JP2003513615A - Epithelial cell proliferation inhibitor - Google Patents

Abstract

  (57) [Summary] Epithelial cell proliferation inhibitors are differentially expressed on normal and cancerous epithelial cells. ECGI proteins and nucleic acid sequences encoding them are useful for diagnosing and treating epithelial cell carcinomas, such as prostate, ovarian, colon cancer.

Description

Detailed Description of the Invention

[0001]

【Technical field】

The present invention relates to a group of epithelial cell carcinoma inhibitors useful in the diagnosis and treatment of epithelial cell carcinoma.

[0002]

[Background technology]

Epithelial cell carcinomas, such as prostate, breast, colon, lung, pancreatic, ovarian, spleen, testicular, thymic carcinomas, are characterized by abnormal and accelerated proliferation of epithelial cells. It is a disease. This growth promotion initially causes tumor formation. As a result, metastases to various organ sites may occur. Although advances have been made in the diagnosis and treatment of various cancers, the mortality from these diseases remains significant.

The treatment of cancer is greatly advanced by early diagnosis. However, it is difficult to detect the disease at an early stage. For example, the prostate, ovaries and other organs, including epithelial tissue, are not easy to palpate. To detect abnormal tumor growth in these organs is
Difficult without frequent screening and the absence of suitable markers. A substantial drawback of available cancer diagnostic assays is the high frequency of false positive and negative results, and the reliability of the available tests is not as high as expected. For this reason
To identify new diagnostics and new therapeutic agents and improve the diagnosis and treatment of cancers such as prostate cancer, breast cancer, colon cancer, lung cancer, pancreatic cancer, ovarian cancer, spleen cancer, testicular cancer, thymus cancer. There is a strong demand.

A novel and specific inhibitor of breast cell proliferation, Mammastatin (Mammasta
tin) was recently identified and characterized. Mammastatin is MammA (PCT / US97 /
18026, ATCC # 97451 deposited on February 22, 1996), MammB (PCT / US97 / 27147, 200
ATCC # deposited June 15, 009 ), And MammC (PCT / US0 with the same filing date)
0 / ATCC # deposited June 15, 2000 ) And other clones.

Mammastatin is produced and secreted by normal breast cells and is detected in blood samples of normal individuals. Blood levels of this breast cell growth inhibitor, specifically the active phosphorylated form of mamastatin, are reduced or absent in breast cancer patients. Administering proteins containing active mastatin (secreted by normal human breast cancer cells) is effective in reducing tumor size and number and preventing tumor growth in end-stage cancer patients.

Epithelial cell growth inhibitors similar to mamastatin have been discovered, identified and characterized herein. This inhibitor has a partial sequence identical to the 5'terminal sequence of mamastatin and little or no identity to the 3'end of the mamastatin molecule. Similar to mamastatin, this newly discovered family of epithelial cell growth inhibitors (EC
GI) is variously expressed in normal epithelial tissue, but not expressed in cancerous epithelial tissue. Also, this newly discovered group of epithelial cell growth inhibitors, like mamastatin, is detected in blood samples taken from normal individuals but not in the blood of patients with epithelial cell carcinoma. Examples are shown below).

[0007]

[Outline of the Invention]

A group of epithelial cell growth inhibitors (ECGIs) have been identified in many different epithelial cells. These ECGIs are differentially expressed in normal epithelial cells, but not in cancerous epithelial cells. As shown in the examples below, mamasstatin-like ECGI proteins have been found in various epithelial cell tissues such as prostate, colon, ovary, lung, spleen, testis, thymus.

[0008]   The ECGI of the present invention is expressed in normal epithelial cells, but not in cancerous epithelial cells.
I can't. Mamastatin-like ECGI protein is a nucleic acid encoding mamastatin
It is encoded by a nucleic acid sequence that hybridizes to the sequence. ECGI protein
Also binds anti-mammastatin antibody. ECGI-encoding nucleus of prostate cells
The acid sequence (PRT-6, SEQ ID NO: 4) is as described in the Examples below.
Isolated and characterized (PRT-6, ATCC # deposited June 15, 2000) ).

Since the ECGI of the present invention is differentially expressed from normal epithelial cells but not from cancerous epithelial cells, analysis of the presence or amount of ECGI will diagnose cancer and / or Alternatively, the progress of treatment can be monitored. EC of the present invention
The GI protein and the nucleic acid encoding it further provide therapeutic agents useful in preventing epithelial cell proliferation, cancer formation, and treating cancer.

