion thereof is involved in the metabolism of compounds or transport of molecules across these membranes where the protein or portion thereof is required for the assembly of cell membranes in microbial or plant cells. It has sufficient homology to the amino acid sequences in Appendix B to maintain potency.

The present invention also provides an isolated preparation of LMRP. In a preferred embodiment, the LMRP comprises the amino acid sequences of Appendix B. In another preferred embodiment, the invention provides an isolated substantially homologous to one complete amino acid sequence of Appendix B (encoded by one open reading frame shown in Appendix A). It relates to a full-length protein. In yet another embodiment, the protein has at least about 50% homology to one complete amino acid sequence of Appendix B, preferably at least about 60%, more preferably at least about 70%, 80% or 90%, and most preferably at least about 9
5%, 96%, 97%, 98%, 99% or more. In another embodiment, the isolated LMRP comprises an amino acid sequence that is at least about 50% or more homologous to one of the amino acid sequences in Appendix B and is required for fatty acid assembly in microbial or plant cells. It can be involved in the metabolism of compounds or the transport of molecules across these membranes, or have one or more of the activities shown in Table 1.

Alternatively, the isolated LMRP may be hybridized to a single nucleotide sequence of Appendix B (eg, under stringent conditions) by a nucleotide sequence, or of a single nucleotide sequence of Appendix B. To at least about 50%, preferably at least about 60%, more preferably at least about 70%, 80% or 90%, and most preferably at least about 95%, 96%, 97%. , 98%, 99%
Alternatively, it can include an amino acid sequence encoded by a nucleotide sequence that is longer than that.

The LMRP polypeptide or biologically active portion thereof can be operably linked to a non-LMRP polypeptide to form a fusion protein. In a preferred embodiment, the fusion protein has an activity that differs from the activity of LMRP alone. In another preferred embodiment, the fusion protein is involved in the metabolism of compounds required for the synthesis of lipids and fatty acids, cofactors and enzymes in microorganisms or plants or the transport of molecules across plant membranes. In a particularly preferred embodiment, incorporation of this fusion protein into a host cell regulates production of the desired compound from the host cell.

Another aspect of the present invention relates to a method for producing a fine chemical. This method comprises culturing a suitable microorganism containing a vector which effects the expression of the LMRP nucleic acid molecule of the present invention such that a fine chemical is produced, or a plant cell, tissue or organ containing such a vector. Or culturing the whole plant. In a preferred embodiment, the method further comprises obtaining cells containing such a vector. In this case, the cells are transformed with a vector that directs expression of the LMRP nucleic acid. In another preferred embodiment, the method further comprises recovering the fine chemical from the culture. In a particularly preferred embodiment, the cells are derived from Physcomitrella, Phaeodactylum, Corynebacterium, Ciliates, Fungi or plants, in particular oilseed.

Another aspect of the present invention relates to a method for producing a fine chemical comprising culturing a suitable host cell whose genomic DNA has been altered by containing the LMRP nucleic acid molecule of the present invention. In another embodiment, the method comprises culturing a suitable host cell whose membrane has been altered by the inclusion of an LMRP polypeptide of the invention.

Another aspect of the invention relates to a method of regulating the production of molecules from microorganisms. The method involves contacting the cell with an agent that modulates LMRP activity or expression of the LMRP nucleic acid such that the cell-bound activity is altered relative to this same activity in the absence of the agent. In a preferred embodiment, the cells are regulated for one or more metabolic pathways for lipids and fatty acids, cofactors and enzymes, or for transport of compounds across such membranes, so that the microorganism Improves the yield or production rate of the desired fine chemicals. L
Agents that regulate MRP activity include agents that stimulate LMRP activity or expression of LMRP nucleic acids. Examples of agents that stimulate LMRP activity or expression of LMRP nucleic acids include small molecules, active LMRP, and L introduced into cells.
Nucleic acid encoding MRP is included. Examples of agents that inhibit the activity or expression of LMRP include small molecules and antisense LMRP nucleic acid molecules.

Another aspect of the invention relates to a method of modulating the yield of a desired compound from cells. This method involves introducing a wild-type or mutant LMRP gene into cells. In this case, such LMRP genes are either maintained on a separate plasmid or integrated into the genome of the host cell. When integrated into the genome, such integration can be random, or the integration replaces the native gene by the introduced gene, which regulates the production of the desired compound from the cell. Can be caused by such recombination,
Alternatively, a gene such as a gene operably linked to a functional expression unit containing at least a sequence that promotes gene expression and a sequence that promotes polyadenylation of a functionally transcribed gene is used in trans Can be caused by.

In a preferred embodiment, the yield is modified. In another preferred embodiment, the desired chemicals can be increased while undesired interfering compounds can be reduced. In a particularly preferred embodiment, the desired fine chemicals are lipids or fatty acids, cofactors or enzymes. In a particularly preferred embodiment, the chemical is a polyunsaturated fatty acid.

DETAILED DESCRIPTION OF THE INVENTION The present invention involves the metabolism of lipids and fatty acids, cofactors and enzymes in the moss of Fiscomitrella patens or the transport of lipophilic compounds across such membranes. Provided are LMRP nucleic acid molecules and LMRP protein molecules. The molecule of the present invention is a Corynebacterium glutamicum (Corynebacterium).
m glutamicum, Corynebacterium Herculis (Coryne)
Bacterium herculis, Corynebacterium Lilium (C
orynebacterium lilium), Corynebacterium acetoacidoph (Corynebacterium acetoacidoph)
Ilum), Corynebacterium acetoglutamicum (Corynebact)
erium acetoglutamium), Corynebacterium acetofilm, Corynebacterium ammoniagenes (Corynebacterium amm)
oniagenes), Corynebacterium fugiokens (Coryneba)
Cerium fujiokense, Corynebacterium nitrilophilus, Brevibacterium ammoniagenes (Brevibacterium ammo)
niagenes), Brevibacterium butanicum (Brevibacte
rum butanicum), Brevibacterium dibaricatum (Bre
vivibacterium divaricatum, Brevibacterium flavum, Brevibacterium hairii, Brevibacterium ketoglutamicum.
micum), Brevibacterium ketosolezukutsumu (Brevibacte
rium ketosoreductum), Brevibacterium lactofermentum
, Brevibacterium linen
s) or Brevibacterium parafinolyticum (Brevibacterium
It can be used in regulating the production of fine chemicals from microorganisms such as Corynebacterium, or Brevibacterium, selected from the group consisting of ium paraffinolyticum). Further, the molecules of the invention include ciliates, fungi, moss, algae and plants (corn, wheat, rye, oats, triticale, rice, barley, soybeans, peanuts, cotton, brassica species (brassica, canola and turnip). Etc.), pepper, sunflower and tagetes (tagetes), solanaceous plants (such as potato, tobacco, eggplant and tomato), species of the genus Vicia, peas, cassava, alfalfa, shrub plants (coffee, cacao, tea), A species of the genus Salix,
It can be used directly in controlling the production of fine chemicals from trees (oil palm, coconut), and perennial and forage crops (eg,
Where overexpression or optimization of the fatty acid biosynthetic protein has a direct effect on the yield, production and / or production efficiency of fatty acids from the modified plant),
Alternatively, it may nonetheless have the indirect effect of increasing the yield, production and / or efficiency of production of the desired compound or reducing undesired compounds (eg lipids and fatty acids, cofactors and enzymes). By modulating the metabolism of a desired compound, altering the yield, production and / or efficiency of production of a desired compound or the desired composition of a compound in a cell, which may affect the production of one or more fine chemicals) . Various aspects of the invention are described further below.

Fine Chemical The term “fine chemical” is recognized in the art as it is produced by an organism with different applications in different industries such as, but not limited to, the pharmaceutical, agricultural and cosmetics industries. Included molecules. Such compounds include
Lipids, fatty acids, cofactors and enzymes, both proteinogenic and non-proteinogenic amino acids, purine and pyrimidine bases, nucleosides, and nucleotides (eg, Kuninaka, A. (1996), nucleotides and related compounds, page 561. ~ P.612, Biotechnology, Volume 6, R
ehm et al., VCH: Weinheim, and compounds contained therein in references), lipids, both saturated and polyunsaturated fatty acids (eg, arachidonic acid), diols (eg, propanediol). And butanediol), carbohydrates (eg hyaluronic acid and trehalose), aromatic compounds (
For example, aromatic amines, vanillin and indigo), vitamins and cofactors (
Ullmann's Encyclopedia of Industrial
Chemistry, Volume A27, Vitamine, pp. 443-613 (
1996), VCH: Weinheim, and references contained therein; On.
g, A. S. , Niki, E .; & Packer, L.A. (1995), UNESC
O / Malaysia Science and Technology Association and Free Radical Research Association (Asia) Union (held in Penang (Malaysia) September 1-3, 1994)
"Health and Diseases", as described in AOCS Press (1995)), enzymes, and Gutcho (1983), Chemicals.
by Fermentation (Noyes Data Corporation)
, ISBN: 08188805086) and all other chemicals described therein. The metabolism and use of some of these fine chemicals are described further below.

I. Lipids and fatty acids, cofactors and enzymes cell membranes perform various intracellular functions. First of all, the membrane distinguishes the contents of the cell from the surrounding environment and thus provides the cell with integrity. The membrane may also serve as a barrier against influx of harmful or unwanted compounds and also outflow of desired compounds. The cell membrane is essentially a bilayer of lipid molecules, in which the polar headgroups face outward (towards the outside and the inside of the cell, respectively) and the nonpolar tails divert. It is impermeable to the unpromoted diffusion of hydrophilic compounds such as proteins, water molecules and ions (due to the membrane's inward orientation at the center of the overlay, which forms a hydrophobic core). For a general review of structure and function, see Gennis, R. et al.
B. (1989), Biomembrane's Molecular Stru.
movie and Function, Springer: Heidelbe
rg)). This barrier allows the cells to maintain a relatively higher concentration of the desired compound and a relatively lower concentration of the unwanted compound than contained in the surrounding medium. This is because the diffusion of these compounds is effectively blocked by the membrane.

However, the membrane also provides an effective barrier for transporting the desired compound intracellularly and unwanted molecules extracellularly. To overcome this difficulty, cell membranes contain multiple types of transporter proteins that can facilitate transmembrane transport of different types of compounds. There are two general types of these transport proteins: pores or channels and transporters. The former are integral membrane proteins (sometimes protein complexes) that form regulated pores through the membrane. This regulation or "gating" is generally specific for molecules transported by pores or channels, which makes these transmembrane structures selectively permeable to certain types of substances. become. For example, the potassium channel is
It is constructed so that only ions with a charge and size similar to that of potassium can pass through. Channel proteins and pore proteins allow the hydrophobic side of the protein to associate with the inside of the membrane, while the hydrophilic side aligns with the inside of the channel, thus allowing passage of selected hydrophilic molecules. It tends to have separate hydrophobic and hydrophilic domains so as to provide a protected hydrophilic environment. Many such pores / channels are known in the art, including pores / channels for potassium, calcium, sodium and chloride ions.

The system mediated by this pore and channel of facilitated diffusion is limited to very small molecules such as ions. This also means that pores or channels that are large enough to allow passage through the protein by facilitated diffusion also
This is because it is not possible to prevent passage of hydrophilic molecules smaller than that. Transport of molecules by this process is sometimes referred to as "facilitated diffusion" because the driving force of the concentration gradient is required to cause the transport. Permease is also
The facilitated diffusion of larger molecules such as glucose or other sugars into cells,
This is possible if the concentration of these molecules on one side of the membrane is greater than the concentration on the other side (this is also called "monotransport"). In contrast to pores or channels, these integral membrane proteins (often having 6 to 14 α-helices that span the membrane) do not form open channels through the membrane, but rather the membrane. Binds to a target molecule on its surface and is then subjected to a conformational change such that the target molecule is released on the opposite side of the membrane.

However, cells often require intracellular or extracellular transport of molecules against an existing concentration gradient (“active transport”). In such a situation, facilitated diffusion cannot occur. Two general mechanisms have been used by cells for such membrane transport: cotransport or countertransport, and energy-coupled transport, such as transport mediated by ABC transporters. Co-transport and on-board transport systems
It links the movement of two different molecules across the membrane (via permease, which has two separate binding sites for two different molecules). That is, in co-transport, two molecules are transported in the same direction, whereas in anti-transport, one molecule is transported intracellularly and at the same time the other molecule is transported extracellularly. This is energetically possible because one of the two molecules moves according to a concentration gradient,
And this energetically favorable event is only possible when the desired compounds move simultaneously against the prevailing concentration gradient. Single molecules can be transported across the membrane against a concentration gradient in an energy driven process, such as the process utilized by the ABC transporter. In this system, the transport protein present in the membrane is AT
It has a P-binding cassette; when the target molecule binds, ATP is converted to ADP + Pi and the resulting energy release is used to move the target molecule to the opposite side of the membrane. This is facilitated by transporters. For a more detailed description of all of these transport systems, see Bamberg, E .; (1993), ion pump charge transport in lipid bilayer membranes, Q. Rev. Biopys. 26: 1-25
Findlay, J .; B. C. (1991), Structures and Functions in Membrane Transport Systems, Curr. Opin. Struct. Biol. 1: 804-810
Higgins, C .; F. (1992), ABC transporters from microorganisms to humans, Ann. Rev. Cell Biol. 8: 67-113; Gennis, R.
． B. (1989), pores, channels and transporters: Biomembrane.
s, Molecular Structure and Function, S
pringer: Heidelberg, p.270-322; Nikaido.
, H .; And Saier, H .; (1992), Transport proteins in bacteria: a common theme in their design, Science, 258: 936-942.
;; and the references contained within each of these references.

Membrane synthesis is a well-characterized process in which the lipid molecule involves a number of components, the most important of which are lipid molecules. Lipid synthesis includes fatty acid synthesis and fatty acid sn-
It can be divided into two parts: the attachment to glycerol-3-phosphate and the addition or modification of polar head groups. Typical lipids utilized in bacterial membranes include phospholipids, glycolipids, sphingolipids and phosphoglycerides. Fatty acids are a group of compounds containing long hydrocarbon chains and terminal carboxylic acid groups. Fatty acids include: lauric acid, palmitic acid, palmitooleic acid, stearic acid, oleic acid, taxooleic acid, 6,9-octadecadienoic acid, linoleic acid, γ-linolenic acid, pinoleic acid, α- Linoleic acid, stearidonic acid, arachidic acid, eicosenoic acid, behenic acid, erucic acid, docasadienoic acid, arachidonic acid, ω6-eicosatrienoic acid, dihomo-γ-linoleic acid, eicasapentaenoic acid (thymnodonic acid), ω3-eico acid. Satrienoic acid, ω3-eicosatetraenoic acid, docosapentaenoic acid, docosahexaenoic acid (cervonic acid), lignoceric acid, and further fatty acids of this class not explicitly indicated. Fatty acid synthesis involves malonyl C by acetyl CoA carboxylase of acetyl CoA.
It begins with either conversion to oA or conversion to acetyl ACP by acetyl transacylase. After the condensation reaction, these two product molecules together form acetoacetyl ACP, which is converted by a series of condensation, reduction and dehydration reactions into saturated fatty acid molecules with the desired chain length. Become. The production of unsaturated fatty acids from such molecules aerobically with the help of molecular oxygen,
Or anaerobically, either catalyzed by a desaturase specific for that (for a reference to fatty acid synthesis in microorganisms, see FC Neidhardt
(1996), E. coli and Salmonella, ASM Pr
ess: Washingto, D.M. C. , Pages 612-632, and references contained therein; Langelel et al. (Eds.) (1999), Biology o.
f Procaryotes, Thieme: Stuttgart, New Y
ork, and references contained therein; Magnuson, K .; Et al (1993
), Microbiological Reviews, 57: 522-542.
, And the references contained therein).

Various cyclopropane fatty acids (CFAs) are synthesized by specific CFA synthases using SAM as a co-substrate. Branched fatty acids are synthesized from branched chain amino acids that are deaminated to form branched 2-oxo acids (Leng.
eler et al. (ed.) (1999), Biology of Procaryote.
s).

Publications on plant fatty acid biosynthesis, desaturation, lipid metabolism and membrane transport of lipoic compounds, β-oxidation, fatty acid modification and cofactors, triacylglycerol storage, and assembly (references therein) (See), Kinney, 1997, Genetic En.
Geneering, editor: JK Setlow, 19: 149-166; Oh.
llogge and Browse, 1995, Plant Cell, 7:95.
7-970; Shanklin and Cahoon, 1998, Annu. Re
v. Plant Physiol. Plant Mol. Biol. , 49: 6
11-641; Voelker, 1996, Genetic Engineer.
ing, editor: JK Setlow, 18: 111-13; Gerhardt,
1992, Prog. Lipid R. 31: 397-417; Guhnema.
nn-Schafer & Kindl, 1995, Biochim. Biophy
S Acta, 1256: 181-186; Kunau et al., 1995, Prog.
． Lipid Res. 34: 267-342; Stymne et al., 1993, B.
iochemistry and Molecular Biology of
Membrane and Storage Lipids of Plan
ts (Editors: Murata and Somerville, Rockville,
American Society of Plant Physiology
st, 150-158); Murphy & Ross, 1988, Plant J.
our. 13 (1): 1-16.

Furthermore, fatty acids have to be transported and incorporated into triacylglycerol storage lipids after various modifications. Lipid bodies can be made by budding from the ER surrounded by structural proteins such as oleosin. Oleosine is an amphipathic polypeptide that specifically binds to plant lipid stores (Mu
rphy DJ (1990), Prog Lipid Res, 29: 299-.
324). Oleosin, such as clone PP0130009039R in Table 1, is involved in oil body stabilization, oil body sizing, and protection of oil bodies from coalescence during water stress. The oleosin cDNA sequence of Fiscomitella patens was overexpressed as a single gene, respectively, to increase the number of oil bodies or to stabilize the oil bodies, or It can be used to produce transgenic plants that are overexpressed in combination with genes for lipid biosynthesis. Furthermore, oil body production can be induced in plant tissues that do not have endogenous oil body production by overexpressing moss oleosin in this particular tissue. Moss ACCase is a tool for increasing or changing the fatty acid content of plants.

Plastid acetyl coenzyme A (CoA) carboxylase (ACCase)
Catalyzes the first relevant reaction of de novo fatty acid biosynthesis. Malonyl CoA is synthesized from acetyl CoA in an ATP-dependent reaction. Two forms of the ACCase enzyme exist in plants, homodimeric ACCase and heterodimeric ACCase.

The tetrameric ACCase has one subunit encoded by plastid (β-carboxyltransferase) and three subunits encoded by the nucleus (biotin carboxy carrier protein (BCCP), biotin carboxylase (BC), α-carboxyl transferase). The activity of the ACCase enzyme is regulated by covalent modifications and allosteric regulatory mechanisms. A new alpha derived from the moss Fiscomitella patens
-Carboxyltransferase transfers chloroplast transit peptides to the N-terminal (
1-47) and can be used for targeting to plastids.
Moreover, ACCase requires biotinylation for enzymatic activity. Therefore,
The enzymes involved in biotinylation and biotin synthesis (such as biotin carboxylase) are important for forming active ACCase.

Northern blot analysis of α-carboxyltransferase reveals that subunit mRNA accumulates in chloroplast-rich tissues. This tissue is actively synthesizing the fatty acids used for membrane biosynthesis and oil (triacylglycerol) production. Overexpression of α-carboxylase in oil-storing plants under the control of embryo-specific promoters can lead to greater protein expression and thus greater enzymatic activity and altered oil synthesis. Increased amounts of fatty acids can be measured quantitatively according to methods known in the art.

The fatty acid profile of oilseeds largely determines the agronomic value of lipid compounds or oils. Oxidative stability due to oil homogeneity, chain length and degree of unsaturation,
Use as a lubricant, copolymer, etc. are determined. The fatty acid profile of organisms such as plants further affects growth and developmental characteristics such as resistance to biotic and abiotic stress. Thus, the use of genes involved in desaturation or elongation processes can be used to optimize lipid compounds. Such genes include free cytochrome b5, NADH cytochrome b5 reductase, cytochrome P450, thioredoxin Δ5-, Δ6-, Δ.
9-, Δ12-desaturases (either acyl lipid desaturases or ACP desaturases), and acyl CoA synthases or acetyl CoA
Genes such as synthase, ketoacyl (CoA or ACP) synthase, ketoacyl reductase, wax biosynthetic enzyme.

Another essential step in lipid synthesis is the transfer of fatty acids to polar head groups by, for example, glycerol phosphate acyltransferase (Frentzen, 1).
998, Lipid, 100 (4-5): 161-166). In addition, the enzymatic steps can be modified to affect intermediate compounds in acylglycerol production. Diacylglycerol kinase, phosphatidylinositol synthase, phosphatidylserine synthase and phosphatidate phosphatase are such genes useful for modifying intermediate compounds. The combination of various precursor molecules and biosynthetic enzymes produces various fatty acid molecules that have a large effect on the composition of the membrane.

Similarly, degradation pathways can also be used to modify the production, distribution and storage of lipid compounds. In particular, lipolytic enzymes such as lysophospholipases, triacylglycerol lipases, phospholipases D1 and D2, lipoxygenases and thioesterases, and β-such as peroxisomal acyl CoA synthases, acyl CoA oxidases, methylcrotonyl CoA carboxylases and ketoacyl CoA thiolases. Oxidative pathway enzymes are well-suited genes for influencing the degradation of lipid compounds. Also, the distribution of lipid compounds can be affected when genes such as acyl-CoA binding proteins, lipid transport proteins or thioesterases are introduced into lipid-synthesizing organisms.

Polyunsaturated Fatty Acids Vitamins, cofactors and health nutrients are easily synthesized by other organisms such as bacteria, but higher animals have lost their synthetic ability and must therefore be ingested. , Or another group of molecules that higher animals cannot produce adequately on their own and must therefore be ingested further. These molecules are bioactive substances in their own right, or precursors of biologically active substances that can serve as electron carriers or intermediates in various metabolic pathways. In addition to their nutritional value, these compounds also have significant industrial value as colorants, antioxidants and catalysts or other processing aids. (For a review of the structures, activities and industrial applications of these compounds, see, eg, Ullman's Encyclo.
(Pedia of Industrial Chemistry, Vitamin, A27, pp. 443-613, VCH: Weinheim, 1996). In the case of polyunsaturated fatty acids, Simopoulos, 1999, Am. J.
Clin. Nutr. 70 (3rd Supplement): 560-569; Takahata et al., Biosc. Biotechnol. Biochem, 1998, 62 (11
): 2079-2085; Willich and Winther, 1995, D.
eutsche Medinische Wochenschrift, 1
20 (7): 229 et seq.), And references cited therein.

The expression cofactor includes non-proteinaceous compounds required to produce normal enzymatic activity. Although such compounds may be organic or inorganic, the cofactor molecules of the invention are preferably organic. The term health nutrition includes dietary supplements that have health benefits in plants and animals, especially humans. Examples of such molecules include vitamins, antioxidants, and also certain lipids (eg polyunsaturated fatty acids).

Their biosynthesis in organisms capable of producing these molecules, such as bacteria, has been extensively characterized (Ullman's Encyclopedia of In.
Dust Chemistry, Vitamin, A27, 443-6
13, VCH: Weinheim, 1996; Michel, G. et al. (1999
), Biochemical Pathways: An Atlas of B.
iochemistry and Molecular Biology, Jo
hn Wiley &Sons; Ong, A .; S. , Niki, E .; & Package
r, L. (1995), UNESCO / Malaysia Institute of Science and Technology and Association of Free Radical Research (Asia) (Penang (Malaysia) September 1, 1994.
Minutes of "Nutrition, lipids, health and diseases" (held from 1st to 3rd), AOCS Pr
ess: Champaign, IL X, 374S).

Another aspect of the invention relates to the use of the manufactured fine chemical itself in the biosynthesis and manufacture of other fine chemicals. For example, the fine chemicals themselves produced may have catalytic activity, such as desaturase, that helps to convert one fine chemical (eg, saturated fatty acids) into another fine chemical (eg, unsaturated fatty acids).

III. ELEMENTS AND METHODS OF THE INVENTION The present invention is, at least in part, herein directed to LMRP nucleic acid molecules and L
It is based on the discovery of novel molecules designated as MRP protein molecules. These molecules control the production of cell membranes in Fiscomitrera patens and Ceratodon purpleus and direct the movement of molecules across such membranes. 1
In one embodiment, the LMRP molecule is involved in the metabolism of compounds required for the assembly of cell membranes in microorganisms and plants or the transport of molecules across these membranes. In a preferred embodiment, the activity of the LMRP molecules of the present invention to regulate the production of membrane compounds and membrane transport affects the production by this organism of the desired fine chemicals. In a particularly preferred embodiment, the LMRP molecules of the invention are regulated in activity such that the microbial or plant metabolic pathways prepared by the LMRP of the invention are regulated in yield, production and / or production efficiency, and The efficiency of transport of the compound therethrough is altered, whereby the yield, production and / or production efficiency of the desired fine chemical by microorganisms and plants is regulated, either directly or indirectly.

The expression LMRP or LMRP polypeptide includes proteins involved in the metabolism of compounds or the transport of molecules across these membranes necessary for the assembly of cell membranes in microorganisms and plants. Examples of LMRPs include LMRPs encoded by the LMRP genes shown in Table 1 and Appendix A. The term LMRP gene or LMRP nucleic acid sequence includes the coding region and also the nucleic acid sequence encoding the LMRP consisting of the corresponding untranslated 5'and 3'sequence regions. Examples of LMRP genes include the genes shown in Table 1. The term production or productivity is art-recognized and the concentration of fermentation product (eg desired fine chemical) produced at a particular time and a particular fermentation volume (eg kg product / hour / liter). )including. The term production efficiency includes the time required to achieve a particular level of production (eg, how long does it take a cell to achieve a particular rate of production of a fine chemical). . The term product / carbon yield is art-recognized and the carbon source product (
That is, the conversion efficiency to fine chemicals is included. This is generally expressed as, for example, kg product / kg carbon source. Increasing the yield or production of a compound increases the amount of recovered molecule or useful recovered molecule of such compound in a particular culture volume at a particular time. The term biosynthesis or biosynthetic pathway is art-recognized and is a compound from intermediate compounds (preferably organic compounds) by cells that may be a multi-step, highly regulated process.
Including the synthesis of. The term degradative or degradative pathway is art-recognized to degradative products (generally speaking smaller molecules or less complex molecules), which can be a multi-step highly controlled process. Compounds by cells (preferably,
Decomposition of organic compounds). The expression of metabolism is art-recognized and includes the whole biochemical reaction taking place in an organism. Thus, metabolism of a particular compound (eg, fatty acid metabolism) includes all biosynthetic, modification and degradation pathways in the organism associated with this compound.

In another embodiment, the LMRP molecules of the invention are capable of modulating the production of desired molecules such as fine chemicals in microorganisms and plants. There are many mechanisms by which changes in the LMRP of the present invention can directly affect the yield, production and / or production efficiency of fine chemicals from microbial or plant strains containing such altered proteins. Such LMRPs involved in the transport of fine chemical molecules within or out of cells are numbered or active such that higher amounts of these compounds are transported through membranes that are more easily recovered and interconverted. Can be increased. Similarly, such LMRPs involved in intracellular transport of nutrients required for biosynthesis of one or more fine chemicals are desired at concentrations of these precursor compounds, cofactor compounds or intermediate compounds. The number or activity can be increased to increase inside the cell. Moreover, fatty acids and lipids are themselves desirable fine chemicals. Thus, by optimizing or increasing the activity of one or more LMRPs of the invention involved in the biosynthesis of these compounds, or by one or more involved in the degradation of these compounds. It may be possible to increase the yield, production and / or production efficiency of fatty acid and lipid molecules from microorganisms or plants by impairing the activity of LMRPs.

Mutagenesis of one or more LMRP genes of the present invention also has LMRPs with altered activity that have an indirect effect on producing one or more desired fine chemicals from microorganisms and plants. Can be generated.
For example, the LMRPs of the present invention, which are involved in extracellular transport of waste products, are known to cause normal metabolic waste of cells (which would be increased in amount due to the overproduction of the desired fine chemicals) to Before possible damage to nucleotides and proteins within (which reduces cell viability) or interferes with fine chemical biosynthesis (which reduces desired fine chemical yield, production and / or production efficiency) The number or activity can be increased so that it can be efficiently transported extracellularly. Furthermore, the relatively large intracellular amounts of the desired fine chemicals can be toxic to the cells in principle, thus increasing the activity or number of transporters that can transport this compound out of the cell. This can increase the viability of the cells in culture, which results in a higher number of cells in the culture that produce the desired fine chemical. The LMRPs of this invention can also be engineered to produce relative amounts of different lipid and fatty acid molecules. This can have a profound effect on the lipid composition of the cell's membrane. Because each type of lipid has different physical properties, changes in the lipid composition of the membrane can significantly change the fluidity of the membrane. Changes in membrane fluidity can affect not only cellular integrity, but also transport of molecules across the membrane. Both of these have a great impact on producing fine chemicals from microorganisms and plants in large scale fermentation cultures. Plant membranes provide specific characteristics such as resistance to heat, cold, salt, drought, and resistance to pathogens such as bacteria and fungi. Therefore, modulating membrane compounds can have a profound effect on the fitness of a plant to survive under the stress conditions described above. This can occur through changes in the signal transduction cascade or directly through altered membrane composition (eg, Chapman, 19
98, Trends in Plant Science, 3 (11): 419.
~ 426), and may affect the signal transduction cascade (see
Wang, 1999, Plant Physiology, 120: 645-6.
51). In mammalian systems, several forms of phosphatidate phosphatases involved in glycerolipid synthesis and signal transduction have been identified.
In yeast, the phosphatidate phosphatase has also been purified and partially characterized (Brindley DN (1988), Phosphatidedat.
e Phosphohydrolase (Brindley DN ed.), Vol. 1, pp. 21-77, CRC Press, Boca Raton). The same second messenger function can be inferred for plant systems.

The isolated nucleic acid sequence of the invention is contained in the genome of the strain Fiscomitella patens, which can be obtained from the moss collection of the University of Hamburg. The nucleotide sequence of the isolated cDNA of Fiscomitella patens LMRP and the predicted amino acid sequence of Fiscomitella patens LMRP are shown in Appendixes A and B, respectively.

Computer analysis was performed to classify and / or identify these nucleotide sequences as sequences encoding proteins involved in the metabolism of cell membrane components or proteins involved in the transport of compounds across such membranes.

The present invention also relates to proteins having an amino acid sequence that is substantially homologous to one amino acid sequence of Appendix B. As used herein,
A protein having an amino acid sequence that is substantially homologous to a selected amino acid sequence has at least about 50% homology to one selected amino acid sequence (eg, an entire selected amino acid sequence). is there. A protein having an amino acid sequence that is substantially homologous to the selected amino acid sequence may also have at least about 50% to 60% homology to the selected amino acid sequence, and preferably at least about 60%. ˜70%, more preferably at least about 70% -80%, 80% -90% or 90% -95%,
Most preferably it can be at least about 96%, 97%, 98%, 99% or more.

Whether the LMRP protein of the invention or a biologically active portion or fragment thereof may be involved in the metabolism of compounds required for the assembly of cell membranes in microorganisms or plants or the transport of molecules across these membranes, Alternatively it may have one or more of the activities shown in Table 1.

[0060]   Various aspects of the invention are described in further detail in the following sections.

A. Isolated Nucleic Acid Molecules One aspect of the invention includes isolated nucleic acid molecules that encode LMRP polypeptides or biologically active portions thereof, as well as nucleic acids that encode LMRP (eg, LMRP DNA). A nucleic acid fragment sufficient for use as a hybridization probe or primer for identification or amplification. As used herein, the term “nucleic acid molecule” refers to a DNA molecule (eg, c
It is intended to include DNA or genomic DNA) and RNA molecules (eg mRNA), as well as analogs of DNA or RNA made using nucleotide analogs. The term also encompasses untranslated sequences present at both the 3'and 5'ends of the coding region of a gene: a sequence of at least about 100 nucleotides upstream from the 5'end of the coding region and 3'of the coding region. A sequence of at least about 20 nucleotides downstream from the end. The nucleic acid molecule can be single-stranded or double-stranded,
It is preferably double-stranded DNA. An "isolated" nucleic acid molecule is a nucleic acid molecule that is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid. Preferably,"
An "isolated" nucleic acid does not have the sequences that naturally flank the nucleic acid in the genomic DNA of the organism from which it was derived (ie, the sequences that are present at the 5'and 3'ends of the nucleic acid). For example, in various embodiments, the isolated LMRP nucleic acid molecule is the genomic DNA of the cell from which the nucleic acid is derived (eg, Fiscomitella patens cells).
Less than about 5 kb, less than about 4 kb, less than about 3 kb naturally flanking the nucleic acid in
It may contain less than about 2 kb, less than about 1 kb, less than about 0.5 kb or less than about 0.1 kb of nucleotide sequence. Furthermore, an "isolated" nucleic acid molecule, such as a cDNA molecule, may be substantially free of other cellular material or culture medium if made by recombinant techniques, or if chemically synthesized. It may be substantially free of chemical precursors or other chemicals.

Nucleic acid molecules of the invention (eg, nucleic acid molecules having the nucleotide sequences of Appendix A) or portions thereof, can be prepared using standard molecular biology techniques and the sequence information provided herein. It can be isolated. For example, P. LM of patterns
The RP cDNA was used as a hybridization probe with all or part of one of the sequences in Appendix A, and standard hybridization techniques (
For example, Sambrook et al., Molecular Cloning: A La.
Laboratory Manual, 2nd Edition, Cold Spring Harb
or Laboratory, Cold Spring Harbor Lab
oratory Press, Cold Spring Harbor, NY,
1989, using techniques such as those described in P. 1989. It can be isolated from a library of patents. In addition, nucleic acid molecules comprising all or part of one of the sequences in Appendix A can be isolated by polymerase chain reaction using oligonucleotide primers designed based on this sequence (eg, Appendix A
A nucleic acid molecule comprising all or part of one of the sequences can be isolated by polymerase chain reaction using oligonucleotide primers designed based on this same sequence in Appendix A). For example, mRNA (eg Chirgw
in et al. (1979) Biochemistry, 18: 5294-5299 by the guanidinium thiocyanate extraction method) and the cDNA can be isolated from reverse transcriptase (eg, Gibco / BRL (Bethesd).
a, MD), Moloney MLV reverse transcriptase; or Seikagak
u America, Inc. (AMV reverse transcriptase available from St. Petersburg, FL). Synthetic oligonucleotide primers required for amplification by the polymerase chain reaction can be designed based on one of the nucleotide sequences shown in Appendix A. The nucleic acid of the present invention is
Amplification can be performed using cDNA or genomic DNA as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. In addition, oligonucleotides corresponding to the LMRP nucleotide sequence can be prepared by standard synthetic techniques, eg, using an automated DNA synthesizer.

In a preferred embodiment, the isolated nucleic acid molecule of the invention comprises one of the nucleotide sequences shown in Appendix A. The sequences in Appendix A correspond to the cDNA of the Fiscomitella patens LMRP of the invention. This cDNA has sequences encoding LMRP (ie, “coding regions” shown in the respective sequences in Appendix A).
), And 5'untranslated sequences and 3'untranslated sequences. Alternatively, the nucleic acid molecule may contain only the coding region of any of the sequences in Appendix A, or may contain the entire genomic fragment isolated from genomic DNA.

For the purposes of this application, it is understood that each of the sequences shown in Appendix A has an identifying entry number. Each of these sequences contains up to three portions, a 5'upstream region, a coding region and a downstream region. Each of these three areas is identified by the same entry number designation to eliminate confusion. In that case, a listing of one of the sequences in Appendix A may refer to any of the sequences in Appendix A and be distinguished by their different entry number designations. The coding region for each of these sequences is
It is translated into the corresponding amino acid sequence shown in Appendix B. The sequences in Appendix B are identified by the same entry number designations as Appendix A so that they can be easily correlated. For example, the amino acid sequence of Appendix B, designated as 38_ck21_g07fwd, is a translation of the coding region of the nucleotide sequence of nucleic acid molecule 38_ck21_g07fwd. In Table 1, 38_ck21_g07fwd is MGD synthase (
The function and utility of individual clones has been demonstrated, as identified as monogalatosyl diacylglycerol synthase). In addition, Table 1 shows the entry number of the longest clone. For example, entry number PP01000
4041R represents the cDNA sequence corresponding to clone 38_ck21_g07fwd. It represents a longer clone that provides more sequence information. Such longer clones can be used to produce a functionally active protein having an MGD polypeptide sequence, or such longer sequences can be used to determine the number of which MGD synthase is a part. It can be used to affect a portion of a complex of individual polypeptides.