[0010]

[Detailed Description of the Invention]

Proteins of the Invention: An "epithelial cell growth inhibitor (ECGI) protein" of the invention is defined herein to mean a mamasstatin-like protein expressed from normal epithelial cells and active in inhibiting its growth. . The active inhibitory ECGI proteins of the present invention are reduced or absent in cancerous epithelial cells. The ECGI protein family disclosed herein is believed to include inhibitors that are specific to each epithelial tissue and show little or no inhibitory activity regardless of tissue type. As described in more detail below, each ECGI protein is presumed to contain a growth inhibitory domain and a tissue-specific domain.

The ECGI protein herein is produced by normal human breast cells and is a breast cell growth inhibitor mamasstatin (PCT / US97 / 18026) that has been previously demonstrated to be useful in the diagnosis and treatment of breast cancer. ) And significant homology. The ECGI protein is encoded by a nucleic acid sequence that binds to one or more anti-mammastatin antibodies, such as 7G6 (Neomarkers, Freemont, CA) and has significant homology to the nucleic acid sequence encoding mamastatin.

The studies reported in the Examples below show that ECGI proteins are differentially expressed in normal epithelial cell tissues, but are expressed in cancerous tissues of epithelial cells such as breast, prostate, ovary and colon. Prove that not. Like mammastatin, the ECGI proteins herein appear, for example, in Western blots, in double or triple bands with one major band and one or two smaller minor bands. This expression pattern has been shown to be derived from protein phosphorylation in mamastatin. Mamastatin, when phosphorylated on two sites, has a molecular weight of approximately 53 kilodaltons. 4 which is smaller than that
The 9 and 44 kilodalton mammastatins correspond to one phosphorylated site or an unphosphorylated protein. Phosphorylation of mamastatin protein correlates with its inhibitory activity.

Western blots of ECGI probed with anti-mammastatin antibody 7G6 show the approximate size of ECGI produced from various epithelial cell tissues. As shown in more detail in the Examples below (see, eg, FIGS. 4-5), prostate cell-derived ECGI migrated to approximately 55 kilodaltons in Western blots, and this in mamasstatin. It is accompanied by minor minor bands of 51 and 46 kilodaltons that show phosphorylated forms similar to the pattern seen. ECGI from colon cells migrates to approximately 50 KD, with minor bands of approximately 47 and 43 kilodaltons. ECGI derived from ovarian cells migrates to approximately 60 kilodaltons.

Nucleic Acid Sequence Encoding ECGI: The nucleic acid sequence herein is defined herein as a nucleic acid sequence encoding an ECGI protein as defined above. The nucleic acid sequence encoding the ECGI protein has significant sequence homology with the nucleic acid sequence encoding mamastatin and hybridizes under high stringency conditions to the nucleic acid sequence encoding mamastatin.

The mamastatin-like epithelial cell growth inhibitor preferably has substantial identity (at least 90%, preferably at least 95% identity) over approximately 1000 contiguous nucleotides of the nucleic acid sequence encoding mamastatin. is doing. The nucleic acid encoding mammastatin includes MammA (PCT / US97 / 18026, 1996 2
ATCC # 97451 deposited on May 22, MammB (PCT / US97 / 27147, ATCC # deposited June 15, 2000) ), And MammC described herein (ATCC # deposited June 15, 2000). ) DNA insert. The conserved sequences determined for the known mamasstatin clones are shown in the comparative sequences in Table 5 below, which are SEQ ID NO: 1 (MammA), SEQ ID NO: 2 (MammB), SEQ ID NO: 3 (MammC).
Is. The prostate ECGI nucleic acid sequence (SEQ ID NO: 4) is shown in Tables 1, 2 and 5.

ECGI can be amplified from a particular epithelial cell nucleic acid library, for example, by using internal mamastatin primers and / or by hybridizing with mamastatin under conditions of stringent stringency. As described in detail in the Examples below, nucleic acid sequences that hybridize with mamastatin include central nervous system, heart, small intestine, large intestine, appendix, rectum, lymphocyte, bone marrow cell, lung and respiratory tract, bladder, uterus, It has been shown to be present in many epithelial tissues such as prostate, testis, ovary, liver, pancreas, adrenal gland, salivary gland and mammary gland (see Figure 1).