In another preferred embodiment, the isolated nucleic acid molecule of the present invention comprises a nucleic acid molecule that is the complement of one of the nucleotide sequences shown in Appendix A, or a portion thereof. A nucleic acid molecule that is complementary to one of the nucleotide sequences shown in Appendix A is
It hybridizes to one of the nucleotide sequences shown in Appendix A,
A nucleic acid molecule that is sufficiently complementary to one of the nucleotide sequences shown in Appendix A so that it can form a stable duplex.

In yet another preferred embodiment, the isolated nucleic acid molecule of the invention comprises:
At least about 50% homology to the single nucleotide sequence shown in Appendix A
-60%, preferably at least about 60% -70%, more preferably at least about 70% -80%, 80% -90% or 90% -95%,
Even more preferably it comprises at least about 95%, 96%, 97%, 98%, 99% or more nucleotide sequences or portions thereof. In a further preferred embodiment, the isolated nucleic acid molecule of the present invention comprises a nucleotide sequence or a portion thereof that hybridizes to one of the nucleotide sequences shown in Appendix A, for example under stringent conditions.

Furthermore, the nucleic acid molecule of the present invention may comprise only a part of the coding region of one of the sequences in Appendix A, eg fragments which may be used as probes or primers, or biologically active LMRPs. Can include a fragment that encodes a unique portion. P. The nucleotide sequence determined from cloning the LMRP gene from Patens is not limited to LMRP homologs from other moss or related species, but also in other cell types and organisms.
Allows the production of probes and primers designed for use in identifying and / or cloning P homologs. The probe / primer typically comprises a substantially purified oligonucleotide. The oligonucleotide is
Typically, under stringent conditions, one sense strand of one of the sequences set forth in Appendix A, one antisense sequence of one of the sequences set forth in Appendix A, or at least about a naturally occurring variant thereof. It comprises a region of nucleotide sequence that hybridizes to 12 (preferably about 25, more preferably about 40, 50 or 75) contiguous nucleotides. Primers based on the nucleotide sequences in Appendix A can be used in PCR reactions to clone LMRP homologs. Probes based on the LMRP nucleotide sequence can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In a preferred embodiment, the probe further comprises a labeling group attached to it. For example, labeling groups include radioisotopes, fluorescent compounds, enzymes,
Or it may be a cofactor for the enzyme. Such a probe may be used, for example, by measuring the level of nucleic acid encoding LMRP in a sample of cells, eg
Use as part of a genomic marker test kit to identify cells that misexpress LMRP by detecting LMRP mRNA levels or determining whether the genomic LMRP gene is mutated or deleted can do.

In one embodiment, the nucleic acid molecules of the invention retain the ability of the protein or portion thereof to participate in the metabolism of compounds required for the assembly of cell membranes in microorganisms or plants or the transport of molecules across these membranes. As such, encodes a protein or portion thereof that comprises an amino acid sequence that is sufficiently homologous to one of the amino acid sequences in Appendix B. As used herein, the phrase "fully homologous" refers to
The minimum number of identical amino acid sequences to one of the amino acid sequences in Appendix B is such that the protein or part thereof may be involved in the metabolism of compounds necessary for the construction of cell membranes in microorganisms or plants or in the transport of molecules across these membranes. A protein or a portion thereof having an amino acid sequence containing an amino acid residue or an equivalent amino acid residue (for example, an amino acid residue having a side chain similar to the amino difference residue in one of the sequences of Appendix B). Protein members of such membrane component metabolic pathways or membrane transport systems may play a role in the production and secretion of one or more fine chemicals, as described herein. Examples of such activity are also described herein. Thus, the function of LMRP contributes, either directly or indirectly, to the yield, production and / or production efficiency of one or more fine chemicals. Examples of LMRP activity are shown in Table 1.

In another embodiment, the protein has at least about 50% to 60% homology to one entire amino acid sequence of Appendix B, preferably at least about 60.
% To 70%, more preferably at least about 70% to 80%, 80% to 90%.
% Or 90% to 95%, most preferably at least about 96%, 97%,
98%, 99% or more.

The portion of the protein encoded by the LMRP nucleic acid molecule of the present invention is preferably one biologically active portion of LMRP. As used herein, does the term "biologically active portion of LMRP" relate to the metabolism of compounds required for the assembly of cell membranes or the transport of molecules across these membranes in microorganisms or plants? , Or a portion (eg, domain / motif) of LMRP having activity as shown in Table 1. To determine whether LMRP or a biologically active portion thereof may be involved in the metabolism of compounds required for the assembly of cell membranes in microorganisms or plants or the transport of molecules across these membranes, an enzyme activity assay It can be performed. Such assay methods are well known to those of skill in the art, as detailed in Example 8 of the Examples.

A further nucleic acid fragment encoding a biologically active portion of LMRP may be isolated from one of the sequences in Appendix B to isolate the encoded portion of the LMRP or peptide (eg, in vitro). It can be prepared by expression (by recombinant expression) and by assessing the activity of LMRP or the encoded portion of the peptide.

The invention further relates to a nucleic acid which differs from one of the nucleotide sequences shown in Appendix A due to the degeneracy of the genetic code and thus encodes the same LMRP as the LMRP encoded by the nucleotide sequence shown in Appendix A. Includes molecules (and portions thereof). In another embodiment, the isolated nucleic acid molecule of the invention has a nucleotide sequence that encodes a protein having the amino acid sequence shown in Appendix B.
In an even further embodiment, a nucleic acid molecule of the invention is a full length Fiscomitrella patens that is substantially homologous to the amino acid sequence of Appendix B (encoded by the open reading frame shown in Appendix A). Encodes a protein.

In addition to the LMRP nucleotide sequence of Physcomitrella patens shown in Appendix A, polymorphisms of DNA sequences that result in amino acid sequence changes of LMRP are present in the population (eg, population of Fiscomitella patens). It will be understood by one of ordinary skill in the art. Such genetic polymorphisms in the LMRP gene may exist among individuals within a population due to natural changes. As used herein, the term "gene"
And the term "recombinant gene" refers to a nucleic acid molecule containing an open reading frame encoding an LMRP (preferably LMRP of Physcomitrella patens). Such natural changes can typically result in 1% -5% variation in the nucleotide sequence of the LMRP gene. Any and all such nucleotide changes and resulting amino acid polymorphisms in LMRP that are the result of natural alterations and do not alter the functional activity of LMRP are intended to be within the scope of the present invention.

Nucleic acid molecules corresponding to naturally occurring variants of the Fiscomitrella patens LMRP cDNA of the present invention and homologs other than Fiscomitrella patens are standard high-strands under stringent hybridization conditions. Isolation based on their homology to LMRP nucleic acids of Fiscomitrella patentes disclosed herein using cDNAs of Fiscomitrella patents or portions thereof as hybridization probes according to hybridization techniques. You can Thus, in another embodiment, an isolated nucleic acid molecule of the invention is a nucleic acid molecule that is at least 15 nucleotides in length and, under stringent conditions, comprises a nucleotide sequence of one of Appendix A. Hybridize. In other embodiments, the nucleic acids are at least 30 nucleotides, 50 nucleotides, 100 nucleotides, or 250 nucleotides or more in length. As used herein, the term "hybridize under stringent conditions" typically keeps nucleotide sequences that are at least 60% homologous to one another to remain hybridized to each other. Hybridization conditions and wash conditions shall be stated. Preferably, the conditions are such that the homology to each other is at least about 65% (more preferably at least about 70%).
%, And most preferably at least about 75% or more) is typically such that the nucleotide sequences remain hybridized to each other. Such stringent conditions are known to those of skill in the art and are
current Protocols in Molecular Biolog
y, John Wiley & Sons, N.Y. Y. (1989), 6.3.1-6.
． Can be found in 3.6. A preferred non-limiting example of stringent hybridization conditions is 6X sodium chloride / sodium citrate (SSC).
Hybridization at about 45 ° C., followed by 0.2 × SSC,
One or several washes in 50% -65 ° C in 0.1% SDS are included. Preferably, the isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequences of Appendix A corresponds to a naturally occurring nucleic acid molecule. As used herein, a "naturally occurring" nucleic acid molecule refers to an RNA or DNA molecule having a naturally occurring nucleotide sequence (eg, a nucleotide sequence encoding a naturally occurring protein). In one embodiment, the nucleic acid encodes the native Fiscomitella patens LMRP.

In addition to naturally occurring variants of the LMRP sequence that may be present in the population, one of skill in the art may further introduce mutations into the nucleotide sequence of Appendix A by mutation, whereby the functional capacity of LMRP. Coded without changing the
It is understood that the amino acid sequence of can be changed. For example, "not required"
Nucleotide substitutions that result in amino acid substitutions at amino acid residues can be made in the sequences in Appendix A. A “non-essential” amino acid residue is a residue that can be changed from one wild-type sequence of LMRP (Appendix B) without changing the activity of said LMRP, whereas the “essential” amino acid residue is The residue is required for LMRP activity. However, other amino acid residues (eg, residues that are not conserved in the domain that have LMRP activity, or are only semi-conserved) may not be required for activity, thus altering LMRP activity. It is thought that it can be changed without causing it.

Accordingly, another aspect of the invention pertains to nucleic acid molecules that encode LMRPs that contain changes in amino acid residues that are not essential for LMRP activity. Such LMRP
Retains at least one of the LMRP activities described herein, although the amino acid residues differ from the sequences contained in Appendix B. In one embodiment, the isolated nucleic acid molecule has at least about 5 homology to one amino acid sequence of Appendix B.
0% amino acid sequence, and P. Whether it may be involved in the metabolism of compounds required for the assembly of cell membranes in Patens or the transport of molecules across these membranes,
Alternatively, it comprises a nucleotide sequence encoding a protein having one or more of the activities shown in Table 1. Preferably, the protein encoded by such a nucleic acid molecule has at least about 50% -60% homology to one of the sequences in Appendix B, preferably at least about 50% to 60%. About 60% to 70%, and even more preferably at least about 70% to 80%, 80% to 90%, 90% homology to one of the sequences in Appendix B.
˜95%, and most preferably at least about 96%, 97%, 98% or 99% homology to one of the sequences in Appendix B.

To determine the% homology of two amino acid sequences (eg, one of the sequences in Appendix B and variants thereof) or two nucleic acids, the sequences are aligned for optimal comparison (eg, Gaps can be introduced in the sequence of one protein or nucleic acid for optimal alignment with the other protein or nucleic acid). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. A position in one sequence (eg, one of the sequences in Appendix B) is occupied by the same amino acid residue or nucleotide as the corresponding position in the other sequence (variant form of the sequence selected from Appendix B). The molecules are homologous at that position (ie,
As used herein, amino acid or nucleic acid “homology” is equivalent to amino acid or nucleic acid “identity”). The percent homology between the two sequences is
Is a function of the number of identical positions that both sequences have (ie,% homology =
Number of identical positions / total number of positions x 100).

An isolated nucleic acid molecule encoding a LMRP homologous to the protein sequences of Appendix B is introduced such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein, It can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequences of Appendix A.
Mutations can be introduced into one of the sequences in Appendix A by standard techniques such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted nonessential amino acid residues. "
A "conservative amino acid substitution" is a substitution in which amino acid residues are replaced with amino acid residues having similar side chains. A family of amino acid residues with similar side chains has been defined in the art. These families include amino acids with basic side chains (eg, lysine, arginine, histidine), amino acids with acidic side chains (eg, aspartic acid, glutamic acid), amino acids with uncharged polar side chains (eg, Glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids having non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains Included are amino acids (eg threonine, valine, isoleucine) and amino acids having aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino acid residue in LMRP is preferably replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, the mutation is
The LMRP can be randomly introduced along all or part of the sequence encoding LMRP, such as by saturation mutagenesis, and the resulting mutants screened for LMRP activity described herein to produce LMRP. Variants that retain activity can be identified. Following mutagenesis of one of the sequences in Appendix A, the encoded protein can be recombinantly expressed and the activity of the protein measured, for example, using the assay described herein. (See Example 8 in Examples).

In addition to the nucleic acid molecules described above that encode LMRPs, another aspect of the invention pertains to isolated nucleic acid molecules that are antisense thereto. An "antisense" nucleic acid is a nucleotide sequence that is complementary to a "sense" nucleic acid that encodes a protein, eg, complementary to the coding strand of a double-stranded cDNA molecule or to an mRNA sequence. It includes nucleotide sequences that are complementary. Thus, the antisense nucleic acid can hydrogen bond to the sense nucleic acid. Antisense nucleic acid is LM
It may be complementary to the entire coding strand of RP, or only to a portion thereof. In one embodiment, the antisense nucleic acid molecule is LM
It is antisense to the "coding region" of the coding strand of the nucleotide sequence encoding RP. The term "coding region" refers to the region of a nucleotide sequence that contains the codons that are translated into amino acid residues (eg, the entire coding region for ,,,,, includes nucleotides 1 ...). In another embodiment, the antisense nucleic acid molecule is antisense to the “non-coding region” of the coding strand of the nucleotide sequence encoding LMRP. The term "noncoding region" refers to the 5'and 3'sequences that flank the coding region that are not translated into amino acids (ie, also shown as 5'untranslated region and 3'untranslated region).

A coding chain sequence encoding a LMRP disclosed herein (eg, Appendix A
Given the sequence shown in 1), the antisense nucleic acid of the present invention can be designed according to Watson and Crick base pairing rules. The antisense nucleic acid molecule can be complementary to the entire coding region of LMRP mRNA, but more preferably is an oligonucleotide that is complementary only to a portion of the coding or non-coding region of LMRP mRNA. is there. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of LMRP mRNA. Antisense oligonucleotides are, for example, about 5 nucleotides, about 10 nucleotides, about 15 nucleotides, about 20 nucleotides, about 25 nucleotides, about 30 nucleotides, about 35 nucleotides, about 40 nucleotides in length.
It can be about 45 nucleotides or about 50 nucleotides. The antisense nucleic acids of the invention can be constructed using chemical synthesis reactions and enzymatic ligation reactions using techniques known in the art. For example, antisense nucleic acids (eg, antisense oligonucleotides) can be chemically synthesized using naturally occurring nucleotides, or to increase the biological stability of the molecule, or with antisense nucleic acids. It can be chemically synthesized using variously modified nucleotides designed to increase the physical stability of the duplex formed with the sense nucleic acid (eg, phosphorothioate derivatives and Acridine substituted nucleotides can be used). Examples of modified nucleotides that can be used to make antisense nucleic acids include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine,
4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-
Carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylcueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2- Dimethylguanine, 2-methyladenine, 2-methylguanine,
3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylcueocin, 5'-methoxycarboxymethyl Uracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wibutoxin, pseudouracil,
Queuosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl- 2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp
3) w, and 2,6-dimethylpurine. Alternatively, antisense nucleic acids can be made biologically using an expression vector in which the nucleic acid molecule is subcloned in the antisense orientation (ie, RNA transcribed from the inserted nucleic acid is of interest). Antisense orientation to the target nucleic acid, which is described further in the section below).

The antisense nucleic acid molecule of the present invention is typically one in which the antisense nucleic acid molecule is L
Administered to cells to hybridize with or bind to cellular mRNA and / or genomic DNA encoding MRP, thereby inhibiting expression of the protein, eg, by inhibiting transcription and / or translation. Created in-situ. Hybridization
It can occur by normal nucleotide complementation to form a stable duplex, or in the case of antisense nucleic acid molecules that bind to DNA duplexes, specific interactions in the major groove of the double helix. Can occur through action. Antisense molecules
For example, by binding an antisense nucleic acid molecule to a peptide or antibody that binds to a cell surface receptor or antigen, the antisense molecule is allowed to specifically bind to a selected cell surface expressed receptor or antigen. Can be modified to Antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. Vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong prokaryotic, viral or eukaryotic promoter (including plant promoters) to achieve a sufficient intracellular concentration of the antisense molecule are preferred .

In yet another embodiment, the antisense nucleic acid molecule of the invention is an α-anomeric nucleic acid molecule. Alpha-anomeric nucleic acid molecules form specific double-stranded hybrids with complementary RNA in which the strands are parallel to each other, as opposed to the normal β-unit (Gaultier et al. (1987) Nucleic Acids. Res
． 15: 6625-6641). Antisense nucleic acid molecules also include 2'-o-methyl ribonucleotides (Inoue et al. (1987) Nucleic Acids.
Res. 15: 6131-6148) or a chimeric RNA-DNA analog (Inoue et al. (1987), FEBS Lett. 215: 327-330).
Can be included.

In yet another embodiment, the antisense nucleic acid of the invention is a ribozyme. A ribozyme is a single-stranded nucleic acid (mRNA having a region complementary to the ribozyme.
RNA, which has a ribonuclease activity and is capable of cleaving
It is a molecule. Therefore, ribozymes (for example, hammerhead ribozyme (Ha
selhoff and Gerlach (1988) Nature 334: 5.
85-591)) can be used to catalytically cleave LMRP mRNA transcripts, thereby inhibiting translation of LMRP mRNA. LM
A ribozyme having specificity for a nucleic acid encoding RP was identified as the nucleotide sequence of the LMRP cDNA disclosed herein (ie, 38_ck in Appendix A).
21_g07fwd) or based on a heterologous sequence that can be isolated according to the methods taught in the present invention. For example, the Tetrahymera L-19 IVS in which the nucleotide sequence of the active site is complementary to the cleavable nucleotide sequence in the LMRP encoding mRNA.
A derivative of RNA can be constructed. For example, US Pat. No. 4,987,0
71 (Cech et al.) And US Pat. No. 5,116,742 (Cech et al.). Alternatively, LMRP mRNA can be used to select a catalytic RNA with a specific ribonuclease activity from a pool of RNA molecules. For example, Bartel, D .; And Szostak, J .; W. (1993
), Science, 261: 1411-1418.

Alternatively, the gene expression of LMRP is expressed by the regulatory region of the LMRP nucleotide sequence (
For example, it can be inhibited by targeting a nucleotide sequence complementary to the promoter and / or enhancer of LMRP) to form a triple helix structure that prevents transcription of the LMRP gene in target cells. In general, Helene, C .; (1991), Anticancer Drug De
s. 6 (6): 569-84; Helene, C .; (1992), Ann. N
． Y. Acad. Sci. 660: 27-36; Maher, L .; J. (199
2), Bioassays, 14 (2): 807-15.

B. Recombinant expression vector and host cell Another aspect of the present invention relates to a vector (preferably an expression vector) containing a nucleic acid encoding LMRP (or a part thereof). As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop body to which additional DNA segments can be ligated. Another type of vector is a viral vector in which additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in the host cell into which they are introduced (eg, bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors, such as non-episomal mammalian vectors, integrate into the host cell's genome when introduced into the host cell, thereby replicating with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are designated herein as "expression vectors". In general, expression vectors useful in recombinant DNA technology are often in the form of plasmids. In the present specification, "plasmid" and "vector" can be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (eg, replication defective retroviruses, adenoviruses and adeno-associated viruses), which provide equivalent functions.

The recombinant expression vector of the present invention comprises the nucleic acid of the present invention in a form suitable for expressing the nucleic acid in a host cell. This means that the recombinant expression vector comprises one or more regulatory sequences selected on the basis of the host used for expression and operably linked to the nucleic acid sequence to be expressed. To do. In a recombinant expression vector "operably linked" allows the expression of nucleotide sequences fused to each other such that both sequences perform the displayed function associated with the sequences used. In a manner such as in an in vitro transcription / translation system, or in the host cell when the vector was introduced into the host cell.
, Shall mean that the nucleotide sequence of interest is linked to the regulatory sequence (s). The term “regulatory sequence” is intended to include promoters, enhancers and other expression control elements (eg, polyadenylation signals). Such regulatory sequences are described, for example, by Goeddel; Gene E.
xpression Technology: Methods in Enzy
, 185, Academic Press, San Diego,
CA (1990) or Gruber and Crossby.
, Methods in Plant Molecular Biology
and Biotechnology (CRC Press, Boca Rat)
on, Florida, editor: Glick and Thompson), Chapter 7,
See pages 89-108 (including references therein). Regulatory sequences include sequences that cause constitutive expression of nucleotide sequences in many types of host cells,
And sequences that allow expression of the nucleotide sequence only under certain host cells or conditions. It will be appreciated by those skilled in the art that the design of the expression vector may depend on such factors as the choice of host cell to be transformed, the expression level of the desired protein and the like. The expression vector of the invention is introduced into a host cell, whereby a protein or peptide, including a fusion protein or fusion peptide, encoded by a nucleic acid as described herein (eg LMRP, L
Mutated forms of MRP, fusion proteins, etc.) can be produced.

The recombinant expression vector of the present invention is used in L-prokaryotic cells or eukaryotic cells.
It can be designed to express MRP. For example, the LMRP gene can be expressed in: C. Expression of foreign genes in bacterial cells such as Glutamicum, insect cells (including baculovirus expression system), yeast and other fungal cells (Romanos, MA et al. (1992), yeast:
Review, Yeast, 8: 423-488; van den Hondal, C .;
A. M. J. J. (1991), Expression of heterologous genes in filamentous fungi, More
Gene Manipulations in Fungi, J.M. W. Ben
net & L. L. Lasure, pp. 396-428: Academic P
less, San Diego; van den Hondal, C.I. A. M.
J. J. And Punt. P. J. (1991), Gene transfer system and vector development for filamentous fungi, Applied Molecular Genet.
ics of Fungi (Peberdy, JF et al. eds.), pages 1 to 28,
Cambridge University Press: Cambridge
), Algae (Falciatore et al., 1999, Marine Biotech)
Nolology, 1: 3, 239-251), various types of ciliates (Holotricia, Peritrichia, Spirotrichia, Stubtoria, Suctoria, Tetrahymena, Paramecium, Coccidium, Columbium, Glaucoma
, Platiophrya, Potomacu
s), Pseudocohnilembus, Euplotes, Engelmaniell
a) and Styronychia, in particular the Ciliate of the genus Stylonychia lemnae with a vector according to the transformation method as described in International Patent Application Publication WO9801572, and multicellular plant cells (S. Schmidt, R. and Willmitze
r, L. (1988), High efficiency Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana leaf and cotyledon explants, Plant Ce.
ll Rep. 583-586; Plant Molecular Biolo
gy and Biotechnology, C Press, Boca Ra
Ton, Florida, Chapter 6/7, S.M. 71-119 (1993); F.
White, B.I. Genes et al., Gene transfer technology, Transgenic Pl
Ants, Volume 1, Engineering and Utilization,
Editor: Kung and R.M. Wu, Academic Press (1993),
128-43; Potrykus, Annu. Rev. Plant Physi
ol. Plant Molec. Biol. 42 (1991), 205-225
(And references cited therein), or mammalian cells. Suitable host cells are Goeddel, Gene Expression Technology.
: Methods in Enzymology, 185, Academic
Further description in Press, San Diego, CA (1990).
Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

Expression of proteins in prokaryotes is most often carried out with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to the protein encoded by it, usually at the amino terminus of a recombinant protein, but also at the C terminus, or fused within suitable regions within the protein. . Such fusion vectors typically serve three purposes: 1) to increase the expression of the recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) as a ligand in affinity purification. To help purify recombinant proteins by acting. In many cases, the fusion expression vector has a proteolytic cleavage site introduced at the junction of the fusion component and the recombinant protein to allow the recombinant protein to be separated from the fusion component after purification of the fusion protein. . Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase.

A typical fusion expression vector is pGEX (Pharmacia Biote).
ch Inc; Smith, D.M. B. And Johnson, K .; S. (198
8), Gene, 67: 31-40), pMAL (New England B).
iolabs, Beverly, MA) and pRIT5 (Pharmacia)
, Piscataway, NJ), each of which is a glutathione S
-Fusing transferase (GST), maltose E binding protein or protein A to the target recombinant protein. In one embodiment, the LMRP
Was cloned into the pGEX expression vector, N-terminal to C-terminal,
A vector encoding a fusion protein containing the GST-thrombin cleavage site-X protein is made. This fusion protein can be purified by affinity chromatography using glutathione-agarose resin.
Recombinant protein not fused to GST can be recovered by cleaving the fusion protein with thrombin.

Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann
Et al. (1988), Gene, 69: 30-315) and pET11d (St.
audi et al., Gene Expression Technology: Me.
methods in Enzymology, 185, Academic Pre
ss, San Diego, California (1990), 60-89)
Is included. Expression of the target gene from the pTrc vector is achieved by hybrid trp
-Dependent on transcription of host RNA polymerase from the lac fusion promoter. p
Expression of the target gene from the ET11d vector is expressed simultaneously with the viral RNA
It relies on transcription from the T7gn10-lac fusion promoter mediated by the polymerase (T7gn1). This viral polymerase is supplied by the BL21 (DE3) or HMS174 (DE3) host strain from an endogenous lambda prophage carrying the T7gn1 gene under the transcriptional control of the lacUV5 promoter.

One way to maximize recombinant protein expression is to express the protein in host cells that have an impaired ability to proteolytically cleave the recombinant protein (Gottesman, G., Gene Expression).
Technology: Methods in Enzymology, 185
, Academic Press, San Diego, California
(1990), 119-128). Another method is the nucleic acid of the nucleic acid inserted into the expression vector such that the individual codons for each amino acid are the codons that are preferentially utilized in the bacterium selected for expression (C. glutamicum, etc.). To change the sequence (Wada et al. (1992), Nucleic Aci.
ds Res. 20: 2111-2118). Such changes in the nucleic acid sequences of the invention can be made by standard DNA synthesis techniques.

In another embodiment, the LMRP expression vector is a yeast expression vector.
Yeast S. Examples of vectors for expression in S. cerevisiae include pY
epSec1 (Baldari et al. (1987), Embo J. 6: 229-2.
34), pMFa (Kurjan and Herskowitz (1982), C.
ell, 30: 933-943), pJRY88 (Schultz et al. (1987).
), Gene, 54: 113-123) and pYES2 (Invitroge).
n Corporation, San Diego, CA). Suitable vectors for use in other fungi such as filamentous fungi and methods for constructing the vectors are described in van den Hondal, C .; A. M. J. J. & Punt. P. J
． (1991), "Gene transfer system and vector development for filamentous fungi",
Applied Molecular Genetics of Fungi (
J. F. Peberdy et al., Pp. 1-28, Cambridge University.
In particular, those described in detail in "Rsity Press: Cambridge" are included.

Alternatively, the LMRPs of this invention can be expressed in insect cells using a baculovirus expression vector. Cultured insect cells (eg, Sf9
Baculovirus vectors that can be used to express proteins in cells include pAc series (Smith et al. (1983) Mol. Cell B).
iol. 3: 2156-2165) and the pVL series (Lucklow and Summers (1989), Virology, 170: 31-39).

In yet another embodiment, the nucleic acids of the invention are expressed in mammalian cells using mammalian expression vectors. Examples of mammalian expression vectors include
pCDM8 (Seed, B. (1987), Nature, 329: 840) and pMT2PC (Kaufman et al. (1987), EMBO J. 6: 187.
˜195) are included. When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, widely used promoters include polyoma, adenovirus 2, cytomegalovirus and simian. Derived from virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells, see Sambro.
ok, J. Fritsh, E .; F. And Maniatis, T .; , Mole
color Cloning: A Laboratory Manual (2nd
Edition, Cold Spring Harbor Laboratory, Cold
Spring Harbor Laboratory Press, Cold
See Chapters 16 and 17 of Spring Harbor, NY, 1989).

In another embodiment, the recombinant mammalian expression vector is capable of expressing a nucleic acid preferentially in a particular cell type (eg, tissue-specific regulatory elements are used to express the nucleic acid). Be done). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include albumin promoter (liver-specific; Pinkert et al. (1987),
Genes Dev. 1: 268-277), lymphoid-specific promoter (C
alame and Eaton (1988), Adv. Immunol. 43: 2
35-275), especially the promoter of the T cell receptor (Winoto and Ba).
ltimore (1989), EMBO J. et al. 8: 729-733) and immunoglobulin promoters (Banerji et al. (1983), Cell, 33:
729-740; Queen and Baltimore (1983), Cell.
33: 741-748), neuron-specific promoters (eg, neurofilament promoter; Byrne and Ruddle (1989), PN.
AS, 86: 5473-5477), pancreas-specific promoters (Edlund et al. (1985), Science, 230: 912-916), as well as mammary gland-specific promoters (eg whey promoter, US Pat. No. 4,873,316). And European Patent Application Publication No. 264,166). Also included are promoters that are regulated by the developmental stage, such as the murine hox promoter (Kes
sel and Gruss (1990), Science, 249: 374-37.
9) and the fetoprotein promoter (Campes and Tilgam)
(1989), Genes Dev. 3: 537-546).

In another embodiment, the LMRPs of the invention are unicellular plant cells (eg algae).
(Falciatore et al., 1999, Marine Biotechnolo.
gy, 1 (3): 239-251 and references therein and plant cells derived from higher plants (eg seed plants such as crop plants). Examples of plant expression vectors include the vectors described below: Bec
ker, D.I. Kemper, E .; Schell, J .; And Masters
on, R.M. (1992), "New plant binary vector in which a selectable marker is present near the left region", Plant Mol. Biol. 20: 1195-
1197; Bevan, M .; W. (1984), "Binary Agrobacterium vector for plant transformation," Nucl. Acid. Res. 12: 8711
~ 8721; "Vectors for gene transfer in higher plants", Transgeni
c Plants, Volume 1, Engineering and Utiliza
Tion, editor: Kung and R.S. Wu, Academic Press, 1
993, S.I. 15-38.

The plant expression cassette is preferably a regulatory sequence (polyadenylation) which is capable of directing gene expression in plant cells and in which each sequence is operably linked so that it can perform its function such as termination of transcription. Signal etc.). A preferred polyadenylation signal is gene 3 known as octopine synthase of Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 (1984).
, 835 or later) or a functional equivalent thereof, and t-DN of Agrobacterium tumefaciens (Agrobacterium tumefaciens)
All other terminators which are signals from A but are functionally active in plants are also suitable.

Since gene expression in plants is very often not restricted at the transcriptional level,
The plant expression cassette preferably contains other operably linked sequences, such as a translation enhancer, such as an overdriving sequence containing a 5'untranslated leader sequence from the tobacco mosaic virus that enhances the protein to RNA ratio. (Gallie et al., 1987, Nucl. Acids Research, 15: 8693-87).
11).

Gene expression in plants must be operably linked to a suitable promoter that directs gene expression in a time, cell or tissue specific manner. Preferred are 35S CAMV (Franck et al., Cell, 21 (1980), 2
85-294) or 19S CaMV (see also US Pat. No. 5,352,605 and International Patent Application Publication WO8402913), or a promoter derived from a plant virus, or Ru described in US Pat. No. 4,962,028.
Promoters that cause constitutive expression, such as plant promoters, such as those derived from the bisco small subunit (Benfey et al., EMBO J.
． 8 (1989), 2195 to 2202).

Other preferred sequences used in the functional linkage in plant gene expression cassettes are plant cell vacuoles, nuclei, amyloplasts and plastids of all types such as chloroplasts and chloroplasts, extracellular. Targeting sequences necessary to direct the gene product to its appropriate cellular compartments such as space, mitochondria, endoplasmic reticulum, oil bodies, peroxisomes and other compartments (for a review, see Kermode
Crit. Rev. Plant Sci. 15, 4 (1996), 285-4
23, and references cited therein).

Plant gene expression can also be driven by chemically inducible promoters (for a review, Gatz, 1997, Annu. Rev. Plant).
Physiol. Plant Mol. Biol. , 48: 89-108). Chemically inducible promoters are particularly suitable when it is desired to drive the expression of the gene in a time-dependent manner. Examples of such promoters include salicylic acid-inducible promoters (International Patent Application Publication WO 95/194.
43), the tetracycline-inducible promoter (Gatz et al. (1992), Pla
nt J. 2, 397-404) and an ethanol-inducible promoter (International Patent Application Publication WO93 / 21334).

Suitable promoters are also promoters that respond to biotic or abiotic stress conditions, such as the promoter of the PRP1 gene that can be induced by pathogens (Ward et al., Plant. Mol. Biol. 22 (1993), Three
61-366), a heat-inducible hsp80 promoter derived from tomato (US Pat. No. 5,187,267), a cold-inducible α-amylase promoter derived from potato (International Patent Application Publication WO9612814) or a lesion-inducible pinII promoter (European patent). 375091).

In particular, such promoters are preferred, which result in gene expression in tissues and organs in which the biosynthesis of lipids and oils takes place in seed cells, such as the cells of the endosperm and developing embryos. Suitable promoters are the napine gene promoter from rape (US Pat. No. 5,608,152), broad bean (Vicia faba).
) -Derived USP promoter (Baeumlein et al., Mol. Gen. Gen.
et. 1991, 225 (3): 459-67), Arabidopsis-derived oleosin promoter (International Patent Application Publication WO9844561), common bean (P).
Phaseolus vulgaris-derived phaseolin promoter (US Pat. No. 5,504,200), Brassica-derived Bce4 promoter (International Patent Application Publication WO9113980), or legumin B4 promoter (LeB4; Baemulen et al., 1992, Plant Jour).
nal, 2 (2): 233-9), as well as corn, barley, wheat,
Promoters that provide seed-specific expression in monocots such as rye, rice and the like. A suitable promoter of interest is l from barley.
Promoter of pt2 gene or lpt1 gene (International Patent Application Publication WO95
15389 and WO9523230), or International Patent Application Publication WO99.
16890 promoter (barley hordein gene, rice gluten gene, rice origin gene, rice prolamin gene, wheat gliadin gene, wheat glutelin gene, corn zein gene, oat glutelin gene, sorghum kashirin. Gene, a promoter derived from the rye secalin gene).

Also particularly preferred are promoters that provide plastid-specific gene expression. This is because plastids are the compartments in which the precursors of lipid biosynthesis and some end products are synthesized. Suitable promoters, such as those for viral RNA polymerase, are described in International Patent Application Publication Nos. WO9516783 and WO9706250, and clpP derived from Arabidopsis.
Promoters are described in WO 9946394.

The invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into the expression vector in the antisense orientation. That is, the DNA molecule is
It is operably linked to regulatory sequences in a manner that allows expression (by transcription of a DNA molecule) of an mRNA molecule that is antisense to the LMRP mRNA. Regulatory sequences can be chosen that are operably linked to the cloned nucleic acid in the antisense orientation and direct continuous expression of antisense RNA molecules in a variety of cell types. For example, viral promoters and / or enhancers or regulatory sequences can be chosen that cause constitutive or tissue-specific or cell-type specific expression of antisense RNA. Antisense expression vectors can be in the form of recombinant plasmids, phagemids or attenuated viruses in which antisense nucleic acids are produced under the control of highly efficient regulatory regions. Its activity can be determined by the cell type into which the vector has been introduced. For a discussion of the regulation of gene expression using antisense genes, see Weintraub, H .; Et al., Antisense RNA as a Molecular Tool for Genetic Analysis, Review-Trends in
Genetics, Volume 1 (1), 1986; Mol et al., 1990, FEBS.
See Letters, 268: 427-430.

Another aspect of the present invention relates to a host cell into which the recombinant expression vector of the present invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms indicate not only the particular cell of interest, but also the progeny or potential progeny of such a cell. Such progeny may not be identical to the parental cell in nature, though some modifications may occur in later generations due to either mutational or environmental influences, but herein Are still within the scope of the terms used in. Furthermore, the progeny, seeds or reproductive cell bodies derived from the transformed or recombinant host cells are also included in the scope of the present invention. They can be used to create new cell lines or plants with improved production of fine chemicals by breeding techniques known in the art.

The host cell can be any prokaryotic or eukaryotic cell. For example, LMR
P to C. bacterial cells such as Glutamicum, insect cells, fungal cells or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells), moss, algae, ciliates, plant cells, fungi, or C. glutamicum
Can be expressed in other microorganisms such as Other suitable host cells are known to those of skill in the art.

Vector DNA can be introduced into prokaryotic or eukaryotic cells by conventional transformation or transfection techniques. The terms “transformation” and “transfection”, conjugation and transduction, as used herein, refer to various art-recognized techniques for introducing foreign nucleic acid (eg, DNA) into a host cell. Technology. This includes calcium phosphate coprecipitation or calcium chloride coprecipitation, DEAE dextran mediated transfection, lipofection, natural capacity, chemical mediated transfer or electroporation. Suitable methods for transforming or transfecting host cells, including plant cells, are described by Sambrook et al. (Molecular).
Cloning: A Laboratory Manual, Second Edition, Cold
Spring Harbor Laboratory, Cold Spring
g Harbor Laboratory Press, Cold Spring
g Harbor, NY, 1989) and other laboratory manuals (Metho).
ds in Molecular Biology, 1995, Volume 44, Ag
roberium protocols (editors: Gartland and Davey, Humana Press, Totowa, New Jersey)
) Etc.) can be found.