The nucleic acid sequence of ECGI isolated from prostate cells has, for example, greater than 95% identity with mamastatin in the 5'half of the molecule, but little or no identity in the 3'half. Does not have identity. Imagine that the 5'end that has identity with mamastatin contains the growth inhibitory domain of the molecule, and the 3'end that has little identity with mamastatin contains a tissue-specific domain. To be done.

Diagnostic Methods The present invention further provides for active inhibitory EC in patient samples such as tissues, cells and body fluids.
An in vitro assay for diagnosing GI is provided. Epithelial cell carcinoma and advanced metastatic disease are diagnosed by correlating the presence and type of ECGI protein in patient samples with that of normal or cancerous human epithelial cells. A patient's blood or tissue sample is analyzed for ECGI proteins, eg, for ECGI protein abundance and / or its molecular weight form. EC as described below
Absence or deficiency of the GI protein, especially the high molecular weight phosphorylated form, is correlated with specific epithelial cells exhibiting progressive metastatic disease.

ECGI analysis can be performed using various known analytical means and methods, such as immunoassays, hybridizations, PCR methods and the like. Above all, anti-E
Immunoassays such as ELISA, Western blot and dot blot analysis which assay patient samples using CGI antibodies are preferred. Preferably recombinant EC
GI standards are used to generate a standard curve to quantify reliable levels of inhibition. Examples of such an immunoassay method include dot blot analysis and Western blot described in Examples below. In another preferred embodiment of the invention, it is performed by immunohistochemically analyzing a tissue sample, such as a tissue biopsy, or by culturing a patient's tumor cells and analyzing the culture for ECGI expression.

In a particularly preferred embodiment, the assay for diagnosing epithelial cell carcinoma comprises at least two specific antibodies: an antibody for identifying the tissue as harvested epithelial tissue, eg an anti-cytokeratin antibody, and It is a specific anti-ECGI antibody. For example,
If an immunoblot format is employed, prostate tissue suspected of containing prostate cancer cells will be homogenized, separated on an SDS / PAGE gel, transferred to a membrane, and probed with anti-keratin and anti-prostate ECGI antibodies. Bound antibody is detected using another isotype-specific antibody conjugated to a suitable marker system such as peroxidase or alkaline phosphatase. The membrane containing the bound primary and secondary antibodies is then developed using known chromogenic or fluorescent methods and quantified by known methods.

In a most preferred embodiment, the sample is analyzed for the size of ECGI and / or its phosphorylated form, for example by Western blot using an anti-ECGI antibody. The reduction or absence of high molecular weight ECGI protein type is correlated with advanced cancer.

The diagnostic kit of the present invention contains, for example, an ECGI protein or a nucleic acid sequence encoding ECGI as a control. Optionally, the diagnostic kit comprises one or more antibodies that bind to the epithelial cell ECGI to be detected or quantified.
This antibody may bind to the mamasstatin-like domain (eg 7G6) or may be a tissue specific ECGI antibody. Further, the diagnostic kit of the present invention may be used in one or more amplification primers or hybridization probes for amplifying and / or detecting a nucleic acid sequence encoding an epithelial cell ECGI, eg in the examples below. Including primers.

Therapeutic Uses ECGI proteins for therapeutic use are prepared from epithelial cell cultures under serum-free conditions or by recombinant techniques. Preferably, the ECGI protein is prepared from yeast or higher eukaryotic cells and the protein is phosphorylated. Recombinant proteins are prepared from host cells or by synthetic means.

Functional mamastatin is administered to a patient by methods known for the administration of phosphoproteins, preferably by injection, to increase the level of the inhibitor in the bloodstream and to interact with the desired epithelium and inhibitor. Increase.

The protein can be delivered to a patient by methods known in the art for delivering phosphoprotein therapeutics. Generally, the inhibitor is mixed with the delivery vehicle and administered by injection.

The dose of the inhibitor to be administered is determined by the person skilled in the art, which is the method of treatment (
modality) and degree of disease. Mamastatin is 10
It inhibits the growth of breast cancer cells by about 50% at the concentration of ng / ml and about 20-
Since growth is arrested at 25 ng / ml, a useful therapeutic dose range for ECGI is a dose of about 2.5 μg to about 250 μg per day. Preferably about 125 μg /
It is the daily dose. The purpose of administration is to achieve a final body dose in the physiological range (eg 15-50 ng / ml) or slightly higher (eg 25-75 ng / ml). For clinical use, a preferred dose range is initial treatment of metastatic disease at about 500 ng / ml, then maintaining a dose of about 50 ng / ml. In clinical trials with mamastatin, a daily dose of about 50 ng / ml to about 750 ng / ml was sufficient to induce remission in patients with stage IV breast cancer.