For stable transfection of mammalian cells, it is known that only a small number of cells can integrate foreign DNA into their genome, depending on the expression vector and transfection technique used. To identify and select for these integrants, a gene encoding a selectable marker (eg, resistance to antibiotics) is generally introduced into the host cell along with the gene of interest. Preferred selectable markers include those that confer resistance to drugs such as G418, hygromycin and methotrexate, or, in plants, those that confer resistance to herbicides such as glyphosate or glufosinate. The nucleic acid encoding the selectable marker can be introduced into the host cell in the same vector as the vector encoding LMRP, or can be introduced in a separate vector. Cells stably transfected with the introduced nucleic acid can be identified, for example, by drug selection (eg, cells containing the selectable marker gene will survive, but other cells will not).

Deletions, additions or substitutions have been introduced to create a microorganism by homologous recombination, whereby the LMRP gene is altered (eg, the LMRP gene is functionally disrupted). A vector containing at least a portion of the gene is prepared. Preferably, the LMRP gene is the Physcomitrella patens LMRP gene, but may be a homologue from the relevant plant,
Alternatively it may be a homologue of mammalian, yeast or insect origin. In a preferred embodiment, the vector is designed such that upon homologous recombination, the endogenous LMRP gene is functionally disrupted (ie, no longer encodes a functional protein). Is also called a knockout vector). Alternatively, upon homologous recombination, the endogenous LMRP gene may be mutated or otherwise altered, but still encode a functional protein (eg, altering upstream regulatory regions). , Thereby the endogenous LM
The vector is designed such that the expression of RP can be altered). To create point mutations by homologous recombination, Cole-Strauss et al., 199.
9, Nucleic Acids Research, 27 (5): 1323-
1330; Kmiec, Gene therapy, 1999, America.
DNA-RNA hybrids known as chimeraplasty known from nScientist, 87 (3): 240-247 can also be used.

On the other hand, in the homologous recombination vector, the altered part of the LMRP gene has exogenous LMRP carried by the vector at its 5 ′ and 3 ′ ends.
Adjacent is an additional nucleic acid of the LMRP gene which causes homologous recombination between the gene and the endogenous LMRP gene in the microorganism or plant. The additional flanking LMRP nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene. Typically, the vector contains flanking DNA of several hundred base pairs to several kilobases (at both the 5'and 3'ends) (eg Thomas, KR for a description of homologous recombination vectors). . And Capecchi, MR.
(1987), Cell, 51: 503; or Streppp et al., 1998, PNAS for cDNA-based recombination in Fiscomitella patens.
, 95 (8): 4368-4373). Vectors are introduced into microbial cells or plant cells (eg by polyethylene glycol mediated DNA) and cells in which the introduced LMRP gene has been homologously recombined with the endogenous LMRP gene are known in the art. Selected using technology.

In another embodiment, recombinant microorganisms can be produced that contain selected systems that allow for regulated expression of the introduced gene. For example, by including the LMRP gene in a vector that puts the gene under the control of the lac operon,
Expression of the MRP gene is only possible in the presence of IPTG. Such regulation systems are well known in the art.

A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (ie, express) LMRP. An alternative method can be applied further in plants by directly transferring DNA to developing flowers by electroporation or Agrobacterium-mediated gene transfer. Therefore, the present invention further provides a method for producing LMRP using the host cell of the present invention. In one embodiment, the method of the invention comprises the steps of: Culturing the host cell of the invention (which has been introduced) in a suitable medium. In another embodiment, the method of the invention further comprises isolating LMRP from the medium or host cells.

C. Isolated LMRP Another aspect of the invention relates to isolated LMRP and biologically active portions thereof. An "isolated" or "purified" protein or biologically active portion thereof is substantially free of cellular material when produced by recombinant DNA technology, or chemically when chemically synthesized. Substantially free of precursors or other chemicals. The expression "substantially free of cellular material" includes preparations of LMRP in which the protein is separated from the cellular components of cells in which the protein is naturally or recombinantly produced. In one embodiment, the expression "substantially free of cellular material" includes less than about 30% (dry weight ratio) of non-LMRP (also referred to herein as "contaminating proteins"). More preferably less than about 20% non-LMRP, and even more preferably less than about 10% non-L.
Included are preparations of LMRPs having MRP, most preferably less than about 5% non-LMRP. When LMRP or a biologically active portion thereof is recombinantly produced, LMRP or a biologically active portion thereof is also preferably substantially free of culture medium. That is, the culture medium is less than about 20% of the volume of the protein preparation, more preferably less than about 10%, and most preferably about 5%.
It is less than%. The expression "substantially free of chemical precursors or other chemicals" includes preparations of LMRP in which the protein is separated from the chemical precursors or other chemicals involved in the synthesis of the protein. . In one embodiment, the phrase “substantially free of chemical precursors or other chemicals” includes about 30
% (Dry weight ratio) of the chemical precursor or non-LMRP chemical, more preferably less than about 20% chemical precursor or non-LMRP chemical, and even more preferably less than about 10%. Having a chemical precursor or non-LMRP chemical of
Most preferably L with less than about 5% chemical precursors or non-LMRP chemicals
Preparations of MRP are included. In a preferred embodiment, the isolated protein or biologically active portion thereof is free of contaminating proteins from the same organism from which LMRP is obtained. Typically, such proteins are found, for example, in plants other than Fiscomitella patens, or in C. glutamic
It is produced by recombinantly expressing LMRP of Fiscomitella patens in microorganisms such as um or ciliates, moss, algae or fungi.

The isolated LMRPs of the invention, or portions thereof, may be involved in the metabolism of compounds required for the assembly of cell membranes in Fiscomitrella patens or the transport of molecules across these membranes, or Table 1. It has one or more of the activities shown in. In a preferred embodiment, the protein or portion thereof retains the ability of the protein or portion thereof to participate in the metabolism of compounds required for the assembly of cell membranes in Fiscomitella patens or the transport of molecules across these membranes. Includes amino acid sequences that are sufficiently homologous to one amino acid sequence in Appendix B. The portion of the protein is preferably a biologically active portion as described herein. In another preferred embodiment, the LMRP of the invention
Has the amino acids shown in Appendix B. In yet another preferred embodiment, the LMRP has an amino acid sequence encoded by a nucleotide sequence that hybridizes to one nucleotide of Appendix A (eg, hybridizes under stringent conditions). In yet another preferred embodiment, the LMRP has at least about 50% to 60% homology to one of the amino acid sequences of Appendix B, preferably at least about 60% to 70%, and more preferably at least about. 70% -80%, 80% -90% or 90%-
95%, and most preferably at least about 96%, 97%, 98%, 9
It has an amino acid sequence encoded by a nucleotide sequence that is 9% or more. Preferred LMRPs of this invention also preferably have at least one of the LMRP activities described herein. For example, the preferred LMR of the present invention
P has an amino acid sequence encoded by a nucleotide sequence that hybridizes to one of the nucleotides in Appendix A (eg, hybridizes under stringent conditions), and the assembly of the cell membrane in Fiscomitrella patentes. May be involved in the metabolism of compounds required for transport or transport of molecules across these membranes, or have one or more of the activities shown in Table 1.

In another embodiment, the LMRP is substantially homologous to one of the amino acid sequences of Appendix B, as detailed in Section I above, and Appendix B
Retains the functional activity of one of the sequences, but differs in amino acid sequence due to natural alterations or mutagenesis. Therefore, in another embodiment, the LMRP
Has at least about 50% to 6 homology to the entire single amino acid sequence of Appendix B.
0%, preferably at least about 60% to 70%, more preferably at least about 70% to 80%, 80% to 90% or 90% to 95%, most preferably at least about 96%, At least one of the LMRP activities described herein and comprising an amino acid sequence that is 97%, 98%, 99% or more.
It is a protein having two types. In another embodiment, the invention pertains to a complete Fiscomitella patens protein that is substantially homologous to the entire single amino acid sequence of Appendix B.

The biologically active portion of LMRP includes an amino acid sequence of LMRP (eg,
A peptide comprising the amino acid sequence derived from the amino acid sequence shown in Appendix B) or the amino acid sequence of a protein homologous to LMRP, wherein the full-length LMR
Included are peptides that contain fewer amino acids than the full length protein that is homologous to P or LMRP and that exhibit at least one activity of LMRP. Typically, a biologically active portion (peptide, eg, 5 amino acids, 10 amino acids, 15 amino acids, 20 amino acids, 30 amino acids, 35 amino acids, 36 amino acids, 37 amino acids, 38 amino acids in length, 39 amino acids, 40 amino acids, 50 amino acids, 100 amino acids or more) are LMRPs
A domain or motif having at least one activity of In addition, other biologically active portions in which other regions of the protein have been deleted are recombinantly prepared and evaluated for one or more of the activities described herein. be able to. Preferably, the biologically active portion of LMRP comprises one or more selected domains / motifs or portions thereof that have biological activity.

LMRPs are preferably produced by recombinant DNA technology. For example, a nucleic acid molecule encoding a protein is cloned into an expression vector (as described above), and the expression vector is introduced into a host cell (as described above), and the LMRP is in the host cell. To be expressed. Then LMRP
Can be isolated from the cells by a suitable purification scheme using standard protein purification techniques. As an alternative to recombinant expression, the LMRP, polypeptide or peptide can be chemically synthesized using standard peptide synthesis techniques. In addition, native LMRPs can be isolated from cells (eg, endothelial cells) using, for example, anti-LMRP antibodies that can be generated by standard techniques utilizing the LMRPs of the invention or fragments thereof. In another embodiment,
Test kits containing the specific anti-LMRP antibodies described above are used to identify and / or further LMRP molecules or fragments thereof in other cell types or organisms.
Or it can be purified.

The present invention also provides chimeric or fusion proteins of LMRP. As used herein, a LMRP "chimeric protein" or "fusion protein" is an LMRP operably linked to a non-LMRP polypeptide.
Contains a polypeptide. "LMRP polypeptide" refers to a polypeptide having an amino acid sequence corresponding to LMRP, whereas "non-LMRP polypeptide"
Refers to a polypeptide having amino acids corresponding to a protein that is not substantially homologous to LMRP (eg, unlike LMRP, a protein derived from the same organism or a different organism). In a fusion protein, the term "operably linked" means that the LMRP and non-LMRP polypeptides are fused together such that both sequences perform the proposed function of belonging to the sequence used. Shall be shown. The non-LMRP polypeptide can be fused to the N-terminus or C-terminus of the LMRP polypeptide. For example, in one embodiment, the fusion protein is a GST-L in which the LMRP sequence is fused to the C-terminus of the GST sequence.
It is an MRP fusion protein. Such fusion proteins can facilitate the purification of recombinant LMRP. In another embodiment, the fusion protein is LMRP containing a heterologous signal sequence at its N-terminus. In certain host cells (eg, mammalian host cells), LMRP expression and / or secretion can be increased by using heterologous signal sequences.

[0120] Preferably, the LMRP chimeric protein or LMRP fusion protein of the invention is produced by standard recombinant DNA techniques. For example, DNA fragments encoding various polypeptide sequences may be labeled according to conventional techniques, eg, blunt or cohesive ends for ligation, restriction enzyme digestion to provide suitable ends, suitable ligation to avoid undesired ligation. The open ends are ligated by using sticky end filling as alkaline phosphatase treatment and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, performing PCR amplification of the gene fragment using an anchor primer that produces a complementary overlap between two consecutive gene fragments, which can subsequently be annealed and reamplified to create a chimeric gene sequence. (For example, Current Protocol
ols in Molecular Biology, eds .: Ausubel et al., John Wiley & Sons, 1992). In addition, many expression vectors are commercially available that already encode a fusion component (eg, a GST polypeptide). Nucleic acid encoding LMRP can be cloned into such an expression vector such that the fusion component is ligated in reading frame to LMRP.

LMRP homologs can be generated by mutagenesis (eg, discontinuous point mutations or truncations of LMRP). The term "homologue" as used herein refers to L acting as an agonist or antagonist of the activity of LMRP.
Refers to a mutant form of MRP. An agonist of LMRP may retain substantially the same activity of LMRP or a portion thereof. Antagonists of LMRPs, for example, by binding competitively to downstream or upstream members of the metabolic cascade of cell membrane components including LMRPs, or to LMRPs that mediate the transport of compounds across such membranes, By causing no translocation, one or more of the naturally occurring forms of activity of LMRP can be inhibited.

In an alternative embodiment, LMRP homologues can be identified by screening combinatorial libraries of variants (eg, truncation variants) of LMRP for LMRP agonist or antagonist activity. In one embodiment, a diverse library of LMRP variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a diverse gene library. A diverse library of LMRP variants may be included, eg, such that a degenerate set of potential LMRP sequences can be expressed as individual polypeptides, or a set of LMRP sequences included therein (eg, for phage display). )) Can be made by enzymatically linking a mixture of synthetic oligonucleotides to a gene sequence so that it can be expressed as a collection of larger fusion proteins. Various methods can be used to generate a library of potential LMRP homologs from degenerate oligonucleotide sequences. Chemical synthesis of degenerate gene sequences can be performed with an automatic DNA synthesizer,
The synthetic gene can then be ligated into an appropriate expression vector. By using a degenerate set of genes, all of the sequences encoding the desired set of potential LMRP sequences can be obtained in one mixture. Methods for synthesizing degenerate oligonucleotides are known in the art (eg, Narang, S.
． A. (1983), Tetrahedron, 39: 3; Itakura et al.
1984), Annu. Rev. Biochem. 53: 323; Itakur.
a et al. (1984), Science, 198: 1056; Ike et al. (1983).
, Nucleic Acid Res. 11: 477).

In addition, a library of fragments of sequences encoding LMRP can be used to generate a diverse population of LMRPs for screening of LMRP homologs and subsequent selection. In one embodiment, the double-stranded PCR fragment of the sequence encoding LMRP is treated with a nuclease under conditions where nicking occurs only at about one site per molecule, and the double-stranded DNA is denatured, Refolding the DNA to form double-stranded DNA that may contain sense / antisense pairs from various nick products, removing the single-stranded portion from the reformed duplex by treatment with S1 nuclease, The resulting fragment library can then be ligated into an expression vector to create a library of coding sequence fragments. By this method it is possible to obtain expression libraries encoding N-terminal, C-terminal and internal fragments of various sizes of LMRP.

Several techniques are used in the art to screen the gene products of combinatorial libraries made by point mutations or truncations, and to screen cDNA libraries for gene products of selected properties. Known for. Such techniques can be adapted for rapid screening of gene libraries generated by combinatorial mutagenesis of LMRP homologs. The most widely used technique for screening large gene libraries, which can be adapted for high-throughput analysis, typically involves cloning the gene library into a replicable expression vector. , Under suitable conditions that transforming the appropriate cells with the resulting vector library and detecting the desired activity facilitates isolation of the gene encoding the gene whose product is detected. It involves expressing a combinatorial gene. Regressive assembly mutagenesis (REM) is a new technique that increases the frequency of functional variants in libraries, which can be used in combination with screening assays to identify LMRP homologs (Arkin. And Yourvan (1992), PNAS, 89: 781.
1-7815; Delgrave et al. (1993), Protein Engine.
eeering, 6 (3): 327-331).

In another embodiment, cell-based assays can be utilized to analyze diverse LMRP libraries using methods well known in the art.

D. Uses and Methods of the Invention The nucleic acid molecules, proteins, protein homologs, fusion proteins, primers, vectors and host cells described herein can be used in one or more of the following methods: Identification of Fiscomitrella patents and related organisms; Mapping of genomes of organisms associated with Fiscomitrella patents; Identification and localization of desired Fiscomitrella patent sequences; Evolutionary research; Necessary for function Of LMRP regions; regulation of LMRP activity; regulation of metabolism of one or more cell membrane components; regulation of membrane transport of one or more compounds; and cell production of desired compounds such as fine chemicals. Adjustment.

The LMRP nucleic acid molecules of the present invention have a variety of uses. First, the LMRP of the present invention
Nucleic acid molecules can be used to identify an organism as being of or closely related to Fiscomitella patens. In addition, the LMRP nucleic acid molecules of the present invention can be used to identify the presence of Fiscomitella patens or an analog thereof in a mixed population of microorganisms. The present invention provides a number of genes for Fiscomitella patens. Therefore, the extracted genomic DNA of a culture of a single population or a mixed population of microorganisms, under stringent conditions, is probed with a region that extends to one region of the gene of the Fiscomitrella patens characteristic of this organism. By probing, it can be confirmed whether this organism is present. Although Fiscomitrella patentes itself has not been used to commercially produce polyunsaturated fatty acids, moss is the only known plant that produces PUFAs. Therefore, DNA sequences related to LMRP are particularly suitable for use for PUFA production in other organisms.

Furthermore, the nucleic acid and protein molecules of the invention can serve as markers for specific regions of the genome. This is not only useful in mapping the genome, but also for functional studies of the proteins of the Fiscomitella patens. For example, in order to identify the region of the genome to which a particular Fiscomitella patens DNA binding protein binds, the Fiscomitella patens genome can be digested and the fragment incubated with the DNA binding protein. You can Fragments that bind to the protein can be further probed with a nucleic acid molecule of the invention, preferably with a label that is easily detectable. By binding such a nucleic acid molecule to a genomic fragment,
The fragments can be localized to the genomic map of Fiscomitella patens and, when performed multiple times with different enzymes, facilitate rapid determination of the nucleic acid sequence to which the protein binds. Furthermore, the nucleic acid molecules of the invention are sufficiently homologous to the sequences of related species such that these nucleic acid molecules can serve as markers for constructing a genomic map in related moss, such as Physcomitrella patens. Can be objective.

The LMRP nucleic acid molecules of the present invention are also useful for evolutionary and protein structural studies. The metabolic and transport processes involving the molecules of the invention are utilized by a wide range of prokaryotic and eukaryotic cells. Therefore,
By comparing the sequences of the nucleic acid molecules of the invention with sequences encoding similar enzymes from other organisms, the evolutionary affinity of these organisms can be assessed. Similarly, such comparisons can evaluate which regions of a sequence are and are not conserved. This can help determine such regions of the protein that are essential for functionalizing the enzyme. This type of determination is useful for protein engineering studies, and proteins
It can provide an indication of what can be tolerated for mutagenesis without loss of function.

By manipulating the LMRP nucleic acid molecules of the invention, LMRPs with functional differences from wild-type LMRPs can be generated. Such proteins may have improved efficiency or activity, or may be present in cells in greater than normal numbers, or may have decreased efficiency or activity.

There are many mechanisms by which changes in the LMRP of the present invention can have a direct effect on the yield, production and / or production efficiency of fine chemicals containing such altered proteins. When cells secrete the desired compound, C.I. because such compounds can be readily purified from the culture medium (as opposed to being extracted from a mass of cultured cells). The recovery of fine chemical compounds from large scale cultures of glutamicum, ciliates, moss, algae or fungi is greatly improved. For plants that express LMRP, increased transport may result in improved partitioning within the tissues or organs of the plant. By increasing either the number or activity of transporter molecules that transport the fine chemical out of the cell, it is possible to increase the amount of fine chemical produced that is present in the extracellular medium, and thus easier Allows for recovery and purification, or more efficient partitioning in the case of plants. Conversely, efficient overproduction of one or more fine chemicals requires increasing amounts of cofactors, precursor molecules and intermediate compounds to the proper biosynthetic pathways. Thus, increasing the number and / or activity of transporter proteins involved in the intracellular transport of nutrients such as carbon sources (ie sugars), nitrogen sources (ie amino acids, ammonium salts), phosphates and sulfur. It may thus be possible to improve the production of fine chemicals by removing any nutrient supply restrictions in the biosynthetic process. In addition, fatty acids and lipids are desirable fine chemicals in their own right,
Therefore, one or more LM of the invention involved in the biosynthesis of these compounds
By optimizing the activity of RP, or increasing its number, or by impairing the activity of one or more LMRPs involved in the degradation of these compounds, moss, algae, plants, fungi, Or C.I. It may be possible to increase the yield, production and / or production efficiency of fatty acid and lipid molecules in other microorganisms such as glutamicum.

Manipulation of one or more LMRP genes of the present invention may also include moss, algae, plants, ciliates or fungi, or C.I. It can lead to LMRPs with altered activity that have an indirect effect on producing one or more desired fine chemicals from other microorganisms such as Glutamicum. For example, the normal biochemical processes of metabolism result in the production of various unwanted products (eg, hydrogen peroxide and other reactive oxygen species) that can severely interfere with these same metabolic processes (eg, peroxysuboxides). Nitrate is known to nitrate the side chain of tyrosine, thereby inactivating some enzymes with tyrosine in the active site (Groves, JT (1999) Curr. Opin. Chem.
Biol. 3 (2): 226-235). Although these waste products are typically excreted, the cells utilized for large-scale production by fermentation have been optimized to overproduce one or more fine chemicals, Therefore, it may produce more waste product than is typical for wild type cells. By optimizing the activity of one or more LMRPs of the invention involved in extracellular transport of waste molecules, cell viability can be improved and efficient metabolic activity maintained. Can be possible. Also, the presence of large amounts of the desired fine chemicals in cells can actually be toxic to cells, thus increasing the ability of cells to secrete these compounds, thereby increasing their viability. Can be improved.

Further, the LMRPs of the present invention can be engineered to vary the relative amounts of various lipid and fatty acid molecules produced. This can have a profound effect on the lipid composition of the cell's membrane. Because each type of lipid has different physical properties, changes in the lipid composition of the membrane can significantly change the fluidity of the membrane. Changes in membrane fluidity can affect the transport of molecules across the membrane. This may alter the extracellular transport of unwanted products or produced fine chemicals or intracellular transport of required nutrients, as previously described. Such changes in membrane fluidity can also have a significant impact on cell integrity. Cells with relatively weaker membranes are more susceptible to damage from abiotic and biotic stress conditions that can damage or kill the cells. LMRP involved in the production of fatty acids and lipids necessary for membrane construction so that the resulting membrane has a membrane composition that is more amenable to the degree of environmental conditions in culture utilized to produce fine chemicals By manipulating, a larger proportion of cells should survive and proliferate. Increasing the number of producer cells should significantly change the yield, production or production efficiency of fine chemicals from culture.

The mutagenesis methods described above for LMRPs to increase fine chemical yields are not meant to be limiting. Therefore, various changes to these methods will be readily apparent to those skilled in the art. Using such methods, and by incorporating the mechanisms disclosed herein, the nucleic acid and protein molecules of the invention have improved yield, production and / or efficiency of production of desired compounds. , Algae expressing mutated LMRP nucleic acid and protein molecules,
Ciliates, plants, fungi, or C.I. It can be used to make microorganisms such as Glutamicum. This desired compound includes moss, ciliates, plants, fungi or C.I. Any natural product of Glutamicum may be mentioned, including the end products of biosynthetic pathways and intermediates of naturally occurring metabolic pathways, as well as those that are not naturally present in the metabolism of said cell, Included are molecules produced by the cell.

The present invention is further illustrated by the following examples, which should not be construed as limiting. The contents of all references, patent applications, patents and published patent applications cited herein are hereby incorporated by reference.

Examples Example 1 General Process a) General Cloning Process: Cloning process (eg, restriction digestion, agarose gel electrophoresis, DNA).
Purification of fragments, transcription of nucleic acids to nitrocellulose or nylon membranes, ligation of DNA fragments, transformation of E. coli cells and yeast cells, bacterial growth, and sequence analysis of recombinant DNA, Sambrook et al. (1989). (Cold Spring Harbor Laboratory
Press: ISBN 0-87969-309-6) or Kaiser, M
ichaelis and Mitchell (1994), "Methods i.
n Yeast Genetics "(Cold Spring Harbor
Laboratory Press: ISBN0-87969-451-3)
Was performed as described in. Transformation and culture: 21 algae such as Chlorella or Phaeodactylum were treated with El-Sheek.
h (1999), Biologa Plantarum, 42: 209-21.
6; Apt et al. (1996), Molecular and General G.
Transforming as described by Enetics, 252 (2): 872-9.

B) Chemicals: The chemicals used were Fluka (N) unless otherwise stated in the text.
eu-Ulm), Merck (Darmstadt), Roth (Karlsr)
ule), Serva (Heidelberg) and Sigma (Deise)
purchased from each company (nhofen). The solution, water purifier of Mili-Q water system (Millipore, Eschborn) obtained from (in the following denoted as _{H 2} O) purified water containing no pyrogen was prepared using. Restriction endonucleases, DNA modifying enzymes and molecular biology kits are available from AGS (Heidelberg), Amersham (Braunschwe).
ig), Biometra (Gottingen), Boehringer M
Annheim (Mannheim), Genomed (Bad Oeynnh
ausen), New England Biolabs (Schwalbac)
h / Taunus), Novagen (Madison, Wisconsin,
USA), Perkin-Elmer (Weiterstadt), Pharma
cia (Freiburg), Qiagen (Hilden) and Strat
It was obtained from each company of agene (Amsterdam, The Netherlands). They were used according to manufacturer's instructions unless otherwise noted.

C) Plant material: For this work, the species Fiscomitella patens (Hedw.) B. S. G. Used plants. The plant is H. L. K. Whitehouse (Gransden Wood
16/14 collected by Huntingdonshire, United Kingdom)
Derived from Engel (1968, Am J Bot, 55, 438-446).
By spores. Plant growth was performed by spores and by gametophyte regeneration. Protozoa were developed from haploid spores as high chloroplast and low chloroplast chloronemas and buds formed after about 12 days. These were grown to give rise to gametophores with spermatozoa and ovipositors. After fertilization, diploid sporophytes with short bristles and spore capsules, in which the reduced spores matured, resulted.

D) Plant growth: Culturing was carried out in a meteorological laboratory at an air temperature of 25 ° C. and a light intensity of 55 micromol-lm-2 (white light; Philips TL65W / 25 fluorescent lamp) and a 16/8 hour light-dark change. I went to. Moss, Reski and Abel (1985, P
Lanta, 165, 354-358), modified with liquid medium using Knop medium, or 1% Oxoid agar (Unipath, Basing).
Cultured in Knop solid medium using Stoke, UK). RNA and DN
The protozoa used to isolate A were cultured in aerated liquid culture. 9 threads
Every day, it was crushed and transferred to a new culture medium.

Example 2 Isolation of Total DNA from Plants Details for isolating total DNA relate to treating 1 gram fresh weight of plant material. CTAB buffer: 2% (w / v) N-cetyl-N, N, N-trimethylammonium bromide (CTAB); 100 mM TrisHCl, pH 8.
． 0; 1.4 M NaCl; 20 mM EDTA. N-lauryl sarcosine buffer: 10% (w / v) N-lauryl sarcosine; 100 mM TrisHCl,
pH 8.0; 20 mM EDTA.

The plant material was ground in a mortar under liquid nitrogen to a fine powder and transferred to a 2 ml Eppendorf container. Thereafter, 1 ml of the decomposition plant solution (1 m
l CTAB, 100 ml N-lauryl sarcosine buffer, 20 ml β-mercaptoethanol and 10 ml proteinase K solution (10 mg / ml)
), And incubated at 60 ° C. for 1 hour with continuous shaking. The resulting homogenate was divided into two Eppendorf vessels (2 ml) and extracted twice by shaking with the same volume of chloroform / isoamyl alcohol (24: 1). For phase separation, centrifugation was carried out for 15 minutes at 8000 × g and RT for each. The DNA was then precipitated for 30 minutes at 70 ° C. using ice-cold isopropanol. Precipitated DNA at 4 ° C and 10,000
g for 30 minutes and 180 ml TE buffer (Sambrook et al.,
1989, Cold Spring Harbor Laboratory P
res: ISBN 0-87969-309-6). For further purification, the DNA was treated with NaCl (final concentration: 1.2M) and reprecipitated with 2 volumes of absolute alcohol for 30 minutes at 70 ° C. After a washing step with 70% ethanol, the DNA is dried and then 50 ml H ₂ O + RNAse.
(Final concentration: 50 mg / ml). The DNA was dissolved overnight at 4 ° C, followed by RNAse digestion at 37 ° C for 1 hour. DNA storage was performed at 4 ° C.

[0142]   Example 3   Total RNA and poly (A) from plants⁺RNA isolation   To examine transcripts, total RNA and poly (A)⁺Both RNAs were isolated
. Total RNA was extracted from wild-type day 9 protofilament by the GTC method (Reski et al., 1994,
Mol. Gen. Genet. 244: 352-359). Poly
A⁺RNA isolation is according to the manufacturer's protocol instructions Dyna Beads ^R (Dynal, Oslo, Finland). Total RNA
Is poly (A)⁺After measuring the RNA concentration, RNA was added to 1/10 volume of 3M acetic acid.
Precipitation by adding sodium (pH 4.6) and 2 volumes of ethanol
And stored at 70 ° C.

Example 4 Construction of a cDNA Library To construct a cDNA library, first strand synthesis was performed by murine leukemia virus reverse transcriptase (Roche, Mannheim, Germany) and oligo d (T).
) Achieved using a primer, second strand synthesis was incubated with DNA polymerase I (Klenow enzyme) and at 12 ° C. (2 hours), 16 ° C. (1 hour) and 22 ° C. (1 hour). Achieved by RNAse H digestion. The reaction is 6
It was stopped by incubation at 5 ° C. (10 minutes) and subsequently transferred to ice. Double-stranded DNA molecules are transferred to T4 DNA polymerase (Roche, Mannh
smoothed by eim) at 37 ° C. (30 minutes). Nucleotides were removed by phenol / chloroform extraction and Sephadex G50 spin column. EcoRI Adapter (Pharmacia, Freiburg, Germany)
Was ligated to both ends of the cDNA by T4 DNA ligase (Roche, 12 ° C, overnight), and polynucleotide kinase (Roche, 37 ° C, 30 minutes)
Phosphorylated by incubation with. This mixture was subjected to separation on a low melting point agarose gel. DNA molecules larger than 300 base pairs were eluted from the gel, phenol extracted and Elutip-D column (Schleicher an.
d Schuell, Dassel, Germany), ligated to vector arms, and used manufacturer's material and Lambda ZAPII using Gigapak Gold kit (Stratagene, Amsterdam, Netherlands) according to manufacturer's instructions. Packaged in phage or lambda ZAP-Express phage.

Example 5 Identification of Genes of Interest Gene sequences can be used to identify homologous or heterologous genes from cDNA or genomic libraries. Homologous genes (eg, full-length cDNA clones) can be isolated by nucleic acid hybridization using, for example, a cDNA library. Depending on the abundance of the gene of interest, 100,000 to 1,000,000 recombinant bacteriophages are deposited and transferred to nylon membranes. After denaturing with alkali, the DNA is immobilized on the membrane, for example by UV crosslinking.
Hybridization is performed under conditions of high stringency. In aqueous solution, hybridization and washing are carried out at an ionic strength of 1 M NaCl and a temperature of 68 ° C. Hybridization probes are made, for example, by radioactive ( ³² P) nick transcription labeling (High Prime).
Roche, Mannheim, Germany). The signal is detected by autoradiography.

Identifying related but non-identical partially homologous or heterologous genes using low stringency hybridization and wash conditions, similar to the procedure described above. You can In the case of an aqueous hybridization solution, the ionic strength is usually kept at 1M NaCl, but the temperature is gradually lowered from 68 ° C to 42 ° C.

Isolation of genes that are homologous only in distinct domains (eg, 10-20 amino acids) can be performed using radiolabeled synthetic oligonucleotide probes. Radiolabeled oligonucleotides are prepared by phosphorylating the 5'prime ends of two complementary oligonucleotides with T4 polynucleotide kinase. Complementary oligonucleotides are annealed and ligated to obtain concatemers. The double-stranded concatemer is then radiolabeled, eg by nick transcription. Hybridizations are usually performed at low stringency conditions using large oligonucleotide concentrations.

Oligonucleotide hybridization solution: 6xSSC; 0.01 M sodium phosphate; 1 mM EDTA (pH 8); 0
． 5% SDS; 100 μg / ml denatured salmon sperm DNA; 0.1% nonfat dried milk.

Upon hybridization, the temperature is the T of the putative oligonucleotide.
The temperature is gradually lowered to 5 ° C. to 10 ° C. lower than m or room temperature, followed by a washing step and autoradiography. Washing is done thoroughly with low stringency, such as three washing steps using 4xSSC. For further details, see Sambrook, J. et al. Et al. (1989), "Molecular Cl
oning: A Laboratory Manual "(Cold Spri
ng Harbor Laboratory Press) or Ausube
1, F.I. M. (1994), "Current Protocols in
"Molecular Biology" (John Wiley & Sons).

Example 6 Isolation of Genes of Interest by Screening Expression Libraries with Antibodies The cDNA sequences can be used, for example, to produce recombinant proteins in E. coli (eg, QIAgen's QIAexpress pQ).
E system). The recombinant protein is then affinity purified, usually by Ni-NTA affinity chromatography (Qiagen). The recombinant protein can then be used to raise specific antibodies, eg, by using standard techniques to immunize rabbits.
Antibodies are described by Gu et al. (1994), BioTechniques, 17: 257-2.
Affinity purified using Ni-NTA column saturated with recombinant antigen as described by 62. The antibody can then be used to screen an expressed cDNA library by immunological screening to identify homologous or heterologous genes (Sambrook, J.
． Et al. (1989), Molecular Cloning: A Laborat.
ory Manual (Cold Spring Harbor Labora)
tory Press) or Ausubel, F.M. M. Et al. (1994), "C
current Protocols in Molecular Biolog
y ”(John Wiley & Sons).

Example 7 Northern Hybridization For RNA hybridization, 20 mg of total RNA or 1 mg of poly (A) ⁺ RNA was added to Amasino (1986, Anal. Biochem).
． 152, 304) using formaldehyde as described in 1.25%
Separation by gel electrophoresis on a concentrated agarose gel and positively charged nylon membrane (Hybond N +) by capillary aspiration using 10xSSC.
, Amersham, Braunschweig) and immobilized with UV light,
And hybridization buffer (10% dextran sulfate (w / v), 1
68 ° C. using M NaCl, 1% SDS, 100 mg herring sperm DNA)
Prehybridization for 3 hours. Labeling of the DNA probe with the Highprime DNA labeling kit (Roche, Mannheim, Germany) was performed using α- ³² P-dCTP (Amersham, Braunschweig,
(Germany) during prehybridization. Hybridization was performed at 68 ° C. overnight in the same buffer after adding the labeled DNA probe. The washing steps were performed at 68 ° C. twice with 2 × SSC for 15 minutes and twice with 1 × SSC, 1% SDS for 30 minutes. The sealed filter was exposed to light at -70 ° C for 1 to 14 days.

Example 8 DNA Sequencing The cDNA library described in Example 4 was isolated from the DNA according to standard methods.
For sequencing, in particular, ABI PRISM Big Dye Termin
attor Cycle Sequencing Ready Reaction
It was used for DNA sequencing by chain termination method using the kit (Perkin-Elmer, Weiterstadt, Germany). Random sequencing, bulk excision in vivo, and DH101 on agar plates
Preparative plasmid recovery from a cDNA library by retransformation of B was performed (materials and protocol details from Stratagene (Amsterdam, The Netherlands)). The plasmid DNA was treated with Luria-Broth medium (Sambrook, J. et al. (Cold Spri) containing ampicillin.
ng Harbor Laboratory Press: ISBN0-879
69-309-6)), and from a culture of E. coli grown overnight, according to the manufacturer's protocol, a Qiagene DNA preparation robot (Qiagene).
, Hilden). A sequencing primer having the following nucleotide sequence was used: 5'-CAGGAAACAGCTATGACC-3 '5'-CTAAAGGGGAACAAAAAGCTG-3'5'-TGTAAAACGACGCGCCAGT-3'.

Example 9 Plasmids for transforming plants Binary vectors such as pBinAR can be used to transform plants (Hofgen and Willmitzer, Plant Sc).
ience, 66 (1990), 221-230). Construction of a binary vector can be done by joining the cDNA to T-DNA in the sense or antisense orientation. A plant promoter at the 5'-prime end of the cDNA activates transcription of the cDNA. Polyadenylation sequence of cDNA 3
'-Present at the prime end.