Since active ECGI is a phosphorylated protein, it is expected that multiple doses of inhibitor may be required to maintain the growth inhibitory level of ECGI in patient blood. Moreover, since ECGI generally functions as a cell growth inhibitor, not as a cell killing agent, it is expected that the maximum effect of the inhibitor will require maintaining a constant level of inhibition in patients with epithelial cell carcinoma.

In its preferred use, ECGI gives high doses (>>) to induce tumor remission.
50 ng / ml, preferably about 50-500 ng / ml). To prevent cancer cell growth, lower maintenance doses (<50 ng / ml, preferably 20-50 ng / ml) are used.

Clinical experience with mammastatin administered to stage IV breast cancer patients has shown that a useful dose is one that maintains physiological levels of mammastatin in the blood.
Administration is preferably daily, but for example, continuous infusion, sustained release depot,
Alternatively, it may be injected once every 2-3 days. Anecdotal evidence indicates that continuous administration induces feedback inhibition, so the preferred dosing regimen is to administer a daily dose of mamastatin for about 25-28 days followed by no 2-5 days.

Diagnostic Assays The assay of the present invention for detecting the presence of functional inhibitors in human tissues and serum screens patients for epithelial cell carcinomas to identify patient populations at high risk of developing epithelial cell carcinomas. It is useful for screening, for early detection of epithelial cancer development, and for monitoring patient inhibitor levels during the treatment period. For example,
An analysis of a patient's blood mammastatin may show, for example, a reduction in high molecular weight phosphorylated prostate ECGI levels as compared to a normal control or patient's previous prostate ECGI profile. Such changes correlate with increased risk of prostate cancer, early onset of prostate cancer, and advanced metastatic prostate cancer. The diagnostic assay for phosphorylated, active 55kD prostate ECGI is preferably specific anti-ECGI.
Perform by Western blot immunoassay or ELISA using antibody.
For example, screening in serum is preferably performed by an immunoassay such as an ELISA, Western blot or dot blot assay.

For best results, patient samples should be assayed within a short period of time (within 1 week), stored at 4 ° C. (within 1 year), or frozen for long-term storage. . Most preferably, the sample is frozen until the time of assay.

[0032]

【Example】

For the better understanding of the invention, the following examples are given, but are not intended to limit the invention in any way. Example 1 Multiple tissue expression of ECGI Northern blot analysis was performed using a multiple tissue expression array (Clonetech, Inc. # 7775-1) to demonstrate the expression of ECGI in various epithelial cell tissues. About 180
A digoxin-labeled EcoRI fragment of mammastatin containing the 0 base pair 3'region of pMammC (SEQ ID NO: 3 to about the 359-end) was used as a probe.
Follow the manufacturer's instructions to transfer DIG-labeled mamastatin cDNA to an easyHYB solution (Ro
che) hybridize with the above array in 10 ml at 65 ° C. for 16 hours to give 65
After washing at ℃, hybridized with anti-DIG antibody, and CSPD color development was performed. The resulting blot was then exposed to Kodak X-OMAT film for 30 minutes at room temperature.

A histology chart of the multiple tissue expression array is shown in FIG. 1A. Hybridization of mammastatin cDNA with array mRNA is shown in FIG. 1B, which shows various epithelial cell tissues expressing mammastatin-like ECGI sequences. Mamastatin cDN
Specific tissues that hybridize with A include the central nervous system, heart, small intestine, large intestine, appendix, rectum, lymphocytes, bone marrow cells, lungs and respiratory tract, bladder, uterus, prostate, testis, ovary, liver, pancreas, adrenal gland. , Salivary glands and mammary glands were included.

EXAMPLE 2 Normal and Cancerous Prostate Cells Normal prostate cells from surgical samples and cancerous prostate cells LnCap obtained from the American Type Culture Collection (ATCC) were incubated and analyzed for prostate ECGI production. did. The cells were cultured in DMEM / F12 medium containing 40 μM calcium supplemented with 5% Chelex-treated horse serum, 10 ng / ml EGF, 10 μg / ml insulin, 100 ng / ml cholera toxin and 1 μg / ml hydrocortisone for 4 days.