Tissue-specific expression can be achieved by using a tissue-specific promoter. For example, seed-specific expression can be achieved using napine or phaseolin,
This can be accomplished by cloning the DC3, LeB4 or USP promoters at the 5-prime end of the cDNA. Also, any other seed-specific promoter element can be used. The CaMV35S promoter can be used for constitutive expression throughout the plant. The expressed protein can be directed to the cell compartment using signal peptides for plastids, mitochondria or the endoplasmic reticulum, for example (Kermode,
Crit. Rev. Plant Sci. 15, 4 (1996), 285-42
3). The signal peptide is responsible for the intracellular localization of the fusion protein,
It is cloned into the 5'-prime end in frame with the cDNA.

Example 10 Transformation of Agrobacterium Transformation of plants mediated by Agrobacterium is described, for example, in GV31.
01 (pMP90) (Koncz and Schell, Mol. Gen. Gen.
et. 204 (1986), 383-396) or LBA4404 (Clon).
tech) Agrobacterium tumefaciens strain. Transformation can be done by standard transformation techniques (Debla
ere et al., Nucl. Acids. Tes. 13 (1984), 4777-47.
88).

Example 11 Plant Transformation Agrobacterium-mediated plant transformation can be performed using standard transformation and regeneration techniques (Gelvin, Stanto).
n B. Schillperroot, Robert A .; , Plant Mol
electrical Biology Manual, 2nd edition (Dordrecht:
Kluwer Academic Publ. , 1995), Section: Ringbu
c ZentraSignature: BT11-P ISBN0-792
3-2731-4; Glick, Bernard R .; Thompson, J
ohn E. , Methods in Plant Molecular Bi
Biology and Biology: C
RC Press, 1993, 360S, ISBN 0-8493-5164-2
).

For example, canola can be transformed by transformation of cotyledons or hypocotyls (Moloney et al., Plant Cell Report, 8 (1989).
) 238-242; De Block et al., Plant Physiol. 91
(1989), 694-701). The use of antibiotics for Agrobacterium and plant selection depends on the binary vector and Agrobacterium strain used for transformation. Selection of rape is usually carried out using kanamycin as a selectable marker for plants.

Agrobacterium-mediated gene transfer to flax is described in, for example, Mlynaro.
va et al. (1994), Plant Cell Report, 13: 282-2.
This can be done using the technique described by 85.

Transformation of soybeans has been described, for example, in EP 0424047, US Pat. No. 3227.
83 (Pioneer Hi-Bred International), or European Patent 0397687, US Pat. No. 5,376,543, US Pat. No. 51.
This can be done using the technique described in No. 69770 (University of Toledo).

Transformation of plants using particle bombardment, polyethylene glycol mediated DNA uptake, or plant transformation with silicon carbide fiber technology has been described, for example, in Fr.
eeling and Walbot, “The maime handbook”
, (1993) (ISBN3-540-97826-7, Springer V.
erlag New York).

Example 12 In Vivo Mutagenesis Escherichia coli or other microorganisms (eg Bacillus spp. Or yeast (such as Saccharomyces cerevisiae, etc.) in which the in vivo mutagenesis is impaired in their ability to maintain the integrity of their genetic information. )) Via plasmid (or other vector) DNA. Typical mutant strains have mutations in the genes of the DNA repair system (eg, mutHLS
, MutD, mutT, etc .; for reference, see Rupp, W .; D. (1996)
, DNA repair mechanism, Escherichia coli and Salmon
ella, pp. 2277-2294, ASM: Washington)). Such strains are well known to those of skill in the art. The use of such strains is described, for example, in Greener, A .; And Callahan, M .; (1994)
, Strategies, 7: 32-34. Mutated DNA
Transferring the molecule to the plant preferably takes place after selection and testing in microorganisms. Transgenic plants are produced according to various examples included in the examples herein.

Example 13 DNA Transfer between Escherichia coli and Corynebacterium glutamicum Several species of Corynebacterium and Brevibacterium are capable of autonomous replication of endogenous plasmids (eg pHM1519 or pBL1). (See for example Martin, JF et al. (1)
987), Biotechnology, 5: 137-146).
Shuttle vectors for E. coli and Corynebacterium glutamicum,
It can be easily constructed by using a standard vector for E. coli with an origin of replication for Corynebacterium glutamicum and a suitable marker from Corynebacterium glutamicum added (Sambrook.
k, J. Et al. (1989), "Molecular Cloning: A Lab.
“Oratory Manual”, Cold Spring Harbor L
Laboratory Press, or Ausubel, F .; M. Et al (199
4), "Current Protocols in Molecular B
"Iology", John Wiley & Sons). Such an origin of replication is
It is preferably obtained from an endogenous plasmid isolated from Corynebacterium and Brevibacterium species. Markers that are particularly useful as transformation markers for these species are the kanamycin resistance gene (such as the kanamycin resistance gene derived from the Tn5 or Tn903 transposon) or the chloramphenicol resistance gene (Winnacker, EL (1987). , From
Genes to Clones Induction to Gene
Technology, VCH, Weinheim). E. coli and C.I. gl
There are numerous examples in the literature that construct a wide range of shuttle vectors that replicate in both Utamicum and can be used for several purposes, including overexpression of genes (for reference, see, for example, Yoshihama, M. et al. (19
85), J. Bacteriol. 162: 591-597; Martin, J.
． F. Et al. (1987), Biotechnology, 5: 137-146; E.
ikmanns, B. J. (1991) Gene 102: 93-98).

Cloning the gene of interest into one of the shuttle vectors described above using standard techniques to introduce such a hybrid vector into various strains of Corynebacterium glutamicum. Is possible. C. glutam
The transformation of icum was performed by protoplast transformation (Katsumata, R. et al. (1984), J. Bacteriol. 159306-311), electroporation (Liebl, E. et al. (1989), FEMS Microbio.
l. Lettes, 53: 399-303), and when a special vector is used (eg, Schafer, A. et al.
1990), J. Bacteriol. 172: 1663-1666) as well. C. C. glutamicum was used to prepare plasmid DNA (using standard methods well known in the art) and transforming it into E. coli. glutamicum
Can be transferred to E. coli. This transformation step can be performed using standard methods, but it is convenient to use an Mcr deficient E. coli strain such as NM522 (Gough & Murray (1983), J.
． Mol. Biol. 166: 1-19).

Example 14 Evaluation of Recombinant Gene Product Expression in Transformed Organisms The activity of recombinant gene products in transformed host organisms has been investigated at the transcriptional and / or translational level. A useful method for confirming the transcription level of a gene (an indicator of the amount of mRNA available for translation of a gene product) is a Northern blot (for reference, see, eg, Ausubel et al. (1988), Curre.
nt Protocols in Molecular Biology, Wi
ley: New York). In this case, the primer designed to bind to the gene of interest is labeled with a (usually radioactive or chemiluminescent) detectable label, so that the total R of the organism's culture is
When NA was extracted, run on a gel, transferred to a stable matrix, and incubated with the probe, the binding and amount of probe indicated the presence of and also the amount of mRNA for this gene. This information reveals the extent of transcription of the transformed gene. Total cellular RNA
To Bormann, E .; R. (1992), Mol. Microbiol. 6
: 317-326, all of which are well known in the art, and can be prepared from cells, tissues or organs.

Standard techniques such as Western blotting can be used to assess the presence or relative amount of protein translated from this mRNA (eg,
Ausubel et al. (1988), Current Protocols in
See Molecular Biology, Wiley: New York). In this method, total cellular proteins are extracted, separated by gel electrophoresis, transferred to a matrix such as nitrocellulose, and incubated with a probe (such as an antibody) that specifically binds to the desired protein. Such probes are generally labeled with a chemiluminescent or colorimetric label that can be easily detected. The presence and amount of label observed indicates the presence and amount of the desired mutant protein present in the cell.

Example 15 Growth of Genetically Modified Corynebacterium glutamicum Medium and Culture Conditions Genetically modified Corynebacterium is cultured in synthetic or natural growth medium. Many different growth media for Corynebacterium are well known and are also readily available (Lieb et al. (1989),
Appl. Microbiol. Biotechnol. , 32: 205-21
0; von der Osten et al. (1998), Biotechnology.
Letters, 11: 11-16; German Patent DE 4,120,867;
Lieb (1992), "Corynebacterium", The Procaryo.
tes, Volume II, Balows, A .; Et al., Springer-Verlag
). These media consist of one or more carbon sources, nitrogen sources, inorganic salts, vitamins and trace elements. Preferred carbon sources are sugars such as monosaccharides, disaccharides or polysaccharides. For example, glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose serve as very good carbon sources. It is also possible to supply sugar to the medium with complex compounds such as molasses or other by-products obtained from sugar refining. It may also be convenient to supply a mixture of different carbon sources. Other possible carbon sources are alcohols and organic acids, such as methanol, ethanol, acetic acid or lactic acid. The nitrogen source is usually an organic or inorganic nitrogen compound or a substance containing these compounds. Exemplary nitrogen sources include ammonia gas or ammonia salt (NH ₄ Cl or (NH ₄ ) ₂ S
Etc. O _4), NH 4 _OH, nitrates, urea, amino acids or complex nitrogen source (corn steep liquor, soy flour, soy protein, yeast extract, meat extract, etc.).

Inorganic salt compounds that may be included in the medium include calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron chloride salts,
Includes phosphates or sulfates. Chelating compounds can be added to the medium to keep the metal ions in solution. Particularly useful chelating compounds include dihydroxyphenols such as catechol or protocatechuate, or organic acids such as citric acid. It is also typical of the medium to contain other growth factors such as vitamins or growth promoting factors. Examples thereof include biotin, riboflavin, thiamine, folic acid, nicotinic acid, pantothenic acid and pyridoxine. Growth factors and salts are often derived from complex media components such as yeast extract, molasses and corn steep liquor. The exact composition of these media compounds depends strongly on direct experimentation and is individually determined for each specific case. For information on optimizing media, read the book "Applied Microbi
ol. Physiology, A Practical Approach "(
Editor: P. M. Rhodes, P. F. Stanbury, IRL Press
(1997), pp. 53-73, ISBN 0-19-963577-3). It is also possible to select a growth medium obtained from a commercial supplier, such as Standard 1 (Merck) or BHI (Grainhart Exudate, DIFC).

All medium components are sterilized either by heating (20 min at 1.5 bar and 121 ° C.) or sterile filtration. The components can be sterilized together or, if necessary, separately. All media components can be present at the beginning of growth or can be added continuously or batchwise as needed.

Culture conditions are defined separately for each experiment. Temperature is 15 ℃ ~ 45
Must be in the range of ° C. The temperature can be kept constant or can be varied during the course of the experiment. The pH of the medium must be in the range 5-8.5 (preferably about 7) and can be maintained by adding a buffer to the medium. Exemplary buffering agents for this purpose include potassium phosphate buffer. Synthetic buffers such as MOPS, HEPES, ACES and others may be used instead or simultaneously. It is also possible to maintain a constant culture pH through the addition of NaOH or _NH 4 OH during growth. When complex media components such as yeast extract are utilized, the need for additional buffering agents may be reduced due to the fact that many complex compounds have large buffering capacity. When the fermentor is used to culture microorganisms, the pH can also be controlled using gaseous ammonia.

Incubation times usually range from hours to days. This time can be selected to allow the maximum amount of product to accumulate in the culture. The disclosed growth experiments can be performed in a variety of vessels such as microtiter plates of various sizes, crow tubes, glass flasks, or glass or metal fermenters. When screening a large number of clones, microorganisms should be cultured in microtiter plates, glass tubes or shake flasks (either baffled or unbaffled). Preferably, 100 ml shake flasks are used filled with 10% (volume ratio) of the required growth medium. The flask should be shaken on a rotary shaker (amplitude: 25 mm) using a speed range of 100 rpm to 300 rpm. Evaporation loss can be reduced by maintaining a moist atmosphere, or a mathematical correction for evaporation loss should be made.

When genetically modified clones are tested, unmodified control clones or control clones containing the basic plasmid without any inserts should also be used. The medium was CM plates (10 g / l glucose, 2.5 g / l NaCl, 2 g
g / l urea, 10 g / l polypeptone, 5 g / l yeast extract, 5 g / l meat extract, 22 g / l NaCl, 2 g / l urea, 10 g / l polypeptone, 5 g / l Yeast extract, 5 g / l meat extract, 22 g / l agar, 2M Na
0.5-1.5 using cells grown on agar plates such as OH, pH 6.8)
OD ₆₀₀ of. The medium was inoculated from the CM plate to C. glutamic
This is done either by introducing a saline suspension of um cells or by adding a liquid preculture of this bacterium.

Example 16 In vitro analysis of the function of the Fiscomitrella patens gene in transgenic organisms The measurement of enzyme activity and kinetic parameters is well established in the art. Experiments measuring the activity of any given altered enzyme must be matched to the specific activity of the wild-type enzyme, which is well within the ability of one of ordinary skill in the art. A general overview of enzymes, as well as structures for measuring the activity of many enzymes,
Specific details regarding kinetics, principles, methods, applications and examples can be found in, for example, the following references: Dixon, M .; And Webb, E .; C. (1
979), Enzymes, Longmans; London; Fersht (
1985), Enzyme Structure and Mechanism.
, Freeman: New York; Walsh (1979), Enzyma.
tic Reaction Mechanisms, Freeman: San
Francesco; Price, N .; C. Stevens, L .; (1982
), Fundamentals of Enzymology, Oxford
Univ. Press: Oxford; Boyer, P.M. D. Hen (1983),
The Enzymes, 3rd Edition, Academic Press: New Y
ork; Bisswanger, H .; (1994), Enzymkinetik.
, Second Edition, VCH: Weinheim (ISBN 3527300325); Be.
rgmeyer, H .; U. Bergmeyer, J .; Graβl, M .; Hen (
1983-1986), Methods of Enzymatic Anal.
ysis, 3rd Edition, Volumes I-XII, Verlag Chemie: Weinh
eim; Ullmann's Encyclopedia of Indust
Rial Chemistry (1987), Volume A9, Enzymes, VCH
: Weinheim, pp. 353-362.

The activity of proteins that bind DNA can be measured by a number of well-established methods, such as the DNA band shift assay (also called gel retardation assay). The effect of such proteins on the expression of other molecules (Kolm
er, H.E. (1995), EMBO J. et al. 14: 3895-1904 and reporter gene assays (such as those described in the references cited therein). Reporter gene test systems are well known and have been established for application in both prokaryotic and eukaryotic cells using enzymes such as β-galactosidase, green fluorescent protein and others.

Measurement of activity of membrane transport proteins was performed according to Gennis, R .; B. (1989), Pores, Channels and Transporters, Biomembranes, Molecular.
Structure and Function, Springer: Heid
elberg, pages 85-137, 199-234 and 270-322.
This can be done according to the techniques such as those described on the page.

Example 17 Analysis of Effect of Recombinant Protein on Production of Desired Product Plant, C.I. Glutamicum, fungi, moss, algae, ciliates, or the effect on the production of a desired compound (such as fatty acids), modified microorganisms or plants suitable conditions (such as those described above) Can be evaluated by assaying the medium and / or cellular components for increased production of the desired product (ie, lipid or fatty acid). Such analytical techniques are well known to those skilled in the art and include spectroscopy, thin layer chromatography, various types of staining methods, enzymatic and microbiological methods, and high performance liquid chromatography. Analytical chromatography such as (eg, Ullman, Encyclopedia of lndust.
Rial Chemistry, Volume A2, pages 89-90 and 443-61.
PCH 3, VCH: Weinheim (1985); Fallon, A .; La (198
7), Application of HPLC in biochemistry, Laboratory Technology
ues in Biochemistry and Molecular Bi
Biology, Vol. 17; Rehm et al. (1993), Biotechnology.
Vol. 3, Chapter III: Product Recovery and Purification, pp. 469-714, VCH:
Weinheim; Belter, P .; A. Et al. (1988), Biosepar.
ations: downstream processing for bio
technology, John Wiley and Sons; Kenne
dy, J.D. F. And Cabral, J .; M. S. (1992), Recover
ry processes for biological material
S. John Wiley and Sons; Shaeiwitz, J .; A.
And Henry, J. et al. D. (1988), Biochemical Separation, Ulmann's,
Encyclopedia of Industrial Chemistry
, B3, Chapter 11, pp. 1-27, VCH: Weinheim; Dechow,
F. J. (1989), Separation and purificati
on technologies in biotechnology, Noyes
Publications).

In addition to the methods described above, plant lipids are described by Cahoon et al. (1999).
, PNAS, 96 (22): 12935-12940 and Browse et al. (1
986), Analytical Biochemistry, 152: 141.
~ 145 extracted from plant material. Qualitative and quantitative analyzes of lipids or fatty acids are described below: Christie,
William W. , Advances in Lipid Method
logy, Ayr / Scotland: Oily Press (Oil Pr
ess Lipid Library; 2); Christie, William
m W. , Gas Chromatography and Lipids. A
Practical Guide-Ayr, Scotland: Oily P
ress, 1989 (reprint: 1992) -IX, 307S. -(Oily P
"less Lipid Library; 1);" Progress in L
"ipid Research", Oxford: Pargamon Press
1 (1952) to 16 (1977) u. d. T. : Progress in
the Chemistry of Fats and other Lipi
ds CODEN.

In addition to measuring the end product of fermentation, other components of the metabolic pathway (such as intermediates and byproducts) utilized in the production of the desired compound are analyzed to determine the overall compound It is also possible to determine the production efficiency. Analytical methods include measuring nutrient levels in the medium (eg, sugars, hydrocarbons, nitrogen sources, phosphates and other ions),
Includes measurement of biomass composition and analysis of the production of common metabolites in the biosynthetic pathway, and measurement of gas produced during fermentation. The standard method for these measurements is the Applied Microbiological Physiology, A Pra.
optical Approach, P.C. M. Rhodes and P.M. F. Sta
nbury, IRL Press, pages 103-129, 131-163 and 165-192 (ISBN: 0199635773), and the references cited therein.

One example is the analysis of fatty acids (abbreviation: FAME, fatty acid methyl ester; GC-MS, gas-liquid chromatography-mass spectrometry; TAG, triacylglycerol; TLC, thin layer chromatography).

Unambiguous evidence for the presence of fatty acid products is provided by Christie and references therein (1997, Advances in Lipid Meth).
odology-Fours edition: Christie, Oily Press, D
undee, 119-169; 1998, method by gas-liquid chromatography-mass spectrometry, Lipids, 33: 343-353) according to standard analytical procedures (GC, GC-MS or TLC). It can be obtained by analyzing the recombinant organism.