Normal human breast cells obtained from patient samples were incubated in the same medium as above and secreted mammastatin in the culture medium was used as a control. Serum obtained from breast cancer patients was also analyzed and used as a control.

The sample body fluid was collected and loaded by suction onto the nitrocellulose membrane of the dot blot apparatus. The resulting membrane was then probed with anti-mammastatin antibody 7G6 and antibody binding was detected with a goat anti-mouse antibody labeled with alkaline phosphatase. Color was developed using the NBT / BCIP substrate system (Life Technologies). The obtained results are shown in FIG.

The anti-mammastatin antibody recognized the protein produced by normal prostate cells, but not the cancerous prostate cells. This is similar to the antibody recognition of mammastatin, a breast cell growth inhibitor, which is produced by normal breast cells but not breast cancer cells. This data, taken together with the data of Example 1, indicates that mammastatin-like ECGI is produced in other epithelial cell tissues, especially the prostate.

Example 3 Various Expressions of ECGI in Prostate, Colon and Ovary Prostate Normal prostate cells (Clonetech, Inc.), LnCap prostate cancer cells (ATCC)
, MCF7 breast cancer cells (ATCC) and normal human breast cells (obtained from hospital tissue) were incubated as in Example 2 above. After incubation for at least 48 hours, cells were lysed in sample loading buffer and analyzed for the presence of ECGI by Western blot using anti-mammastatin antibody 7G6 as a probe. Normal human breast cell protein (NHMC) cell lysate (1 mg
/ Ml) was used as the mamastatin control (A). The data obtained is shown in FIG. Normal prostate cell lysates (D) contained proteins recognized by anti-mammastatin antibodies, but prostate cancer cells (LnCap) (B) and breast cancer cells (M).
CF7) (C) was not contained. The protein recognized by prostate cell lysate (D) was similar in size to that of mamastatin (A).

Colon and Prostate Normal prostate cells (Clonetech, Inc.), LnCap prostate cancer cells (ATCC)
, Sw948 colon cancer cells (ATCC) and normal colon epithelial cells (obtained from patient's surgical tissue) were incubated as in Example 2 above. Cell lysates were prepared in sample loading buffer and analyzed for ECGI expression by Western blot using anti-mammastatin antibody 7G6 as a probe.

As shown in FIG. 4, normal prostate (A) and normal colon (C) epithelial cells were
It expressed a protein recognized by anti-mammastatin antibodies, whereas cancer cells from these tissues did not (B, D). The differential expression of the protein is similar to that found for mammastatin in breast cancer. In addition, the pattern of bands shown on Western blots of normal prostate and colon tissue is similar to the pattern of phosphorylation found in mammastatin expressed on normal human breast cells. A relatively large major band was noted along with two smaller, hazy bands. This pattern correlated with the phosphorylation of mamastatin.

Prostate ECGI is shown by Western blot analysis (FIG. 4) to have a molecular weight of approximately 51 kilodaltons. Colonic ECGI has been shown to have a molecular weight of approximately 50 kilodaltons.

Ovary OvCar-ovarian cancer cell (ATCC), normal human ovary cell (patient surgical tissue)
And normal human breast cells (patient surgical tissue) were incubated as in Example 2 above. After incubation for at least 48 hours, growth medium was removed and rinsed with saline and SDS-PAGE sample loading buffer until viscous to prepare direct cell lysates. The lysate was collected, separated by 10% SDS-PAGE, transferred to nitrocellulose by electrophoresis, and anti-mammastatin antibody 7G was added.
6 was used. The data obtained are shown in FIG. 5, where lane A is molecular weight standard, B is OvCar-ovarian cancer cell lysate, C is normal human ovary cell lysate and D is normal human breast cell lysate. Contains.

FIG. 5 shows that the mammastatin-like ECGI protein is produced in normal human ovarian tissue and is recognized by anti-mammastatin antibodies. This protein is not expressed in the ovarian cancer cells analyzed. Ovarian ECGI has a molecular weight of approximately 60 kilodaltons.

Example 4 Differential Detection of Prostate GCEI in Blood Serum samples obtained from three healthy male volunteers were analyzed for the presence of prostate ECGI and compared to sera obtained from patients with prostate cancer. 400 μL of serum sample
And 200 μL were used in duplicate. Samples were aspirated onto nitrocellulose in a 96 well dot blot apparatus. The filters were then probed with anti-mammastatin antibody 7G6 and developed with NBT / BCIP substrate. The data are shown in FIG.

Cultures of normal human mammary cells (NHMC) produced standard conditioned medium for comparison. The standards contained 400, 200, 100, 50, 25, 12 and 6 μL of NHCM medium in duplicate. Serum samples obtained from healthy adult males (A, C, D) and adult prostate cancer patients (B) were analyzed with 400 and 200 μL serum samples. The major signals (A, C) obtained by normal serum
, D) showed the presence of prostate ECGI, whereas the sera of patients with prostate cancer showed weak signals.

Example 5 Prostate ECGI Inhibitory Activity Normal prostate cells (Clonetech, Inc.) PC3 and LnCap prostate cancer cells (ATCC) were cultured in RPMI medium containing 10% fetal calf serum at 5.0 × 10 ^4. Cells were added at a density of cells / mL to 12-well plates. After 24 hours, 1
0% conditioned medium was added. The experiment was performed three times for each sample. The plate
Incubated at 37 ° C., 5% CO _{2 for} 6 days, at the end of the incubation period, cells were lysed with cetrimide and counted using a Colter counter.
The inhibition percentage was calculated by comparing treated wells with untreated wells and the data obtained is shown in the table below. Androgen-insensitive PC3 cells were not inhibited by normal prostate cell culture medium or conditioned medium obtained from normal prostate cells. In contrast, LnCap cells were inhibited by the addition of growth medium, and this inhibition was somewhat enhanced by medium from normal prostate versus medium from cancer cells.

[0047]

[Table 1]

Example 6 Isolation and Characterization of Prostate ECGI DNA A nucleic acid library was generated from normal prostate cell (patient surgical tissue) mRNA and prostate cancer cell LnCap (ATCC).

Nucleic acid sequences of normal and cancerous prostate cell libraries were inserted into the vector and used to transform bacteria. Bacterial colonies expressing normal prostate and prostate cancer cell nucleic acid sequences were screened by hybridizing with digoxin labeled mamastatin nucleic acid probe under stringent conditions as described above.

Positive colonies were selected and grown in LB broth. The plasmid obtained from the positive colonies was purified, digested with ECO RI and Xhol, and the cDNA insert was excised. Then, the digested DNA was separated on a 1% agarose gel (
(See FIG. 7), the separated DNA was subjected to Southern blot analysis using the digoxin-labeled mamastatin fragment as a probe. As shown in Figure 7 below, two prostate ECGI clones each having a length of approximately 2 Kb were isolated: one clone was isolated from a normal prostate tissue library (PRN2.1) and another One was isolated from the LnCap prostate cancer cell library (PRT-6).

PRT-6 was further characterized and its nucleic acid sequence was determined. As shown in Table 1 below, the nucleic acid sequence encoding prostate ECGI has substantial identity (> 90%) to mamastatin at the 5'end of the molecule (about 15 to 1032 MammC nucleotides). With little or no identity at the 3'end of the molecule. The similarities and differences of these areas are schematically illustrated in FIG.

Example 7 Isolation and Characterization of Prostate ECGI DNA Nucleic acid libraries were constructed from mRNA or normal prostate cells (obtained from patient's surgical tissue) and LnCap prostate tumor cells (ATCC). This Liberer cDNA was used to transform E. coli and plated for colony hybridization. Colonies were screened using the digoxin labeled mamastatin C fragment generated by PCR with external PCR primers M200 and M2200. [SEQ ID NO: 5] M200: GCGCCGGCCGGGCGCGACCCG [SEQ ID NO: 6] M2200: GCAATCTCAGCGCACTGCTGC

Bacterial colonies expressing prostate ECGI clones were hybridized with labeled mamastatin probe under stringent hybridization conditions as described above.

Example 8 Homology of Prostate ECGI Prostate ECGI sequences were analyzed against nucleic acid sequences present in GenBank. A portion of the two molecules, 28S mRNA and Hip55, showed some similarity to domains within the prostate ECGI sequence.

28S mRNA homology has been identified in many gene sequences as important for growth regulation (Hu et. Al., 1999, PNAS 96: 1339-1344; Mauro et al.,
1997, PNAS 94; 422-427). Hip55 is a protein that binds to hematopoietic progenitor type 1 kinase, which is a protein involved in the src signaling pathway (Ensena
et al., 1999, JBC 274: 33945-50).