The material to be analyzed was sonicated, glass milled, liquid nitrogen and milled.
Alternatively, it can be resolved by other applicable methods. The material must be centrifuged after disintegration. The precipitate is resuspended in water (Aqua dest),
Heated at 100 ° C for 10 minutes, cooled with ice, and centrifuged again,
It is then extracted with 0.5M sulfuric acid in methanol containing 2% dimethoxypropane for 1 hour at 90 ° C., which leads to hydrolyzed oil and fat compounds, which results in transmethylated lipids. These fatty acid methyl esters were extracted into petroleum ether and finally into a capillary column (Chr with a temperature gradient of 170 ° C. to 240 ° C. for 20 minutes and 240 ° C. for 5 minutes.
ompack, WCOT fused silica, CP-Wax-52CB, 25m, 0.3
2 mm) and subjected to GC analysis. The identity of the resulting fatty acid methyl ester must be revealed by using standards available from commercial sources (ie Sigma).

In the case of fatty acids for which no standard is available, the molecular identity is derivatized and then G
Must be shown by C-MS analysis. For example, the presence of triple bond fatty acids may lead to a derivatization with 4,4-dimethoxyoxazoline-Derivaten (
Christie (1998), supra), by GC-MS.

Example 18 Purification of desired product from transformed organisms Plant material or fungi, moss, algae, ciliates or C.I. glutamicum
Recovery of the desired product from the cells, or the supernatant of the culture described above,
It can be done in a variety of ways well known in the art. If the desired product is not secreted from the cells, the cells can be harvested from the culture by low speed centrifugation and the cells lysed by standard techniques such as mechanical force or sonication. Plant organs can be mechanically separated from other tissues or organs. After homogenization, cell debris was removed by centrifugation,
The supernatant fraction containing the soluble protein is then retained for further purification of the desired compound. If the product is secreted from the desired cells, the cells are separated from the culture by low speed centrifugation and the supernatant fraction is retained for further purification.

The supernatant fraction from either purification method retains the desired molecule on the chromatographic resin, while not retaining many impurities in the sample or retaining impurities by the resin. On the other hand, the sample is subjected to chromatography using a suitable resin that is not retained. Such chromatographic steps can be repeated using the same or different chromatographic resins, if necessary. The person skilled in the art is well aware of the selection of the appropriate chromatography resin for the particular molecule to be purified and its most effective application. The purified product can be concentrated by filtration or ultrafiltration and stored at a temperature at which product stability is maximized.

A great variety of purification methods are known to the person skilled in the art and the above purification methods are not meant to be limiting. Such purification techniques are described, for example, in Bailey, J .; E.
& Ollis, D .; F. , Biochemical Engineering
Fundamentals, McGraw-Hill: New York (19
896).

The identity and purity of isolated compounds can be evaluated by techniques standard in the art. Such techniques include high performance liquid chromatography (HPL).
C), spectroscopic methods, staining methods, thin layer chromatography, NIRS, enzyme assays, or microbiological methods. Such analytical methods are reviewed below: Patek et al. (1994) Appl. Environ. Microb
iol. 60: 133-140; Malakhova et al. (1996) Biot.
ekhnologya, 11: 27-32; Schmidt et al. (1998),
Bioprocess Engineer, 19: 67-70; Ulmann '.
s Encyclopedia of Industrial Chemist
ry (1996), Volume A27, VCH: Weinheim, pp. 89-90, 5.
21-540 pages, 540-547 pages, 559-566 pages, 575-58 pages
1 and 581-587; Michel, G .; (1999), Bioch
electrical Pathways: An Atlas of Biochemi
story and Molecular Biology, John Wile
y and Sons; Fallon, A .; Et al. (1987), H in Biochemistry
Application of PLC, Laboratory Technologies in Bioc
17 chemistry and Molecular Biology.

Example 19 Expression of the Physcomitrella Gene in Crop Plants An expression cassette was provided in Example 9 to express the moss gene in crop plants.
Must be made according to. Individual coding sequences (preferably the longest open reading frame, more preferably the open reading frame containing the start and stop codons) are transformed into higher plants in sense or antisense orientation to obtain overexpression or cosuppression. To be done. See Examples 9-11 for suitable expression vectors and transformation systems.

There are two ways to clone a cDNA fragment into an expression vector. The cloning site of the insert can be used for cloning purposes, or the cDNA fragment to be cloned can be designed by PCR and the use of designed PCR primers. The longest open reading frame start and stop codons were determined as shown in Table 1B and can be used to define suitable primers. Suitable open reading frame start and stop codons and fragment lengths are illustrated in Table 1 for a given clone.

[0187] Below is shown that this is the phosphatidate phosphatase or the abbreviation PAP (Clone Entry No. PP00407) derived from Physcomitrella patens.
2140R) and the like coding sequence of Table 1. this is,
It can then be applied in a similar manner to other cDNA sequences. PA
A P cDNA clone is amplified from clone PP004072140R using the polymerase chain reaction (PCR). The forward primer is cDNA
Containing the coding sequence for the PAP gene from the 5'end of and containing 18-24 additional coding base pairs included in PCR primers such as the restriction sites and translation optimization sequences before the ATG codon and the primers below. Including: 5'-forward primer: GGTACCAAAATGGGAAACGGA
TACAGTTCCC 3'-reverse primer: GGATCCTAAGTTTACAGACATA
GTACGTGT

PCR primers can be designed in a similar fashion for all other genes of the invention. Restriction sites can vary and must be chosen based on the particular gene. It must be ensured that the restriction motif chosen is not within the coding region of the individual gene. This is the smaller cd
It is necessary to allow restriction enzyme digestion after PCR amplification that does not give rise to NA fragments or truncated cDNA fragments. The alternative restriction site is
For example, a site derived from pBluescript SK- (Stratagene).

The reverse primer contains a sequence complementary to the 21 nucleotides before the stop codon, the stop codon itself, and a restriction cloning site. Where applicable, an Asp718 site before the start ATG codon and BamHI after the stop codon.
The sites are used for the synthesis of designed primers and the subsequent controlled cloning of PCR products. Other sequences can be inherited by PCR primers or cloning cassettes if desired.

After PCR using forward and reverse primers, the resulting fragment was digested with Asp718 / BamHI digested pBSSK (St
ratagene, CA, USA). The nucleotide sequence of the cloned gene is confirmed to ensure that no errors were introduced by the PCR reaction.

The plasmid containing the cloned sequence is digested with Asp718 / BamHI. The resulting fragment containing the cDNA sequence is eluted from the agarose gel and ligated into the Asp718 / BamHI digested vector. The resulting plasmid containing the cDNA sequence in the vector is transformed into Agrobacterium (see Example 9). This Agrobacterium is Arabidopsis thaliana,
Used to transform oilseed rape or flax plants.

Phosphatidate phosphatase (EC 3.1.3.4) catalyzes the hydrolysis of phosphatidates to give sn-1,2-diacylglycerol and inorganic phosphate. This is an important step in the production of triacylglycerol (TAG). Sn-1,2-diacylglycerol (DAG) is acylated at the sn-3 position by diacylglycerol acyltransferase, and finally TAG is produced.

Various methods can be used to measure this enzymatic activity from plant material.
Characterization of plant-derived phosphatidate phosphatase (PAP) can be used to modify the total fatty acyl composition of triglycerides and oils according to the description of the present invention. In order to modify the lipid content in higher plants and to alter the developmental processes and physiology of plants (eg stress tolerance), PAP from Fiscomitella patens has been identified as Arabidopsis thaliana, oilseed rape, flax or other. Of the above crop plants, in particular the plants described in Examples 9-11. Enzymatic assays are used to measure PAP activity in various tissues of control plants and plants transformed with sense and antisense constructs. Leaf lipids can be analyzed by the Iatroscan device (Iatron laboratories, Tokyo,
Gas chromatography with FID detection (Japan), thin layer chromatography (TLC). The seed lipids of control and transgenic plants are examined for changes in diacylglycerol, triacylglycerol or phospholipid levels. For this purpose, oil distilled from mature seeds is subjected to digestion with pancreatic lipase. Pancreatic lipase (
Thompson W. , MacDonald G .; , European Jo
urnal of Biochemistry, 65 (1): 107-11, 1
976) cleaves fatty acids from the sn-1 and sn-3 positions, but not from the sn-2 position. Therefore, the fatty acid in the obtained monoglyceride is sn-
It is considered to be a fatty acid at the 2nd position. The digested products are chromatographed on TLC plates. The chromatographically separated products are then eluted and analyzed as fatty acid methyl esters. Furthermore, the activity of the PAP enzyme is
Measured by following the release of water-soluble ³² P _i from chloroform-soluble [ ³² P] PA (Carman GM and Lin YP (1991), Met.
hods Enzymol. 197, 548-553). The reaction mixture is 100
50 mM Tris maleate buffer, pH 6.5 in a total volume of μl
, 0.1 mM PA, 1 mM Triton X-100, ₂ mM Na ₂ EDTA,
Contains 10 mM 2-mercaptoethanol and enzyme. Enzyme assay is 30 ℃
For 30 minutes.

Equivalence The artisan will recognize, using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein, or as such. You can check the equivalent. Such equivalents are intended to be covered by the appended claims.

[0195]

[Brief description of drawings]

Table 1A: Accessions / entry numbers of proteins and enzymes involved in lipid metabolism and corresponding partial nucleic acid molecules. B: Proteins and enzymes involved in lipid metabolism, the clone entry number of the longest nucleic acid clone to the corresponding partial nucleic acid clone, and the clone entry number of the additional longest clone having no corresponding partial nucleic acid clone.
In addition, the total base pair number of the longest nucleic acid clone and the start positions of the open reading frame and stop codon are shown. Appendix A: Nucleic acid sequences encoding lipid metabolism related proteins (LMRPs). Appendix B: LMRP Polypeptide Sequence.

─────────────────────────────────────────────────── ─── Continued Front Page (51) Int.Cl. ⁷ Identification Code FI Theme Coat (Reference) C07K 14/415 C07K 16/14 16/14 16/16 16/16 C12N 1/15 C12N 1/15 1 / 19 1/19 1/21 1/21 C12P 7/64 15/02 C12R 1:13 C12P 7/64 1:15 // (C12N 1/21 1:91 C12R 1:13) C12N 15/00 ZNAA (C12N 1/21 C C12R 1:15) (C12N 1/21 C12R 1:91) (C12P 7/64 C12R 1:13) (C12P 7/64 C12R 1:15) (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, D, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ , TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ. , EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM , TR, TT, TZ, UA, UG, UZ, VN, YU, ZA, ZW (72) Inventor Ale Hull T. Thomas Germany, 67346, Speyer, Maulbronner, Hof, 49 (72) Inventor Rheindle, Andreas Germany, 67134, Birkenheide, Albertine-Scheller-Strasse, 21 (72) Inventor Chirps, Petra Germany, 68163 , Mannheim, Landtyrstraße, 12 (72) Inventor Bischof, Friedrich Germany, 68163, Mannheim, Eichelsheimer, Strasse, 6 (72) Inventor Frank, Marx Germany, 67061, LudwigsHalfen, Georg-Helweg- Strasse, 14 (72) Inventor Freund, Anete Germany, 67117, Rimburger Hof, Rämerweg, 17 Tse (72) Inventor Duvenich, Erke Germany, 79102, Freiburg, Sternwaldstraße, 7 (72) Inventor Schmidt, Ralph Michael Germany, 67489, Kirweiler, Am, Schlossgarten, 9th (72) Inventor Leschi, Ralph Germany, 79254, Oberito, Am, Osterbach, 26 F term (reference) 2B030 AA07 AD08 CA06 CA17 CA19 CB03 CD03 CD07 CD09 4B024 AA03 AA05 BA80 CA04 DA01 DA06 DA11 EA01 EA04 GA11 GA14 HA11 4B064 AD88 AD90 AF27 CC03 CD06 CD09 DA10 DA20 4B065 AA01X AA22X AA24X AA57X AA83X AA88X AA89YA74 FA20 CA74 CA20 CA07 CA20 CA23 CA24 CA10 CA23 CA24 CA10 CA23 CA24 CA24 CA10 CA24 CA24 CA10

Claims (53)

[Claims] 1. An isolated nucleic acid molecule derived from moss and encoding a lipid metabolism-related protein (LMRP) or a portion thereof. 2. Moss is Physcomitr (Physcomitr)
ella patterns or Ceratodon purpleus (Ceratodo)
N. purpureus) isolated nucleic acid molecule. 3. The LMR in which the nucleic acid molecule is involved in the production of fine chemicals
3. The isolated nucleic acid molecule of claim 1 or 2 which encodes a P protein. 4. The LMR in which the nucleic acid molecule is involved in the production of fatty acids or lipids
An isolated nucleic acid molecule according to any one of claims 1 to 3, which encodes a P protein. 5. The isolated nucleic acid of any one of claims 1-4, wherein the nucleic acid molecule encodes a LMRP protein involved in the production of saturated, unsaturated or polyunsaturated fatty acids. molecule. 6. The isolated nucleic acid molecule of any one of claims 1-5, wherein the nucleic acid molecule encodes a LMRP protein that facilitates transmembrane transport. 7. An isolated nucleic acid molecule derived from moss and selected from the group consisting of the sequences shown in Appendix A or a portion thereof. 8. An isolated nucleic acid molecule encoding a polypeptide sequence selected from the group consisting of the sequences set forth in Appendix B. 9. An isolated nucleic acid molecule encoding a naturally occurring allelic variant of a polypeptide selected from the group of amino acid sequences consisting of the sequences shown in Appendix B. 10. An isolated nucleic acid molecule or a portion thereof that comprises a nucleotide sequence that has at least 50% homology to a nucleotide sequence selected from the group consisting of the sequences set forth in Appendix A. 11. An isolated nucleic acid molecule comprising a fragment of at least 15 nucleotides of a nucleic acid comprising a nucleotide sequence selected from the group consisting of the sequences set forth in Appendix A. 12. An isolated nucleic acid molecule that hybridizes under stringent conditions to the nucleic acid molecule of any one of claims 1-11. 13. An isolated nucleic acid molecule comprising the nucleic acid molecule of any one of claims 1-12 or a portion thereof and a nucleotide sequence encoding a heterologous polypeptide. 14. A vector comprising the nucleic acid molecule according to any one of claims 1 to 13. 15. The vector according to claim 14, which is an expression vector. 16. A host cell transformed with the expression vector according to claim 15. 17. The host cell according to claim 16, which is a microorganism. 18. The host cell according to claim 16, which belongs to the genus Moss or the genus Algae. 19. The host cell according to claim 16, which is a plant cell. 20. The host cell according to claim 16, wherein the expression of the nucleic acid molecule regulates the production of fine chemicals from the cell. 21. The host cell of any one of claims 16-19, wherein expression of the nucleic acid molecule regulates fatty acid or lipid production from the cell. 22. The host cell of any one of claims 16-19, wherein expression of the nucleic acid molecule regulates polyunsaturated fatty acid production from the cell. 23. The host cell of any one of claims 16-19, wherein the polyunsaturated fatty acid is arachidonic acid or eicosapentaenoic acid. 24. Progeny, seed or fertile cell body derived from the host cell according to any one of claims 16 to 23. 25. A method for producing a polypeptide, which comprises culturing the host cell according to any one of claims 16 to 19 in an appropriate culture medium to thereby produce the polypeptide. 26. An isolated LMRP polypeptide or portion thereof derived from moss or algae. 27. An isolated LMRP polypeptide or portion thereof derived from a microorganism or fungus. 28. An isolated LMRP polypeptide derived from a plant or a portion thereof. 29. The polypeptide according to any one of claims 26 to 28, wherein the polypeptide is involved in production of fine chemicals. 30. The polypeptide of any one of claims 26-28, wherein the polypeptide is involved in facilitating transmembrane transport. 31. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of the sequences shown in Appendix B. 32. An isolated polypeptide comprising a naturally occurring allelic variant of a polypeptide comprising an amino acid sequence selected from the group consisting of the sequences set forth in Appendix B, or a portion thereof. 33. The isolated polypeptide of any of claims 26-32, further comprising a heterologous amino acid sequence. 34. An isolated polypeptide encoded by a nucleic acid molecule comprising a nucleotide sequence having at least 50% homology to a nucleic acid selected from the group consisting of the sequences set forth in Appendix A. 35. An isolated polypeptide comprising an amino acid sequence that is at least 50% homologous to an amino acid sequence selected from the group consisting of the sequences set forth in Appendix B. 36. An antibody that specifically binds to the LMRP polypeptide of any one of claims 26-35 or a portion thereof. 37. As a probe or primer for identifying and / or cloning other nucleic acid molecules involved in the synthesis of fatty acids or lipids, or for participating in assisting membrane trafficking in other cell types or other organisms. A test kit comprising the nucleic acid molecule according to any one of claims 1 to 12 to be used, a part and / or a complement thereof. 38. A test kit comprising the LMRP antibody of claim 36 for identifying and / or purifying other LMRP molecules or fragments thereof in other cell types or organisms. 39. A method for producing a fine chemical, which comprises culturing cells containing the vector according to claim 14 or 15 so that the fine chemical is produced. 40. The method of claim 39, further comprising recovering the fine chemical from the culture. 41. The method further comprising the step of transforming the cell with the vector according to claim 14 or 15 to obtain a cell containing the vector.
The method according to 9 or 40. 42. The method according to claim 39, wherein the cells are microorganisms.
The method described in the section. 43. The cells are Corynebacte.
42. The method according to any one of claims 39 to 41, which belongs to the genus Rium or the genus Brevibacterium. 44. The method according to claim 39, wherein the cell belongs to the genus Moss or the genus Algae.
The method according to any one of 1. 45. The method according to any one of claims 39 to 41, wherein the cells are plant cells. 46. The method according to any one of claims 39 to 45, wherein expression of the nucleic acid molecule from the vector regulates production of the fine chemical. 47. The method of claim 46, wherein the fine chemical is selected from the group consisting of lipids, saturated fatty acids and unsaturated fatty acids. 48. The fine chemicals are polyunsaturated fatty acids.
The method according to 6. 49. The method of claim 48, wherein the amino acid is obtained from the group consisting of arachidonic acid or eicosapentaenoic acid. 50. A method for producing a fine chemical, which comprises culturing a cell which contains the nucleic acid molecule according to any one of claims 1 to 13 and whose genomic DNA is changed. 51. The method of claim 50, comprising culturing cells whose membranes are altered by containing the polypeptide of any one of claims 26-35. 52. A fine chemical produced by the method according to any one of claims 39 to 51. 53. Use of the fine chemical according to claim 52 or the polypeptide according to any one of claims 26 to 35 for the production of another fine chemical.