The deduced amino acid sequence was deduced for prostate clones using the open reading frame known for Hip55. As shown in Table 3 below, the translation contains some stop codons internally. In addition, the Hip55 ORF was used to deduce the deduced amino acid sequences for the MammB and MammC sequences, as shown in Tables 4 and 5.

[0057]

[Table 2]

[0058]

[Table 3]

[0059]

[Table 4]

[0060]

[Table 5]

[0061]

[Table 6]

[0062]

[Table 7]

[0063]

[Table 8]

[0064]

[Table 9]

[0065]

[Table 10]

[0066]

[Table 11]

[0067]

[Table 12]

[0068]

[Table 13]

[0069]

[Table 14]

[0070]

[Table 15]

[0071]

[Table 16]

[0072]

[Table 17]

[0073]

[Table 18]

[0074]

[Table 19]

[0075]

[Table 20]

[0076]

[Table 21]

[0077]

[Table 22]

[0078]

[Table 23]

[Brief description of drawings]

FIG. 1A is a schematic diagram of an mRNA test panel showing the localization of specific tissue mRNAs to be analyzed.

FIG. 1B is a computer scan imaging of a Northern blot showing hybridization of mamastatin nucleic acid sequences to mRNA from various tissues of FIG. 1A.

FIG. 2: Computer scan imaging of a dot blot assay in which control mammastatin standardized proteins, serum samples from breast cancer patients, and conditioned medium from normal and cancer-like human prostate cells were probed with anti-mammastatin antibody 7G6. Is.

FIG. 3: Normal human breast cell lysate (A), human prostate cancer LnCap cell lysate (B), MCF7 breast cancer cell lysate (C), and normal human prostate cell lysate (D) with anti-mammastatin antibody. Computer scan imaging of a Western blot assay probed with 7G6.

FIG. 4: Cell lysates from normal prostate cells (A), LnCap prostate cancer cells (B), normal colon cells (C), and colon cancer cells (D) were examined using anti-mammastatin antibody 7G6. Computer scan imaging of Western blot assay.

FIG. 5: Western blot assay of cell lysates derived from human ovarian cancer cells (B), normal human ovarian cells (C), and normal human breast cells (D) using anti-mammastatin antibody 7G6. Computer scan imaging. Lane A contains molecular weight standards.

FIG. 6 is a computer scan imaging of a dot blot assay in which serum samples from healthy male adults (A, C, D) and prostate cancer patients (B) were examined with anti-mammastatin antibody 7G6.

FIG. 7 is a computer scan imaging of a DNA gel containing a putative prostate ECGF DNA clone.

FIG. 8 is a schematic diagram showing prostate ECGI and its structural relationship to other sequences.

─────────────────────────────────────────────────── ─── Continued Front Page (51) Int.Cl. ⁷ Identification Code FI Theme Coat (Reference) C12Q 1/68 G01N 33/566 G01N 33/53 33/574 A 33/566 C12N 15/00 ZNAA 33/574 A61K 37/02 (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL , SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID , IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW

Claims (7)

[Claims] 1. A mamastatin-like epithelial cell growth inhibitor having a sequence substantially identical to at least 1/3 of the mamastatin molecule. 2. The epithelial cells are the central nervous system, heart, small intestine, large intestine, appendix, rectum, lymphocyte, bone marrow cell, lung and respiratory tract, bladder, uterus, prostate, testis, ovary, liver,
The inhibitor according to claim 1, which is a pancreas, an adrenal gland, a salivary gland, and a mammary gland. 3. A nucleic acid sequence encoding an epithelial cell growth inhibitor that inhibits proliferation of non-mammary epithelial cells, which nucleic acid sequence can be amplified from normal mammary epithelial cells by internal PCR primers derived from mamastatin. Nucleic acid sequence. 4. The nucleic acid sequence according to claim 3, wherein the epithelial cell is a colon, ovary, prostate, spleen, testis or thymocyte. 5. A body fluid is analyzed for the presence or amount of the protein of claim 1 or the nucleic acid sequence of claim 3, and the reduction or absence of the protein or the nucleic acid sequence is correlated with epithelial cell carcinoma. , A method for detecting epithelial cell carcinoma. 6. A method of treating epithelial cell carcinoma in a patient, wherein the protein of claim 1 or the nucleic acid sequence of claim 3 is administered to the patient. 7. A protein according to claim 1 and / or a nucleic acid according to claim 4, and optionally an antibody that specifically binds to the protein according to claim 1.
Diagnostic kit.